WO2005054480A2 - Insect resistant cotton plants and methods of detecting the same - Google Patents
Insect resistant cotton plants and methods of detecting the same Download PDFInfo
- Publication number
- WO2005054480A2 WO2005054480A2 PCT/EP2004/012663 EP2004012663W WO2005054480A2 WO 2005054480 A2 WO2005054480 A2 WO 2005054480A2 EP 2004012663 W EP2004012663 W EP 2004012663W WO 2005054480 A2 WO2005054480 A2 WO 2005054480A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sample
- seq
- cot203
- polynucleotide
- event
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
Definitions
- the present invention relates to genetic engineering of plants and in particular to an insect resistant transgenic cotton plant. Specifically, the invention relates to a cotton plant designated COT203 which comprises a VIP3 A gene. It also relates to methods of detecting material derived from the plant.
- Plant pests are a major factor in the loss of the world's important agricultural crops. About $8 billion is lost every year in the U.S. due to infestations of plants by non-mammalian pests including insects. In addition to losses in field crops, insect pests are also a burden to vegetable and fruit growers, to producers of ornamental flowers, and to home gardeners.
- Insect pests are mainly controlled by intensive applications of chemical pesticides, which are active through inhibition of insect growth, prevention of insect feeding or reproduction, or cause death. Good control of insect pests can thus be reached, but these chemicals can sometimes also affect other, beneficial insects.
- Another problem resulting from the wide use of chemical pesticides is the appearance of resistant insect varieties. This has been partially alleviated by various resistance management practices, but there is an increasing need for alternative pest control agents.
- Biological pest control agents such as Bacillus thuringiensis strains expressing pesticidal toxins like ⁇ -endotoxins, have also been applied to crop plants with satisfactory results, offering an alternative or compliment to chemical pesticides.
- genes coding for some of these ⁇ -endotoxins have been isolated and their expression in heterologous hosts has been shown to provide another tool for the control of economically important insect pests.
- insecticidal toxins such as Bacillus thuringiensis ⁇ -endotoxins in transgenic plants, has provided efficient protection against selected insect pests, and transgenic plants expressing such toxins have been commercialised, allowing farmers to reduce applications of chemical insect control agents.
- VTPs vegetable insecticidal proteins
- VTP3A toxins possess insecticidal activity against a wide spectrum of lepidopteran insects including but not limited to fall armyworm, Spodoptera frugiperda, black cutworm, Agrotis ipsilon, sugarcane borer, Diatraea saccharalis, and lesser cornstalk borer, Elasmopalpus lignosellus, and when expressed in transgenic plants, for example cotton, confer protection on the plant from insect feeding damage.
- the cotton family genus Gossypium, a member of the Malvaceae, consists of 39 species, of which Gossypium hirsutum is the most commonly cultivated species. Three other species are also cultivated: G. arboreum, G. barbadense, and G. herbaceum. These cultivated species are grown primarily for the seed hairs that are made into textiles. Cotton is suitable as a textile fibre because the mature dry hairs twist in such a way that fine strong threads can be spun from them. Other products, such as cottonseed oil, cake, and cotton linters are by-products of fibre production.
- insect pests of cotton include Beet armyworm (Spodoptera exigud), Boll weevil (Anthonomus grandis grandis), Cabbage looper (Trichoplusia ni), Clouded plant bug (Neurocolpus nubilus), Cotton aphid (Aphis gossypi ⁇ ), Cotton bollworm (Heliocoverpa zea), Cutworms (Feltia subterranea, Peridroma saucia, Agrotis ipsilon), European corn borer (Ostrinia nubilalis), Fall armyworm (Spodoptera frugiperda), Seedling thrips (Frankliniella spp.), Soybean looper (Pseudoplusia includens), Stink bugs (Nezara viridula, Acrosternum hilare, E
- Transformation and regeneration of cotton plants is now a well-established procedure, typically based on Agrobacterium tumefaciens mediated transfer of foreign DNA into cotton plant parts and regeneration of said plant parts in tissue culture into fully fertile, transgenic cotton plants.
- Agrobacterium tumefaciens mediated transfer of foreign DNA into cotton plant parts and regeneration of said plant parts in tissue culture into fully fertile, transgenic cotton plants.
- An insect resistant cotton plant could reduce the need to apply chemical pesticides, which may be detrimental to other, beneficial insects and the environment.
- COT203 event in the context of this application refers to the original insecticidal transgenic cotton plant described herein.
- Insecticidal refers to any inhibitory effect on an insect, including but not limited to reduced feeding, retarded growth, reduced fecundity, paralysis or death.
- Flucundity comprises all aspects related to reproduction such as reproductive ability, reproductive frequency and number of offspring.
- any plant material derived from the COT203 event including seeds.
- the COT203 event exhibits a novel genotype comprising at least one expression cassette.
- the cassette comprises a suitable promoter for expression in plants operably linked to a gene that encodes a VIP3 A insecticidal toxin, useful in controlling a wide spectrum of lepidopteran insect pests, and a suitable polyadenylation signal.
- Suitable promoters may be isolated from, inter alia, plants. Numerous plant promoters have been isolated and characterised including constitutive, switchable and/or tissue specific promoters.
- Suitable promoters may be selected from the following, non-limiting group: CaMV35S, FMV35S, Ubiquitin, Act2, NOS, OCS, Cestrum yellow leaf curl virus promoter, Patatin, E9, alcA/alcR switch, GST switch, RMS switch, oleosin, Gelvin, ribulose bisphosphate carboxylase-oxygenase small sub-unit, actin 7, MR7 promoter (maize), Gos 9 (rice), GOS2 promoters, MasOcs (or super promoter), RolD promoter (Agrobacterium rhizogenes), SuperMAS promoter, and Suc2 promoter (Arabidopsis).
- the promoter is the Ubiquitin promoter, UBQ3, from Arabidopsis thaliana. Additional elements such as enhancer sequences may also be incorporated into the expression cassette in order to boost levels of gene expression, for example transcriptional or translational enhancers, such as tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. Alternatively it may be desirable to include a targeting sequence, for example, to direct transportation of the VTP3A toxin to a particular cellular compartment. For example if it is desired to provide the protein outside of the cell then an extracellular targeting sequence may be ligated to the polynucleotide encoding the VIP protein.
- TMV tobacco etch virus
- targeting include targeting to a specific intracellular organelle or compartment, for example to the endoplasmic reticulum using a 'KDEL' retention sequence.
- Numerous polyadenylation signals have been isolated and characterised. Examples of suitable polyadenylation signals functional in plants include that from the nopaline synthase gene (nos) of Agrobacterium tumefaciens, from the proteinase inhibitor II gene and from the alpha-tubulin gene (EP ⁇ A 652,286). In one embodiment of the present invention, the polyadenylation signal is that from the nos gene of Agrobacterium tumefaciens.
- the polynucleotide encoding the VIP3A protein may also be codon-optimised or otherwise altered to enhance for example, transcription once it is incorporated into plant material.
- codon optimisation may also be used to alter the predicted secondary structure of the RNA transcript produced in any transformed cell, or to destroy cryptic RNA instability elements present in the unaltered transcript, thereby increasing the stability and/or availability of the transcript in the transformed cell (Abler and Green (1996) Plant Molecular Biology (32) pp.63-78).
- a second cassette that comprises a gene which, when expressed, can be used as a selectable marker.
- selectable markers Numerous selectable markers have been characterised, including some that confer tolerance to antibiotics and others that confer tolerance to herbicides. Examples of suitable selectable marker genes include those that confer tolerance to- hygromycin, kanamycin or gentamycin. Further suitable selectable markers include genes that confer resistance to herbicides such as glyphosate- based herbicides or resistance to toxins such as eutypine. Other forms of selection are also available such as hormone based selection systems such as the Multi Auto Transformation (MAT) system of Hiroyrasu Ebinuma et al. (1997) PNAS Vol.
- MAT Multi Auto Transformation
- the selectable marker gene is one that confers tolerance to hygromycin.
- This second expression cassette is useful for selecting transformants during and following plant transformation. Optionally, it may be segregated away from the COT203 event precursor after transformation to leave the COT203 event itself.
- the COT203 event perse does not comprise a selectable marker cassette. Further expression cassettes are optionally comprised in the COT203 event. For example these may provide other desirable benefits such as herbicide resistance.
- the expression cassettes may be introduced into the plant on the same or different plasmids. If the expression cassettes are present on the same plasmid and introduced into the plant via aaAgrobacterium-mediated transformation method, they may be present within the same or different T-DNA regions. In one embodiment of the present invention, two expression cassettes are present on different T-DNA regions within the same plasmid.
- a polynucleotide comprising at least 17 contiguous nucleotides from the 26-nucleotide sequence of SEQ ID NO: 1.
- said polynucleotide comprises at least 18 contiguous nucleotides from SEQ ID NO: 1.
- said polynucleotide comprises at least 20 contiguous nucleotides from SEQ ID NO: 1.
- said polynucleotide comprises at least 22 contiguous nucleotides from SEQ ID NO: 1.
- said polynucleotide comprises at least 23 contiguous nucleotides from SEQ ID NO: 1.
- polynucleotide comprises at least 24 contiguous nucleotides from SEQ ID NO: 1. In a further embodiment said polynucleotide comprises at least 25 contiguous nucleotides from SEQ ID NO: 1. In a still further embodiment there is provided a polynucleotide comprising the sequence of SEQ ID NO: 1.
- a polynucleotide comprising at least 17 contiguous nucleotides from the 26-nucleotide sequence of SEQ ID NO: 2. In one embodiment said polynucleotide comprises at least 18 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 20 contiguous nucleotides from SEQ ID NO: 2. In a still further embodiment said polynucleotide comprises at least 22 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 23 contiguous nucleotides from SEQ ID NO: 2.
- polynucleotide comprises at least 24 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 25 contiguous nucleotides from SEQ ID NO: 2. In a still further embodiment there is provided a polynucleotide comprising the sequence of SEQ ID NO: 2.
- polynucleotide as described above further comprising the sequence of SEQ ID NO: 7.
- polynucleotide as described above further comprising the sequence of SEQ ID NO: 8.
- a plant comprising a polynucleotide which comprises at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
- said plant comprises at least 18 contiguous nucleotides.of SEQ ID NO: 1 and / or SEQ ID NO: 2.
- said plant comprises at least 20 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
- said plant comprises at least 22 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
- said plant comprises at least 23 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a still further embodiment said plant comprises at least 24 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a further embodiment said plant comprises at least 25 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In yet a further embodiment said plant comprises the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a further embodiment, said plant additionally comprises the sequence of SEQ ID NO: 7. hi a further embodiment still, said plant additionally comprises the sequence of SEQ ID NO: 8. In one embodiment of the present invention, said plant is a cotton plant. In a further embodiment, said plant is an insecticidal cotton plant which is the COT203 event, or a plant derived therefrom.
- Agrobacterium-mediated transformation is a commonly used method for transformation of dicotyledonous plants.
- the foreign DNA to be introduced into the plant is cloned into a binary vector in between left and right border consensus sequences. This is the T-DNA region.
- the binary vector is transferred into an Agrobacterium cell, which is subsequently used to infect plant tissue.
- the T-DNA region of the vector comprising the foreign DNA is inserted into the plant genome.
- the marker gene cassette and trait gene cassette may be present on the same T-DNA region, different T-DNA regions in the same vector, or even different T-DNA regions in different vectors. In one embodiment of the present invention, the cassettes are present on different T-DNA regions in the same vector.
- direct DNA transfer can be used to introduce the DNA directly into a plant cell.
- One suitable method of direct transfer may be bombardment of plant cells with a vector comprising the DNA for insertion using a particle gun (particle-mediated biolistic transformation); another established method, 'whiskers', involves coating the DNA onto silicon carbide fibres onto which cells are impaled.
