WO2005054480A2 - Plants de coton resistant aux insectes et procedes de detection de ces derniers - Google Patents

Plants de coton resistant aux insectes et procedes de detection de ces derniers Download PDF

Info

Publication number
WO2005054480A2
WO2005054480A2 PCT/EP2004/012663 EP2004012663W WO2005054480A2 WO 2005054480 A2 WO2005054480 A2 WO 2005054480A2 EP 2004012663 W EP2004012663 W EP 2004012663W WO 2005054480 A2 WO2005054480 A2 WO 2005054480A2
Authority
WO
WIPO (PCT)
Prior art keywords
sample
seq
cot203
polynucleotide
event
Prior art date
Application number
PCT/EP2004/012663
Other languages
English (en)
Other versions
WO2005054480A3 (fr
Inventor
David Vincent Negrotto
Frank Arthur Shotkoski
Wenjin Yu
Original Assignee
Syngenta Participations Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Syngenta Participations Ag filed Critical Syngenta Participations Ag
Publication of WO2005054480A2 publication Critical patent/WO2005054480A2/fr
Publication of WO2005054480A3 publication Critical patent/WO2005054480A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance

Definitions

  • the present invention relates to genetic engineering of plants and in particular to an insect resistant transgenic cotton plant. Specifically, the invention relates to a cotton plant designated COT203 which comprises a VIP3 A gene. It also relates to methods of detecting material derived from the plant.
  • Plant pests are a major factor in the loss of the world's important agricultural crops. About $8 billion is lost every year in the U.S. due to infestations of plants by non-mammalian pests including insects. In addition to losses in field crops, insect pests are also a burden to vegetable and fruit growers, to producers of ornamental flowers, and to home gardeners.
  • Insect pests are mainly controlled by intensive applications of chemical pesticides, which are active through inhibition of insect growth, prevention of insect feeding or reproduction, or cause death. Good control of insect pests can thus be reached, but these chemicals can sometimes also affect other, beneficial insects.
  • Another problem resulting from the wide use of chemical pesticides is the appearance of resistant insect varieties. This has been partially alleviated by various resistance management practices, but there is an increasing need for alternative pest control agents.
  • Biological pest control agents such as Bacillus thuringiensis strains expressing pesticidal toxins like ⁇ -endotoxins, have also been applied to crop plants with satisfactory results, offering an alternative or compliment to chemical pesticides.
  • genes coding for some of these ⁇ -endotoxins have been isolated and their expression in heterologous hosts has been shown to provide another tool for the control of economically important insect pests.
  • insecticidal toxins such as Bacillus thuringiensis ⁇ -endotoxins in transgenic plants, has provided efficient protection against selected insect pests, and transgenic plants expressing such toxins have been commercialised, allowing farmers to reduce applications of chemical insect control agents.
  • VTPs vegetable insecticidal proteins
  • VTP3A toxins possess insecticidal activity against a wide spectrum of lepidopteran insects including but not limited to fall armyworm, Spodoptera frugiperda, black cutworm, Agrotis ipsilon, sugarcane borer, Diatraea saccharalis, and lesser cornstalk borer, Elasmopalpus lignosellus, and when expressed in transgenic plants, for example cotton, confer protection on the plant from insect feeding damage.
  • the cotton family genus Gossypium, a member of the Malvaceae, consists of 39 species, of which Gossypium hirsutum is the most commonly cultivated species. Three other species are also cultivated: G. arboreum, G. barbadense, and G. herbaceum. These cultivated species are grown primarily for the seed hairs that are made into textiles. Cotton is suitable as a textile fibre because the mature dry hairs twist in such a way that fine strong threads can be spun from them. Other products, such as cottonseed oil, cake, and cotton linters are by-products of fibre production.
  • insect pests of cotton include Beet armyworm (Spodoptera exigud), Boll weevil (Anthonomus grandis grandis), Cabbage looper (Trichoplusia ni), Clouded plant bug (Neurocolpus nubilus), Cotton aphid (Aphis gossypi ⁇ ), Cotton bollworm (Heliocoverpa zea), Cutworms (Feltia subterranea, Peridroma saucia, Agrotis ipsilon), European corn borer (Ostrinia nubilalis), Fall armyworm (Spodoptera frugiperda), Seedling thrips (Frankliniella spp.), Soybean looper (Pseudoplusia includens), Stink bugs (Nezara viridula, Acrosternum hilare, E
  • Transformation and regeneration of cotton plants is now a well-established procedure, typically based on Agrobacterium tumefaciens mediated transfer of foreign DNA into cotton plant parts and regeneration of said plant parts in tissue culture into fully fertile, transgenic cotton plants.
  • Agrobacterium tumefaciens mediated transfer of foreign DNA into cotton plant parts and regeneration of said plant parts in tissue culture into fully fertile, transgenic cotton plants.
  • An insect resistant cotton plant could reduce the need to apply chemical pesticides, which may be detrimental to other, beneficial insects and the environment.
  • COT203 event in the context of this application refers to the original insecticidal transgenic cotton plant described herein.
  • Insecticidal refers to any inhibitory effect on an insect, including but not limited to reduced feeding, retarded growth, reduced fecundity, paralysis or death.
  • Flucundity comprises all aspects related to reproduction such as reproductive ability, reproductive frequency and number of offspring.
  • any plant material derived from the COT203 event including seeds.
  • the COT203 event exhibits a novel genotype comprising at least one expression cassette.
  • the cassette comprises a suitable promoter for expression in plants operably linked to a gene that encodes a VIP3 A insecticidal toxin, useful in controlling a wide spectrum of lepidopteran insect pests, and a suitable polyadenylation signal.
  • Suitable promoters may be isolated from, inter alia, plants. Numerous plant promoters have been isolated and characterised including constitutive, switchable and/or tissue specific promoters.
  • Suitable promoters may be selected from the following, non-limiting group: CaMV35S, FMV35S, Ubiquitin, Act2, NOS, OCS, Cestrum yellow leaf curl virus promoter, Patatin, E9, alcA/alcR switch, GST switch, RMS switch, oleosin, Gelvin, ribulose bisphosphate carboxylase-oxygenase small sub-unit, actin 7, MR7 promoter (maize), Gos 9 (rice), GOS2 promoters, MasOcs (or super promoter), RolD promoter (Agrobacterium rhizogenes), SuperMAS promoter, and Suc2 promoter (Arabidopsis).
  • the promoter is the Ubiquitin promoter, UBQ3, from Arabidopsis thaliana. Additional elements such as enhancer sequences may also be incorporated into the expression cassette in order to boost levels of gene expression, for example transcriptional or translational enhancers, such as tobacco etch virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. Alternatively it may be desirable to include a targeting sequence, for example, to direct transportation of the VTP3A toxin to a particular cellular compartment. For example if it is desired to provide the protein outside of the cell then an extracellular targeting sequence may be ligated to the polynucleotide encoding the VIP protein.
  • TMV tobacco etch virus
  • targeting include targeting to a specific intracellular organelle or compartment, for example to the endoplasmic reticulum using a 'KDEL' retention sequence.
  • Numerous polyadenylation signals have been isolated and characterised. Examples of suitable polyadenylation signals functional in plants include that from the nopaline synthase gene (nos) of Agrobacterium tumefaciens, from the proteinase inhibitor II gene and from the alpha-tubulin gene (EP ⁇ A 652,286). In one embodiment of the present invention, the polyadenylation signal is that from the nos gene of Agrobacterium tumefaciens.
  • the polynucleotide encoding the VIP3A protein may also be codon-optimised or otherwise altered to enhance for example, transcription once it is incorporated into plant material.
  • codon optimisation may also be used to alter the predicted secondary structure of the RNA transcript produced in any transformed cell, or to destroy cryptic RNA instability elements present in the unaltered transcript, thereby increasing the stability and/or availability of the transcript in the transformed cell (Abler and Green (1996) Plant Molecular Biology (32) pp.63-78).
  • a second cassette that comprises a gene which, when expressed, can be used as a selectable marker.
  • selectable markers Numerous selectable markers have been characterised, including some that confer tolerance to antibiotics and others that confer tolerance to herbicides. Examples of suitable selectable marker genes include those that confer tolerance to- hygromycin, kanamycin or gentamycin. Further suitable selectable markers include genes that confer resistance to herbicides such as glyphosate- based herbicides or resistance to toxins such as eutypine. Other forms of selection are also available such as hormone based selection systems such as the Multi Auto Transformation (MAT) system of Hiroyrasu Ebinuma et al. (1997) PNAS Vol.
  • MAT Multi Auto Transformation
  • the selectable marker gene is one that confers tolerance to hygromycin.
  • This second expression cassette is useful for selecting transformants during and following plant transformation. Optionally, it may be segregated away from the COT203 event precursor after transformation to leave the COT203 event itself.
  • the COT203 event perse does not comprise a selectable marker cassette. Further expression cassettes are optionally comprised in the COT203 event. For example these may provide other desirable benefits such as herbicide resistance.
  • the expression cassettes may be introduced into the plant on the same or different plasmids. If the expression cassettes are present on the same plasmid and introduced into the plant via aaAgrobacterium-mediated transformation method, they may be present within the same or different T-DNA regions. In one embodiment of the present invention, two expression cassettes are present on different T-DNA regions within the same plasmid.
  • a polynucleotide comprising at least 17 contiguous nucleotides from the 26-nucleotide sequence of SEQ ID NO: 1.
  • said polynucleotide comprises at least 18 contiguous nucleotides from SEQ ID NO: 1.
  • said polynucleotide comprises at least 20 contiguous nucleotides from SEQ ID NO: 1.
  • said polynucleotide comprises at least 22 contiguous nucleotides from SEQ ID NO: 1.
  • said polynucleotide comprises at least 23 contiguous nucleotides from SEQ ID NO: 1.
  • polynucleotide comprises at least 24 contiguous nucleotides from SEQ ID NO: 1. In a further embodiment said polynucleotide comprises at least 25 contiguous nucleotides from SEQ ID NO: 1. In a still further embodiment there is provided a polynucleotide comprising the sequence of SEQ ID NO: 1.
  • a polynucleotide comprising at least 17 contiguous nucleotides from the 26-nucleotide sequence of SEQ ID NO: 2. In one embodiment said polynucleotide comprises at least 18 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 20 contiguous nucleotides from SEQ ID NO: 2. In a still further embodiment said polynucleotide comprises at least 22 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 23 contiguous nucleotides from SEQ ID NO: 2.
  • polynucleotide comprises at least 24 contiguous nucleotides from SEQ ID NO: 2. In a further embodiment said polynucleotide comprises at least 25 contiguous nucleotides from SEQ ID NO: 2. In a still further embodiment there is provided a polynucleotide comprising the sequence of SEQ ID NO: 2.
  • polynucleotide as described above further comprising the sequence of SEQ ID NO: 7.
  • polynucleotide as described above further comprising the sequence of SEQ ID NO: 8.
  • a plant comprising a polynucleotide which comprises at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • said plant comprises at least 18 contiguous nucleotides.of SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • said plant comprises at least 20 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • said plant comprises at least 22 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • said plant comprises at least 23 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a still further embodiment said plant comprises at least 24 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a further embodiment said plant comprises at least 25 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2. In yet a further embodiment said plant comprises the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2. In a further embodiment, said plant additionally comprises the sequence of SEQ ID NO: 7. hi a further embodiment still, said plant additionally comprises the sequence of SEQ ID NO: 8. In one embodiment of the present invention, said plant is a cotton plant. In a further embodiment, said plant is an insecticidal cotton plant which is the COT203 event, or a plant derived therefrom.
  • Agrobacterium-mediated transformation is a commonly used method for transformation of dicotyledonous plants.
  • the foreign DNA to be introduced into the plant is cloned into a binary vector in between left and right border consensus sequences. This is the T-DNA region.
  • the binary vector is transferred into an Agrobacterium cell, which is subsequently used to infect plant tissue.
  • the T-DNA region of the vector comprising the foreign DNA is inserted into the plant genome.
  • the marker gene cassette and trait gene cassette may be present on the same T-DNA region, different T-DNA regions in the same vector, or even different T-DNA regions in different vectors. In one embodiment of the present invention, the cassettes are present on different T-DNA regions in the same vector.
  • direct DNA transfer can be used to introduce the DNA directly into a plant cell.
  • One suitable method of direct transfer may be bombardment of plant cells with a vector comprising the DNA for insertion using a particle gun (particle-mediated biolistic transformation); another established method, 'whiskers', involves coating the DNA onto silicon carbide fibres onto which cells are impaled.
  • Other methods for transforming plant cells include protoplast transformation (optionally in the presence of polyethylene glycols); sonication of plant tissues, cells or protoplasts in a medium comprising the polynucleotide or vector; micro-insertion of the polynucleotide or vector into plant material (optionally employing the known silicon carbide "whiskers” technique), electroporation and the like.
  • transgenic plants Following transformation, transgenic plants must be regenerated from the transformed plant tissue, and progeny possessing the foreign DNA selected using an appropriate marker such as resistance to hygrornycin.
  • an appropriate marker such as resistance to hygrornycin.
  • the skilled man is familiar with the composition of suitable regeneration media.
  • the selectable marker can be segregated away from transgenic events by conventional plant breeding methods, thus resulting in, for example, the COT203 event.
  • a plant of the invention has an insecticidal effect on insects from one or more species from the group comprising Heliothis sp., Helicoverpa sp. and Spodoptera sp. which may infest it.
  • "Infest” as used herein refers to attack, colonisation, feeding or damage in any way by one or more insects.
  • the plant of the present invention will provide a self-defence mechanism against infestation by pest insects such as Helicoverpa zea (cotton boll worm).
  • pest insects such as Helicoverpa zea (cotton boll worm).
  • the present invention is not limited to the COT203 event itself, but is further extended to include any plant material derived therefrom, including seeds in so far as they contain at least one of the present inventive polynucleotides.
