Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/52—Cytokines; Lymphokines; Interferons
  • C07K14/555—Interferons [IFN]
  • C07K14/565—IFN-beta
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells

Definitions

• the present invention provides a mutein of human interferon-beta in which one or two sugar chain is added according to the artificial mutagenesis of 110, 117 and/ or 137 amino acid of natural human interferon-beta. More particularly, the present invention provides a mutein of human interferon-beta having enhanced antiviral activity and half-life, which is expressed through animal cell to have additional one or two sugar chain according to the artificial replacement of 110, 117 and/ or 137 amino acid into asparagine; a gene for encoding such mutein of interferon-beta; and a preparation method thereof.
• Interferons are one of major cytokines which show the antiviral activity, the suppression of cell growth and the modulation of immune response (Baron et al. JAMA 266: p 1375, 1991).
• interferon-beta IFN- ⁇
• IFN- ⁇ interferon-beta
• the double strand RNA which won't be created in normal cells will be produced if the cells are infected by virus, which is a signal inducing the synthesis of IFN- ⁇ (Jane way et al. Immunobiolo y : The immune system in health and disease. 4th ed. New York: Elsevier Science/ Garland Publishing, pp 385-386, 1999).
• the signal transduction pathway of IFN- ⁇ is initiated as the IFN- ⁇ combines with its receptor, which exists in the heterodimer made up of two polypeptides with their sizes of 550 amino acids and 487 amino acids (Russell-Harde et al. Biochemical and Biophysical Research Communications 255: pp 539-544, 1999). Then, phosphorylated receptor is combined with STAT2, and STAT2 forms dimer to activate the transcription of various genes at the nucleus (Arduini et al. Protein Science 8: pp 1867-1877, 1999).
• IFN- ⁇ can facilitate recognition of the virus infected cell by CD7 cell, which increases the apoptosis of virus infected cell (Janeway et al Immunobiology: The immune system in health and disease. 4th ed. New York: Elsevier Science/ Garland Publishing. pp 385-386, 1999). Especially, in the presence of double strand RNA induced by virus infection, elF2 is inactivated by dsRNA dependent kinase and the synthesis of protein is suppressed (Biron et al. Seminars in Immunology 10: pp 383-390, 1998).
• IFN- ⁇ has been applied for relieving or treating the multiple sclerosis, which occurs in central nervous system, especially, brain or spine, as auto-immune disease caused by the mechanism that T cells attack the neuron cells of central nervous system as exogenous cells (Goodkin et al. Multiple sclerosis: Treatment options for patients with relapsing-remitting and secondary progressive multiple sclerosis, 1999).
• this auto-immune disease can be relieved by recovery of suppressive T cells (Dayal et al. All- trans retinoic acid potentiates the ability of interferon beta-lb, 1998).
• this disease can be relieved by suppression of enzyme formation related to the synthesis of nitiric oxide, as one of major factors for causing multiple sclerosis (Hua et al. Beta inteferon prevents nitric oxide/ peroxynitrate from damaging the central nervous system, 1998.)
• IFN- ⁇ is the first treatment for multiple sclerosis, which was approved by FDA on 1993 (Revelle M 1993 07 Sept. FDA licenses interferon beta-lb).
• the approved IFN- ⁇ lb has been produced in E. coli by recombinant DNA technology to have no sugar chains (Arduini et al. Protein Science 8: pp 1867-1877, 1999). This product has been commercially marketed as trade name 'Betaseron' which is the unique drug for treating multiple sclerosis.
• the second drug approved by FDA on 1996 for treating multiple sclerosis is IFN- ⁇ la produced and expressed from Chinese Hamster Ovary Cell, which is very similar to the natural human interferon-beta (HnlFN- ⁇ ) due to its sugar chains.
• This drug has been marketed as trade name 'Avonex' by Biogen (Goodkin et al. Multiple sclerosis: Treatment options for patients with relapsing-remitting and secondary progressive multiple sclerosis, 1999).
• Interferon-beta can be applied for the treatment of cancer, auto-immune disease and virus infection as well as multiple sclerosis, because it has antiviral activity, cell growth inhibiting and proliferative activity and also can boost the immune system's anticancer function by stimulating NK cells, cytotoxic T cells, and macrophages(Cirelli et al.
• the present invention relates to a mutein of IFN- ⁇ having enhanced in vivo activity for treating multiple sclerosis. More particularly, this invention relates to a mutein of IFN- ⁇ having longer half-life by adding one or two sugar chain to the polypeptide of IFN- ⁇ .