- Other methods for transforming plant cells include protoplast transformation (optionally in the presence of polyethylene glycols); sonication of plant tissues, cells or protoplasts in a medium comprising the polynucleotide or vector; micro-insertion of the polynucleotide or vector into plant material (optionally employing the known silicon carbide "whiskers” technique), electroporation and the like.
- transgenic plants Following transformation, transgenic plants must be regenerated from the transformed plant tissue, and progeny possessing the foreign DNA selected using an appropriate marker such as resistance to hygrornycin.
- an appropriate marker such as resistance to hygrornycin.
- the skilled man is familiar with the composition of suitable regeneration media.
- the selectable marker can be segregated away from transgenic events by conventional plant breeding methods, thus resulting in, for example, the COT203 event.
- a plant of the invention has an insecticidal effect on insects from one or more species from the group comprising Heliothis sp., Helicoverpa sp. and Spodoptera sp. which may infest it.
- "Infest” as used herein refers to attack, colonisation, feeding or damage in any way by one or more insects.
- the plant of the present invention will provide a self-defence mechanism against infestation by pest insects such as Helicoverpa zea (cotton boll worm).
- pest insects such as Helicoverpa zea (cotton boll worm).
- the present invention is not limited to the COT203 event itself, but is further extended to include any plant material derived therefrom, including seeds in so far as they contain at least one of the present inventive polynucleotides.
- the present invention includes, but is not limited to plants that are derived from a breeding cross with the COT203 event or a derivative therefrom by conventional breeding or other methods.
- the invention also includes plant material derived from the COT203 event that may comprise additional, modified or fewer polynucleotide sequences compared to the CQT203 event or exhibit other phenotypic characteristics. For example it may be desirable to transform plant material derived from the COT203 event to generate a new event that possesses an additional trait, such as a second insect resistance gene. This process is known as gene stacking.
- the second insect resistance gene may encode, for example insecticidal lectins, insecticidal protease inhibitors and insecticidal proteins derived from species of the
- the second insect resistance gene encodes an insecticidal gene from Bacillus thuringiensis.
- the second insect resistance gene encodes a Cry gene from the bacterium Bacillus thuringiensis, which Cry gene produces a toxin with a different mode of action or binding site in the insect gut to VIP for the control of different insect species.
- the Cry gene may, for example, be Cryl Ab.
- the present invention further provides plant material derived from the COT203 event which possesses an additional trait such as herbicide resistance, nematode resistance or fungal resistance.
- said additional trait is herbicide resistance.
- the herbicide resistance trait may be provided, for example, by a herbicide degradation enzyme, or a target-site specific resistant enzyme.
- said herbicide resistance trait provides resistance to a herbicide which comprises glyphosate acid or an agriculturally acceptable salt thereof.
- said herbicide resistance trait is provided by a gene encoding EPSP synthase or a mutant thereof.
- the present invention further provides a method of controlling insects comprising providing the COT203 event or plant material derived from the COT203 event at a locus where said insects feed.
- the invention yet further provides a method of controlling insects comprising providing the COT203 event or plant material derived from the COT203 event at a locus where said insects feed, and applying other agrochemicals to said plant material such as herbicides, fungicides and other insecticidal compounds including other insecticidal proteins.
- Examples of possible insecticidal compounds include insecticidal lectins, insecticidal protease inhibitors and insecticidal proteins derived from species of the Bacillus thuringiensis, Xenorhabdus nematophilus; or Photorabdus luminescens.
- Examples of possible chemicals include pyrethroids, carbamates, imidacloprid, organochlorines, and macromolecules such as spinosad, abamectin or emamectin.
- a method of detecting the COT203 event or plant material derived from the COT203 transgenic event comprising obtaining a sample for analysis; extracting DNA from the sample; providing a pair of primers designed to bind to a polynucleotide comprising at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2; amplifying the region which lies between the sites at which the primers bind; and detecting the presence of the amplification product.
- Suitable pairs of primers for use in this method of detection can be designed using parameters well known to those skilled in the art of molecular biology now that SEQ ID NOs 1 and 2 are made available.
- one or both primers of the pair may be designed to be vector-specific, trait gene specific, promoter specific, and/or specific to the sequence of the junction between the inserted DNA and the genomic DNA.
- one of the primers is designed to be specific to the inserted sequence, and the other primer specific to the genomic DNA upstream or downstream of the insertion site, fri one embodiment, the sequence of said primers is depicted as SEQ ID NO: 19 and SEQ ID NO: 20.
- the region amplified by said method is between 100 and 1000 base pairs in length. In a further embodiment the amplicon is between 100 and 400 base pairs in length. In a still further embodiment the amplicon is 336 base pairs in length. In a further embodiment the amplicon is produced using the above method in conjunction with the primers of the sequence of SEQ ID NO: 19 and SEQ ID NO: 20, and is 336 base pairs in length. These primers are specific for the COT203 event.
- Alternative primers which may be used in combination to detect the COT203 event include SEQ ID NOs: 3 and 4 which produce a 341b ⁇ amplicon, SEQ ID NOs 13 and 14 which are specific for the COT203 event and produce an 84 bp amplicon, and SEQ ID NOs 5 and 6 which are specific for the VIP gene and produce a 556bp amplicon.
- PCR polymerase chain reaction
- An embodiment of the present invention employs variations of the PCR principle such as TaqManTM. This involves labelling at least one of the primers involved in the amplification process with a fluorescent dye. When unbound, the primer adopts a conformation such that no fluorescence can be detected. However, when the primer is bound to a piece of DNA, the conformation changes and fluorescence can be detected. In this way, the amplification process can be monitored in real-time, the intensity of fluorescence corresponding directly to the level of amplification.
- Suitable primers for use in TaqManTM PCR are depicted as SEQ ID NOs 13 to 15. These may be used in conjunction with internal control primers such as those depicted as SEQ ID NOs 10 to 12.
- TaqManTM analysis may be useful for example, for detecting the presence of the COT203 event in a background of wild type cotton, or for detecting the adventitious presence of COT203 in other germplasm.
- Further embodiments of the present ' invention include, but are not limited to, RACE PCR.
- a further embodiment of the present invention involves the use of multiplex PCR for distinguishing between homozygous COT203 plant material and heterozygous COT203 plant material.
- This is known to those skilled in the art as zygosity testing, and involves the use of three PCR primers which bind to specific parts of the cotton genome and / or inserted DNA. The presence or absence of each of two amplification products of particular sizes indicates whether the test sample is heterozygous or homozygous for COT202. Suitable primers for use in such a zygosity test are depicted as SEQ ID NOs 16 to 18.
- a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; providing a probe designed to bind to the complement of a polynucleotide which comprises at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2 when said polynucleotide is single stranded; hybridising said probe with the sample; and detecting whether the probe has hybridised.
- said probe comprises the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2.
- said probe comprises SEQ ID NO: 7. In a further embodiment, said probe consists of SEQ ID NO: 7. In one embodiment, said probe comprises SEQ ID NO: 8. In a further embodiment, said probe consists of SEQ ID NO: 8.
- the probe may be, for example, a PCR product or restriction digestion fragment.
- the probe as described herein may be tagged with a fluorescent, radioactive, enzymatic or other suitable label to enable hybridisation to be detected. The skilled man will know how to design suitable probes, now that he has the benefit of the present disclosure.
- a method of hybridising a probe to the sample under stringent conditions and detecting whether the probe has hybridised comprising, for example: hybridisation at a temperature of about 60°C in a solution containing 6 x SSC, 0.01% SDS and 0.25% skimmed milk powder, followed by rinsing at the same temperature in a solution containing 1 x SSC and 0.1% SDS.
- More stringent hybridisation conditions may comprise: hybridisation at a temperature of about 65 °C in a solution containing 6 x SSC, 0.01% SDS and 0.25% skimmed milk powder, followed by rinsing at the same temperature in a solution containing 0.2 x SSC and 0.1% SDS.
- Suitable techniques for detecting plant material derived from the COT203 event based on the hybridisation principle include, but are not limited to Southern Blots, Northern Blots and in-situ hybridisation. The skilled man is familiar with techniques such as these. Typically, they involve incubating a probe with a sample, washing to remove unbound probe, and detecting whether the probe has hybridised. Said detection method is dependent on the type of tag attached to the probe - for example, a radioactively labelled probe can be detected by exposure to and development of x-ray film. Alternatively, an enzymatically labelled probe may be detected by conversion of a substrate to effect a colour change.
- a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; providing an antibody or binding protein designed to bind to a VIP protein contained within a plant comprising at least 17 contiguous nucleotides from SEQ ID NO: 1 and / or SEQ ID NO: 2; incubating said antibody or binding protein with the sample; and detecting whether the antibody or binding protein has bound.
- said VIP protein comprises the sequence of SEQ ID NO: 9.
- Suitable methods of detecting plant material derived from the COT203 event based on said antibody binding include, but are not limited to Western Blots, Enzyme-Linked
- ImmunoSorbent Assays ELISA and SELDI mass spectrometry.
- Typical steps include incubating a sample with an antibody that binds to the VIP protein, washing to remove unbound antibody, and detecting whether the antibody has bound.
- Many such detection methods are based on enzymatic reactions - for example the antibody may be tagged with an enzyme such as horse radish peroxidase, and on application of a suitable substrate, a colour change detected.
- Suitable antibodies may be monoclonal or polyclonal.
- a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; making a protein extract of the sample; providing a test strip designed to detect the presence of a VIP protein present within the sample; incubating the test strip with the sample; and detecting whether VIP protein is present.
- said VIP protein comprises the sequence of SEQ ID NO: 9.
- An alternative antibody-based detection method for COT203 uses of dipsticks or test strips. Typical steps include incubating a test strip with a sample and observing the presence or absence of coloured bands on the test strip. The coloured bands are indicative of the presence of a protein in the sample. Such dipstick or test strip tests are protein specific, and may be used for rapid testing of samples in the field.
- a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; subjecting one or more insects of the species Spodoptera frugiperda (susceptible to VIP3A) to the sample; subjecting one or more insects of species Ostrinia nubilalis (not susceptible to VEP3 A) to the sample as a control; detecting whether the sample has an insecticidal effect on insects from each species; and comparing the results with an authentic COT203 bioassay profile.
- the results are compared against an authentic COT203 bioassay profile that is produced using insects of the same condition (including insect age and culture conditions) which have been subjected to the same dose and type of COT203 plant material (including plant age, plant variety and tissue type) and where the insecticidal effect is detected the same length of time after subjecting the insects to the COT203 sample.
- Detection of an insecticidal effect may be, for example, an assessment of insect mortality, or of the growth stage of the insects.
- Spodoptera frugiperda is a positive control for COT203 as it is susceptible to a suitable dose of VIP3A
- Ostrinia nubilalis is a negative control for COT203 as it is not susceptible to a suitable dose of VIP3 A.
- Alternative insect species that are either susceptible or not susceptible to VIP3A may be substituted in an assay as described above as appropriate, provided that the results are compared against an authentic profile generated using the same insect species.
- the method of detecting plant material derived from the COT203 event includes but is not limited to leaf-feeding bioassays in which a leaf or other suitable plant part from the COT203 event or any plant material derived from the COT203 event, is infested with one or more pest insects. Detection may be through assessment of damage to the leaf or plant part after set time periods, assessment of mortality or another insecticidal effect on the insects.
- Alternative plant parts which may be used for such bioassays include bolls and squares.
- Such bioassays may, for example, be carried out in the laboratory, field, or glasshouse, and may be subject to natural or artificial insect infestation.
- kits of parts comprising a means for detecting the presence in a sample of plant material derived from the COT203 event.
- said kit of parts comprises a means for detecting the presence in a sample of a polynucleotide comprising at least 17 contiguous nucleotides from the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2, or a protein encoded by a polynucleotide as described above, or a VIP protein.
- said kit of parts may comprise DNA amplification-detection technology such as PCR or TaqManTM.
- said kit of parts may comprise probe hybridisation- detection technology such as Southern Blots, Northern Blots or in-situ Hybridisation.