  • the present invention includes, but is not limited to plants that are derived from a breeding cross with the COT203 event or a derivative therefrom by conventional breeding or other methods.
  • the invention also includes plant material derived from the COT203 event that may comprise additional, modified or fewer polynucleotide sequences compared to the CQT203 event or exhibit other phenotypic characteristics. For example it may be desirable to transform plant material derived from the COT203 event to generate a new event that possesses an additional trait, such as a second insect resistance gene. This process is known as gene stacking.
  • the second insect resistance gene may encode, for example insecticidal lectins, insecticidal protease inhibitors and insecticidal proteins derived from species of the
  • the second insect resistance gene encodes an insecticidal gene from Bacillus thuringiensis.
  • the second insect resistance gene encodes a Cry gene from the bacterium Bacillus thuringiensis, which Cry gene produces a toxin with a different mode of action or binding site in the insect gut to VIP for the control of different insect species.
  • the Cry gene may, for example, be Cryl Ab.
  • the present invention further provides plant material derived from the COT203 event which possesses an additional trait such as herbicide resistance, nematode resistance or fungal resistance.
  • said additional trait is herbicide resistance.
  • the herbicide resistance trait may be provided, for example, by a herbicide degradation enzyme, or a target-site specific resistant enzyme.
  • said herbicide resistance trait provides resistance to a herbicide which comprises glyphosate acid or an agriculturally acceptable salt thereof.
  • said herbicide resistance trait is provided by a gene encoding EPSP synthase or a mutant thereof.
  • the present invention further provides a method of controlling insects comprising providing the COT203 event or plant material derived from the COT203 event at a locus where said insects feed.
  • the invention yet further provides a method of controlling insects comprising providing the COT203 event or plant material derived from the COT203 event at a locus where said insects feed, and applying other agrochemicals to said plant material such as herbicides, fungicides and other insecticidal compounds including other insecticidal proteins.
  • Examples of possible insecticidal compounds include insecticidal lectins, insecticidal protease inhibitors and insecticidal proteins derived from species of the Bacillus thuringiensis, Xenorhabdus nematophilus; or Photorabdus luminescens.
  • Examples of possible chemicals include pyrethroids, carbamates, imidacloprid, organochlorines, and macromolecules such as spinosad, abamectin or emamectin.
  • a method of detecting the COT203 event or plant material derived from the COT203 transgenic event comprising obtaining a sample for analysis; extracting DNA from the sample; providing a pair of primers designed to bind to a polynucleotide comprising at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2; amplifying the region which lies between the sites at which the primers bind; and detecting the presence of the amplification product.
  • Suitable pairs of primers for use in this method of detection can be designed using parameters well known to those skilled in the art of molecular biology now that SEQ ID NOs 1 and 2 are made available.
  • one or both primers of the pair may be designed to be vector-specific, trait gene specific, promoter specific, and/or specific to the sequence of the junction between the inserted DNA and the genomic DNA.
  • one of the primers is designed to be specific to the inserted sequence, and the other primer specific to the genomic DNA upstream or downstream of the insertion site, fri one embodiment, the sequence of said primers is depicted as SEQ ID NO: 19 and SEQ ID NO: 20.
  • the region amplified by said method is between 100 and 1000 base pairs in length. In a further embodiment the amplicon is between 100 and 400 base pairs in length. In a still further embodiment the amplicon is 336 base pairs in length. In a further embodiment the amplicon is produced using the above method in conjunction with the primers of the sequence of SEQ ID NO: 19 and SEQ ID NO: 20, and is 336 base pairs in length. These primers are specific for the COT203 event.
  • Alternative primers which may be used in combination to detect the COT203 event include SEQ ID NOs: 3 and 4 which produce a 341b ⁇ amplicon, SEQ ID NOs 13 and 14 which are specific for the COT203 event and produce an 84 bp amplicon, and SEQ ID NOs 5 and 6 which are specific for the VIP gene and produce a 556bp amplicon.
  • PCR polymerase chain reaction
  • An embodiment of the present invention employs variations of the PCR principle such as TaqManTM. This involves labelling at least one of the primers involved in the amplification process with a fluorescent dye. When unbound, the primer adopts a conformation such that no fluorescence can be detected. However, when the primer is bound to a piece of DNA, the conformation changes and fluorescence can be detected. In this way, the amplification process can be monitored in real-time, the intensity of fluorescence corresponding directly to the level of amplification.
  • Suitable primers for use in TaqManTM PCR are depicted as SEQ ID NOs 13 to 15. These may be used in conjunction with internal control primers such as those depicted as SEQ ID NOs 10 to 12.
  • TaqManTM analysis may be useful for example, for detecting the presence of the COT203 event in a background of wild type cotton, or for detecting the adventitious presence of COT203 in other germplasm.
  • Further embodiments of the present ' invention include, but are not limited to, RACE PCR.
  • a further embodiment of the present invention involves the use of multiplex PCR for distinguishing between homozygous COT203 plant material and heterozygous COT203 plant material.
  • This is known to those skilled in the art as zygosity testing, and involves the use of three PCR primers which bind to specific parts of the cotton genome and / or inserted DNA. The presence or absence of each of two amplification products of particular sizes indicates whether the test sample is heterozygous or homozygous for COT202. Suitable primers for use in such a zygosity test are depicted as SEQ ID NOs 16 to 18.
  • a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; providing a probe designed to bind to the complement of a polynucleotide which comprises at least 17 contiguous nucleotides of SEQ ID NO: 1 and / or SEQ ID NO: 2 when said polynucleotide is single stranded; hybridising said probe with the sample; and detecting whether the probe has hybridised.
  • said probe comprises the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2.
  • said probe comprises SEQ ID NO: 7. In a further embodiment, said probe consists of SEQ ID NO: 7. In one embodiment, said probe comprises SEQ ID NO: 8. In a further embodiment, said probe consists of SEQ ID NO: 8.
  • the probe may be, for example, a PCR product or restriction digestion fragment.
  • the probe as described herein may be tagged with a fluorescent, radioactive, enzymatic or other suitable label to enable hybridisation to be detected. The skilled man will know how to design suitable probes, now that he has the benefit of the present disclosure.
  • a method of hybridising a probe to the sample under stringent conditions and detecting whether the probe has hybridised comprising, for example: hybridisation at a temperature of about 60°C in a solution containing 6 x SSC, 0.01% SDS and 0.25% skimmed milk powder, followed by rinsing at the same temperature in a solution containing 1 x SSC and 0.1% SDS.
  • More stringent hybridisation conditions may comprise: hybridisation at a temperature of about 65 °C in a solution containing 6 x SSC, 0.01% SDS and 0.25% skimmed milk powder, followed by rinsing at the same temperature in a solution containing 0.2 x SSC and 0.1% SDS.
  • Suitable techniques for detecting plant material derived from the COT203 event based on the hybridisation principle include, but are not limited to Southern Blots, Northern Blots and in-situ hybridisation. The skilled man is familiar with techniques such as these. Typically, they involve incubating a probe with a sample, washing to remove unbound probe, and detecting whether the probe has hybridised. Said detection method is dependent on the type of tag attached to the probe - for example, a radioactively labelled probe can be detected by exposure to and development of x-ray film. Alternatively, an enzymatically labelled probe may be detected by conversion of a substrate to effect a colour change.
  • a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; providing an antibody or binding protein designed to bind to a VIP protein contained within a plant comprising at least 17 contiguous nucleotides from SEQ ID NO: 1 and / or SEQ ID NO: 2; incubating said antibody or binding protein with the sample; and detecting whether the antibody or binding protein has bound.
  • said VIP protein comprises the sequence of SEQ ID NO: 9.
  • Suitable methods of detecting plant material derived from the COT203 event based on said antibody binding include, but are not limited to Western Blots, Enzyme-Linked
  • ImmunoSorbent Assays ELISA and SELDI mass spectrometry.
  • Typical steps include incubating a sample with an antibody that binds to the VIP protein, washing to remove unbound antibody, and detecting whether the antibody has bound.
  • Many such detection methods are based on enzymatic reactions - for example the antibody may be tagged with an enzyme such as horse radish peroxidase, and on application of a suitable substrate, a colour change detected.
  • Suitable antibodies may be monoclonal or polyclonal.
  • a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; making a protein extract of the sample; providing a test strip designed to detect the presence of a VIP protein present within the sample; incubating the test strip with the sample; and detecting whether VIP protein is present.
  • said VIP protein comprises the sequence of SEQ ID NO: 9.
  • An alternative antibody-based detection method for COT203 uses of dipsticks or test strips. Typical steps include incubating a test strip with a sample and observing the presence or absence of coloured bands on the test strip. The coloured bands are indicative of the presence of a protein in the sample. Such dipstick or test strip tests are protein specific, and may be used for rapid testing of samples in the field.
  • a method of detecting plant material derived from the COT203 event comprising obtaining a sample for analysis; subjecting one or more insects of the species Spodoptera frugiperda (susceptible to VIP3A) to the sample; subjecting one or more insects of species Ostrinia nubilalis (not susceptible to VEP3 A) to the sample as a control; detecting whether the sample has an insecticidal effect on insects from each species; and comparing the results with an authentic COT203 bioassay profile.
  • the results are compared against an authentic COT203 bioassay profile that is produced using insects of the same condition (including insect age and culture conditions) which have been subjected to the same dose and type of COT203 plant material (including plant age, plant variety and tissue type) and where the insecticidal effect is detected the same length of time after subjecting the insects to the COT203 sample.
  • Detection of an insecticidal effect may be, for example, an assessment of insect mortality, or of the growth stage of the insects.
  • Spodoptera frugiperda is a positive control for COT203 as it is susceptible to a suitable dose of VIP3A
  • Ostrinia nubilalis is a negative control for COT203 as it is not susceptible to a suitable dose of VIP3 A.
  • Alternative insect species that are either susceptible or not susceptible to VIP3A may be substituted in an assay as described above as appropriate, provided that the results are compared against an authentic profile generated using the same insect species.
  • the method of detecting plant material derived from the COT203 event includes but is not limited to leaf-feeding bioassays in which a leaf or other suitable plant part from the COT203 event or any plant material derived from the COT203 event, is infested with one or more pest insects. Detection may be through assessment of damage to the leaf or plant part after set time periods, assessment of mortality or another insecticidal effect on the insects.
  • Alternative plant parts which may be used for such bioassays include bolls and squares.
  • Such bioassays may, for example, be carried out in the laboratory, field, or glasshouse, and may be subject to natural or artificial insect infestation.
  • kits of parts comprising a means for detecting the presence in a sample of plant material derived from the COT203 event.
  • said kit of parts comprises a means for detecting the presence in a sample of a polynucleotide comprising at least 17 contiguous nucleotides from the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 2, or a protein encoded by a polynucleotide as described above, or a VIP protein.
  • said kit of parts may comprise DNA amplification-detection technology such as PCR or TaqManTM.
  • said kit of parts may comprise probe hybridisation- detection technology such as Southern Blots, Northern Blots or in-situ Hybridisation.
  • said kit of parts may comprise antibody binding-detection technology such as Western Blots, ELISA's, SELDI mass spectrometry or test strips.
  • said kit of parts may comprise insect bioassay-detection technology such as leaf feeding bioassays or mortality bioassays. Each of these detection technologies may be used as described above.
  • said kit of parts may comprise any combination of the afore-mentioned detection technologies.
  • kit of parts may comprise in the form of instructions one or more of the methods described above.
  • the polynucleotides of the invention as described above for detecting the COT203 event.
  • said polynucleotides may be used in a method for detecting the COT203 event as described above.
  • SEQ ID NO 1 Polynucleotide sequence which extends across the junction where the 5' end of the COT203 insert is inserted into the cotton genome in event COT203.
  • SEQ ID NO 2 Polynucleotide sequence which extends across the junction where the 3' end of the COT203 insert is inserted into the cotton genome in event COT203.
  • SEQ ID NOs 3 - 6 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event.
  • SEQ ID NOs 7 - 8 Polynucleotide sequences suitable for use as probes in the detection of the COT203 event.
  • SEQ ID NO 9 Amino acid sequence of the VIP3A toxin protein.
  • SEQ ID NOs 10 - 15 Polynucleotide sequences suitable for use as TaqManTM primers in the detection of the COT203 event.
  • SEQ ID NOs 16 - 18 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event via zygosity testing.
  • SEQ ID NOs 19 - 20 Polynucleotide sequences suitable for use as primers in the detection of the COT203 event.
  • the vector included a selectable marker cassette comprising a Ubiquitin (UBQ3) promoter, the UBQ3 intron, a gene sequence which encodes a protein conferring resistance to hygromycin, and a nos polyadenylation sequence.
  • the vector also included the expression cassette of the target gene, which cassette comprised a Ubiquitin (UBQ3) promoter, the UBQ3 intron, a sequence encoding the VIP3A gene that had been codon optimised for expression in maize, and a nos polyadenylation sequence.
  • the selectable marker cassette and VIP3A containing cassette were cloned between the left and right border sequences within different T-DNA regions of vector pNOV103.
  • the vector also comprised a gene conferring resistance to an antibiotic, kanamycin, for prokaryotic selection.
  • the vector was transformed into Agrobacterium tumefaciens strain GV3101 using standard Agrobacterium transformation techniques, and transformed cells selected through their resistance to kanamycin.