• In vivo activity of IFN- ⁇ depends on the in vivo half -life. It has been known that in vivo half-life of glycoprotein is related to the contents of sialic acid located at the terminus of sugar chain. Therefore, in vivo activity of IFN- ⁇ is influenced by the existence of sugar chain. Because the addition and structure of sugar chain depends on the host cell, specific host cell will be required to the specific formation of sugar chain to the glycoprotein.
• Major approach can be accomplished by replacing some amino acids of natural IFN- ⁇ gene by mutagenesis.
• immune response corresponding to peptide stretch of recombinant human IFN- ⁇ having C17S has been examined (Redlich et al., Proc. Natl. Acad. Sci., USA, Vol.88, pp.4040-4044, 1991).
• EPO erythropoietin
• hTPO analogues by deleting the C-terminus amino acids to the natural hTPO; hTP0151 (amino acid 1-151) or by adding new amino acids after deleting C-terminus amino acid; hTP0174 (amino acid 1-174).
• new analogue has been developed by adding methionine-lysine to N- terminus of hTP0163.
• these analogues showed lower in vivo activity compared to natural hTPO, while these analogues maintain in vitro activity (PCT pamphlet No. W095/ 026746).
• the second approach is to develop an analogue by adding polyethylene glycol (hereinafter 'PEG') to hTPO like Amgen's hTP0163-PEG (PCT pamphlet No. W095/ 026746, Compositions and methods for stimulating magakaryocyte growth and differentiation, U.S. Pat. No. 5,795,569 Mono-pegylated proteins that megakaryocyte growth and differentiation).
• 'PEG' polyethylene glycol
• hTP0163-PEG PCT pamphlet No. W095/ 026746, Compositions and methods for stimulating magakaryocyte growth and differentiation
• U.S. Pat. No. 5,795,569 Mono-pegylated proteins that megakaryocyte growth and differentiation
• W099/ 003887 'Derivatives of growth hormone and related proteins' disclosed the PEG analogue of growth hormone, wherein cysteine residue is replaced by non-essential amino acid in the polypeptide.
• IFN- ⁇ is regarded as one of related proteins belonged to growth hormone superfamily.
• PCT pamphlet No. WO00/ 023114 Polymer conjugates of interferon beta-lA and their uses' disclosed the IFN- ⁇ glycosylated and PEG-lated.
• U.S. Pat. No. 5,218,092 Modified granulocyte-colony stimulating factor polypeptide with added carbohydrate chains' disclosed the modification of granulocyte-colony stimulating factor by introducing carbohydrate chain to enhance the activity.
• IFN- ⁇ was indicated as one of polypeptides, which can be modified by the method disclosed in U.S. Pat. No. 5,218,092.
• the third approach is to enhance IFN- ⁇ activity by introducing sugar chain to the protein.
• sugar chain Generally, most of proteins are present in the form of glycoprotein.
• This sugar chains is linked to the specific site of amino acid sequence and the kinds of sugar chains can be classified into two groups. O-linked sugar chains are added to oxygen sites of serine or threonine and N-linked sugar chains are added to amide of asparagine sites having the sequence asparagine-X-serine/theronine (X is any amino acid except proline) in the polypeptide.
• sugar chains of glycoprotein influence the physical, chemical and/ or biological properties of protein, especially, in vivo biological and pharmaco-kinetic properties (Jenkins et al., Nature Biotechnological., 14: pp 975-981, 1996); Liu et al., Act. TIBTECK, 10: pp 114-120 , 1992).
• the fourth approach is to develop a fusion protein.
• a fusion protein As an example, it was reported that formation of the dimer of EPO had been tried to enhance the half-life in the body (A.J. Sytkowski et al, J. Biol. Chem. vol. 274, No. 35, pp 24773-24778).
• new amino acid, peptide or protein fragment was fused with EPO molecule to enhance the in vivo activity.
• the use of amino acid, peptide or protein fragment for fusion protein can be applied in a limited manner, because this modification through fusion causes the decline of original activity as well as the increase of antigenicity. Fusion protein or chimeric protein has been researched for other proteins except IFN- ⁇ .
• follicle stimulating hormone as one of female hormones has been disclosed (Furuhashi et al, 1995, Mol. Endocrinol.).
• Antiviral analysis method for example, CPE (U.S. Pat. No. 5,545,723 'Muteins of interferon-beta' and U.S. Pat. No. 4,914,033 'Structure and properties of modified interferons'); ⁇ ) binding with receptor (U.S. Pat. No.
• IFN- ⁇ 2 responsive gene activation of interferon-stimulating response element (ISRE) linked with reporter gene such as lucif erase
• ISRE interferon-stimulating response element
• the present invention uses the method for introducing additional sugar chain to the specific site of protein to enhance the activity, according to the teaching of U.S. Pat. No. 5,618,698, in which at least one sugar chain is introduced to EPO.