- said kit of parts may comprise antibody binding-detection technology such as Western Blots, ELISA's, SELDI mass spectrometry or test strips.
- said kit of parts may comprise insect bioassay-detection technology such as leaf feeding bioassays or mortality bioassays. Each of these detection technologies may be used as described above.
- said kit of parts may comprise any combination of the afore-mentioned detection technologies.
- kit of parts may comprise in the form of instructions one or more of the methods described above.
- the polynucleotides of the invention as described above for detecting the COT203 event.
- said polynucleotides may be used in a method for detecting the COT203 event as described above.
- SEQ ID NO 1 Polynucleotide sequence which extends across the junction where the 5' end of the COT203 insert is inserted into the cotton genome in event COT203.
- SEQ ID NO 2 Polynucleotide sequence which extends across the junction where the 3' end of the COT203 insert is inserted into the cotton genome in event COT203.
- SEQ ID NOs 3 - 6 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event.
- SEQ ID NOs 7 - 8 Polynucleotide sequences suitable for use as probes in the detection of the COT203 event.
- SEQ ID NO 9 Amino acid sequence of the VIP3A toxin protein.
- SEQ ID NOs 10 - 15 Polynucleotide sequences suitable for use as TaqManTM primers in the detection of the COT203 event.
- SEQ ID NOs 16 - 18 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event via zygosity testing.
- SEQ ID NOs 19 - 20 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event.
- the vector included a selectable marker cassette comprising a Ubiquitin (UBQ3) promoter, the UBQ3 intron, a gene sequence which encodes a protein conferring resistance to hygromycin, and a nos polyadenylation sequence.
- the vector also included the expression cassette of the target gene, which cassette comprised a Ubiquitin (UBQ3) promoter, the UBQ3 intron, a sequence encoding the VIP3A gene that had been codon optimised for expression in maize, and a nos polyadenylation sequence.
- the selectable marker cassette and VIP3A containing cassette were cloned between the left and right border sequences within different T-DNA regions of vector pNOV103.
- the vector also comprised a gene conferring resistance to an antibiotic, kanamycin, for prokaryotic selection.
- the vector was transformed into Agrobacterium tumefaciens strain GV3101 using standard Agrobacterium transformation techniques, and transformed cells selected through their resistance to kanamycin.
- 1.2 Plant transformation The COT203 event was produced by Agrobacterium-mediated transformation of Gossypium hirsutum L. cv Coker 312. Coker 312 seeds were sown in the glasshouse. Tender petioles were cut from 3 to 5 weeks old plants, and sterilized by immersion in 70% ethanol. The petioles were then immersed in a 5% Clorox + 2ml/L Tween 20 solution for 20 minutes. Petioles were washed 3 times in ddH 2 O.
- petioles were cut off, and petioles transferred to petiole pre-culture medium (4.3g/L MS salts, 200X B5 vitamins, 30g/L glucose, 2.4g/L phytogel, pH 7.0) and allowed to pre-culture in the light at 30°C for 3 days.
- petiole pre-culture medium 4.3g/L MS salts, 200X B5 vitamins, 30g/L glucose, 2.4g/L phytogel, pH 7.0
- the ends were cut off the petioles and placed in 3 to 5ml of bacterial solution in a sterile petri dish. Once in the solution, the petioles were cut lengthwise and then cut into 2cm sections. After the petiole explants had soaked in bacterial solution for 5 to 10 minutes, they were transferred to co-culture plates, and allowed to co-culture at 24°C for 48 hours under low light intensity. Co-cultured explants were transferred to MMS1 medium (recipe as for MMS1 liquid medium, additionally with 2.4g/L phytogel) containing 500mg/L Cefotaxime and lOmg/L Hygromycin, and incubated at 30 °C under a light cycle of 16 hours light and 8 hours dark. Explants were transferred to fresh medium after 2 weeks, and every 4 to 6 weeks thereafter until callus was formed.
- MMS1 medium pe as for MMS1 liquid medium, additionally with 2.4g/L phytogel
- calli were the size of a garden pea, they were removed from the explants and transferred to fresh MMS1 medium containing 500mg/L Cefotaxime and lOmg/L Hygromycin, and maintained in tissue culture by subculturing every 4 weeks as appropriate.
- Somatic embryos formed within 1 to 2 months. Somatic embryos were transferred to EG (embryoid germimation) medium (10X EG stock (consisting of lx 10L pack of Musashige and Skoog Modified Basal Salt Mixture (Sigma), 19g KNO3, 50ml 200X B5 vitamins, water to IL), 1 g/L glutamine, 0.5g/L asparagine, recipe), and sub-cultured to fresh EG medium every 3 to 4 weeks.
- EG embryoid germimation
- somatic embryos Once somatic embryos turned green and were larger than 2cm, they were plated root down in EG medium. At all stages of regeneration, growing plantlets were prevented from reaching the lids or sides of their containers. Germinated embryos with 1 to 2 true leaves were transferred to EG medium in 175ml Greiners. Strong plantlets with true leaves were transferred to sterile peat plugs expanded with dH 2 O in 175ml Greiners and transferred to a growth cabinet under conditions of 14 hours daylight at 30°C and 10 hours darkness at 20°C. Thereafter, plantlets were transplanted into pots and grown in the glasshouse.
- Putative transgenic plants were screened by PCR for the presence of the VIP3A gene. Positive events were identified and screened using insect bioassays for insecticidal activity against Fall Armyworm (Spodoptera frugiperda) (see Example 7). Insecticidal lines were characterized for copy number by TaqManTM analysis (see Example 2). TI seed from several events were observed in a field trial for insect resistance and agronomic quality. Two events, COT202 and COT203, were chosen based on having a single copy of the transgene, good protein expression as identified by ELISA (see Example 4), good insecticidal activity against Cotton Boll Worm (Helicoverpa zed) and field performance. The hygromycin selectable marker cassette was segregated away using conventional plant breeding to result in the COT202 event and the COT203 event.
- TaqManTM PCR reactions were setup using a standard reaction mix comprising: 5ul 2x Jumpstart Master Mix for Q-PCR (Sigma, #P2893), supplemented with . 15mM MgCl 2 and 200nM Strata-ROX 0.2ul 50x FAM primer / probe mix 0.2ul 50x VIC primer / probe mix 1.6ul Water.
- primer / probe mixes comprised 45ul of each primer at a concentration of ImM, 50ul of the probe at a concentration of lOOuM and 860ul nuclease free water, and were stored in an amber tube at 4°C.
- suitable primer / probe sequence combinations which were used are:
- COT203-F TCCGGTACCGGAGCTCG.
- SEQ ID NO: 13 Forward COT203-R AAATTACCATTTGCCCTCCTTTC
- Reverse COT203-FAM TCTGCAGACGCGTCGACGTCATATG
- SEQ ID NO: 15 Reverse COT203-FAM TCTGCAGACGCGTCGACGTCATATG
- Genomic DNA from COT203 was extracted as described in Example 2.1.
- PCR primers were designed to bind to cotton genomic DNA sequence upstream of the site at which the COT203 cassette inserted (SEQ LD NO: 16); the cotton genomic DNA sequence downstream of the site at which the COT203 cassette inserted (SEQ ID NO 17); and the COT203 cassette sequence itself (SEQ ID NO: 18).
- a 25ul PCR reaction was set up for each sample to be tested as follows: lx JumpState ReadyMix REDTaq PCR (Sigma P-l 107) 0.5uM primer 1 (SEQ ID NO: 16) 0.5uM primer 2 (SEQ ID NO: 17) 0.5uM primer 3 (SEQ ID NO: 18) 0.2% BSA 20 ng genomic DNA ddH2O to 25ul
- the PCR reactions were heated in a thermocycler at 94°C for 5 minutes, followed by 30 cycles as follows: 94°C for 30 seconds, 55°C for 45 seconds, 72°C for 1 minute. The reaction was completed by heating at 72°C for 5 minutes.
- PCR reactions were run on an agarose gel, and DNA bands visualised under UV light after staining with ethidium bromide. The presence of 2 bands indicated that the sample was from a COT203 heterozygote plant; 1 band of 336bp in size indicated that the sample was from a COT203 homozygote plant; and 1 band of approximately 730bp in size indicated that the sample was from a homozygote wild type cotton plant.
- the COT203 event can be detected in a simple PCR reaction using the primers depicted as SEQ ID NO: 19 and 20, SEQ ID NO: 3 and 4, SEQ ID NO: 13 and 14 or SEQ ID NO: 16 and 18.
- the composition of the PCR reaction mixture is the same as described in example 3.2 above.
- the PCR reactions are heated in a thermocycler at 94°C for 5 minutes, followed by 30 cycles as follows: 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 20 seconds. The reaction is completed by heating at 72°C for 5 minutes.
- a DNA fragment of 336bp, 341bp, 84bp or 336bp in size respectively indicates the presence of the COT203 event.
- Example 4 COT203 Detection via Southern Blot 4.1 DNA extraction for use in Southern Blotting Approximately 2 to 3g fresh weight of young leaf tissue was ground in a chilled mortar and pestle to a fine powder and added to 15 ml of ice-cold Nuclei extraction buffer (0.35M glucose, 0.1M Tris-HCl pH8, 50mM Na 2 EDTA, 2% Polyvinyl-pyrrolidone- 10, 0.1% ascorbic acid, 0.2% B-mercaptoethanol) in a labelled tube. The sample was incubated on ice for 15-20 minutes.
- the tube was mixed gently and centrifuged at 2700g for 20 minutes at 4°C. The supernatant was discarded and 8ml of nuclei lysis buffer (0.14M sorbitol, 0.22M Tris-Cl pH8, 0.8M NaCl, 0.22M Na 2 EDTA, 0.8%w/v CTAB, 1% Sarkosyl, 1% Polyvinyl-pyrrolidone- 10, 0.1% ascorbic acid, 0.2% B-mercaptoethanol, 5 ⁇ g/ml proteinase K) was added. After mixing, the tubes were incubated at 65°C for 30 minutes. 10ml chloroform was added, and the tube mixed gently by inversion until an emulsion formed followed by centrifugation at 4600rpm for 10 minutes at room temperature.
- nuclei lysis buffer 0.14M sorbitol, 0.22M Tris-Cl pH8, 0.8M NaCl, 0.22M Na 2 EDTA, 0.8%w/v CTAB, 1% Sarkosyl,
- the aqueous layer was removed into a new tube containing 1 O ⁇ l RNase A (lOmg sigma R4642), and the tube incubated for 30 minutes at 37°C. The chloroform and centrifugation steps were repeated once.
- the aqueous layer was removed into a new tube containing 10ml propan-2-ol. After approximately 15 minutes incubation at room temperature, a gelatinous precipitate was observed in the middle of the tube. The tube was mixed gently to precipitate out the DNA.
- the DNA was spooled out using a sterile loop into a falcon tube containing 70% ethanol. The DNA was air-dried to remove the ethanol and resuspended in 200-400 ⁇ l TE.
- the samples are incubated at room temperature at 4600 rpm for 10 minutes.
- the aqueous phase is transferred to a fresh 15ml tube.
- 0.6 volumes of cold isopropanol are added and the sample is incubated at room temperature for approximately 30 minutes.
- the DNA is spooled out and dissolved in 500ul TE.
- lOul of lOmg/ml RNAse are added and incubated for 15 minutes at room temperature.
- the sample is mixed gently and centrifuged at 13000rpm for 5 min.
- the supernatant is transferred to a fresh tube using a fine Pasteur pipette and re-extracted with chloroform: isoamyl alcohol (24:1) as above.
- the supernatant is transferred to fresh tubes, 1/10 volume 3M NaOAc (pH4.8) added and mixed, and then one volume cold isopropanol is added.
- the sample may be incubated at room temperature for up to 30 minutes to precipitate the DNA.
- the DNA is spooled out and resuspended in 70% ethanol.