  • 1.2 Plant transformation The COT203 event was produced by Agrobacterium-mediated transformation of Gossypium hirsutum L. cv Coker 312. Coker 312 seeds were sown in the glasshouse. Tender petioles were cut from 3 to 5 weeks old plants, and sterilized by immersion in 70% ethanol. The petioles were then immersed in a 5% Clorox + 2ml/L Tween 20 solution for 20 minutes. Petioles were washed 3 times in ddH 2 O.
  • petioles were cut off, and petioles transferred to petiole pre-culture medium (4.3g/L MS salts, 200X B5 vitamins, 30g/L glucose, 2.4g/L phytogel, pH 7.0) and allowed to pre-culture in the light at 30°C for 3 days.
  • petiole pre-culture medium 4.3g/L MS salts, 200X B5 vitamins, 30g/L glucose, 2.4g/L phytogel, pH 7.0
  • the ends were cut off the petioles and placed in 3 to 5ml of bacterial solution in a sterile petri dish. Once in the solution, the petioles were cut lengthwise and then cut into 2cm sections. After the petiole explants had soaked in bacterial solution for 5 to 10 minutes, they were transferred to co-culture plates, and allowed to co-culture at 24°C for 48 hours under low light intensity. Co-cultured explants were transferred to MMS1 medium (recipe as for MMS1 liquid medium, additionally with 2.4g/L phytogel) containing 500mg/L Cefotaxime and lOmg/L Hygromycin, and incubated at 30 °C under a light cycle of 16 hours light and 8 hours dark. Explants were transferred to fresh medium after 2 weeks, and every 4 to 6 weeks thereafter until callus was formed.
  • MMS1 medium pe as for MMS1 liquid medium, additionally with 2.4g/L phytogel
  • calli were the size of a garden pea, they were removed from the explants and transferred to fresh MMS1 medium containing 500mg/L Cefotaxime and lOmg/L Hygromycin, and maintained in tissue culture by subculturing every 4 weeks as appropriate.
  • Somatic embryos formed within 1 to 2 months. Somatic embryos were transferred to EG (embryoid germimation) medium (10X EG stock (consisting of lx 10L pack of Musashige and Skoog Modified Basal Salt Mixture (Sigma), 19g KNO3, 50ml 200X B5 vitamins, water to IL), 1 g/L glutamine, 0.5g/L asparagine, recipe), and sub-cultured to fresh EG medium every 3 to 4 weeks.
  • EG embryoid germimation
  • somatic embryos Once somatic embryos turned green and were larger than 2cm, they were plated root down in EG medium. At all stages of regeneration, growing plantlets were prevented from reaching the lids or sides of their containers. Germinated embryos with 1 to 2 true leaves were transferred to EG medium in 175ml Greiners. Strong plantlets with true leaves were transferred to sterile peat plugs expanded with dH 2 O in 175ml Greiners and transferred to a growth cabinet under conditions of 14 hours daylight at 30°C and 10 hours darkness at 20°C. Thereafter, plantlets were transplanted into pots and grown in the glasshouse.
  • Putative transgenic plants were screened by PCR for the presence of the VIP3A gene. Positive events were identified and screened using insect bioassays for insecticidal activity against Fall Armyworm (Spodoptera frugiperda) (see Example 7). Insecticidal lines were characterized for copy number by TaqManTM analysis (see Example 2). TI seed from several events were observed in a field trial for insect resistance and agronomic quality. Two events, COT202 and COT203, were chosen based on having a single copy of the transgene, good protein expression as identified by ELISA (see Example 4), good insecticidal activity against Cotton Boll Worm (Helicoverpa zed) and field performance. The hygromycin selectable marker cassette was segregated away using conventional plant breeding to result in the COT202 event and the COT203 event.
  • TaqManTM PCR reactions were setup using a standard reaction mix comprising: 5ul 2x Jumpstart Master Mix for Q-PCR (Sigma, #P2893), supplemented with . 15mM MgCl 2 and 200nM Strata-ROX 0.2ul 50x FAM primer / probe mix 0.2ul 50x VIC primer / probe mix 1.6ul Water.
  • primer / probe mixes comprised 45ul of each primer at a concentration of ImM, 50ul of the probe at a concentration of lOOuM and 860ul nuclease free water, and were stored in an amber tube at 4°C.
  • suitable primer / probe sequence combinations which were used are:
  • COT203-F TCCGGTACCGGAGCTCG.
  • SEQ ID NO: 13 Forward COT203-R AAATTACCATTTGCCCTCCTTTC
  • Reverse COT203-FAM TCTGCAGACGCGTCGACGTCATATG
  • SEQ ID NO: 15 Reverse COT203-FAM TCTGCAGACGCGTCGACGTCATATG
  • Genomic DNA from COT203 was extracted as described in Example 2.1.
  • PCR primers were designed to bind to cotton genomic DNA sequence upstream of the site at which the COT203 cassette inserted (SEQ LD NO: 16); the cotton genomic DNA sequence downstream of the site at which the COT203 cassette inserted (SEQ ID NO 17); and the COT203 cassette sequence itself (SEQ ID NO: 18).
  • a 25ul PCR reaction was set up for each sample to be tested as follows: lx JumpState ReadyMix REDTaq PCR (Sigma P-l 107) 0.5uM primer 1 (SEQ ID NO: 16) 0.5uM primer 2 (SEQ ID NO: 17) 0.5uM primer 3 (SEQ ID NO: 18) 0.2% BSA 20 ng genomic DNA ddH2O to 25ul
  • the PCR reactions were heated in a thermocycler at 94°C for 5 minutes, followed by 30 cycles as follows: 94°C for 30 seconds, 55°C for 45 seconds, 72°C for 1 minute. The reaction was completed by heating at 72°C for 5 minutes.
  • PCR reactions were run on an agarose gel, and DNA bands visualised under UV light after staining with ethidium bromide. The presence of 2 bands indicated that the sample was from a COT203 heterozygote plant; 1 band of 336bp in size indicated that the sample was from a COT203 homozygote plant; and 1 band of approximately 730bp in size indicated that the sample was from a homozygote wild type cotton plant.
  • the COT203 event can be detected in a simple PCR reaction using the primers depicted as SEQ ID NO: 19 and 20, SEQ ID NO: 3 and 4, SEQ ID NO: 13 and 14 or SEQ ID NO: 16 and 18.
  • the composition of the PCR reaction mixture is the same as described in example 3.2 above.
  • the PCR reactions are heated in a thermocycler at 94°C for 5 minutes, followed by 30 cycles as follows: 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 20 seconds. The reaction is completed by heating at 72°C for 5 minutes.
  • a DNA fragment of 336bp, 341bp, 84bp or 336bp in size respectively indicates the presence of the COT203 event.
  • Example 4 COT203 Detection via Southern Blot 4.1 DNA extraction for use in Southern Blotting Approximately 2 to 3g fresh weight of young leaf tissue was ground in a chilled mortar and pestle to a fine powder and added to 15 ml of ice-cold Nuclei extraction buffer (0.35M glucose, 0.1M Tris-HCl pH8, 50mM Na 2 EDTA, 2% Polyvinyl-pyrrolidone- 10, 0.1% ascorbic acid, 0.2% B-mercaptoethanol) in a labelled tube. The sample was incubated on ice for 15-20 minutes.
  • the tube was mixed gently and centrifuged at 2700g for 20 minutes at 4°C. The supernatant was discarded and 8ml of nuclei lysis buffer (0.14M sorbitol, 0.22M Tris-Cl pH8, 0.8M NaCl, 0.22M Na 2 EDTA, 0.8%w/v CTAB, 1% Sarkosyl, 1% Polyvinyl-pyrrolidone- 10, 0.1% ascorbic acid, 0.2% B-mercaptoethanol, 5 ⁇ g/ml proteinase K) was added. After mixing, the tubes were incubated at 65°C for 30 minutes. 10ml chloroform was added, and the tube mixed gently by inversion until an emulsion formed followed by centrifugation at 4600rpm for 10 minutes at room temperature.
  • nuclei lysis buffer 0.14M sorbitol, 0.22M Tris-Cl pH8, 0.8M NaCl, 0.22M Na 2 EDTA, 0.8%w/v CTAB, 1% Sarkosyl,
  • the aqueous layer was removed into a new tube containing 1 O ⁇ l RNase A (lOmg sigma R4642), and the tube incubated for 30 minutes at 37°C. The chloroform and centrifugation steps were repeated once.
  • the aqueous layer was removed into a new tube containing 10ml propan-2-ol. After approximately 15 minutes incubation at room temperature, a gelatinous precipitate was observed in the middle of the tube. The tube was mixed gently to precipitate out the DNA.
  • the DNA was spooled out using a sterile loop into a falcon tube containing 70% ethanol. The DNA was air-dried to remove the ethanol and resuspended in 200-400 ⁇ l TE.
  • the samples are incubated at room temperature at 4600 rpm for 10 minutes.
  • the aqueous phase is transferred to a fresh 15ml tube.
  • 0.6 volumes of cold isopropanol are added and the sample is incubated at room temperature for approximately 30 minutes.
  • the DNA is spooled out and dissolved in 500ul TE.
  • lOul of lOmg/ml RNAse are added and incubated for 15 minutes at room temperature.
  • the sample is mixed gently and centrifuged at 13000rpm for 5 min.
  • the supernatant is transferred to a fresh tube using a fine Pasteur pipette and re-extracted with chloroform: isoamyl alcohol (24:1) as above.
  • the supernatant is transferred to fresh tubes, 1/10 volume 3M NaOAc (pH4.8) added and mixed, and then one volume cold isopropanol is added.
  • the sample may be incubated at room temperature for up to 30 minutes to precipitate the DNA.
  • the DNA is spooled out and resuspended in 70% ethanol.
  • the DNA is air-dried to remove the ethanol and resuspended in 200ul water.
  • the DNA was quantified using a spectrophotometer and running out on a gel. Suitable enzyme digests were prepared using 5ug DNA per digest in a total volume of 40ul. Digests included Hindlll, Xmal, BamHI, Nhel, and Sad, both alone and in combination. In particular, a Hindlll and Xmal double digest was used to detect the intactness of the VIP3A gene; a Nhel digest was used to detect VIP3A locus number. Digests were incubated for 6 hours at the appropriate temperature for each enzyme.
  • a Southern Blot was prepared as follows: A glass plate was placed over a tray containing 20X SSC and a strip of 3M paper was placed onto the glass plate such that both ends dipped into the 20X SSC solution (to act as a wick). A piece of 3M paper the same size as the gel was placed on the wick, and the gel placed on this.
  • Strips of nescofilm were laid i around the edges of the gel to form a seal.
  • a Hybond membrane was placed on top of the gel, followed by two further pieces of 3M paper. Throughout the assembly of the blot, care was taken to ensure that no air bubbles were trapped between the membrane, gel and 3M paper.
  • a 5cm-10cm stack of absorbent paper towels was placed on top of the 3M paper and held in place with a weight.
  • a suitable DNA probe was prepared by PCR or restriction digest of binary plasmid. 25ng probe DNA in 45ul TE was boiled for 5 minutes, placed on ice for 5 minutes then transferred to a Rediprime II (Amersham Pharmacia Biotech, #RPN1633) tube. After addition of 5ul P32-labelled dCTP to the Rediprime tube, the probe was incubated at 37°C for 1 hour .
  • the probe was purified by centrifugation through a microspin G-50 column (Amersham Pharmacia Biotech, #27-5330-01) according to the manufacturers instructions to remove unincorporated dNTPs.
  • the activity of the probe was measured roughly by comparing the amount of radioactive component remaining in the column to the amount in the sample tube, with a ratio of at least 50:50 being acceptable.
  • the Hybond membrane was pre-hybridised by wetting with 40 ml pre-warmed Rapid-Hyb buffer (Amersham- Pharmacia), at 65°C for 30 minutes. The labelled probe was boiled for 5 minutes, and placed on ice for 5 minutes.
  • Extraction buffer (lOOmM Tris, lOOmM Sodium Borate, 5mM MgCl, 0.05% Tween 20, 0.2% Sodium Ascorbate, Water, pH 7.8, ImM AEBSF, O.OOlmM Leupeptin) was added to the sample in a ratio of 2:1 (volume extraction buffer : sample fresh weight) for fresh tissue or 30:1 (volume extraction buffer : sample dry weight) for lyophilised tissue.
  • the sample was vortexed and homogenised using a Brinkman PT 10/35 Polytron equipped with a PTA 10TS foam- reducing generator, until the mixture became liquefied. Extracts were centrifuged at 10,000 x g for 15 minutes. The protein extract supernatant was stored at 2-8°C.
  • the ELISA procedure used standard techniques as follows. A 96-well plate was soaked in ethanol for 2 hours, and air-dried. The plate was coated with 50ul goat anti-VIP3 A antibody per well and incubated overnight at 2-8°C. After washing three times with IX ELISA wash solution (lOOmM Tris, 0.5% Tween-20, 75mM NaCl, pH8.5), the plate was dried briefly by tapping upside down on a paper towel.
  • 150ul blocking solution (lOmM NaPO 4 , 140mM NaCl, 1% BSA, 0.02% Sodium Azide, titrated to pH7.4 with monobasic NaPi and dibasic NaPi) was added to each well followed by incubation at room temperature for 45 minutes. The plate was washed 3 times as described above.
  • VIP3A standards and protein extract samples were applied to appropriate wells of the plate in triplicate, 50ul total volume per well.
  • the plate was incubated at 2-8°C for 1 hour 30 minutes, followed by room temperature for a further 30 minutes.
  • the plate was washed three times with ELISA wash solution, and then incubated at 35-39°C for 1 hour with 50ul rabbit anti-VIP3 A antibody per well.
  • the plate was washed three times with ELISA wash solution, and incubated at room temperature for 30 minutes with 50ul donkey anti-rabbit alkaline phosphatase per well. Following a further three washes with ELISA wash solution, 50ul phosphatase substrate solution was added per well and the plate incubated for 30 minutes at room temperature.
  • Example 6 COT203 detection via DipStick 6.1 Protein extraction A piece of leaf tissue approximately 2 cm 2 was placed in a tube containing extraction buffer. A plastic stirrer was used to extract protein from the tissue, by cutting into and mascerating the tissue.
  • test strip was placed into the tube and incubated for 5 to 10 minutes for the result to develop.
  • the test strip comprised a first band at which anti-VIP3A antibody was bound, and a second band at which a control antibody was bound.
  • a double red line in the result window of the test strip indicated that VIP3A was present.
  • the lower line indicated the presence of VEP 3 A protein while the upper line was a control indicating that the assay was working correctly.
  • Leaf assays were performed on Fall Army Worm (Spodoptera frugiperda), Cotton Boll Worm (Helicoverpa zed) and Tobacco Budworm (Heliothis virescens) as follows: Pads were soaked with 300ul to 500ul distilled water and placed into Gelman dishes. Leaf pieces measuring between approximately 0.5 square inches and 0.75 square inches were excised from cotton plants 8 to 12 inches in height, and placed on the pads. Between 8 and 10 insect larvae were placed in each dish and a lid fitted. The dishes were incubated at 28°C. On the third and sixth days after infestation, damage to the leaf in each dish was scored and compared with the control plants.
  • the experiment was incubated at room temperature for approximately 3 weeks. The bolls were then cut open to determine damage. Damage to the boll was compared to the control samples.
  • Terminal leaves were snap-frozen on dry-ice at time of picking and lyophilised overnight.
  • the freeze dried tissue was ground in a mortar and pestle to a fine powder and resuspended in 0.2% agar solution to make an 8% (0.08g/ml) suspension of leaf powder.
  • the suspension was overlaid on top of artificial insect diet in 96-well plates and left to dry. A single neonate insect larva was introduced into each well and the plates sealed. The plates were incubated at 28°C. On the sixth day after infestation, larval mortality was scored and compared with control samples.
  • Example 8 COT203 Field Trials 8.1 Field trial design
  • the efficacy of the COT203 event against Heliothis virescens (Tobacco Bud Worm) and Helicoverpa zea (Cotton Boll Worm) was tested by conducting field trials at three locations in the US, namely Leland (MS), Quitman (GA) and Beasley (TX). Trials in each location were set up using a randomised complete block design, with four entry plots comprising four rows of 40 feet in length and four repetitions per trial. Seed was planted to obtain a plant stand of approximately 3 plants per foot of row length.
  • Each field trial included non transgenic Coker 312 plants for control purposes, and two other transgenic events designated event A and event B for comparison purposes.