• the object of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said mutein of human interferon-beta is prepared by the steps comprising i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ⁇ ) expressing said artificially mutated cDNA in animal cell; and i ⁇ ) obtaining said mutein of human interferon-beta having additional one or two sugar chain.
• DAO aspartate
• M117 methionine
• E137 glutamate
• the preferred embodiment of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to replace 110th site of aspartate (DUO) and/ or 137th site of glutamate (E137) by asparagine (D110N, E137N, D110N-E137N) in 166 natural human interferon-beta.
• said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to replace 110th site of aspartate (DUO) and/ or 137th site of glutamate (E137) by asparagine (D110N, E137N, D110N-E137N) in 166 natural human interferon-beta.
• Another embodiment of the present invention is to provide a mutein of human interferon-beta in which additional one or two sugar chain is added, wherein said first step for preparing mutein of human interferon-beta is the step for preparing the artificial mutagenesis of cDNA in order to have one further replacement of amino acid selected from the group consisting of 72th site of glutamine (Q72), 73th site of aspartate (D73), 75th site of serine (S75) and 116th site of leucine (L116) by asparagine (N).
• the further object of the present invention is to provide a mutated cDNA clone expressing a mutein of human interferon-beta, wherein said cDNA clone is artificially mutated to have one or two AAT sequence at asparagine (N) transcription sites, where natural transcription sites are selected from group consisting of 110th site of aspartate (GAT), 117th site of methionine (ATG) and 137th site of glutamate (GAG) in natural human interferon-beta cDNA sequence of SEQ ID NO: 2.
• the present invention also provides a method for preparing a mutein of human interferon-beta in which additional one or two sugar chain is added, comprising the steps of: i ) preparing the artificial mutagenesis of cDNA in order to replace one or two amino acid selected from 110th site of aspartate (DUO), 117th site of methionine (M117) and 137th site of glutamate (E137) by asparagine (N) in 166 natural human interferon-beta amino acid sequence of SEQ ID NO: 1 ; ii ) expressing said artificially mutated cDNA in animal cell such as CHO cell; and iii) obtaining said mutein of human interferon-beta having additional one or two sugar chain.
• the present invention also provides a pharmaceutical composition
• a pharmaceutical composition comprising a mutein of human interferon-beta as active ingredient and other diluent, adjuvant, and carrier.
• FIG 1 shows the cDNA sequence and amino acid sequence of human interferon-beta. The parts indicated by '*' (6,10,11,16,56,67,
• 74,88,98,155,159,160 amino acid show the helix turn of three-dimensional structure of interferon-beta.
• the parts indicated by '**' (27,39,92,142 amino acid) show the important sites for receptor binding and activity.
• the sites indicated by '!' (72,73 amino acid) show the antiviral activity sites.
• FIG 2 shows a process for introducing Asn-X-Ser/Thr (N-X-S/T) sequence at desired place using site-directed mutagenesis method.
• the first step shows the synthesis of substituted gene by PCR using specific primer set.
• the second step shows the transformation of E. coli using methylated interferon-beta gene as template and digesting with Dpn I in the PCR reacting solution containing synthesized interferon-beta gene.
• FIG 3 shows the cloning process of expression vector pcDNA3.1-IFN ⁇ in order to express mutein of interferon-beta.
• FIG 4 shows the co-transfection process of expression vector pcDNA3.1-IFN ⁇ and vector ⁇ SP72-DHFR in order to insert it into animal cell.
• FIG 5 shows the Western Blot picture after electrophoresis of mutein of interferon-beta expressed by COS cell.
• An anti-human IFN- ⁇ monoclonal antibody is used as the primary antibody and a rabbit anti-mouse IgG antibody conjugated HRP (Zymed) is used as the secondary antibody.
• FIG 6 shows the Western Blot picture after cleavage with N-glycanase and electrophoresis of mutein of interferon-beta expressed by COS cell.
• An anti-human IFN- ⁇ monoclonal antibody is used as the primary antibody and a rabbit anti-mouse IgG antibody conjugated HRP (Zymed) is used as the secondary antibody.
• FIG 7 shows the Western Blot picture indicating the degree of cleavage (at the time of cleavage, 10 minutes after cleavage, 30 minute after cleavage, 3 hours after cleavage, 8 hours after cleavage, 16 hours after cleavage) with N-glycanase to mutein of interferon-beta (N-2) expressed by CHO cell.
• FIG 8 shows SDS-PAGE and Western Blot picture of mutein of interferon-beta purified from CHO cell culture soup.
• FIG 9 shows the Isoelectric focusing gel electrophoresis according to Western Blot as to mutein of interferon-beta expressed by CHO cell and natural type interferon-beta to identify the distribution of isoform of protein.