- the DNA is air-dried to remove the ethanol and resuspended in 200ul water.
- the DNA was quantified using a spectrophotometer and running out on a gel. Suitable enzyme digests were prepared using 5ug DNA per digest in a total volume of 40ul. Digests included Hindlll, Xmal, BamHI, Nhel, and Sad, both alone and in combination. In particular, a Hindlll and Xmal double digest was used to detect the intactness of the VIP3A gene; a Nhel digest was used to detect VIP3A locus number. Digests were incubated for 6 hours at the appropriate temperature for each enzyme.
- a Southern Blot was prepared as follows: A glass plate was placed over a tray containing 20X SSC and a strip of 3M paper was placed onto the glass plate such that both ends dipped into the 20X SSC solution (to act as a wick). A piece of 3M paper the same size as the gel was placed on the wick, and the gel placed on this.
- Strips of nescofilm were laid i around the edges of the gel to form a seal.
- a Hybond membrane was placed on top of the gel, followed by two further pieces of 3M paper. Throughout the assembly of the blot, care was taken to ensure that no air bubbles were trapped between the membrane, gel and 3M paper.
- a 5cm-10cm stack of absorbent paper towels was placed on top of the 3M paper and held in place with a weight.
- a suitable DNA probe was prepared by PCR or restriction digest of binary plasmid. 25ng probe DNA in 45ul TE was boiled for 5 minutes, placed on ice for 5 minutes then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After addition of 5ul P32-labelled dCTP to the Rediprime tube, the probe was incubated at 37°C for 1 hour .
- the probe was purified by centrifugation through a microspin G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturers instructions to remove unincorporated dNTPs.
- the activity of the probe was measured roughly by comparing the amount of radioactive component remaining in the column to the amount in the sample tube, with a ratio of at least 50:50 being acceptable.
- the Hybond membrane was pre-hybridised by wetting with 40 ml pre-warmed Rapid-Hyb buffer (Amersham- Pharmacia), at 65°C for 30 minutes. The labelled probe was boiled for 5 minutes, and placed on ice for 5 minutes.
- Extraction buffer (lOOmM Tris, lOOmM Sodium Borate, 5mM MgCl, 0.05% Tween 20, 0.2% Sodium Ascorbate, Water, pH 7.8, ImM AEBSF, O.OOlmM Leupeptin) was added to the sample in a ratio of 2:1 (volume extraction buffer : sample fresh weight) for fresh tissue or 30:1 (volume extraction buffer : sample dry weight) for lyophilised tissue.
- the sample was vortexed and homogenised using a Brinkman PT 10/35 Polytron equipped with a PTA 10TS foam- reducing generator, until the mixture became liquefied. Extracts were centrifuged at 10,000 x g for 15 minutes. The protein extract supernatant was stored at 2-8°C.
- the ELISA procedure used standard techniques as follows. A 96-well plate was soaked in ethanol for 2 hours, and air-dried. The plate was coated with 50ul goat anti-VIP3 A antibody per well and incubated overnight at 2-8°C. After washing three times with IX ELISA wash solution (lOOmM Tris, 0.5% Tween-20, 75mM NaCl, pH8.5), the plate was dried briefly by tapping upside down on a paper towel.
- 150ul blocking solution (lOmM NaPO 4 , 140mM NaCl, 1% BSA, 0.02% Sodium Azide, titrated to pH7.4 with monobasic NaPi and dibasic NaPi) was added to each well followed by incubation at room temperature for 45 minutes. The plate was washed 3 times as described above.
- VIP3A standards and protein extract samples were applied to appropriate wells of the plate in triplicate, 50ul total volume per well.
- the plate was incubated at 2-8°C for 1 hour 30 minutes, followed by room temperature for a further 30 minutes.
- the plate was washed three times with ELISA wash solution, and then incubated at 35-39°C for 1 hour with 50ul rabbit anti-VIP3 A antibody per well.
- the plate was washed three times with ELISA wash solution, and incubated at room temperature for 30 minutes with 50ul donkey anti-rabbit alkaline phosphatase per well. Following a further three washes with ELISA wash solution, 50ul phosphatase substrate solution was added per well and the plate incubated for 30 minutes at room temperature.
- Example 6 COT203 detection via DipStick 6.1 Protein extraction A piece of leaf tissue approximately 2 cm 2 was placed in a tube containing extraction buffer. A plastic stirrer was used to extract protein from the tissue, by cutting into and mascerating the tissue.
- test strip was placed into the tube and incubated for 5 to 10 minutes for the result to develop.
- the test strip comprised a first band at which anti-VIP3A antibody was bound, and a second band at which a control antibody was bound.
- a double red line in the result window of the test strip indicated that VIP3A was present.
- the lower line indicated the presence of VEP 3 A protein while the upper line was a control indicating that the assay was working correctly.
- Leaf assays were performed on Fall Army Worm (Spodoptera frugiperda), Cotton Boll Worm (Helicoverpa zed) and Tobacco Budworm (Heliothis virescens) as follows: Pads were soaked with 300ul to 500ul distilled water and placed into Gelman dishes. Leaf pieces measuring between approximately 0.5 square inches and 0.75 square inches were excised from cotton plants 8 to 12 inches in height, and placed on the pads. Between 8 and 10 insect larvae were placed in each dish and a lid fitted. The dishes were incubated at 28°C. On the third and sixth days after infestation, damage to the leaf in each dish was scored and compared with the control plants.
- the experiment was incubated at room temperature for approximately 3 weeks. The bolls were then cut open to determine damage. Damage to the boll was compared to the control samples.
- Terminal leaves were snap-frozen on dry-ice at time of picking and lyophilised overnight.
- the freeze dried tissue was ground in a mortar and pestle to a fine powder and resuspended in 0.2% agar solution to make an 8% (0.08g/ml) suspension of leaf powder.
- the suspension was overlaid on top of artificial insect diet in 96-well plates and left to dry. A single neonate insect larva was introduced into each well and the plates sealed. The plates were incubated at 28°C. On the sixth day after infestation, larval mortality was scored and compared with control samples.
- Example 8 COT203 Field Trials 8.1 Field trial design
- the efficacy of the COT203 event against Heliothis virescens (Tobacco Bud Worm) and Helicoverpa zea (Cotton Boll Worm) was tested by conducting field trials at three locations in the US, namely Leland (MS), Quitman (GA) and Beasley (TX). Trials in each location were set up using a randomised complete block design, with four entry plots comprising four rows of 40 feet in length and four repetitions per trial. Seed was planted to obtain a plant stand of approximately 3 plants per foot of row length.
- Each field trial included non transgenic Coker 312 plants for control purposes, and two other transgenic events designated event A and event B for comparison purposes.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US52612003P | 2003-12-01 | 2003-12-01 | |
US60/526,120 | 2003-12-01 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2005054480A2 true WO2005054480A2 (en) | 2005-06-16 |
WO2005054480A3 WO2005054480A3 (en) | 2007-08-30 |
Family
ID=34652418
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2004/012663 WO2005054480A2 (en) | 2003-12-01 | 2004-11-09 | Insect resistant cotton plants and methods of detecting the same |
Country Status (2)
Country | Link |
---|---|
AR (1) | AR047134A1 (es) |
WO (1) | WO2005054480A2 (es) |
Cited By (202)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011076892A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076889A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076877A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076882A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076885A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
EP2453012A1 (en) | 2010-11-10 | 2012-05-16 | Bayer CropScience AG | HPPD variants and methods of use |
WO2012072489A1 (de) | 2010-11-29 | 2012-06-07 | Bayer Cropscience Ag | Alpha-beta-ungesättigte imine |
WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
WO2012072696A1 (de) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
WO2012126938A2 (en) | 2011-03-23 | 2012-09-27 | Bayer Cropscience Ag | Active compound combinations |
WO2012130684A1 (en) | 2011-03-25 | 2012-10-04 | Bayer Cropscience Ag | Use of n-(1,2,5-oxadiazol-3-yl)benzamides for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides |
WO2012130685A1 (en) | 2011-03-25 | 2012-10-04 | Bayer Cropscience Ag | Use of n-(tetrazol-4-yl)- or n-(triazol-3-yl)arylcarboxamides or their salts for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides |
WO2012136581A1 (en) | 2011-04-08 | 2012-10-11 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
WO2012171914A1 (en) | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
WO2013026740A2 (en) | 2011-08-22 | 2013-02-28 | Bayer Cropscience Nv | Methods and means to modify a plant genome |
WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013110594A1 (en) | 2012-01-25 | 2013-08-01 | Bayer Intellectual Property Gmbh | Active compound combinations containing fluopyram and biological control agent |
WO2013110591A1 (en) | 2012-01-25 | 2013-08-01 | Bayer Intellectual Property Gmbh | Active compounds combination containing fluopyram bacillus and biologically control agent |
WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
WO2014019983A1 (en) | 2012-07-31 | 2014-02-06 | Bayer Cropscience Ag | Compositions comprising a pesticidal terpene mixture and an insecticide |
WO2014043435A1 (en) | 2012-09-14 | 2014-03-20 | Bayer Cropscience Lp | Hppd variants and methods of use |
EP2719280A1 (en) | 2012-10-11 | 2014-04-16 | Bayer CropScience AG | Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi |
WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
WO2014086758A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086749A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086764A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086747A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086759A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising biological control agents |
WO2014086748A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086750A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086753A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising biological control agents |
WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
WO2014124375A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and a biological control agent |
WO2014124373A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and an insecticide |
WO2014124368A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and a fungicide |
WO2014138339A2 (en) | 2013-03-07 | 2014-09-12 | Athenix Corp. | Toxin genes and methods for their use |
WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
EP2885970A1 (en) | 2013-12-21 | 2015-06-24 | Bayer CropScience AG | Fungicide compositions comprising compound I, at least one succinate dehydrogenase (SDH) inhibitor and at least one triazole fungicide |
WO2015138394A2 (en) | 2014-03-11 | 2015-09-17 | Bayer Cropscience Lp | Hppd variants and methods of use |
WO2015160620A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and an insecticide |
WO2015160619A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and a fungicide |
WO2015160618A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and a biological control agent |
EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
EP3081085A1 (en) | 2015-04-14 | 2016-10-19 | Bayer CropScience AG | Method for improving earliness in cotton |
WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
EP3097782A1 (en) | 2015-05-29 | 2016-11-30 | Bayer CropScience Aktiengesellschaft | Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents |
WO2017042259A1 (en) | 2015-09-11 | 2017-03-16 | Bayer Cropscience Aktiengesellschaft | Hppd variants and methods of use |
EP3205210A1 (en) | 2012-05-30 | 2017-08-16 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide selected from inhibitors of the succinate dehydrogenase |
WO2017182420A1 (en) | 2016-04-20 | 2017-10-26 | Bayer Cropscience Nv | Elite event ee-gh7 and methods and kits for identifying such event in biological samples |
EP3243387A2 (en) | 2012-05-30 | 2017-11-15 | Bayer CropScience Aktiengesellschaft | Compositions comprising a biological control agent and an insecticide |
WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
EP3281526A1 (en) | 2012-05-30 | 2018-02-14 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3292764A2 (en) | 2012-05-30 | 2018-03-14 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide selected from inhibitors of the respiratory chain at complex iii |
EP3300603A2 (en) | 2012-05-30 | 2018-04-04 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3318128A2 (en) | 2012-05-30 | 2018-05-09 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
WO2018098214A1 (en) | 2016-11-23 | 2018-05-31 | Bayer Cropscience Lp | Axmi669 and axmi991 toxin genes and methods for their use |
WO2018119336A1 (en) | 2016-12-22 | 2018-06-28 | Athenix Corp. | Use of cry14 for the control of nematode pests |
WO2018136611A1 (en) | 2017-01-18 | 2018-07-26 | Bayer Cropscience Lp | Use of bp005 for the control of plant pathogens |
WO2018136604A1 (en) | 2017-01-18 | 2018-07-26 | Bayer Cropscience Lp | Bp005 toxin gene and methods for its use |
EP3360418A1 (en) | 2012-05-30 | 2018-08-15 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3363289A2 (en) | 2012-05-30 | 2018-08-22 | Bayer CropScience Aktiengesellschaft | Compositions comprising a biological control agent and an insecticide |
WO2018165091A1 (en) | 2017-03-07 | 2018-09-13 | Bayer Cropscience Lp | Hppd variants and methods of use |
WO2018195256A1 (en) | 2017-04-21 | 2018-10-25 | Bayer Cropscience Lp | Method of improving crop safety |
WO2019068811A1 (en) | 2017-10-06 | 2019-04-11 | Bayer Aktiengesellschaft | COMPOSITIONS COMPRISING FLUOPYRAM AND TIOXAZAFENE |
WO2019083808A1 (en) | 2017-10-24 | 2019-05-02 | Basf Se | IMPROVING HERBICIDE TOLERANCE AGAINST HPPD INHIBITORS BY REGULATION OF PUTATIVE REDUCED 4-HYDROXYPHENYLPYRUVATE REDUCES IN SOYBEANS |
WO2019083810A1 (en) | 2017-10-24 | 2019-05-02 | Basf Se | IMPROVING HERBICIDE TOLERANCE FOR 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE (HPPD) INHIBITORS BY NEGATIVE REGULATION OF HPPD EXPRESSION IN SOYBEANS |
WO2019233863A1 (de) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbizid wirksame bizyklische benzoylpyrazole |
EP3701796A1 (en) | 2019-08-08 | 2020-09-02 | Bayer AG | Active compound combinations |
EP3708565A1 (en) | 2020-03-04 | 2020-09-16 | Bayer AG | Pyrimidinyloxyphenylamidines and the use thereof as fungicides |
WO2020231751A1 (en) | 2019-05-10 | 2020-11-19 | Bayer Cropscience Lp | Active compound combinations |
WO2021013719A1 (en) | 2019-07-23 | 2021-01-28 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021013721A1 (de) | 2019-07-22 | 2021-01-28 | Bayer Aktiengesellschaft | 5-amino substituierte pyrazole und triazole als schädlingsbekämpfungsmittel |
WO2021013720A1 (en) | 2019-07-23 | 2021-01-28 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021022069A1 (en) | 2019-08-01 | 2021-02-04 | Bayer Cropscience Lp | Method of improving cold stress tolerance and crop safety |
WO2021058659A1 (en) | 2019-09-26 | 2021-04-01 | Bayer Aktiengesellschaft | Rnai-mediated pest control |
WO2021064075A1 (en) | 2019-10-02 | 2021-04-08 | Bayer Aktiengesellschaft | Active compound combinations comprising fatty acids |
WO2021069569A1 (en) | 2019-10-09 | 2021-04-15 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021069567A1 (en) | 2019-10-09 | 2021-04-15 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021089673A1 (de) | 2019-11-07 | 2021-05-14 | Bayer Aktiengesellschaft | Substituierte sulfonylamide zur bekämpfung tierischer schädlinge |
WO2021097162A1 (en) | 2019-11-13 | 2021-05-20 | Bayer Cropscience Lp | Beneficial combinations with paenibacillus |
WO2021099271A1 (en) | 2019-11-18 | 2021-05-27 | Bayer Aktiengesellschaft | Active compound combinations comprising fatty acids |
WO2021099303A1 (en) | 2019-11-18 | 2021-05-27 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021105091A1 (en) | 2019-11-25 | 2021-06-03 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
US11066424B2 (en) | 2018-08-18 | 2021-07-20 | Boragen, Inc. | Solid forms of substituted benzoxaborole and compositions thereof |
WO2021155084A1 (en) | 2020-01-31 | 2021-08-05 | Pairwise Plants Services, Inc. | Suppression of shade avoidance response in plants |
WO2021165195A1 (en) | 2020-02-18 | 2021-08-26 | Bayer Aktiengesellschaft | Heteroaryl-triazole compounds as pesticides |
WO2021211926A1 (en) | 2020-04-16 | 2021-10-21 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021209490A1 (en) | 2020-04-16 | 2021-10-21 | Bayer Aktiengesellschaft | Cyclaminephenylaminoquinolines as fungicides |
WO2021213978A1 (de) | 2020-04-21 | 2021-10-28 | Bayer Aktiengesellschaft | 2-(het)aryl-substituierte kondensierte heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2021224220A1 (en) | 2020-05-06 | 2021-11-11 | Bayer Aktiengesellschaft | Pyridine (thio)amides as fungicidal compounds |
WO2021224323A1 (en) | 2020-05-06 | 2021-11-11 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021228734A1 (en) | 2020-05-12 | 2021-11-18 | Bayer Aktiengesellschaft | Triazine and pyrimidine (thio)amides as fungicidal compounds |
WO2021233861A1 (en) | 2020-05-19 | 2021-11-25 | Bayer Aktiengesellschaft | Azabicyclic(thio)amides as fungicidal compounds |
EP3915971A1 (en) | 2020-12-16 | 2021-12-01 | Bayer Aktiengesellschaft | Phenyl-s(o)n-phenylamidines and the use thereof as fungicides |
WO2021247477A1 (en) | 2020-06-02 | 2021-12-09 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021245087A1 (en) | 2020-06-04 | 2021-12-09 | Bayer Aktiengesellschaft | Heterocyclyl pyrimidines and triazines as novel fungicides |
WO2021249995A1 (en) | 2020-06-10 | 2021-12-16 | Bayer Aktiengesellschaft | Azabicyclyl-substituted heterocycles as fungicides |
WO2021255089A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides |
WO2021257775A1 (en) | 2020-06-17 | 2021-12-23 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021255169A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines as fungicides |
WO2021255170A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines as fungicides |
WO2021255118A1 (en) | 2020-06-18 | 2021-12-23 | Bayer Aktiengesellschaft | Composition for use in agriculture |
WO2021255091A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazoles and their derivatives as fungicides |
WO2021255071A1 (en) | 2020-06-18 | 2021-12-23 | Bayer Aktiengesellschaft | 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection |
EP3929189A1 (en) | 2020-06-25 | 2021-12-29 | Bayer Animal Health GmbH | Novel heteroaryl-substituted pyrazine derivatives as pesticides |
WO2022002818A1 (de) | 2020-07-02 | 2022-01-06 | Bayer Aktiengesellschaft | Heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2022033991A1 (de) | 2020-08-13 | 2022-02-17 | Bayer Aktiengesellschaft | 5-amino substituierte triazole als schädlingsbekämpfungsmittel |
WO2022053453A1 (de) | 2020-09-09 | 2022-03-17 | Bayer Aktiengesellschaft | Azolcarboxamide als schädlingsbekämpfungsmittel |
WO2022058327A1 (en) | 2020-09-15 | 2022-03-24 | Bayer Aktiengesellschaft | Substituted ureas and derivatives as new antifungal agents |
EP3974414A1 (de) | 2020-09-25 | 2022-03-30 | Bayer AG | 5-amino substituierte pyrazole und triazole als schädlingsbekämpfungsmittel |
WO2022129200A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | Use of dhodh inhibitor for controlling resistant phytopathogenic fungi in crops |
WO2022129196A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | Heterobicycle substituted 1,2,4-oxadiazoles as fungicides |
WO2022129190A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides |
WO2022129188A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | 1,2,4-oxadiazol-3-yl pyrimidines as fungicides |
CN114807121A (zh) * | 2022-04-26 | 2022-07-29 | 广西特色作物研究院 | 一种柑橘dna快速提取方法 |
EP4036083A1 (de) | 2021-02-02 | 2022-08-03 | Bayer Aktiengesellschaft | 5-oxy substituierte hetereozyklen, als schädlingsbekämpfungsmittel |
WO2022173885A1 (en) | 2021-02-11 | 2022-08-18 | Pairwise Plants Services, Inc. | Methods and compositions for modifying cytokinin oxidase levels in plants |
WO2022182834A1 (en) | 2021-02-25 | 2022-09-01 | Pairwise Plants Services, Inc. | Methods and compositions for modifying root architecture in plants |
WO2022207496A1 (en) | 2021-03-30 | 2022-10-06 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2022207494A1 (en) | 2021-03-30 | 2022-10-06 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2022233777A1 (en) | 2021-05-06 | 2022-11-10 | Bayer Aktiengesellschaft | Alkylamide substituted, annulated imidazoles and use thereof as insecticides |
WO2022238391A1 (de) | 2021-05-12 | 2022-11-17 | Bayer Aktiengesellschaft | 2-(het)aryl-substituierte kondensierte heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2022266271A1 (en) | 2021-06-17 | 2022-12-22 | Pairwise Plants Services, Inc. | Modification of growth regulating factor family transcription factors in soybean |
WO2022271892A1 (en) | 2021-06-24 | 2022-12-29 | Pairwise Plants Services, Inc. | Modification of hect e3 ubiquitin ligase genes to improve yield traits |
WO2023278651A1 (en) | 2021-07-01 | 2023-01-05 | Pairwise Plants Services, Inc. | Methods and compositions for enhancing root system development |
WO2023019188A1 (en) | 2021-08-12 | 2023-02-16 | Pairwise Plants Services, Inc. | Modification of brassinosteroid receptor genes to improve yield traits |
WO2023017120A1 (en) | 2021-08-13 | 2023-02-16 | Bayer Aktiengesellschaft | Active compound combinations and fungicide compositions comprising those |
WO2023023496A1 (en) | 2021-08-17 | 2023-02-23 | Pairwise Plants Services, Inc. | Methods and compositions for modifying cytokinin receptor histidine kinase genes in plants |
WO2023025682A1 (en) | 2021-08-25 | 2023-03-02 | Bayer Aktiengesellschaft | Novel pyrazinyl-triazole compounds as pesticides |
EP4144739A1 (de) | 2021-09-02 | 2023-03-08 | Bayer Aktiengesellschaft | Anellierte pyrazole als schädlingsbekämpfungsmittel |
WO2023034731A1 (en) | 2021-08-30 | 2023-03-09 | Pairwise Plants Services, Inc. | Modification of ubiquitin binding peptidase genes in plants for yield trait improvement |
WO2023034891A1 (en) | 2021-09-02 | 2023-03-09 | Pairwise Plants Services, Inc. | Methods and compositions for improving plant architecture and yield traits |
WO2023049720A1 (en) | 2021-09-21 | 2023-03-30 | Pairwise Plants Services, Inc. | Methods and compositions for reducing pod shatter in canola |
WO2023060152A2 (en) | 2021-10-07 | 2023-04-13 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023060028A1 (en) | 2021-10-04 | 2023-04-13 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023078915A1 (en) | 2021-11-03 | 2023-05-11 | Bayer Aktiengesellschaft | Bis(hetero)aryl thioether (thio)amides as fungicidal compounds |