Abstract

La présente invention concerne un plant de coton transgénique résistant aux insectes et se rapporte notamment à un événement spécifique appelé COT203. Cette invention concerne également des polynucléotides qui sont caractéristiques de l'événement COT203, des plants comprenant lesdits polynucléotides et des procédés de détection de l'événement COT203.
PCT/EP2004/012663 2003-12-01 2004-11-09 Plants de coton resistant aux insectes et procedes de detection de ces derniers WO2005054480A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US52612003P 2003-12-01 2003-12-01
US60/526,120 2003-12-01

Publications (2)

Publication Number Publication Date
WO2005054480A2 true WO2005054480A2 (fr) 2005-06-16
WO2005054480A3 WO2005054480A3 (fr) 2007-08-30

Family

ID=34652418

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2004/012663 WO2005054480A2 (fr) 2003-12-01 2004-11-09 Plants de coton resistant aux insectes et procedes de detection de ces derniers

Country Status (2)

Country Link
AR (1) AR047134A1 (fr)
WO (1) WO2005054480A2 (fr)

Cited By (202)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011076885A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes à des herbicides inhibiteurs de hppd
WO2011076877A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
WO2011076892A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
WO2011076882A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes à des herbicides inhibiteurs de la hppd
WO2011076889A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
EP2453012A1 (fr) 2010-11-10 2012-05-16 Bayer CropScience AG Variants de HPPD et procédés d'utilisation
WO2012072696A1 (fr) 2010-12-01 2012-06-07 Bayer Cropscience Ag Combinaison de principes actifs contenant des pyridyléthylbenzamides et d'autres principes actifs
WO2012072660A1 (fr) 2010-12-01 2012-06-07 Bayer Cropscience Ag Utilisation de fluopyram pour la lutte contre les nématodes dans des plantes cultivées et pour l'augmentation du rendement
WO2012072489A1 (fr) 2010-11-29 2012-06-07 Bayer Cropscience Ag Imine alpha-bêta insaturée
WO2012120105A1 (fr) 2011-03-10 2012-09-13 Bayer Cropscience Ag Utilisation de composés de lipochito-oligosaccharide pour la protection des graines traitées
WO2012126938A2 (fr) 2011-03-23 2012-09-27 Bayer Cropscience Ag Combinaisons de composés actifs
WO2012130684A1 (fr) 2011-03-25 2012-10-04 Bayer Cropscience Ag Utilisation de n-(1,2,5-oxadiazol-3-yl)benzamides pour lutter contre les plantes indésirables dans des zones de plantes cultivées transgéniques développant une tolérance aux herbicides inhibiteurs de la hppd
WO2012130685A1 (fr) 2011-03-25 2012-10-04 Bayer Cropscience Ag L'utilisation de n-(tétrazol-4-yl)- ou n-(triazol-3-yl)arylcarboxamides ou de leurs sels pour lutter contre les plantes indésirables dans des zones de plantes cultivées transgéniques développant une tolérance aux herbicides inhibiteurs de la hppd
WO2012136581A1 (fr) 2011-04-08 2012-10-11 Bayer Cropscience Ag Dérivés fongicides d'hydroximoyl-tétrazole
WO2012171914A1 (fr) 2011-06-14 2012-12-20 Bayer Intellectual Property Gmbh Utilisation d'un composé de type énaminocarbonyle en association avec un agent de lutte biologique
EP2561759A1 (fr) 2011-08-26 2013-02-27 Bayer Cropscience AG 2-amidobenzimidazoles fluoroalkyl substitués et leur effet sur la croissance des plantes
WO2013026740A2 (fr) 2011-08-22 2013-02-28 Bayer Cropscience Nv Procédés et moyens pour modifier un génome de plante
WO2013037956A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation de 5-phényl- ou de 5-benzyl-2 isoxazoline-3 carboxylates pour améliorer le rendement de végétaux
WO2013037717A1 (fr) 2011-09-12 2013-03-21 Bayer Intellectual Property Gmbh Dérivés de 3-{phényl[(hétérocyclylméthoxy)imino]méthyl}-1,2,4-oxadizol-5(4h)-one 4-substituée fongicides
WO2013037958A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation de phénylpyrazoline-3-carboxylates pour améliorer le rendement de végétaux
WO2013037955A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation d'acylsulfonamides pour améliorer le rendement de végétaux
WO2013050410A1 (fr) 2011-10-04 2013-04-11 Bayer Intellectual Property Gmbh Arni pour la lutte contre des champignons et oomycètes par inhibition du gène de la saccharopine déshydrogénase
WO2013075817A1 (fr) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Dérivés fongicides du n-[(silyle trisubstitué)méthyle]carboxamide
WO2013079566A2 (fr) 2011-11-30 2013-06-06 Bayer Intellectual Property Gmbh Dérivés (n-bicycloakyl et n-tricycloalkyl)(thio)carboxamides fongicides
WO2013092519A1 (fr) 2011-12-19 2013-06-27 Bayer Cropscience Ag Utilisation de dérivés de diamide d'acide anthranilique pour lutter contre les organismes nuisibles dans des cultures transgéniques
WO2013098147A1 (fr) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Dérivés fongicides de 3-[(pyridin-2-ylméthoxyimino)(phényl)méthyl]-2-substitué-1,2,4-oxadiazol-5(2h)-one
WO2013098146A1 (fr) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Dérivés fongicides de 3-[(1,3-thiazol-4-ylméthoxyimino)(phényl)méthyl]-2-substitué-1,2,4-oxadiazol-5(2h)-one
WO2013110591A1 (fr) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Combinaison de composés actifs contenant du fluopyrame, un bacille et un agent de lutte biologique
WO2013110594A1 (fr) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Associations de composés actifs contenant du fluopyrame et un agent de lutte biologique
WO2013127704A1 (fr) 2012-02-27 2013-09-06 Bayer Intellectual Property Gmbh Associations de composés actifs contenant une thiazoylisoxazoline et un fongicide
WO2013139949A1 (fr) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprenant un composé de strigolactame pour la croissance et le rendement accrus de plantes
WO2013153143A1 (fr) 2012-04-12 2013-10-17 Bayer Cropscience Ag N-acyl-2-(cyclo)alkylpyrrolidines et pipéridines utiles en tant que fongicides
WO2013156560A1 (fr) 2012-04-20 2013-10-24 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(silylphényle trisubstitué) méthylène]-(thio)carboxamide
WO2013156559A1 (fr) 2012-04-20 2013-10-24 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(hétérocyclylphényl)méthylène]-(thio)carboxamide
EP2662364A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides tétrahydronaphtyles de pyrazole
EP2662360A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles 5-halogenopyrazoles
EP2662362A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles de pyrazole
EP2662363A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Biphénylcarboxamides 5-halogenopyrazoles
EP2662361A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles de pyrazole
EP2662370A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides de benzofuranyle 5-halogenopyrazole
WO2013167544A1 (fr) 2012-05-09 2013-11-14 Bayer Cropscience Ag 5-halogénopyrazole indanyle carboxamides
WO2013167545A1 (fr) 2012-05-09 2013-11-14 Bayer Cropscience Ag Pyrazole indanyle carboxamides
WO2013174836A1 (fr) 2012-05-22 2013-11-28 Bayer Cropscience Ag Combinaisons de composés actifs comprenant un dérivé de lipochitooligosaccharide et un composé nématicide, insecticide ou fongicide
WO2014019983A1 (fr) 2012-07-31 2014-02-06 Bayer Cropscience Ag Compositions contenant un mélange terpénique pesticide et un insecticide
WO2014043435A1 (fr) 2012-09-14 2014-03-20 Bayer Cropscience Lp Variants hppd et leurs procédés d'utilisation
EP2719280A1 (fr) 2012-10-11 2014-04-16 Bayer CropScience AG Utilisation de dérivés de carboxamide N-phenylethylpyrazole ou des sels de ceux-ci pour le management de la résistance des fungi phytopathogènes
WO2014060518A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé permettant de favoriser la croissance des plantes à l'aide de dérivés carboxamide
WO2014060502A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Combinaisons de composés actifs comprenant des dérivés carboxamide
WO2014060519A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé d'amélioration de la tolérance des plantes aux stress abiotiques à l'aide de dérivés carboxamide ou thiocarboxamide
WO2014060520A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé de traitement de plantes contre des champignons résistants aux fongicides à l'aide de dérivés de carboxamide ou de thiocarboxamide
EP2735231A1 (fr) 2012-11-23 2014-05-28 Bayer CropScience AG Combinaisons de composés actifs
WO2014083088A2 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides binaires
WO2014083031A2 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges binaires pesticides et fongicides
WO2014083089A1 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides et pesticides ternaires
WO2014083033A1 (fr) 2012-11-30 2014-06-05 Bayer Cropsience Ag Mélange fongicide ou pesticide binaire
WO2014082950A1 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides ternaires
WO2014086759A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant des agents de lutte biologique
WO2014086753A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant des agents de lutte biologique
WO2014086747A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086758A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014086748A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086764A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086750A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014086749A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014090765A1 (fr) 2012-12-12 2014-06-19 Bayer Cropscience Ag Utilisation de 1-[2-fluoro-4-méthyle-5-(2,2,2- trifluoroéthylsulfinyl)phényl]-5-amino-3-trifluorométhyl)-1 h-1,2,4 tfia zole à des fins de régulation des nématodes dans les cultures résistantes aux nématodes
WO2014095826A1 (fr) 2012-12-18 2014-06-26 Bayer Cropscience Ag Combinaisons binaires fongicides et bactéricides
WO2014095677A1 (fr) 2012-12-19 2014-06-26 Bayer Cropscience Ag Carboxamides difluorométhyl-nicotinique-tétrahydronaphtyle
WO2014124375A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant de la gougérotine et un agent de lutte biologique
WO2014124369A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant un agent de lutte biologique à base de streptomyces et un fongicide
WO2014124373A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant de la gougérotine et un insecticide
WO2014138339A2 (fr) 2013-03-07 2014-09-12 Athenix Corp. Gènes de toxine et leurs procédés d'utilisation
WO2014170364A1 (fr) 2013-04-19 2014-10-23 Bayer Cropscience Ag Mélange insecticide ou pesticide binaire
WO2014170345A2 (fr) 2013-04-19 2014-10-23 Bayer Cropscience Ag Procédé pour l'utilisation améliorée du potentiel de production de plantes transgéniques
WO2014177514A1 (fr) 2013-04-30 2014-11-06 Bayer Cropscience Ag Phénéthylcarboxamides n-substitués nématicides
WO2014177582A1 (fr) 2013-04-30 2014-11-06 Bayer Cropscience Ag N-(2-fluoro-2-phénéthyl)carboxamides en tant que nématocides et endoparasiticides
WO2014206953A1 (fr) 2013-06-26 2014-12-31 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(bicyclylphényl)méthylène]-(thio)carboxamide
WO2015082586A1 (fr) 2013-12-05 2015-06-11 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-{[2- (cycloalkyl-1-substitué)phényl]méthylène}-(thio)carboxamide
WO2015082587A1 (fr) 2013-12-05 2015-06-11 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-{[2- (cycloalkyl-1-substitué)phényl]méthylène}-(thio)carboxamide
EP2885970A1 (fr) 2013-12-21 2015-06-24 Bayer CropScience AG Compositions fongicides comportant un composé I, au moins un inhibiteur de déshydrogénase de la succinate (SDH) et au moins un fongicide de triazole
WO2015138394A2 (fr) 2014-03-11 2015-09-17 Bayer Cropscience Lp Variants hppd et leurs procédés d'utilisation
WO2015160620A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un insecticide
WO2015160619A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un fongicide
WO2015160618A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un agent de lutte biologique
EP2997825A1 (fr) 2011-04-22 2016-03-23 Bayer Intellectual Property GmbH Combinaisons de composés actifs comprenant un dérivé de (thio)carboxamide et un composé fongicide
EP3081085A1 (fr) 2015-04-14 2016-10-19 Bayer CropScience AG Procédé d'amélioration de précocité dans le coton
WO2016166077A1 (fr) 2015-04-13 2016-10-20 Bayer Cropscience Aktiengesellschaft Dérivés de n-cycloalkyle-n-(bihétérocyclyléthylène)-(thio)carboxamide
EP3097782A1 (fr) 2015-05-29 2016-11-30 Bayer CropScience Aktiengesellschaft Procédés de régulation de nématodes phytopathogènes par combinaison du fluopyram et de biopesticides
WO2017042259A1 (fr) 2015-09-11 2017-03-16 Bayer Cropscience Aktiengesellschaft Variants de la hppd et procédé d'utilisation
EP3205210A1 (fr) 2012-05-30 2017-08-16 Bayer CropScience Aktiengesellschaft Compositions contenant un agent de lutte biologique et un fongicide appartenant au groupe constitué des inhibiteurs de la succinate déshydrogénase
WO2017182420A1 (fr) 2016-04-20 2017-10-26 Bayer Cropscience Nv Événement élite ee-gh7, procédés et kits d'identification de cet événement dans des échantillons biologiques
EP3243387A2 (fr) 2012-05-30 2017-11-15 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un insecticide
WO2018019676A1 (fr) 2016-07-29 2018-02-01 Bayer Cropscience Aktiengesellschaft Combinaisons de composés actifs et procédés pour protéger le matériau de propagation des plantes
EP3281526A1 (fr) 2012-05-30 2018-02-14 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3292764A2 (fr) 2012-05-30 2018-03-14 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide de la groupe des inhibiteurs de la chaine respiratoire au complexe iii
EP3300603A2 (fr) 2012-05-30 2018-04-04 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3318128A2 (fr) 2012-05-30 2018-05-09 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
WO2018098214A1 (fr) 2016-11-23 2018-05-31 Bayer Cropscience Lp Gènes de toxines axmi669 et axmi991 et procédés d'utilisation de ceux-ci
WO2018119336A1 (fr) 2016-12-22 2018-06-28 Athenix Corp. Utilisation de cry14 dans la lutte contre les nématodes parasites
WO2018136611A1 (fr) 2017-01-18 2018-07-26 Bayer Cropscience Lp Utilisation de bp005 pour lutter contre des pathogènes végétaux
WO2018136604A1 (fr) 2017-01-18 2018-07-26 Bayer Cropscience Lp Gène de toxine bp005 et ses procédés d'utilisation