• FIG 10 shows HPLC data, which is prepared by the steps of i ) cleaving a mutein of interferon-beta expressed by CHO cell and natural interferon-beta with Lysyl endoproteinase; ii ) reducing them with DTT; iii) alkylation of obtained material with Iodoacetamide (Sigma); and iv) cleaving the sugar chain with PNGase F and analyzing them with Reverse phase C18 column.
• A) the natural interferon-beta B) a mutein of interferon-beta (N-2), C) a mutein of interferon-beta (N-20).
• FIG 11 shows the comparison of antiviral activity by muteins of interferon-beta expressed by CHO cell and natural interferon-beta.
• FIG 12 shows the anti-proliferation effect by muteins of interferon-beta expressed by CHO cell and natural interferon-beta.
• FIG 13 shows the immune-enhanced property by muteins of interferon-beta expressed by CHO cell and natural interferon-beta by measuring the activation of MHC class I in A549 cell.
• FIG 14 shows the plasma concentration of interferon-beta (muteins of interferon-beta expressed by CHO cell and natural interferon-beta) in rats at time interval.
• the gene for mutein of interferon-beta is prepared by site-directed mutagenesis in order to introduce Asn-X-Ser/Thr (N-X-S/T) sequence in natural interferon-beta amino acid sequence, so that additional sugar chain can be added.
• One or two site selected from the group consisting of Q72, D73, S75, DUO, L116, M117, and E137 of human interferon-beta amino acid sequence (SEQ ID NO: 1)(FIG 1) is artificially replaced by asparagine.
• primer set is prepared for overlapping PCR as to the mutated site.
• overlapping PCR is carried out using overlapping primer set and Pfu-turbo DNA polymerase with plasmid pGEM-T Easy vector (Promega, USA) containing interferon-beta gene as template.
• primer sets for overlapping PCR obtaining interferon-beta mutated gene. Only one overlapping PCR is required for replacing one nucleotide in interferon-beta gene. However, two overlapping PCRs are required for replacing two nucleotides in interferon-beta gene.
• CAGTGCTAGATGAATCTTTTCTGAAAATAGCAAAG SEQ ID NO: 4
• 2nd sense primer CTTTGCTATTTTCAGAAATGATTCATCTAGCACTG (SEQ ID NO: 5)
• antisense primer GCTATTTTCAGACAAAATTCATCTAGCACTGGC (SEQ ID NO: 7) antisense primer :
• 2nd antisense primer GGTGCAGACTGCTCATGTTTTTTCCCCTGGT (SEQ ID NO: 18) vi) Primer-set for preparing mutated interferon-beta gene (M117N)
• the codon encoding above 7 amino acids is replaced by the codon encoding asparagine.
• This plasmid is called 'pGEMT-IFN- ⁇ -X'.
• the gene for a mutein of interferon-beta is obtained by carrying out PCR using two primers PI (CCGGAATTCGCCACCATGACCAACAA GTGTCTCCTCCAAA, SEQ ID NO: 27) and P2 (CCGCTCGAGGTCACT TAAACAGCATCTGCTGGTTGA, SEQ ID NO: 28).
• mutated gene for mutein of interferon-beta 22 kinds are manufactured.
• Table 1 shows the replacing amino acid site and replacing nucleotide site of 22 kinds of mutated gene.
• Expression of mutein of interferon-beta by the cultivation of transformed cell After cloning expression vector containing mutated gene, COS cell is transfected by this vector.
• Expression vector, pcDNA3.1-IFN ⁇ is prepared as shown in FIG 3 with following steps. i ) Digesting pcDNA3.1 (Invitrogen) and amplified IFN- ⁇ gene with restriction enzyme, EcoR I and Xho I; ii ) eluting of linear pcDNA3.1 and IFN- ⁇ gene in agarose gel using Qiagen elution kit; iii) transforming E. coli DH5 ⁇ after ligation of said gene; and iv) selecting and obtaining the transformed plasmid.
• expression vector pcDNA3.1-IFN— ⁇ and pSP72-DHFR are co-transfected in order to insert them to animal cell.
• Lipofectin-DNA complex is obtained.
• this complex is overlaid on COS cell.
• Said COS cell is transfected and incubated in 5% C0 2 incubator at 37 TJ .
• transfected COS cell is cultivated.
• transfected cell is selected in the medium containing G418. Selection medium has been exchanged in 4 days interval and the concentration of medium for apoptosis is determined. Then, transfected cell is selected by replacing medium to alpha-MEM minimal medium deficient of deoxyribonucleoside and ribonucleoside containing G418.