WO2023099445A1 (en) | 2021-11-30 | 2023-06-08 | Bayer Aktiengesellschaft | Bis(hetero)aryl thioether oxadiazines as fungicidal compounds |
WO2023108035A1 (en) | 2021-12-09 | 2023-06-15 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023147526A1 (en) | 2022-01-31 | 2023-08-03 | Pairwise Plants Services, Inc. | Suppression of shade avoidance response in plants |
WO2023148028A1 (en) | 2022-02-01 | 2023-08-10 | Globachem Nv | Methods and compositions for controlling pests |
WO2023148031A1 (en) | 2022-02-01 | 2023-08-10 | Globachem Nv | Methods and compositions for controlling pests in cotton |
WO2023168217A1 (en) | 2022-03-02 | 2023-09-07 | Pairwise Plants Services, Inc. | Modification of brassinosteroid receptor genes to improve yield traits |
WO2023192838A1 (en) | 2022-03-31 | 2023-10-05 | Pairwise Plants Services, Inc. | Early flowering rosaceae plants with improved characteristics |
WO2023196886A1 (en) | 2022-04-07 | 2023-10-12 | Pairwise Plants Services, Inc. | Methods and compositions for improving resistance to fusarium head blight |
WO2023205714A1 (en) | 2022-04-21 | 2023-10-26 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield traits |
WO2023215704A1 (en) | 2022-05-02 | 2023-11-09 | Pairwise Plants Services, Inc. | Methods and compositions for enhancing yield and disease resistance |
WO2023215809A1 (en) | 2022-05-05 | 2023-11-09 | Pairwise Plants Services, Inc. | Methods and compositions for modifying root architecture and/or improving plant yield traits |
WO2023213670A1 (en) | 2022-05-03 | 2023-11-09 | Bayer Aktiengesellschaft | Crystalline forms of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine |
WO2023213626A1 (en) | 2022-05-03 | 2023-11-09 | Bayer Aktiengesellschaft | Use of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine for controlling unwanted microorganisms |
US11834466B2 (en) | 2017-11-30 | 2023-12-05 | 5Metis, Inc. | Benzoxaborole compounds and formulations thereof |
EP4295688A1 (en) | 2022-09-28 | 2023-12-27 | Bayer Aktiengesellschaft | Active compound combination |
WO2024006791A1 (en) | 2022-06-29 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024006679A1 (en) | 2022-06-27 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for modifying shade avoidance in plants |
WO2024006792A1 (en) | 2022-06-29 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024030984A1 (en) | 2022-08-04 | 2024-02-08 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield traits |
WO2024036240A1 (en) | 2022-08-11 | 2024-02-15 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024054880A1 (en) | 2022-09-08 | 2024-03-14 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield characteristics in plants |
WO2024068519A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068517A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068520A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068518A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998044137A2 (en) * | 1997-04-03 | 1998-10-08 | Novartis Ag | Plant pest control |
WO2002078437A2 (en) * | 2001-03-30 | 2002-10-10 | Syngenta Participations Ag | Novel pesticidal toxins |
WO2003075655A2 (en) * | 2002-03-06 | 2003-09-18 | Syngenta Participation Ag | Novel vip3 toxins and methods of use |
-
2004
- 2004-11-09 WO PCT/EP2004/012663 patent/WO2005054480A2/en active Application Filing
- 2004-11-29 AR ARP040104423A patent/AR047134A1/es unknown
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998044137A2 (en) * | 1997-04-03 | 1998-10-08 | Novartis Ag | Plant pest control |
WO2002078437A2 (en) * | 2001-03-30 | 2002-10-10 | Syngenta Participations Ag | Novel pesticidal toxins |
WO2003075655A2 (en) * | 2002-03-06 | 2003-09-18 | Syngenta Participation Ag | Novel vip3 toxins and methods of use |
Non-Patent Citations (4)
Title |
---|
DATABASE EMBL [Online] 4 July 2001 (2001-07-04), "Homo sapiens chromosome 5 clone RP11-19O2, complete sequence." XP002319568 retrieved from EBI accession no. EM_PRO:AC092335 Database accession no. AC092335 * |
LIAO CHUNYAN ET AL: "Toxicity of Bacillus thuringiensis insecticidal proteins for Helicoverpa armigera and Helicoverpa punctigera (Lepidoptera: Noctuidae), major pests of cotton" JOURNAL OF INVERTEBRATE PATHOLOGY, SAN DIEGO, CA, US, vol. 80, no. 1, May 2002 (2002-05), pages 55-63, XP002273074 ISSN: 0022-2011 * |
MOAR WILLIAM J: "Breathing new life into insect-resistant plants." NATURE BIOTECHNOLOGY. OCT 2003, vol. 21, no. 10, October 2003 (2003-10), pages 1152-1154, XP002319567 ISSN: 1087-0156 * |
SHOTKOSKI, FRANK ET AL: "Vip: a novel insecticidal protein with broad spectrum lepidopteran activity" PROCEEDINGS - BELTWIDE COTTON CONFERENCES 89-93 CODEN: PCOCEN; ISSN: 1059-2644, January 2003 (2003-01), XP009044606 * |
Cited By (236)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011076892A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076889A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076877A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076882A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
WO2011076885A1 (en) | 2009-12-23 | 2011-06-30 | Bayer Cropscience Ag | Plants tolerant to hppd inhibitor herbicides |
EP2669370A1 (en) | 2010-11-10 | 2013-12-04 | Bayer CropScience AG | HPPD variants and methods of use |
EP2669372A1 (en) | 2010-11-10 | 2013-12-04 | Bayer CropScience AG | HPPD variants and methods of use |
EP2453012A1 (en) | 2010-11-10 | 2012-05-16 | Bayer CropScience AG | HPPD variants and methods of use |
EP2669369A1 (en) | 2010-11-10 | 2013-12-04 | Bayer CropScience AG | HPPD variants and methods of use |
EP2669371A1 (en) | 2010-11-10 | 2013-12-04 | Bayer CropScience AG | HPPD variants and methods of use |
EP2669373A1 (en) | 2010-11-10 | 2013-12-04 | Bayer CropScience AG | HPPD variants and methods of use |
US9055743B2 (en) | 2010-11-29 | 2015-06-16 | Bayer Intellectual Property Gmbh | Alpha, beta-unsaturated imines |
WO2012072489A1 (de) | 2010-11-29 | 2012-06-07 | Bayer Cropscience Ag | Alpha-beta-ungesättigte imine |
WO2012072696A1 (de) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
WO2012072660A1 (en) | 2010-12-01 | 2012-06-07 | Bayer Cropscience Ag | Use of fluopyram for controlling nematodes in crops and for increasing yield |
EP3103338A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
EP3103340A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
EP3103334A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
EP3103339A1 (de) | 2010-12-01 | 2016-12-14 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
EP3092900A1 (de) | 2010-12-01 | 2016-11-16 | Bayer Intellectual Property GmbH | Wirkstoffkombinationen umfassend pyridylethylbenzamide und weitere wirkstoffe |
WO2012120105A1 (en) | 2011-03-10 | 2012-09-13 | Bayer Cropscience Ag | Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds |
EP3292761A1 (en) | 2011-03-23 | 2018-03-14 | Bayer Intellectual Property GmbH | Active compound combinations |
WO2012126938A2 (en) | 2011-03-23 | 2012-09-27 | Bayer Cropscience Ag | Active compound combinations |
EP3295797A1 (en) | 2011-03-23 | 2018-03-21 | Bayer Intellectual Property GmbH | Active compound combinations |
EP3292760A1 (en) | 2011-03-23 | 2018-03-14 | Bayer Intellectual Property GmbH | Active compound combinations |
WO2012130684A1 (en) | 2011-03-25 | 2012-10-04 | Bayer Cropscience Ag | Use of n-(1,2,5-oxadiazol-3-yl)benzamides for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides |
WO2012130685A1 (en) | 2011-03-25 | 2012-10-04 | Bayer Cropscience Ag | Use of n-(tetrazol-4-yl)- or n-(triazol-3-yl)arylcarboxamides or their salts for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides |
WO2012136581A1 (en) | 2011-04-08 | 2012-10-11 | Bayer Cropscience Ag | Fungicide hydroximoyl-tetrazole derivatives |
EP2997825A1 (en) | 2011-04-22 | 2016-03-23 | Bayer Intellectual Property GmbH | Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound |
WO2012171914A1 (en) | 2011-06-14 | 2012-12-20 | Bayer Intellectual Property Gmbh | Use of an enaminocarbonyl compound in combination with a biological control agent |
US9670496B2 (en) | 2011-08-22 | 2017-06-06 | Bayer Cropscience N.V. | Methods and means to modify a plant genome |
WO2013026740A2 (en) | 2011-08-22 | 2013-02-28 | Bayer Cropscience Nv | Methods and means to modify a plant genome |
US10538774B2 (en) | 2011-08-22 | 2020-01-21 | Basf Agricultural Solutions Seed, Us Llc | Methods and means to modify a plant genome |
EP2561759A1 (en) | 2011-08-26 | 2013-02-27 | Bayer Cropscience AG | Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth |
WO2013037717A1 (en) | 2011-09-12 | 2013-03-21 | Bayer Intellectual Property Gmbh | Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4h)-one derivatives |
WO2013037955A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of acylsulfonamides for improving plant yield |
WO2013037956A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield |
WO2013037958A1 (en) | 2011-09-16 | 2013-03-21 | Bayer Intellectual Property Gmbh | Use of phenylpyrazolin-3-carboxylates for improving plant yield |
WO2013050410A1 (en) | 2011-10-04 | 2013-04-11 | Bayer Intellectual Property Gmbh | RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE |
WO2013075817A1 (en) | 2011-11-21 | 2013-05-30 | Bayer Intellectual Property Gmbh | Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives |
WO2013079566A2 (en) | 2011-11-30 | 2013-06-06 | Bayer Intellectual Property Gmbh | Fungicidal n-bicycloalkyl and n-tricycloalkyl (thio)carboxamide derivatives |
WO2013092519A1 (en) | 2011-12-19 | 2013-06-27 | Bayer Cropscience Ag | Use of anthranilic acid diamide derivatives for pest control in transgenic crops |
WO2013098146A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013098147A1 (en) | 2011-12-29 | 2013-07-04 | Bayer Intellectual Property Gmbh | Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives |
WO2013110594A1 (en) | 2012-01-25 | 2013-08-01 | Bayer Intellectual Property Gmbh | Active compound combinations containing fluopyram and biological control agent |
WO2013110591A1 (en) | 2012-01-25 | 2013-08-01 | Bayer Intellectual Property Gmbh | Active compounds combination containing fluopyram bacillus and biologically control agent |
WO2013127704A1 (en) | 2012-02-27 | 2013-09-06 | Bayer Intellectual Property Gmbh | Active compound combinations containing a thiazoylisoxazoline and a fungicide |
WO2013139949A1 (en) | 2012-03-23 | 2013-09-26 | Bayer Intellectual Property Gmbh | Compositions comprising a strigolactame compound for enhanced plant growth and yield |
WO2013153143A1 (en) | 2012-04-12 | 2013-10-17 | Bayer Cropscience Ag | N-acyl- 2 - (cyclo) alkylpyrrolidines and piperidines useful as fungicides |
WO2013156559A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives |
WO2013156560A1 (en) | 2012-04-20 | 2013-10-24 | Bayer Cropscience Ag | N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives |
EP2662360A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole indanyl carboxamides |
EP2662364A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole tetrahydronaphthyl carboxamides |
WO2013167544A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | 5-halogenopyrazole indanyl carboxamides |
EP2662370A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole benzofuranyl carboxamides |
EP2662362A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazole indanyl carboxamides |
EP2662363A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | 5-Halogenopyrazole biphenylcarboxamides |
EP2662361A1 (en) | 2012-05-09 | 2013-11-13 | Bayer CropScience AG | Pyrazol indanyl carboxamides |
WO2013167545A1 (en) | 2012-05-09 | 2013-11-14 | Bayer Cropscience Ag | Pyrazole indanyl carboxamides |