EP3360418A1 (fr) 2012-05-30 2018-08-15 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3363289A2 (fr) 2012-05-30 2018-08-22 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un insecticide
WO2018165091A1 (fr) 2017-03-07 2018-09-13 Bayer Cropscience Lp Variants de la hppd et leurs procédés d'utilisation
WO2018195256A1 (fr) 2017-04-21 2018-10-25 Bayer Cropscience Lp Procédé d'amélioration de sécurité de culture
WO2019068811A1 (fr) 2017-10-06 2019-04-11 Bayer Aktiengesellschaft Compositions comprenant du fluopyrame et du tioxazafène
WO2019083808A1 (fr) 2017-10-24 2019-05-02 Basf Se Amélioration de la tolérance aux herbicides vis-à-vis d'inhibiteurs de hppd par régulation à la baisse des 4-hydroxyphénylpyruvate réductases putatives dans le soja
WO2019083810A1 (fr) 2017-10-24 2019-05-02 Basf Se Amélioration de la tolérance aux herbicides pour des inhibiteurs de la 4-hydroxyphénylpyruvate dioxygénase (hppd) par la régulation négative de l'expression de hppd dans le soja
WO2019233863A1 (fr) 2018-06-04 2019-12-12 Bayer Aktiengesellschaft Benzoylpyrazoles bicycliques utilisés comme herbicide
EP3701796A1 (fr) 2019-08-08 2020-09-02 Bayer AG Combinaisons de composés actifs
EP3708565A1 (fr) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphénylamidines et leur utilisation comme fongicides
WO2020231751A1 (fr) 2019-05-10 2020-11-19 Bayer Cropscience Lp Combinaisons de composés actifs
WO2021013721A1 (fr) 2019-07-22 2021-01-28 Bayer Aktiengesellschaft Triazoles et pyrazoles à substitution 5-amino utilisés comme pesticides
WO2021013720A1 (fr) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021013719A1 (fr) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021022069A1 (fr) 2019-08-01 2021-02-04 Bayer Cropscience Lp Procédé d'amélioration de la tolérance au stress dû au froid et de l'innocuité des cultures
WO2021058659A1 (fr) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Lutte contre les nuisibles induite par arni
WO2021064075A1 (fr) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Combinaisons de composés actifs comprenant des acides gras
WO2021069569A1 (fr) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
WO2021069567A1 (fr) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021089673A1 (fr) 2019-11-07 2021-05-14 Bayer Aktiengesellschaft Sulfonyl amides substitués pour lutter contre des animaux nuisibles
WO2021097162A1 (fr) 2019-11-13 2021-05-20 Bayer Cropscience Lp Combinaisons bénéfiques contenant paenibacillus
WO2021099303A1 (fr) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021099271A1 (fr) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Combinaisons de composés actifs comprenant des acides gras
WO2021105091A1 (fr) 2019-11-25 2021-06-03 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
US11066424B2 (en) 2018-08-18 2021-07-20 Boragen, Inc. Solid forms of substituted benzoxaborole and compositions thereof
WO2021155084A1 (fr) 2020-01-31 2021-08-05 Pairwise Plants Services, Inc. Suppression de la réponse d'évitement d'ombre dans des plantes
WO2021165195A1 (fr) 2020-02-18 2021-08-26 Bayer Aktiengesellschaft Composés hétéroaryle-triazole utilisés comme pesticides
WO2021211926A1 (fr) 2020-04-16 2021-10-21 Pairwise Plants Services, Inc. Procédés permettant de contrôler la taille du méristème pour améliorer les cultures
WO2021209490A1 (fr) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephénylaminoquinoléines utiles en tant que fongicides
WO2021213978A1 (fr) 2020-04-21 2021-10-28 Bayer Aktiengesellschaft Dérivés hétérocycliques condensés à substitution 2- (het) aryle utilisés comme agents de lutte contre les organismes nuisibles
WO2021224220A1 (fr) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Pyridine (thio)amides en tant que composés fongicides
WO2021224323A1 (fr) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
WO2021228734A1 (fr) 2020-05-12 2021-11-18 Bayer Aktiengesellschaft (thio)amides de triazine et de pyrimidine utilisés comme composés fongicides
WO2021233861A1 (fr) 2020-05-19 2021-11-25 Bayer Aktiengesellschaft (thio)amides azabicycliques en tant que composés fongicides
EP3915971A1 (fr) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phényl-s(o)n-phénylamidines et leur utilisation comme fongicides
WO2021247477A1 (fr) 2020-06-02 2021-12-09 Pairwise Plants Services, Inc. Procédés de régulation de la taille du méristème pour l'amélioration des cultures
WO2021245087A1 (fr) 2020-06-04 2021-12-09 Bayer Aktiengesellschaft Hétérocyclyl pyrimidines et triazines en tant que nouveaux fongicides
WO2021249995A1 (fr) 2020-06-10 2021-12-16 Bayer Aktiengesellschaft Hétérocycles à substitution azabicyclyle utilisés comme fongicides
WO2021255071A1 (fr) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Dérivés de 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine utilisés comme fongicides pour la protection des cultures
WO2021255169A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines en tant que fongicides
WO2021255089A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines et 1,3,4-oxadiazole pyridines utilisées comme fongicides
WO2021255170A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines en tant que fongicides
WO2021255091A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazoles et leurs dérivés comme fongicides
WO2021257775A1 (fr) 2020-06-17 2021-12-23 Pairwise Plants Services, Inc. Procédés de régulation de la taille de méristème pour l'amélioration des cultures
WO2021255118A1 (fr) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Composition destinée à être utilisée en agriculture
EP3929189A1 (fr) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Nouveaux dérivés de pyrazine hétéroaryle substitués utilisés en tant que pesticides
WO2022002818A1 (fr) 2020-07-02 2022-01-06 Bayer Aktiengesellschaft Dérivés d'hétérocyclène utiles en tant qu'agents de lutte contre les nuisibles
WO2022033991A1 (fr) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft Triazoles à substitution 5-amino utilisés en tant qu'agents de lutte contre les nuisibles
WO2022053453A1 (fr) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide servant d'agents de lutte contre les nuisibles
WO2022058327A1 (fr) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Urées et dérivés substitués en tant que nouveaux agents antifongiques
EP3974414A1 (fr) 2020-09-25 2022-03-30 Bayer AG Pyrazoles et triazoles substitués par un 5-amino en tant que pesticides
WO2022129196A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazoles substitués par hétérobicycle utilisés en tant que fongicides
WO2022129200A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Utilisation d'un inhibiteur de la dhodh pour lutter contre des champignons phytopathogènes résistants dans des cultures
WO2022129190A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazoles substitués par (hétéro)aryle utilisés comme fongicides
WO2022129188A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines en tant que fongicides
CN114807121A (zh) * 2022-04-26 2022-07-29 广西特色作物研究院 一种柑橘dna快速提取方法
EP4036083A1 (fr) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft Hétéréocycles substitués de 5-oxy en tant que pesticides
WO2022173885A1 (fr) 2021-02-11 2022-08-18 Pairwise Plants Services, Inc. Procédés et compositions pour modifier les niveaux de cytokinine oxydase dans des plantes
WO2022182834A1 (fr) 2021-02-25 2022-09-01 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'architecture racinaire chez des plantes
WO2022207496A1 (fr) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole en tant que fongicide
WO2022207494A1 (fr) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole en tant que fongicide
WO2022233777A1 (fr) 2021-05-06 2022-11-10 Bayer Aktiengesellschaft Imidazoles annelés substitués par alkylamide et leur utilisation comme insecticides
WO2022238391A1 (fr) 2021-05-12 2022-11-17 Bayer Aktiengesellschaft Dérivés hétérocycliques condensés à substitution 2-(het)aryle utilisés comme agents de lutte antiparasitaire
WO2022266271A1 (fr) 2021-06-17 2022-12-22 Pairwise Plants Services, Inc. Modification de facteurs de transcription de la famille des facteurs de régulation de la croissance dans le soja
WO2022271892A1 (fr) 2021-06-24 2022-12-29 Pairwise Plants Services, Inc. Modification des gènes de l'ubiquitine ligase e3 hect pour améliorer les caractéristiques liées au rendement
WO2023278651A1 (fr) 2021-07-01 2023-01-05 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer le développement de système racinaire
WO2023017120A1 (fr) 2021-08-13 2023-02-16 Bayer Aktiengesellschaft Combinaisons de composés actifs et compositions fongicides comprenant celles-ci
WO2023019188A1 (fr) 2021-08-12 2023-02-16 Pairwise Plants Services, Inc. Modification de gènes du récepteur des brassinostéroïdes pour améliorer des caractéristiques de rendement
WO2023023496A1 (fr) 2021-08-17 2023-02-23 Pairwise Plants Services, Inc. Procédés et compositions pour modifier les gènes de l'histidine kinase du récepteur de la cytokinine dans des plantes
WO2023025682A1 (fr) 2021-08-25 2023-03-02 Bayer Aktiengesellschaft Nouveaux composés de pyrazinyle-triazole utilisés comme pesticides
EP4144739A1 (fr) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Pyrazoles annelés en tant que produit pesticide
WO2023034891A1 (fr) 2021-09-02 2023-03-09 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer l'architecture des plantes et les caractéristiques de rendement
WO2023034731A1 (fr) 2021-08-30 2023-03-09 Pairwise Plants Services, Inc. Modification de gènes de peptidase de liaison à l'ubiquitine dans des plantes pour améliorer des caractéristiques de rendement
WO2023049720A1 (fr) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Procédés et compositions pour réduire l'éclatement de la cosse dans le canola
WO2023060152A2 (fr) 2021-10-07 2023-04-13 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleron et du rendement des graines
WO2023060028A1 (fr) 2021-10-04 2023-04-13 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleuron et du rendement en graines
WO2023078915A1 (fr) 2021-11-03 2023-05-11 Bayer Aktiengesellschaft Bis(hétéro)aryl thioéther (thio)amides utiles en tant que composés fongicides
WO2023099445A1 (fr) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hétéro)aryl thioéther oxadiazines utilisées en tant que composés fongicides
WO2023108035A1 (fr) 2021-12-09 2023-06-15 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleuron et du rendement en graines
WO2023147526A1 (fr) 2022-01-31 2023-08-03 Pairwise Plants Services, Inc. Suppression de la réponse d'évitement d'ombre dans des plantes
WO2023148028A1 (fr) 2022-02-01 2023-08-10 Globachem Nv Procédés et compositions pour lutter contre les animaux nuisibles
WO2023148031A1 (fr) 2022-02-01 2023-08-10 Globachem Nv Procédés et compositions pour lutter contre les nuisibles dans le coton
WO2023168217A1 (fr) 2022-03-02 2023-09-07 Pairwise Plants Services, Inc. Modification de gènes récepteurs de brassinostéroïdes pour améliorer des caractéristiques de rendement
WO2023192838A1 (fr) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Plantes rosacées à floraison précoce présentant des caractéristiques améliorées
WO2023196886A1 (fr) 2022-04-07 2023-10-12 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer la résistance à la fusariose de l'épi
WO2023205714A1 (fr) 2022-04-21 2023-10-26 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractéristiques de rendement
WO2023215809A1 (fr) 2022-05-05 2023-11-09 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'architecture racinaire et/ou améliorer des propriétés de rendement de plantes
WO2023215704A1 (fr) 2022-05-02 2023-11-09 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer le rendement et la résistance aux maladies
WO2023213626A1 (fr) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Utilisation de (5s)-3-[3-(3-chloro-2-fluorophénoxy)-6-méthylpyridazin-4-yl]-5-(2-chloro-4-méthylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine pour lutter contre des micro-organismes indésirables
WO2023213670A1 (fr) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Formes cristallines de (5s)-3-[3-(3-chloro-2-fluorophénoxy)-6-méthylpyridazin-4-yl]-5-(2-chloro-4-méthylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine
US11834466B2 (en) 2017-11-30 2023-12-05 5Metis, Inc. Benzoxaborole compounds and formulations thereof
EP4295688A1 (fr) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Combinaison de composés actifs
WO2024006791A1 (fr) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions permettant de réguler la taille du méristème pour améliorer les cultures
WO2024006679A1 (fr) 2022-06-27 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'évitement de l'ombre dans des plantes
WO2024006792A1 (fr) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions permettant de réguler la taille du méristème pour améliorer les cultures
WO2024030984A1 (fr) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractères de rendement
WO2024036240A1 (fr) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Procédés et compositions pour réguler la taille des méristèmes pour l'amélioration des cultures
WO2024054880A1 (fr) 2022-09-08 2024-03-14 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractéristiques de rendement dans des végétaux
WO2024068517A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068518A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-hétéroaryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068519A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068520A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044137A2 (fr) * 1997-04-03 1998-10-08 Novartis Ag Lutte contre des ennemis des plantes
WO2002078437A2 (fr) * 2001-03-30 2002-10-10 Syngenta Participations Ag Nouvelles toxines pesticides
WO2003075655A2 (fr) * 2002-03-06 2003-09-18 Syngenta Participation Ag Nouvelles toxines vip3 et leurs procedes d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998044137A2 (fr) * 1997-04-03 1998-10-08 Novartis Ag Lutte contre des ennemis des plantes
WO2002078437A2 (fr) * 2001-03-30 2002-10-10 Syngenta Participations Ag Nouvelles toxines pesticides
WO2003075655A2 (fr) * 2002-03-06 2003-09-18 Syngenta Participation Ag Nouvelles toxines vip3 et leurs procedes d'utilisation