• the expression capability for mutein of interferon-beta by CHO cell is measured by Western Blot with following method. After electrophoresis, developed protein is transferred into nitrocellulose filter using transfer blotter. After washing, nitrocellulose filter is reacted with anti-human IFN- ⁇ monoclonal antibody as first antibody. After washing, said filter is reacted with rabbit anti-mouse IgG antibody conjugated HRP. After completion of reaction, electrogenerated chemiluminescence (ECL) is added to detect positive band of a mutein of interferon-beta in X-ray film.
• ECL electrogenerated chemiluminescence
• the interferon-beta protein is quantified by EIA. Then, the potencies of mutein of interferon-beta and natural interferon-beta are measured by antiviral activity test.
• Enzyme-Immuno-Assay is employed for measuring antiviral activity.
• potency of antiviral activity is measured by EIA.
• Table 2 shows the ratio of potency of antiviral activity/ EIA. From this experiment, the antiviral activities of N-2 mutein (DllON), N-19 mutein (DllON M117N), N-20 mutein (DllON E137N), N-22 mutein (M117N E137N) are measured to be enhanced.
• + M.W. of mutein of interferon-beta is 24 kDa, where one sugar chain is additionally added.
• ++ M.W. of mutein of interferon-beta is 26 kDa, where two sugar chains are additionally added.
• Half-life test is carried out by measuring the concentration of interferon-beta muteins in the plasma after injecting it into rats. After injecting natural and mutein of interferon-beta into rats using cathete, the bloods are collected at the same time of injection, 1 min, 5 min, 15 min, 30 min, 1 hr 15 min, 3 hr, 5 hr, 8 hr. Collected bloods are prevented to be coagulated by treating anti-coagulant solution. The amounts of interferon-beta in the plasma of rats are measured by antiviral test method. The increase of half-life can be detected by pharmacokinetics. Table 3 shows the results.
• vectors can be used to express cDNA for preparing mutein of interferon-beta of the present invention.
• Preferred vectors are adaptable to eukaryotic host cell in order to add sugar chain in mutein of interferon-beta.
• Vectors useful to eukaryotic host cell have expression sequences derived from SV40, Bovine Papilloma Virus, Adenovirus or Cytomegalo virus.
• Preferred example of vector can be pCDNA3.1(+)/Hyg (Invitrogen, Carlsbad, Calif., USA) and pCI-neo (Stratagen, La Jolla, Calif., USA).
• the host cell to be used has to show high introduction of DNA and high expression of introduced DNA.
• eukaryotic host cell has to be employed for this invention.
• the example of mammalian host cell contains CHO cell, COS cell such as COS 1, COS 7, BHK cell and mouse cell.
• the host cells are cultivated in nutrient medium adaptable to produce polypeptide.
• host cells can be cultivated in shake flask, fermenter in laboratory scale or fermenter in industrial scale in order to express and produce polypeptide.
• the present invention also provides a pharmaceutical composition containing mutein of interferon-beta as active ingredient.
• the therapeutic composition for mutein of interferon-beta can be a formulation of freeze-dried cake or solution containing pharmaceutically acceptable carrier, diluent and/ or stabilizer.
• solution, suspension or emulsion can be prepared with pharmaceutically acceptable carrier and/ or diluent.
• the gene for mutein of interferon-beta is prepared by site-directed mutagenesis in order to introduce Asn-X-Ser/Thr (N-X-S/T) sequence in natural interferon-beta amino acid sequence, so that additional sugar chain can be attached.
• One or two site selected from the group consisting of Q72, D73, S75, DUO, L116, M117, and E137 of human interferon-beta amino acid sequence (SEQ ID NO: 1) is artificially replaced by asparagine.
• primer sets SEQ ID NO: 3 ⁇ SEQ ID NO: 26
• overlapping PCR is carried out using overlapping primer set and Pfu-turbo DNA polymerase with plasmid pGEM-T Easy vector (Promega, USA) containing interferon-beta gene as template.
• E. coli XLl-blue and heated at 42 TJ for 45 sec. Then, E. coli is cooled by ice. E. coli is cultivated in 500 ⁇ i of cultivation medium at 37 TJ for 1 hour. After cultivation, cells are collected by centrifuge. Collected cells are spread in LB agar medium and cultivated at 37 TJ for 16 hours. Then, colonies are formed. After isolating plasmid DNA of cells in the colony, the sequence of DNA for mutein of interferon-beta is confirmed by DNA sequencer. As a result, 7 codons are replaced by the codon for encoding asparagine.
• the sequence of interferon-beta is mutated into Q72N, D73N, S75N, DllON, L116N, M117N, E137N.
• one or two mutated nucleotide sequences selected from the group consisting of Q72N, D73N, S75N, DllON, L116N, M117N, E137N are obtained.