WO2013174836A1 (en) | 2012-05-22 | 2013-11-28 | Bayer Cropscience Ag | Active compounds combinations comprising a lipo-chitooligosaccharide derivative and a nematicide, insecticidal or fungicidal compound |
EP3243387A2 (en) | 2012-05-30 | 2017-11-15 | Bayer CropScience Aktiengesellschaft | Compositions comprising a biological control agent and an insecticide |
EP3281526A1 (en) | 2012-05-30 | 2018-02-14 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3292764A2 (en) | 2012-05-30 | 2018-03-14 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide selected from inhibitors of the respiratory chain at complex iii |
EP3300603A2 (en) | 2012-05-30 | 2018-04-04 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3318128A2 (en) | 2012-05-30 | 2018-05-09 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3488700A1 (en) | 2012-05-30 | 2019-05-29 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3205210A1 (en) | 2012-05-30 | 2017-08-16 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide selected from inhibitors of the succinate dehydrogenase |
EP3409120A1 (en) | 2012-05-30 | 2018-12-05 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3363289A2 (en) | 2012-05-30 | 2018-08-22 | Bayer CropScience Aktiengesellschaft | Compositions comprising a biological control agent and an insecticide |
EP3360418A1 (en) | 2012-05-30 | 2018-08-15 | Bayer CropScience Aktiengesellschaft | Composition comprising a biological control agent and a fungicide |
EP3424322A1 (en) | 2012-07-31 | 2019-01-09 | Bayer CropScience Aktiengesellschaft | Compositions comprising a pesticidal terpene mixture and an insecticide |
WO2014019983A1 (en) | 2012-07-31 | 2014-02-06 | Bayer Cropscience Ag | Compositions comprising a pesticidal terpene mixture and an insecticide |
EP3173477A1 (en) | 2012-09-14 | 2017-05-31 | Bayer Cropscience LP | Hppd variants and methods of use |
EP3683307A2 (en) | 2012-09-14 | 2020-07-22 | BASF Agricultural Solutions Seed US LLC | Hppd variants and methods of use |
WO2014043435A1 (en) | 2012-09-14 | 2014-03-20 | Bayer Cropscience Lp | Hppd variants and methods of use |
WO2014056956A1 (en) | 2012-10-11 | 2014-04-17 | Bayer Cropscience Ag | Use of n-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi |
EP2719280A1 (en) | 2012-10-11 | 2014-04-16 | Bayer CropScience AG | Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi |
WO2014060519A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives |
WO2014060520A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives |
WO2014060518A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Method of plant growth promotion using carboxamide derivatives |
WO2014060502A1 (en) | 2012-10-19 | 2014-04-24 | Bayer Cropscience Ag | Active compound combinations comprising carboxamide derivatives |
WO2014079789A1 (en) | 2012-11-23 | 2014-05-30 | Bayer Cropscience Ag | Active compound combinations |
EP2735231A1 (en) | 2012-11-23 | 2014-05-28 | Bayer CropScience AG | Active compound combinations |
WO2014083088A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary fungicidal mixtures |
WO2014083031A2 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Binary pesticidal and fungicidal mixtures |
WO2014083089A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal and pesticidal mixtures |
WO2014083033A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropsience Ag | Binary fungicidal or pesticidal mixture |
WO2014082950A1 (en) | 2012-11-30 | 2014-06-05 | Bayer Cropscience Ag | Ternary fungicidal mixtures |
EP3318129A1 (en) | 2012-12-03 | 2018-05-09 | Bayer CropScience Aktiengesellschaft | Method for pest control by applying a combination of paecilomyces lilacinus and fluopyram |
WO2014086764A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086749A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086758A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086747A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086759A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising biological control agents |
WO2014086748A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and a fungicide |
WO2014086750A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising a biological control agent and an insecticide |
WO2014086753A2 (en) | 2012-12-03 | 2014-06-12 | Bayer Cropscience Ag | Composition comprising biological control agents |
WO2014090765A1 (en) | 2012-12-12 | 2014-06-19 | Bayer Cropscience Ag | Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops |
WO2014095826A1 (en) | 2012-12-18 | 2014-06-26 | Bayer Cropscience Ag | Binary fungicidal and bactericidal combinations |
WO2014095677A1 (en) | 2012-12-19 | 2014-06-26 | Bayer Cropscience Ag | Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides |
WO2014124375A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and a biological control agent |
WO2014124379A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising a streptomyces-based biological control agent and an insecticide |
WO2014124361A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising a streptomyces-based biological control agent and another biological control agent |
WO2014124368A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and a fungicide |
WO2014124373A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising gougerotin and an insecticide |
WO2014124369A1 (en) | 2013-02-11 | 2014-08-14 | Bayer Cropscience Lp | Compositions comprising a streptomyces-based biological control agent and a fungicide |
EP3626828A2 (en) | 2013-03-07 | 2020-03-25 | BASF Agricultural Solutions Seed US LLC | Toxin genes and methods for their use |
WO2014138339A2 (en) | 2013-03-07 | 2014-09-12 | Athenix Corp. | Toxin genes and methods for their use |
WO2014170345A2 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Method for improved utilization of the production potential of transgenic plants |
WO2014170364A1 (en) | 2013-04-19 | 2014-10-23 | Bayer Cropscience Ag | Binary insecticidal or pesticidal mixture |
WO2014177582A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | N-(2-fluoro-2-phenethyl)carboxamides as nematicides and endoparasiticides |
WO2014177514A1 (en) | 2013-04-30 | 2014-11-06 | Bayer Cropscience Ag | Nematicidal n-substituted phenethylcarboxamides |
WO2014206953A1 (en) | 2013-06-26 | 2014-12-31 | Bayer Cropscience Ag | N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives |
WO2015082586A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
WO2015082587A1 (en) | 2013-12-05 | 2015-06-11 | Bayer Cropscience Ag | N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives |
EP2885970A1 (en) | 2013-12-21 | 2015-06-24 | Bayer CropScience AG | Fungicide compositions comprising compound I, at least one succinate dehydrogenase (SDH) inhibitor and at least one triazole fungicide |
WO2015138394A2 (en) | 2014-03-11 | 2015-09-17 | Bayer Cropscience Lp | Hppd variants and methods of use |
WO2015160618A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and a biological control agent |
WO2015160620A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and an insecticide |
WO2015160619A1 (en) | 2014-04-16 | 2015-10-22 | Bayer Cropscience Lp | Compositions comprising ningnanmycin and a fungicide |
WO2016166077A1 (en) | 2015-04-13 | 2016-10-20 | Bayer Cropscience Aktiengesellschaft | N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives |
EP3081085A1 (en) | 2015-04-14 | 2016-10-19 | Bayer CropScience AG | Method for improving earliness in cotton |
EP3097782A1 (en) | 2015-05-29 | 2016-11-30 | Bayer CropScience Aktiengesellschaft | Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents |
WO2016193073A1 (en) | 2015-05-29 | 2016-12-08 | Bayer Cropscience Aktiengesellschaft | Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents |
WO2017042259A1 (en) | 2015-09-11 | 2017-03-16 | Bayer Cropscience Aktiengesellschaft | Hppd variants and methods of use |
US11926838B2 (en) | 2016-04-20 | 2024-03-12 | BASF Agricultural Solutions Seed US LLC | Elite event EE-GH7 and methods and kits for identifying such event in biological samples |
US11085050B2 (en) | 2016-04-20 | 2021-08-10 | Basf Agricultural Solutions Seed, Us Llc | Elite event EE-GH7 and methods and kits for identifying such event in biological samples |
WO2017182420A1 (en) | 2016-04-20 | 2017-10-26 | Bayer Cropscience Nv | Elite event ee-gh7 and methods and kits for identifying such event in biological samples |
WO2018019676A1 (en) | 2016-07-29 | 2018-02-01 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
WO2018098214A1 (en) | 2016-11-23 | 2018-05-31 | Bayer Cropscience Lp | Axmi669 and axmi991 toxin genes and methods for their use |
WO2018119336A1 (en) | 2016-12-22 | 2018-06-28 | Athenix Corp. | Use of cry14 for the control of nematode pests |
WO2018136604A1 (en) | 2017-01-18 | 2018-07-26 | Bayer Cropscience Lp | Bp005 toxin gene and methods for its use |
WO2018136611A1 (en) | 2017-01-18 | 2018-07-26 | Bayer Cropscience Lp | Use of bp005 for the control of plant pathogens |
WO2018165091A1 (en) | 2017-03-07 | 2018-09-13 | Bayer Cropscience Lp | Hppd variants and methods of use |
WO2018195256A1 (en) | 2017-04-21 | 2018-10-25 | Bayer Cropscience Lp | Method of improving crop safety |
WO2019068811A1 (en) | 2017-10-06 | 2019-04-11 | Bayer Aktiengesellschaft | COMPOSITIONS COMPRISING FLUOPYRAM AND TIOXAZAFENE |
WO2019083810A1 (en) | 2017-10-24 | 2019-05-02 | Basf Se | IMPROVING HERBICIDE TOLERANCE FOR 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE (HPPD) INHIBITORS BY NEGATIVE REGULATION OF HPPD EXPRESSION IN SOYBEANS |
WO2019083808A1 (en) | 2017-10-24 | 2019-05-02 | Basf Se | IMPROVING HERBICIDE TOLERANCE AGAINST HPPD INHIBITORS BY REGULATION OF PUTATIVE REDUCED 4-HYDROXYPHENYLPYRUVATE REDUCES IN SOYBEANS |
US11834466B2 (en) | 2017-11-30 | 2023-12-05 | 5Metis, Inc. | Benzoxaborole compounds and formulations thereof |
WO2019233863A1 (de) | 2018-06-04 | 2019-12-12 | Bayer Aktiengesellschaft | Herbizid wirksame bizyklische benzoylpyrazole |
US11066424B2 (en) | 2018-08-18 | 2021-07-20 | Boragen, Inc. | Solid forms of substituted benzoxaborole and compositions thereof |
US11560393B2 (en) | 2018-08-18 | 2023-01-24 | 5Metis, Inc. | Solid forms of substituted benzoxaborole and compositions thereof |
US11236115B2 (en) | 2018-08-18 | 2022-02-01 | 5Metis, Inc. | Solid forms of substituted benzoxaborole and compositions thereof |
WO2020231751A1 (en) | 2019-05-10 | 2020-11-19 | Bayer Cropscience Lp | Active compound combinations |
WO2021013721A1 (de) | 2019-07-22 | 2021-01-28 | Bayer Aktiengesellschaft | 5-amino substituierte pyrazole und triazole als schädlingsbekämpfungsmittel |
WO2021013719A1 (en) | 2019-07-23 | 2021-01-28 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021013720A1 (en) | 2019-07-23 | 2021-01-28 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021022069A1 (en) | 2019-08-01 | 2021-02-04 | Bayer Cropscience Lp | Method of improving cold stress tolerance and crop safety |
EP3701796A1 (en) | 2019-08-08 | 2020-09-02 | Bayer AG | Active compound combinations |
WO2021058659A1 (en) | 2019-09-26 | 2021-04-01 | Bayer Aktiengesellschaft | Rnai-mediated pest control |
WO2021064075A1 (en) | 2019-10-02 | 2021-04-08 | Bayer Aktiengesellschaft | Active compound combinations comprising fatty acids |
WO2021069569A1 (en) | 2019-10-09 | 2021-04-15 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021069567A1 (en) | 2019-10-09 | 2021-04-15 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021089673A1 (de) | 2019-11-07 | 2021-05-14 | Bayer Aktiengesellschaft | Substituierte sulfonylamide zur bekämpfung tierischer schädlinge |
WO2021097162A1 (en) | 2019-11-13 | 2021-05-20 | Bayer Cropscience Lp | Beneficial combinations with paenibacillus |