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [Online] 4 July 2001 (2001-07-04), "Homo sapiens chromosome 5 clone RP11-19O2, complete sequence." XP002319568 retrieved from EBI accession no. EM_PRO:AC092335 Database accession no. AC092335 *
LIAO CHUNYAN ET AL: "Toxicity of Bacillus thuringiensis insecticidal proteins for Helicoverpa armigera and Helicoverpa punctigera (Lepidoptera: Noctuidae), major pests of cotton" JOURNAL OF INVERTEBRATE PATHOLOGY, SAN DIEGO, CA, US, vol. 80, no. 1, May 2002 (2002-05), pages 55-63, XP002273074 ISSN: 0022-2011 *
MOAR WILLIAM J: "Breathing new life into insect-resistant plants." NATURE BIOTECHNOLOGY. OCT 2003, vol. 21, no. 10, October 2003 (2003-10), pages 1152-1154, XP002319567 ISSN: 1087-0156 *
SHOTKOSKI, FRANK ET AL: "Vip: a novel insecticidal protein with broad spectrum lepidopteran activity" PROCEEDINGS - BELTWIDE COTTON CONFERENCES 89-93 CODEN: PCOCEN; ISSN: 1059-2644, January 2003 (2003-01), XP009044606 *

Cited By (236)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011076885A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes à des herbicides inhibiteurs de hppd
WO2011076877A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
WO2011076892A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
WO2011076882A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes à des herbicides inhibiteurs de la hppd
WO2011076889A1 (fr) 2009-12-23 2011-06-30 Bayer Cropscience Ag Plantes tolérantes aux herbicides inhibiteurs de hppd
EP2669371A1 (fr) 2010-11-10 2013-12-04 Bayer CropScience AG Variants de HPPD et procédés dýutilisation
EP2669372A1 (fr) 2010-11-10 2013-12-04 Bayer CropScience AG Variants de HPPD et procédés d'utilisation
EP2453012A1 (fr) 2010-11-10 2012-05-16 Bayer CropScience AG Variants de HPPD et procédés d'utilisation
EP2669373A1 (fr) 2010-11-10 2013-12-04 Bayer CropScience AG Variants de HPPD et procédés d'utilisation
EP2669369A1 (fr) 2010-11-10 2013-12-04 Bayer CropScience AG Variants de HPPD et procédés dýutilisation
EP2669370A1 (fr) 2010-11-10 2013-12-04 Bayer CropScience AG Variants de HPPD et procédés d'utilisation
US9055743B2 (en) 2010-11-29 2015-06-16 Bayer Intellectual Property Gmbh Alpha, beta-unsaturated imines
WO2012072489A1 (fr) 2010-11-29 2012-06-07 Bayer Cropscience Ag Imine alpha-bêta insaturée
WO2012072696A1 (fr) 2010-12-01 2012-06-07 Bayer Cropscience Ag Combinaison de principes actifs contenant des pyridyléthylbenzamides et d'autres principes actifs
WO2012072660A1 (fr) 2010-12-01 2012-06-07 Bayer Cropscience Ag Utilisation de fluopyram pour la lutte contre les nématodes dans des plantes cultivées et pour l'augmentation du rendement
EP3103338A1 (fr) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Combinaisons de substance actives comprenant du pyridyléthylbenzamide et d'autres substances actives
EP3103339A1 (fr) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Combinaisons de substance actives comprenant du pyridyléthylbenzamide et d'autres substances actives
EP3103334A1 (fr) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Combinaisons de substance actives comprenant du pyridyléthylbenzamide et d'autres substances actives
EP3103340A1 (fr) 2010-12-01 2016-12-14 Bayer Intellectual Property GmbH Combinaisons de substance actives comprenant du pyridyléthylbenzamide et d'autres substances actives
EP3092900A1 (fr) 2010-12-01 2016-11-16 Bayer Intellectual Property GmbH Combinaison de principes actifs contenant des pyridyléthylbenzamides et d'autres principes actifs
WO2012120105A1 (fr) 2011-03-10 2012-09-13 Bayer Cropscience Ag Utilisation de composés de lipochito-oligosaccharide pour la protection des graines traitées
EP3292761A1 (fr) 2011-03-23 2018-03-14 Bayer Intellectual Property GmbH Combinaisons de composés actifs
WO2012126938A2 (fr) 2011-03-23 2012-09-27 Bayer Cropscience Ag Combinaisons de composés actifs
EP3295797A1 (fr) 2011-03-23 2018-03-21 Bayer Intellectual Property GmbH Combinaisons de composés actifs
EP3292760A1 (fr) 2011-03-23 2018-03-14 Bayer Intellectual Property GmbH Combinaisons de composés actifs
WO2012130684A1 (fr) 2011-03-25 2012-10-04 Bayer Cropscience Ag Utilisation de n-(1,2,5-oxadiazol-3-yl)benzamides pour lutter contre les plantes indésirables dans des zones de plantes cultivées transgéniques développant une tolérance aux herbicides inhibiteurs de la hppd
WO2012130685A1 (fr) 2011-03-25 2012-10-04 Bayer Cropscience Ag L'utilisation de n-(tétrazol-4-yl)- ou n-(triazol-3-yl)arylcarboxamides ou de leurs sels pour lutter contre les plantes indésirables dans des zones de plantes cultivées transgéniques développant une tolérance aux herbicides inhibiteurs de la hppd
WO2012136581A1 (fr) 2011-04-08 2012-10-11 Bayer Cropscience Ag Dérivés fongicides d'hydroximoyl-tétrazole
EP2997825A1 (fr) 2011-04-22 2016-03-23 Bayer Intellectual Property GmbH Combinaisons de composés actifs comprenant un dérivé de (thio)carboxamide et un composé fongicide
WO2012171914A1 (fr) 2011-06-14 2012-12-20 Bayer Intellectual Property Gmbh Utilisation d'un composé de type énaminocarbonyle en association avec un agent de lutte biologique
US9670496B2 (en) 2011-08-22 2017-06-06 Bayer Cropscience N.V. Methods and means to modify a plant genome
WO2013026740A2 (fr) 2011-08-22 2013-02-28 Bayer Cropscience Nv Procédés et moyens pour modifier un génome de plante
US10538774B2 (en) 2011-08-22 2020-01-21 Basf Agricultural Solutions Seed, Us Llc Methods and means to modify a plant genome
EP2561759A1 (fr) 2011-08-26 2013-02-27 Bayer Cropscience AG 2-amidobenzimidazoles fluoroalkyl substitués et leur effet sur la croissance des plantes
WO2013037717A1 (fr) 2011-09-12 2013-03-21 Bayer Intellectual Property Gmbh Dérivés de 3-{phényl[(hétérocyclylméthoxy)imino]méthyl}-1,2,4-oxadizol-5(4h)-one 4-substituée fongicides
WO2013037956A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation de 5-phényl- ou de 5-benzyl-2 isoxazoline-3 carboxylates pour améliorer le rendement de végétaux
WO2013037958A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation de phénylpyrazoline-3-carboxylates pour améliorer le rendement de végétaux
WO2013037955A1 (fr) 2011-09-16 2013-03-21 Bayer Intellectual Property Gmbh Utilisation d'acylsulfonamides pour améliorer le rendement de végétaux
WO2013050410A1 (fr) 2011-10-04 2013-04-11 Bayer Intellectual Property Gmbh Arni pour la lutte contre des champignons et oomycètes par inhibition du gène de la saccharopine déshydrogénase
WO2013075817A1 (fr) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Dérivés fongicides du n-[(silyle trisubstitué)méthyle]carboxamide
WO2013079566A2 (fr) 2011-11-30 2013-06-06 Bayer Intellectual Property Gmbh Dérivés (n-bicycloakyl et n-tricycloalkyl)(thio)carboxamides fongicides
WO2013092519A1 (fr) 2011-12-19 2013-06-27 Bayer Cropscience Ag Utilisation de dérivés de diamide d'acide anthranilique pour lutter contre les organismes nuisibles dans des cultures transgéniques
WO2013098147A1 (fr) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Dérivés fongicides de 3-[(pyridin-2-ylméthoxyimino)(phényl)méthyl]-2-substitué-1,2,4-oxadiazol-5(2h)-one
WO2013098146A1 (fr) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Dérivés fongicides de 3-[(1,3-thiazol-4-ylméthoxyimino)(phényl)méthyl]-2-substitué-1,2,4-oxadiazol-5(2h)-one
WO2013110591A1 (fr) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Combinaison de composés actifs contenant du fluopyrame, un bacille et un agent de lutte biologique
WO2013110594A1 (fr) 2012-01-25 2013-08-01 Bayer Intellectual Property Gmbh Associations de composés actifs contenant du fluopyrame et un agent de lutte biologique
WO2013127704A1 (fr) 2012-02-27 2013-09-06 Bayer Intellectual Property Gmbh Associations de composés actifs contenant une thiazoylisoxazoline et un fongicide
WO2013139949A1 (fr) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprenant un composé de strigolactame pour la croissance et le rendement accrus de plantes
WO2013153143A1 (fr) 2012-04-12 2013-10-17 Bayer Cropscience Ag N-acyl-2-(cyclo)alkylpyrrolidines et pipéridines utiles en tant que fongicides
WO2013156559A1 (fr) 2012-04-20 2013-10-24 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(hétérocyclylphényl)méthylène]-(thio)carboxamide
WO2013156560A1 (fr) 2012-04-20 2013-10-24 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(silylphényle trisubstitué) méthylène]-(thio)carboxamide
EP2662364A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides tétrahydronaphtyles de pyrazole
EP2662360A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles 5-halogenopyrazoles
WO2013167545A1 (fr) 2012-05-09 2013-11-14 Bayer Cropscience Ag Pyrazole indanyle carboxamides
EP2662370A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides de benzofuranyle 5-halogenopyrazole
EP2662361A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles de pyrazole
EP2662363A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Biphénylcarboxamides 5-halogenopyrazoles
EP2662362A1 (fr) 2012-05-09 2013-11-13 Bayer CropScience AG Carboxamides indanyles de pyrazole
WO2013167544A1 (fr) 2012-05-09 2013-11-14 Bayer Cropscience Ag 5-halogénopyrazole indanyle carboxamides
WO2013174836A1 (fr) 2012-05-22 2013-11-28 Bayer Cropscience Ag Combinaisons de composés actifs comprenant un dérivé de lipochitooligosaccharide et un composé nématicide, insecticide ou fongicide
EP3243387A2 (fr) 2012-05-30 2017-11-15 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un insecticide
EP3281526A1 (fr) 2012-05-30 2018-02-14 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3292764A2 (fr) 2012-05-30 2018-03-14 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide de la groupe des inhibiteurs de la chaine respiratoire au complexe iii
EP3300603A2 (fr) 2012-05-30 2018-04-04 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3318128A2 (fr) 2012-05-30 2018-05-09 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3488700A1 (fr) 2012-05-30 2019-05-29 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3205210A1 (fr) 2012-05-30 2017-08-16 Bayer CropScience Aktiengesellschaft Compositions contenant un agent de lutte biologique et un fongicide appartenant au groupe constitué des inhibiteurs de la succinate déshydrogénase
EP3409120A1 (fr) 2012-05-30 2018-12-05 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3363289A2 (fr) 2012-05-30 2018-08-22 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un insecticide
EP3360418A1 (fr) 2012-05-30 2018-08-15 Bayer CropScience Aktiengesellschaft Compositions comprenant un agent de contrôle biologique et un fongicide
EP3424322A1 (fr) 2012-07-31 2019-01-09 Bayer CropScience Aktiengesellschaft Compositions comprenant un mélange de pesticides contenant du terpène et un insecticide
WO2014019983A1 (fr) 2012-07-31 2014-02-06 Bayer Cropscience Ag Compositions contenant un mélange terpénique pesticide et un insecticide
EP3173477A1 (fr) 2012-09-14 2017-05-31 Bayer Cropscience LP Variants de hppd et procédés d'utilisation
EP3683307A2 (fr) 2012-09-14 2020-07-22 BASF Agricultural Solutions Seed US LLC Variants de hppd et procédés d'utilisation
WO2014043435A1 (fr) 2012-09-14 2014-03-20 Bayer Cropscience Lp Variants hppd et leurs procédés d'utilisation
WO2014056956A1 (fr) 2012-10-11 2014-04-17 Bayer Cropscience Ag Utilisation de dérivés n-phényléthylpyrazole carboxamide ou de leurs sels pour gérer la résistance des champignons phytopathogènes
EP2719280A1 (fr) 2012-10-11 2014-04-16 Bayer CropScience AG Utilisation de dérivés de carboxamide N-phenylethylpyrazole ou des sels de ceux-ci pour le management de la résistance des fungi phytopathogènes
WO2014060518A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé permettant de favoriser la croissance des plantes à l'aide de dérivés carboxamide
WO2014060520A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé de traitement de plantes contre des champignons résistants aux fongicides à l'aide de dérivés de carboxamide ou de thiocarboxamide
WO2014060519A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Procédé d'amélioration de la tolérance des plantes aux stress abiotiques à l'aide de dérivés carboxamide ou thiocarboxamide
WO2014060502A1 (fr) 2012-10-19 2014-04-24 Bayer Cropscience Ag Combinaisons de composés actifs comprenant des dérivés carboxamide
WO2014079789A1 (fr) 2012-11-23 2014-05-30 Bayer Cropscience Ag Associations de composés actifs
EP2735231A1 (fr) 2012-11-23 2014-05-28 Bayer CropScience AG Combinaisons de composés actifs
WO2014082950A1 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides ternaires
WO2014083033A1 (fr) 2012-11-30 2014-06-05 Bayer Cropsience Ag Mélange fongicide ou pesticide binaire
WO2014083089A1 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides et pesticides ternaires
WO2014083031A2 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges binaires pesticides et fongicides
WO2014083088A2 (fr) 2012-11-30 2014-06-05 Bayer Cropscience Ag Mélanges fongicides binaires
EP3318129A1 (fr) 2012-12-03 2018-05-09 Bayer CropScience Aktiengesellschaft Procédé de lutte contre des bioagresseurs d'utilisation d'une compositions comprenant paecilomyces lilacinus et fluopyram
WO2014086747A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086753A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant des agents de lutte biologique
WO2014086759A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant des agents de lutte biologique
WO2014086758A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014086748A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086764A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un fongicide
WO2014086750A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014086749A2 (fr) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprenant un agent de lutte biologique et un insecticide
WO2014090765A1 (fr) 2012-12-12 2014-06-19 Bayer Cropscience Ag Utilisation de 1-[2-fluoro-4-méthyle-5-(2,2,2- trifluoroéthylsulfinyl)phényl]-5-amino-3-trifluorométhyl)-1 h-1,2,4 tfia zole à des fins de régulation des nématodes dans les cultures résistantes aux nématodes
WO2014095826A1 (fr) 2012-12-18 2014-06-26 Bayer Cropscience Ag Combinaisons binaires fongicides et bactéricides
WO2014095677A1 (fr) 2012-12-19 2014-06-26 Bayer Cropscience Ag Carboxamides difluorométhyl-nicotinique-tétrahydronaphtyle
WO2014124375A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant de la gougérotine et un agent de lutte biologique
WO2014124379A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant un agent de contrôle biologique à base de streptomyces et un insecticide
WO2014124369A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant un agent de lutte biologique à base de streptomyces et un fongicide
WO2014124368A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant de la gougérotine et un fongicide
WO2014124373A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprenant de la gougérotine et un insecticide
WO2014124361A1 (fr) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comportant un agent de lutte biologique à base de streptomyces et un autre agent de lutte biologique
EP3626828A2 (fr) 2013-03-07 2020-03-25 BASF Agricultural Solutions Seed US LLC Gènes de toxine et leurs procédés d'utilisation
WO2014138339A2 (fr) 2013-03-07 2014-09-12 Athenix Corp. Gènes de toxine et leurs procédés d'utilisation
WO2014170364A1 (fr) 2013-04-19 2014-10-23 Bayer Cropscience Ag Mélange insecticide ou pesticide binaire
WO2014170345A2 (fr) 2013-04-19 2014-10-23 Bayer Cropscience Ag Procédé pour l'utilisation améliorée du potentiel de production de plantes transgéniques
WO2014177514A1 (fr) 2013-04-30 2014-11-06 Bayer Cropscience Ag Phénéthylcarboxamides n-substitués nématicides
WO2014177582A1 (fr) 2013-04-30 2014-11-06 Bayer Cropscience Ag N-(2-fluoro-2-phénéthyl)carboxamides en tant que nématocides et endoparasiticides
WO2014206953A1 (fr) 2013-06-26 2014-12-31 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-[(bicyclylphényl)méthylène]-(thio)carboxamide
WO2015082586A1 (fr) 2013-12-05 2015-06-11 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-{[2- (cycloalkyl-1-substitué)phényl]méthylène}-(thio)carboxamide
WO2015082587A1 (fr) 2013-12-05 2015-06-11 Bayer Cropscience Ag Dérivés de n-cycloalkyl-n-{[2- (cycloalkyl-1-substitué)phényl]méthylène}-(thio)carboxamide
EP2885970A1 (fr) 2013-12-21 2015-06-24 Bayer CropScience AG Compositions fongicides comportant un composé I, au moins un inhibiteur de déshydrogénase de la succinate (SDH) et au moins un fongicide de triazole