• This plasmid is called as 'pGEMT-IFN- ⁇ -X' (X is number of mutein of interferon-beta).
• Table 1 shows the 22 kinds of mutated gene for mutein of interferon-beta prepared in the present invention.
• PCR is carried out with primer PI (SEQ ID NO: 27) and primer P2 (SEQ ID NO: 28) using pGEMT-IFN- ⁇ -X containing gene of mutein of interferon-beta as template. Then, gene for coding mutein of interferon-beta containing additional one or two Asn-X-Ser/Thr (N-X-S/T) sequence is obtained (FIG 3). DNA polymerase (Stratagene) is used for this PCR and the terminus of gene coding mutein of interferon-beta has restriction enzyme sites of EcoRI and Xhol. Then, pcDNA3.1
• muteins of interferon-beta N-2, N-5, N-19, N-20, N-22, COS cells are transfected by these expression vectors.
• COS cells is pre-cultivated like this. They are seeded into 60 mm tissue culture plate in a concentration of 2 * 10 cells/ mi to be cultured for 24 hours.
• 2 ⁇ g of expression vector DNA and 7 ⁇ i of LipofectinTM are added and reacted to 100 ⁇ i of serum-free DMEM medium for 15 min at room temperature. The mixture is again reacted for 15 min at room temperature to form Lipofectin-DNA complex.
• COS cells After adding serum-free DMEM to obtained Lipofectin-DNA complex, this complex is overlaid on COS cells. Said COS cells are transfected and incubated in 5% C0 2 incubator at 37 TJ for 6 hours. COS cells transfected by expression vectors are cultured in DMEM medium containing 10% fetal bovine serum (JRH), 50 ⁇ g/mi of penicillin and 50 ⁇ g/ mi of streptomycin in 5% C0 2 condition at 37 TJ for 48 hours. After 3 to 5 days culture, transfected COS cell suspension is collected.
• JRH fetal bovine serum
• the molecular weight of mutein of interferon-beta increases compared to that of natural interferon-beta (FIG 5).
• the molecular weight of mutein of interferon-beta decreases by the treatment of N-glycanase because additinal sugar chain is removed (FIG 6).
• the protein amounts of each interferon-beta are determined by EIA. Further, the potencies of both mutein of interferon-beta and natural interferon-beta are measured by antiviral activity test.
• EIA is carried out using PBL EIA kit. Each 100 ⁇ i of diluent solution is added to each designated well of the antibody conjugated plate in EIA kit. Also, 100 ⁇ i of diluted international standard solution and experimental solution are mixed and reacted for 1 hour at room temperature.
• the international standard solution is prepared by following steps; i ) dissolving one ample of international standard of human interferon-beta (NIBSC, England) with 1 mi of buffer; ii ) distributing 100 ⁇ i of standard solution to each vial; iii) storing this vial at -70 TJ; and iv) melting and diluting this vial at the time of using.
• IFN- ⁇ concentration according to each absorbance of international standard and test material is measured using standard curve.
• the value of interferon-beta concentration is calculated from the mean value of 3 different dilution samples.
• the antiviral activity test is carried out according to the same manner of described above.
• Table 2 shows the increase of M.W. of mutein of interferon-beta and the ratio of potency of antiviral activity/ EIA. According to this experiment, it is confirmed that the molecular weight of mutein of interferon-beta increases based upon the additional sugar chain, and that the antiviral activity of mutein of interferon-beta expressed from COS cell is same or better than that of natural interferon-beta.
• CHO cell (DG44) is cultured to be 4 0-80% (1-4 X 10 5 cell/60mm dish). After mixing 3 ⁇ i of
• LipofectAmoine reagent and 97 ⁇ i of cell cultivation medium ( ⁇ -MEM with media, serum-free, antibiotics-free), plasmid pcDNA3.1-IFN- ⁇ -X DNA (0.1 ⁇ g/ ⁇ i, 2 g) and plasmid pSP72-DHFR (0.2 ⁇ g) are added to cultured CHO cells.
• the medium is exchanged by alpha-MEM medium containing 10% FBS and 500 ⁇ g/ mi of G418.
• the transfected cells are selected after cultivating for 7 to 10 days in the minimal alpha-MEM medium deficient of deoxyribonucleoside and ribonucleoside.
• transfected cells (CHO DHFR+) are secondarily selected.
• Secondarily selected CHO DHFR+ transfected cells are cloned by limiting dilution method in 96 well plate.
• concentration of MTX metalhotrexate, Sigma, USA
• MTX resistant clone is thirdly selected by collecting the cells growing in MTX selection medium.