WO2021099303A1 (en) | 2019-11-18 | 2021-05-27 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021099271A1 (en) | 2019-11-18 | 2021-05-27 | Bayer Aktiengesellschaft | Active compound combinations comprising fatty acids |
WO2021105091A1 (en) | 2019-11-25 | 2021-06-03 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021155084A1 (en) | 2020-01-31 | 2021-08-05 | Pairwise Plants Services, Inc. | Suppression of shade avoidance response in plants |
WO2021165195A1 (en) | 2020-02-18 | 2021-08-26 | Bayer Aktiengesellschaft | Heteroaryl-triazole compounds as pesticides |
EP3708565A1 (en) | 2020-03-04 | 2020-09-16 | Bayer AG | Pyrimidinyloxyphenylamidines and the use thereof as fungicides |
WO2021211926A1 (en) | 2020-04-16 | 2021-10-21 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021209490A1 (en) | 2020-04-16 | 2021-10-21 | Bayer Aktiengesellschaft | Cyclaminephenylaminoquinolines as fungicides |
WO2021213978A1 (de) | 2020-04-21 | 2021-10-28 | Bayer Aktiengesellschaft | 2-(het)aryl-substituierte kondensierte heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2021224323A1 (en) | 2020-05-06 | 2021-11-11 | Bayer Aktiengesellschaft | Novel heteroaryl-triazole compounds as pesticides |
WO2021224220A1 (en) | 2020-05-06 | 2021-11-11 | Bayer Aktiengesellschaft | Pyridine (thio)amides as fungicidal compounds |
WO2021228734A1 (en) | 2020-05-12 | 2021-11-18 | Bayer Aktiengesellschaft | Triazine and pyrimidine (thio)amides as fungicidal compounds |
WO2021233861A1 (en) | 2020-05-19 | 2021-11-25 | Bayer Aktiengesellschaft | Azabicyclic(thio)amides as fungicidal compounds |
WO2021247477A1 (en) | 2020-06-02 | 2021-12-09 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021245087A1 (en) | 2020-06-04 | 2021-12-09 | Bayer Aktiengesellschaft | Heterocyclyl pyrimidines and triazines as novel fungicides |
WO2021249995A1 (en) | 2020-06-10 | 2021-12-16 | Bayer Aktiengesellschaft | Azabicyclyl-substituted heterocycles as fungicides |
WO2021257775A1 (en) | 2020-06-17 | 2021-12-23 | Pairwise Plants Services, Inc. | Methods for controlling meristem size for crop improvement |
WO2021255118A1 (en) | 2020-06-18 | 2021-12-23 | Bayer Aktiengesellschaft | Composition for use in agriculture |
WO2021255071A1 (en) | 2020-06-18 | 2021-12-23 | Bayer Aktiengesellschaft | 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine derivatives as fungicides for crop protection |
WO2021255089A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides |
WO2021255091A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazoles and their derivatives as fungicides |
WO2021255170A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines as fungicides |
WO2021255169A1 (en) | 2020-06-19 | 2021-12-23 | Bayer Aktiengesellschaft | 1,3,4-oxadiazole pyrimidines as fungicides |
EP3929189A1 (en) | 2020-06-25 | 2021-12-29 | Bayer Animal Health GmbH | Novel heteroaryl-substituted pyrazine derivatives as pesticides |
WO2021259997A1 (en) | 2020-06-25 | 2021-12-30 | Bayer Animal Health Gmbh | Novel heteroaryl-substituted pyrazine derivatives as pesticides |
WO2022002818A1 (de) | 2020-07-02 | 2022-01-06 | Bayer Aktiengesellschaft | Heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2022033991A1 (de) | 2020-08-13 | 2022-02-17 | Bayer Aktiengesellschaft | 5-amino substituierte triazole als schädlingsbekämpfungsmittel |
WO2022053453A1 (de) | 2020-09-09 | 2022-03-17 | Bayer Aktiengesellschaft | Azolcarboxamide als schädlingsbekämpfungsmittel |
WO2022058327A1 (en) | 2020-09-15 | 2022-03-24 | Bayer Aktiengesellschaft | Substituted ureas and derivatives as new antifungal agents |
EP3974414A1 (de) | 2020-09-25 | 2022-03-30 | Bayer AG | 5-amino substituierte pyrazole und triazole als schädlingsbekämpfungsmittel |
EP3915971A1 (en) | 2020-12-16 | 2021-12-01 | Bayer Aktiengesellschaft | Phenyl-s(o)n-phenylamidines and the use thereof as fungicides |
WO2022129200A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | Use of dhodh inhibitor for controlling resistant phytopathogenic fungi in crops |
WO2022129188A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | 1,2,4-oxadiazol-3-yl pyrimidines as fungicides |
WO2022129196A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | Heterobicycle substituted 1,2,4-oxadiazoles as fungicides |
WO2022129190A1 (en) | 2020-12-18 | 2022-06-23 | Bayer Aktiengesellschaft | (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides |
EP4036083A1 (de) | 2021-02-02 | 2022-08-03 | Bayer Aktiengesellschaft | 5-oxy substituierte hetereozyklen, als schädlingsbekämpfungsmittel |
WO2022173885A1 (en) | 2021-02-11 | 2022-08-18 | Pairwise Plants Services, Inc. | Methods and compositions for modifying cytokinin oxidase levels in plants |
WO2022182834A1 (en) | 2021-02-25 | 2022-09-01 | Pairwise Plants Services, Inc. | Methods and compositions for modifying root architecture in plants |
WO2022207496A1 (en) | 2021-03-30 | 2022-10-06 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2022207494A1 (en) | 2021-03-30 | 2022-10-06 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2022233777A1 (en) | 2021-05-06 | 2022-11-10 | Bayer Aktiengesellschaft | Alkylamide substituted, annulated imidazoles and use thereof as insecticides |
WO2022238391A1 (de) | 2021-05-12 | 2022-11-17 | Bayer Aktiengesellschaft | 2-(het)aryl-substituierte kondensierte heterocyclen-derivate als schädlingsbekämpfungsmittel |
WO2022266271A1 (en) | 2021-06-17 | 2022-12-22 | Pairwise Plants Services, Inc. | Modification of growth regulating factor family transcription factors in soybean |
WO2022271892A1 (en) | 2021-06-24 | 2022-12-29 | Pairwise Plants Services, Inc. | Modification of hect e3 ubiquitin ligase genes to improve yield traits |
WO2023278651A1 (en) | 2021-07-01 | 2023-01-05 | Pairwise Plants Services, Inc. | Methods and compositions for enhancing root system development |
WO2023019188A1 (en) | 2021-08-12 | 2023-02-16 | Pairwise Plants Services, Inc. | Modification of brassinosteroid receptor genes to improve yield traits |
WO2023017120A1 (en) | 2021-08-13 | 2023-02-16 | Bayer Aktiengesellschaft | Active compound combinations and fungicide compositions comprising those |
WO2023023496A1 (en) | 2021-08-17 | 2023-02-23 | Pairwise Plants Services, Inc. | Methods and compositions for modifying cytokinin receptor histidine kinase genes in plants |
WO2023025682A1 (en) | 2021-08-25 | 2023-03-02 | Bayer Aktiengesellschaft | Novel pyrazinyl-triazole compounds as pesticides |
WO2023034731A1 (en) | 2021-08-30 | 2023-03-09 | Pairwise Plants Services, Inc. | Modification of ubiquitin binding peptidase genes in plants for yield trait improvement |
EP4144739A1 (de) | 2021-09-02 | 2023-03-08 | Bayer Aktiengesellschaft | Anellierte pyrazole als schädlingsbekämpfungsmittel |
WO2023034891A1 (en) | 2021-09-02 | 2023-03-09 | Pairwise Plants Services, Inc. | Methods and compositions for improving plant architecture and yield traits |
WO2023049720A1 (en) | 2021-09-21 | 2023-03-30 | Pairwise Plants Services, Inc. | Methods and compositions for reducing pod shatter in canola |
WO2023060028A1 (en) | 2021-10-04 | 2023-04-13 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023060152A2 (en) | 2021-10-07 | 2023-04-13 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023078915A1 (en) | 2021-11-03 | 2023-05-11 | Bayer Aktiengesellschaft | Bis(hetero)aryl thioether (thio)amides as fungicidal compounds |
WO2023099445A1 (en) | 2021-11-30 | 2023-06-08 | Bayer Aktiengesellschaft | Bis(hetero)aryl thioether oxadiazines as fungicidal compounds |
WO2023108035A1 (en) | 2021-12-09 | 2023-06-15 | Pairwise Plants Services, Inc. | Methods for improving floret fertility and seed yield |
WO2023147526A1 (en) | 2022-01-31 | 2023-08-03 | Pairwise Plants Services, Inc. | Suppression of shade avoidance response in plants |
WO2023148031A1 (en) | 2022-02-01 | 2023-08-10 | Globachem Nv | Methods and compositions for controlling pests in cotton |
WO2023148028A1 (en) | 2022-02-01 | 2023-08-10 | Globachem Nv | Methods and compositions for controlling pests |
WO2023168217A1 (en) | 2022-03-02 | 2023-09-07 | Pairwise Plants Services, Inc. | Modification of brassinosteroid receptor genes to improve yield traits |
WO2023192838A1 (en) | 2022-03-31 | 2023-10-05 | Pairwise Plants Services, Inc. | Early flowering rosaceae plants with improved characteristics |
WO2023196886A1 (en) | 2022-04-07 | 2023-10-12 | Pairwise Plants Services, Inc. | Methods and compositions for improving resistance to fusarium head blight |
WO2023205714A1 (en) | 2022-04-21 | 2023-10-26 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield traits |
CN114807121A (zh) * | 2022-04-26 | 2022-07-29 | 广西特色作物研究院 | 一种柑橘dna快速提取方法 |
WO2023215704A1 (en) | 2022-05-02 | 2023-11-09 | Pairwise Plants Services, Inc. | Methods and compositions for enhancing yield and disease resistance |
WO2023213626A1 (en) | 2022-05-03 | 2023-11-09 | Bayer Aktiengesellschaft | Use of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine for controlling unwanted microorganisms |
WO2023213670A1 (en) | 2022-05-03 | 2023-11-09 | Bayer Aktiengesellschaft | Crystalline forms of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine |
WO2023215809A1 (en) | 2022-05-05 | 2023-11-09 | Pairwise Plants Services, Inc. | Methods and compositions for modifying root architecture and/or improving plant yield traits |
WO2024006679A1 (en) | 2022-06-27 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for modifying shade avoidance in plants |
WO2024006792A1 (en) | 2022-06-29 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024006791A1 (en) | 2022-06-29 | 2024-01-04 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024030984A1 (en) | 2022-08-04 | 2024-02-08 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield traits |
WO2024036240A1 (en) | 2022-08-11 | 2024-02-15 | Pairwise Plants Services, Inc. | Methods and compositions for controlling meristem size for crop improvement |
WO2024054880A1 (en) | 2022-09-08 | 2024-03-14 | Pairwise Plants Services, Inc. | Methods and compositions for improving yield characteristics in plants |
EP4295688A1 (en) | 2022-09-28 | 2023-12-27 | Bayer Aktiengesellschaft | Active compound combination |
WO2024068519A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068517A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068520A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
WO2024068518A1 (en) | 2022-09-28 | 2024-04-04 | Bayer Aktiengesellschaft | 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide |
Also Published As
Publication number | Publication date |
---|---|
WO2005054480A3 (en) | 2007-08-30 |
AR047134A1 (es) | 2006-01-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7521550B2 (en) | Insect resistant cotton plants and methods of detecting the same | |
US7371940B2 (en) | COT102 insecticidal cotton | |
AU2006254493B2 (en) | CE43- 67B, insecticidal transgenic cotton expressing CRY1AB | |
WO2005054480A2 (en) | Insect resistant cotton plants and methods of detecting the same | |
US20100024077A1 (en) | Ce44-69d insecticidal cotton | |
WO2006128569A2 (en) | 1143-14a, insecticidal transgenic cotton expressing cry1ab | |
WO2006128572A1 (en) | Ce46-02a insecticidal cotton | |
WO2006128570A1 (en) | 1143-51b insecticidal cotton | |
WO2006128568A2 (en) | T342-142, insecticidal transgenic cotton expressing cry1ab | |
RU2622079C2 (ru) | СПОСОБ ОБНАРУЖЕНИЯ ТРАНСФОРМАНТА СОИ рDAB9582.814.19.1 | |
AU2003283295B2 (en) | COT102 insecticidal cotton | |
CN101184848A (zh) | 表达cry1ab的杀昆虫转基因棉ce44-69d |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase |
Ref document number: 04797739 Country of ref document: EP Kind code of ref document: A2 |