WO2015138394A2 (fr) 2014-03-11 2015-09-17 Bayer Cropscience Lp Variants hppd et leurs procédés d'utilisation
WO2015160618A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un agent de lutte biologique
WO2015160620A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un insecticide
WO2015160619A1 (fr) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprenant de la ningnanmycine et un fongicide
WO2016166077A1 (fr) 2015-04-13 2016-10-20 Bayer Cropscience Aktiengesellschaft Dérivés de n-cycloalkyle-n-(bihétérocyclyléthylène)-(thio)carboxamide
EP3081085A1 (fr) 2015-04-14 2016-10-19 Bayer CropScience AG Procédé d'amélioration de précocité dans le coton
EP3097782A1 (fr) 2015-05-29 2016-11-30 Bayer CropScience Aktiengesellschaft Procédés de régulation de nématodes phytopathogènes par combinaison du fluopyram et de biopesticides
WO2016193073A1 (fr) 2015-05-29 2016-12-08 Bayer Cropscience Aktiengesellschaft Procédés de lutte contre des nématodes phytopathogènes en combinant le fluopyram et des agents de lutte biologique
WO2017042259A1 (fr) 2015-09-11 2017-03-16 Bayer Cropscience Aktiengesellschaft Variants de la hppd et procédé d'utilisation
US11926838B2 (en) 2016-04-20 2024-03-12 BASF Agricultural Solutions Seed US LLC Elite event EE-GH7 and methods and kits for identifying such event in biological samples
US11085050B2 (en) 2016-04-20 2021-08-10 Basf Agricultural Solutions Seed, Us Llc Elite event EE-GH7 and methods and kits for identifying such event in biological samples
WO2017182420A1 (fr) 2016-04-20 2017-10-26 Bayer Cropscience Nv Événement élite ee-gh7, procédés et kits d'identification de cet événement dans des échantillons biologiques
WO2018019676A1 (fr) 2016-07-29 2018-02-01 Bayer Cropscience Aktiengesellschaft Combinaisons de composés actifs et procédés pour protéger le matériau de propagation des plantes
WO2018098214A1 (fr) 2016-11-23 2018-05-31 Bayer Cropscience Lp Gènes de toxines axmi669 et axmi991 et procédés d'utilisation de ceux-ci
WO2018119336A1 (fr) 2016-12-22 2018-06-28 Athenix Corp. Utilisation de cry14 dans la lutte contre les nématodes parasites
WO2018136604A1 (fr) 2017-01-18 2018-07-26 Bayer Cropscience Lp Gène de toxine bp005 et ses procédés d'utilisation
WO2018136611A1 (fr) 2017-01-18 2018-07-26 Bayer Cropscience Lp Utilisation de bp005 pour lutter contre des pathogènes végétaux
WO2018165091A1 (fr) 2017-03-07 2018-09-13 Bayer Cropscience Lp Variants de la hppd et leurs procédés d'utilisation
WO2018195256A1 (fr) 2017-04-21 2018-10-25 Bayer Cropscience Lp Procédé d'amélioration de sécurité de culture
WO2019068811A1 (fr) 2017-10-06 2019-04-11 Bayer Aktiengesellschaft Compositions comprenant du fluopyrame et du tioxazafène
WO2019083810A1 (fr) 2017-10-24 2019-05-02 Basf Se Amélioration de la tolérance aux herbicides pour des inhibiteurs de la 4-hydroxyphénylpyruvate dioxygénase (hppd) par la régulation négative de l'expression de hppd dans le soja
WO2019083808A1 (fr) 2017-10-24 2019-05-02 Basf Se Amélioration de la tolérance aux herbicides vis-à-vis d'inhibiteurs de hppd par régulation à la baisse des 4-hydroxyphénylpyruvate réductases putatives dans le soja
US11834466B2 (en) 2017-11-30 2023-12-05 5Metis, Inc. Benzoxaborole compounds and formulations thereof
WO2019233863A1 (fr) 2018-06-04 2019-12-12 Bayer Aktiengesellschaft Benzoylpyrazoles bicycliques utilisés comme herbicide
US11066424B2 (en) 2018-08-18 2021-07-20 Boragen, Inc. Solid forms of substituted benzoxaborole and compositions thereof
US11560393B2 (en) 2018-08-18 2023-01-24 5Metis, Inc. Solid forms of substituted benzoxaborole and compositions thereof
US11236115B2 (en) 2018-08-18 2022-02-01 5Metis, Inc. Solid forms of substituted benzoxaborole and compositions thereof
WO2020231751A1 (fr) 2019-05-10 2020-11-19 Bayer Cropscience Lp Combinaisons de composés actifs
WO2021013721A1 (fr) 2019-07-22 2021-01-28 Bayer Aktiengesellschaft Triazoles et pyrazoles à substitution 5-amino utilisés comme pesticides
WO2021013720A1 (fr) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021013719A1 (fr) 2019-07-23 2021-01-28 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021022069A1 (fr) 2019-08-01 2021-02-04 Bayer Cropscience Lp Procédé d'amélioration de la tolérance au stress dû au froid et de l'innocuité des cultures
EP3701796A1 (fr) 2019-08-08 2020-09-02 Bayer AG Combinaisons de composés actifs
WO2021058659A1 (fr) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Lutte contre les nuisibles induite par arni
WO2021064075A1 (fr) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Combinaisons de composés actifs comprenant des acides gras
WO2021069567A1 (fr) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021069569A1 (fr) 2019-10-09 2021-04-15 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
WO2021089673A1 (fr) 2019-11-07 2021-05-14 Bayer Aktiengesellschaft Sulfonyl amides substitués pour lutter contre des animaux nuisibles
WO2021097162A1 (fr) 2019-11-13 2021-05-20 Bayer Cropscience Lp Combinaisons bénéfiques contenant paenibacillus
WO2021099303A1 (fr) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole utilisés comme pesticides
WO2021099271A1 (fr) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Combinaisons de composés actifs comprenant des acides gras
WO2021105091A1 (fr) 2019-11-25 2021-06-03 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
WO2021155084A1 (fr) 2020-01-31 2021-08-05 Pairwise Plants Services, Inc. Suppression de la réponse d'évitement d'ombre dans des plantes
WO2021165195A1 (fr) 2020-02-18 2021-08-26 Bayer Aktiengesellschaft Composés hétéroaryle-triazole utilisés comme pesticides
EP3708565A1 (fr) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphénylamidines et leur utilisation comme fongicides
WO2021209490A1 (fr) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephénylaminoquinoléines utiles en tant que fongicides
WO2021211926A1 (fr) 2020-04-16 2021-10-21 Pairwise Plants Services, Inc. Procédés permettant de contrôler la taille du méristème pour améliorer les cultures
WO2021213978A1 (fr) 2020-04-21 2021-10-28 Bayer Aktiengesellschaft Dérivés hétérocycliques condensés à substitution 2- (het) aryle utilisés comme agents de lutte contre les organismes nuisibles
WO2021224323A1 (fr) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Nouveaux composés hétéroaryle-triazole en tant que pesticides
WO2021224220A1 (fr) 2020-05-06 2021-11-11 Bayer Aktiengesellschaft Pyridine (thio)amides en tant que composés fongicides
WO2021228734A1 (fr) 2020-05-12 2021-11-18 Bayer Aktiengesellschaft (thio)amides de triazine et de pyrimidine utilisés comme composés fongicides
WO2021233861A1 (fr) 2020-05-19 2021-11-25 Bayer Aktiengesellschaft (thio)amides azabicycliques en tant que composés fongicides
WO2021247477A1 (fr) 2020-06-02 2021-12-09 Pairwise Plants Services, Inc. Procédés de régulation de la taille du méristème pour l'amélioration des cultures
WO2021245087A1 (fr) 2020-06-04 2021-12-09 Bayer Aktiengesellschaft Hétérocyclyl pyrimidines et triazines en tant que nouveaux fongicides
WO2021249995A1 (fr) 2020-06-10 2021-12-16 Bayer Aktiengesellschaft Hétérocycles à substitution azabicyclyle utilisés comme fongicides
WO2021257775A1 (fr) 2020-06-17 2021-12-23 Pairwise Plants Services, Inc. Procédés de régulation de la taille de méristème pour l'amélioration des cultures
WO2021255118A1 (fr) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Composition destinée à être utilisée en agriculture
WO2021255071A1 (fr) 2020-06-18 2021-12-23 Bayer Aktiengesellschaft Dérivés de 3-(pyridazin-4-yl)-5,6-dihydro-4h-1,2,4-oxadiazine utilisés comme fongicides pour la protection des cultures
WO2021255169A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines en tant que fongicides
WO2021255091A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazoles et leurs dérivés comme fongicides
WO2021255170A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines en tant que fongicides
WO2021255089A1 (fr) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines et 1,3,4-oxadiazole pyridines utilisées comme fongicides
EP3929189A1 (fr) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Nouveaux dérivés de pyrazine hétéroaryle substitués utilisés en tant que pesticides
WO2021259997A1 (fr) 2020-06-25 2021-12-30 Bayer Animal Health Gmbh Nouveaux dérivés de pyrazine substitués par hétéroaryle utilisés en tant que pesticides
WO2022002818A1 (fr) 2020-07-02 2022-01-06 Bayer Aktiengesellschaft Dérivés d'hétérocyclène utiles en tant qu'agents de lutte contre les nuisibles
WO2022033991A1 (fr) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft Triazoles à substitution 5-amino utilisés en tant qu'agents de lutte contre les nuisibles
WO2022053453A1 (fr) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide servant d'agents de lutte contre les nuisibles
WO2022058327A1 (fr) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Urées et dérivés substitués en tant que nouveaux agents antifongiques
EP3974414A1 (fr) 2020-09-25 2022-03-30 Bayer AG Pyrazoles et triazoles substitués par un 5-amino en tant que pesticides
EP3915971A1 (fr) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phényl-s(o)n-phénylamidines et leur utilisation comme fongicides
WO2022129190A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazoles substitués par (hétéro)aryle utilisés comme fongicides
WO2022129188A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines en tant que fongicides
WO2022129196A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazoles substitués par hétérobicycle utilisés en tant que fongicides
WO2022129200A1 (fr) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Utilisation d'un inhibiteur de la dhodh pour lutter contre des champignons phytopathogènes résistants dans des cultures
EP4036083A1 (fr) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft Hétéréocycles substitués de 5-oxy en tant que pesticides
WO2022173885A1 (fr) 2021-02-11 2022-08-18 Pairwise Plants Services, Inc. Procédés et compositions pour modifier les niveaux de cytokinine oxydase dans des plantes
WO2022182834A1 (fr) 2021-02-25 2022-09-01 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'architecture racinaire chez des plantes
WO2022207494A1 (fr) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole en tant que fongicide
WO2022207496A1 (fr) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole en tant que fongicide
WO2022233777A1 (fr) 2021-05-06 2022-11-10 Bayer Aktiengesellschaft Imidazoles annelés substitués par alkylamide et leur utilisation comme insecticides
WO2022238391A1 (fr) 2021-05-12 2022-11-17 Bayer Aktiengesellschaft Dérivés hétérocycliques condensés à substitution 2-(het)aryle utilisés comme agents de lutte antiparasitaire
WO2022266271A1 (fr) 2021-06-17 2022-12-22 Pairwise Plants Services, Inc. Modification de facteurs de transcription de la famille des facteurs de régulation de la croissance dans le soja
WO2022271892A1 (fr) 2021-06-24 2022-12-29 Pairwise Plants Services, Inc. Modification des gènes de l'ubiquitine ligase e3 hect pour améliorer les caractéristiques liées au rendement
WO2023278651A1 (fr) 2021-07-01 2023-01-05 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer le développement de système racinaire
WO2023019188A1 (fr) 2021-08-12 2023-02-16 Pairwise Plants Services, Inc. Modification de gènes du récepteur des brassinostéroïdes pour améliorer des caractéristiques de rendement
WO2023017120A1 (fr) 2021-08-13 2023-02-16 Bayer Aktiengesellschaft Combinaisons de composés actifs et compositions fongicides comprenant celles-ci
WO2023023496A1 (fr) 2021-08-17 2023-02-23 Pairwise Plants Services, Inc. Procédés et compositions pour modifier les gènes de l'histidine kinase du récepteur de la cytokinine dans des plantes
WO2023025682A1 (fr) 2021-08-25 2023-03-02 Bayer Aktiengesellschaft Nouveaux composés de pyrazinyle-triazole utilisés comme pesticides
WO2023034731A1 (fr) 2021-08-30 2023-03-09 Pairwise Plants Services, Inc. Modification de gènes de peptidase de liaison à l'ubiquitine dans des plantes pour améliorer des caractéristiques de rendement
EP4144739A1 (fr) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Pyrazoles annelés en tant que produit pesticide
WO2023034891A1 (fr) 2021-09-02 2023-03-09 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer l'architecture des plantes et les caractéristiques de rendement
WO2023049720A1 (fr) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Procédés et compositions pour réduire l'éclatement de la cosse dans le canola
WO2023060028A1 (fr) 2021-10-04 2023-04-13 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleuron et du rendement en graines
WO2023060152A2 (fr) 2021-10-07 2023-04-13 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleron et du rendement des graines
WO2023078915A1 (fr) 2021-11-03 2023-05-11 Bayer Aktiengesellschaft Bis(hétéro)aryl thioéther (thio)amides utiles en tant que composés fongicides
WO2023099445A1 (fr) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hétéro)aryl thioéther oxadiazines utilisées en tant que composés fongicides
WO2023108035A1 (fr) 2021-12-09 2023-06-15 Pairwise Plants Services, Inc. Procédés d'amélioration de la fertilité du fleuron et du rendement en graines
WO2023147526A1 (fr) 2022-01-31 2023-08-03 Pairwise Plants Services, Inc. Suppression de la réponse d'évitement d'ombre dans des plantes
WO2023148028A1 (fr) 2022-02-01 2023-08-10 Globachem Nv Procédés et compositions pour lutter contre les animaux nuisibles
WO2023148031A1 (fr) 2022-02-01 2023-08-10 Globachem Nv Procédés et compositions pour lutter contre les nuisibles dans le coton
WO2023168217A1 (fr) 2022-03-02 2023-09-07 Pairwise Plants Services, Inc. Modification de gènes récepteurs de brassinostéroïdes pour améliorer des caractéristiques de rendement
WO2023192838A1 (fr) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Plantes rosacées à floraison précoce présentant des caractéristiques améliorées
WO2023196886A1 (fr) 2022-04-07 2023-10-12 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer la résistance à la fusariose de l'épi
WO2023205714A1 (fr) 2022-04-21 2023-10-26 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractéristiques de rendement
CN114807121A (zh) * 2022-04-26 2022-07-29 广西特色作物研究院 一种柑橘dna快速提取方法
WO2023215704A1 (fr) 2022-05-02 2023-11-09 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer le rendement et la résistance aux maladies
WO2023213626A1 (fr) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Utilisation de (5s)-3-[3-(3-chloro-2-fluorophénoxy)-6-méthylpyridazin-4-yl]-5-(2-chloro-4-méthylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine pour lutter contre des micro-organismes indésirables
WO2023213670A1 (fr) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Formes cristallines de (5s)-3-[3-(3-chloro-2-fluorophénoxy)-6-méthylpyridazin-4-yl]-5-(2-chloro-4-méthylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine
WO2023215809A1 (fr) 2022-05-05 2023-11-09 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'architecture racinaire et/ou améliorer des propriétés de rendement de plantes
WO2024006679A1 (fr) 2022-06-27 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions pour modifier l'évitement de l'ombre dans des plantes
WO2024006792A1 (fr) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions permettant de réguler la taille du méristème pour améliorer les cultures
WO2024006791A1 (fr) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Procédés et compositions permettant de réguler la taille du méristème pour améliorer les cultures
WO2024030984A1 (fr) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractères de rendement
WO2024036240A1 (fr) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Procédés et compositions pour réguler la taille des méristèmes pour l'amélioration des cultures
WO2024054880A1 (fr) 2022-09-08 2024-03-14 Pairwise Plants Services, Inc. Procédés et compositions pour améliorer des caractéristiques de rendement dans des végétaux
EP4295688A1 (fr) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Combinaison de composés actifs
WO2024068517A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068518A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-hétéroaryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068519A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide
WO2024068520A1 (fr) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hétéro)aryl-5-chlorodifluorométhyl-1,2,4-oxadiazole utilisé comme fongicide