• the cell line growing at 1 ⁇ M of MTX medium more than 1 month is selected and isolated with following steps. i ) Culturing the cell line in 96 well-multi plate; ii ) selecting some cell line expressing a large amount of interferon-beta are selected by EIA; in) transferring said cell line into 24 well plate; and iv) subsequently transferring said cell line into 6 well plate. Finally, single cell line expressing interferon-beta among transfected CHO cells is selected and established by EIA. The amount of mutein of interferon-beta expressed by selected CHO-137 cell line reaches 8.6 ⁇ g/mi/ 24. hr, whereas the amount of interferon-beta expressed by normal CHO cell is only 1.8 ⁇ g/ mi/ 24. hr. Therefore, selected cell line has productivity twice more than that of natural cell line.
• Cell line obtained from Example 4 containing one or two mutated interferon-beta gene is cultured in cell factory (Nunc, Cat No. 170069). Expression cell line is transferred and cultured in a-MEM medium containing 10% FBS in a concentration of 5X10 cell/ m#. The cell line is grown on 5% C0 2 condition at 37 TJ for 72 hours. Grown cell line is washed with PBS 3 times to remove the serum component and the medium is exchanged by serum-free medium (Sigma C8730). The cultivated suspension is collected in every 24 hours interval by replacing serum-free medium. After collecting cultivated suspension 4 times, obtained suspension is purified.
• Non-adsorbed material is washed by flowing buffer B (20 mM sodium phosphate, 1 M NaCl, 30% Ethylen Glycol, pH 7.4) and the protein adsorbed in resin is eluted by buffer C (20 mM sodium phosphate, 1 M NaCl, 60% Ethylen Glycol, pH 7.4).
• Eluent solution is dialyzed by PBS (Phosphate Buffered Saline) and it is concentrated by concentrator (Centricon, Cut off 10,000). Finally, it is dialyzed by PBS.
• Example 5 Purified material obtained in Example 5 and 5X sample buffer solution (125 mM Tris-HCl, 5% SDS, 50% glycerol, 0.1% ⁇ -mercapto-ethanol, 1 mg/mi bromophenol blue) are mixed in a ratio of 1 : 4. After pretreatment at 95 TJ for 5 min, each 20 ⁇ i of testing material and molecular weight marker are developed in 15% polyacrylamide gel after loading them. After electrophoresis, it is stained with Coomassie Brilliant Blue and decolorized.
• the amount of interferon-beta in purified protein is detected using Human IFN- ⁇ ELISA kit (PBL).
• the amount of sialic acid is measured according to the method of Masaki Ito et al. (Masaki Ito et al., Anal. Biochem. 300, 260 (2002)).
• Sialic acid is isolated from glycoprotein after treating 0.1 N HC1 for 1 hour at 80 TJ .
• Isolated sialic acid is labeled using sialic acid fluorescent label kit (Takara) and the amount of sialic acid is measured using HPLC.
• Table 4 shows the percentage of weight sialic acid/ weight IFN- ⁇ . Mutein of interferon-beta shows about twice sialic acid amount compared to natural interferon-beta.
• the amount of interferon-beta from purified protein is measured using human IFN- ⁇ ELISA kit (PBL) and isoelectric point of protein is measured.
• PBL human IFN- ⁇ ELISA kit
• IEF vex IEF Gels kit
• the pattern of interferon-beta is confirmed by Western Blot. According to increase of amount of sialic acid at the terminus of sugar chain, the pattern of isoelectric point becomes to be declined (FIG 9).
• peptide mapping is carried out. Peptide mapping is carried out according to the method of Jun Utsumi et al. (Jun Utsumi et al., Eur. J. Biochem. 181, 545 (1989)). Each mutein of interferon-beta is cleaved by Lysyl endoproteinase from Achromobacter (WAKO). Then, it is reduced by DTT (Sigma) and alkylated by lodoacetamide (Sigma). Finally, it is cleaved by PNGase F enzyme (Sigma) to be same pattern of interferon-beta. Then, it is analyzed by HPLC using Reverse phase C18 column. It is confirmed that natural type and mutein of interferon-beta have same pattern (FIG 10).
• the antiviral activity is measured as to mutein of interferon-beta N-2, N-5, and N-20 and interferon-beta without sugar chain (IFN- ⁇ -lb) using natural interferon-beta as standard.
• A549 cells are cultured in MEM medium supplemented with 10% FBS, 5 mi of MEM nonessential amino acid 100X solution, 100 mM of sodium pyruvate. At the same day of analysis, cell are laid in fresh medium and the density of cell is adjusted into 300000 cell/m#. Interferons-beta in experimental group and control group are diluted. Dilution is carried out in the 96- well microtiter plate after delivering 100 ⁇ /well. All samples are tested in duplicate. Control well contains only 100 ⁇ i of medium (without IFN- ⁇ ). After delivering 100 ⁇ i of cells per each well, plate is incubated in 5% C0 2 condition at 37 TJ for 20 hours.