Also Published As

Publication number Publication date
WO2005054480A3 (fr) 2007-08-30
AR047134A1 (es) 2006-01-11

Similar Documents

Publication Publication Date Title
US7521550B2 (en) Insect resistant cotton plants and methods of detecting the same
US7371940B2 (en) COT102 insecticidal cotton
AU2006254493B2 (en) CE43- 67B, insecticidal transgenic cotton expressing CRY1AB
WO2005054480A2 (fr) Plants de coton resistant aux insectes et procedes de detection de ces derniers
US20100024077A1 (en) Ce44-69d insecticidal cotton
WO2006128569A2 (fr) Coton insecticide 1143-14a
WO2006128572A1 (fr) Coton insecticide ce46-02a
WO2006128570A1 (fr) Coton insecticide 1143-51b
WO2006128568A2 (fr) Coton insecticide t342-142
RU2622079C2 (ru) СПОСОБ ОБНАРУЖЕНИЯ ТРАНСФОРМАНТА СОИ рDAB9582.814.19.1
AU2003283295B2 (en) COT102 insecticidal cotton
CN101184848A (zh) 表达cry1ab的杀昆虫转基因棉ce44-69d

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

NENP Non-entry into the national phase in:

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase

Ref document number: 04797739

Country of ref document: EP

Kind code of ref document: A2