• Antiviral activity of IFN- ⁇ -lb without sugar chain shows low antiviral activity, whereas muteins of interferon-beta N-2, N-5, and N-20 show high antiviral activities compared to that of natural type.
• Mutein of interferon-beta N-20 having additional two sugar chain shows the best antiviral activity and muteins of interferon-beta N-2 and N-5 show similar antiviral activity (FIG 11).
• the anti-proliferation effect by mutein of interferon-beta is measured. This effect is measured compared to that of natural interferon-beta using Daudi cell.
• Daudi cells are cultured RPMI 1640 medium supplemented with 100 U/mi of penicillin, 100 mg/ mi of streptomycin, 2 mM of glutamine and 10% FBS.
• Interferons-beta in experimental group and control group are diluted using RPMI 1640 medium containing 10% FBS. Dilution is carried out in the 96-well microtiter plate after delivering 100 ⁇ i/wel ⁇ . All samples are tested in duplicate.
• Cells are distributed in a concentration of 10000 cell/ well in 96-well plate and incubated in 5% C0 2 condition at 37 TJ for 40 -48 hours. Then, 50 ⁇ i of medium containing 3[H] thymidine l ⁇ Ci is added into well and cells are incubated for 6 hours. After collecting cells, radioactive amount is measured.
• Mutein of interferon-beta has a anti-proliferation effect as to Daudi cell and the activity depends on the amount of interferon-beta.
• IFN- ⁇ -lb shows low anti-proliferation effect
• muteins of interferon-beta N-2, N-5 and N-20 show high anti-proliferation effect compared to that of natural interferon-beta. Therefore, it is confirmed that anti-proliferation effect increases according to the increase of number of additional sugar chain in mutein of interferon-beta (FIG 12).
• the immno-regulation function of natural and muteins of interferon-beta are measured by the activation of MHC class I in A549 cell.
• A549 cells are cultured in DMEM medium containing 10% FBS and 2 mM glutamine. After diluting cells, cells are delivered to the medium containing diluted natural interferon-beta, muteins of interferon-beta and IFN- ⁇ -lb in a concentration of 100000 cell/m£. Then, cells are incubated in 5% C0 2 condition at 37 TJ for 48 hours. After treating cells with Hank's buffered salt solution containing 5 mM EDTA, cells are collected by centrifugation. Cells are diluted to the concentration of 2 x 10 cell/ mi with FACS buffer and the expression of MHC class I is measured by FACS analysis. Anti-HLA ABC antibody coupled with biotin and streptavidin coupled with fluorescence are used for detection. All samples are tested in duplicate.
• interferon-beta shows slightly better immune-enhanced effect compared to that of IFN- ⁇ -la. It is also confirmed that immune-enhanced effect increases according to the increase of number of additional sugar chain in interferon-beta, and that IFN- ⁇ -lb without additional sugar chain shows low immune-enhanced effect (FIG 13).
• 1 group consists of random sampling 4 animals under same weight range. Experiment is carried out under three groups i ) administered with natural interferon-beta, ii ) administered with mutein of interferon-beta, and iii) without administering any drug. Catheter is inserted two days before experiment and the average weight of rats is 253.5 g.
• Natural interferon-beta and mutein of interferon-beta are injected in vein of rats.
• the blood is collected from the catheter at the times of 1, 5, 15, 30 min, 1 hr 15 min, 3 hr, 5 hr, 8 hr after injection.
• the tube is washed with normal saline and the amount of each collected blood is 0.3 mL.
• the catheter is filled with heparin saline (50 IU/mL). Collected blood is treated with anti coagulant (sodium citrate 4%) and it is centrifuged to collect plasma after removing blood cells.
• anti coagulant sodium citrate 46%
• FIG 14 shows the plasma concentration of interferon-beta (muteins of interferon-beta expressed by CHO cell and natural interferon-beta) in rats at time interval. Pharmacokinetics is calculated by above plasma concentration in rats. The results are shown in Table 3.

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Toxicology (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicinal Chemistry (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=33128926

Family Applications (1)

Country Status (2)

Cited By (3)

Families Citing this family (1)

Citations (3)

• 2003
  • 2003-03-31 KR KR20030019924A patent/KR100541850B1/ko not_active IP Right Cessation
• 2004
  • 2004-03-31 WO PCT/KR2004/000738 patent/WO2004087753A1/en active Application Filing

Patent Citations (3)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events