Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
  • A61K38/10—Peptides having 12 to 20 amino acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

• Fig. 3A is a panel of photographs showing no visible lung metastasis in the group treated with CXCR4 antagonist.
• “Pharmaceutically acceptable salt” refers to those salts which retain the biological effectiveness and properties of the free bases and which are obtained by reaction with inorganic or organic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, malic acid, maleic acid, succinic acid, tartaric acid, citric acid, and the like.
• inorganic or organic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, malic acid, maleic acid, succinic acid, tartaric acid, citric acid, and the like.
• siRNA means a small inhibitory ribonucleic acid.
• the siRNA are typically less than 30 nucleotides in length and can be single or double stranded.
• the ribonucleotides can be natural or artificial and can be chemically modified.
• Longer siRNAs can comprise cleavage sites that can be enzymatically or chemically cleaved to produce siRNAs having lengths less than 30 nucleotides, typically 21 to 23 nucleotides.
• siRNAs share sequence homology with corresponding target mRNAs. The sequence homology can be 100 percent or less but sufficient to result is sequence specific association between the siRNA and the targeted mRNA.
• inhibitory nucleic acid means an RNA, DNA, or combination thereof that interferes or interrupts the translation of mRNA. Inhibitory nucleic acids can be single or double stranded. The nucleotides of the inhibitory nucleic acid can be chemically modified, natural or artificial.
• antibody therapy may be limited by: (i) the difficulty or expense of commercial-scale production; (ii) delivery problem and slow diffusion due to a large mass; and (ii) exclusion of monoclonal antibody from compartments like the blood/brain barrier (Cho, M. J. and Juliano, R. Macromolecular versus small-molecule therapeutics: drug discovery, development and clinical considerations. Trends Biotechnol, 14: 153- 158, 1996).
• large molecules such as antibodies with a molecular weight of 150kDa may not easily diffuse between cells inside of the solid tumor. Therefore, antibodies may be inefficient molecules to target cells deep within the tumor mass.
• Another CXCR4 antagonist includes T134 (Arakaki, R. T134, a small-molecule CXCR4 inhibitor, has no cross-drug resistance with AMD3100, a CXCR4 antagonist with a different structure. Journal of Virology, February 1999, p. 1719-1723, Vol.73, No.2). 2.2 Polynucleotide Antagonists
• biotinylated CXCR4 antagonist is a potent reagent for detecting CXCR4 receptors from cultured cancer cells and paraffinized tissues on breast cancer patients through the use of immunofluorescence and flow cytometry.
• the combined usage of the CXCR4 antagonist and other antibodies of known metastatic markers e.g., Her-2
• a specific dosage form of the compositions of the disclosure comprises: a wall defining a cavity, the wall having an exit orifice formed or formable therein and at least a portion of the wall being semipermeable; an expandable layer located within the cavity remote from the exit orifice and in fluid communication with the semipermeable portion of the wall; a dry or substantially dry state drug layer located within the cavity adjacent the exit orifice and in direct or indirect contacting relationship with the expandable layer; and a flow-promoting layer interposed between the inner surface of the wall and at least the external surface of the drug layer located within the cavity, wherein the drug layer comprises a salt of a CXCR4 antagonist, or a polymorph, solvate, hydrate, dehydrate, co-crystal, anhydrous, or amorphous form thereof. See U.S. Pat. No. 6,368,626, the entirety of which is incorporated herein by reference.
• additional components may be used prior to, in conjunction with, or subsequent to treatment with pharmaceutically acceptable salts of a CXCR4 antagonist of the disclosure.
• penetration enhancers can be used to assist in delivering the active ingredients to or across the tissue.
• Kits of the disclosure can further comprise pharmaceutically acceptable vehicles that can be used to administer one or more active ingredients.
• the kit can comprise a sealed container of a suitable vehicle in which the active ingredient can be dissolved to form a particulate-free sterile solution that is suitable for parenteral administration.
• the average copy number of CXCR4 gene was calculated per ⁇ g of total RNA.
• total RNA was prepared from frozen tissue sections of animal lungs with Trizol (Invitrogen) according to manufacturer's instruction.
• the human HPRT-specific primers pairs are from the previous report 12
• the human CXCR4-specific primers for 149 base pairs are 5'- GAACCCTGTTTCCGTGAAGA (SEQ ID NO: 17) and 5'- CTTGTCCGTCATGCTTCTCA (SEQ ID NO: 18) (Genbank Accession no.
• siRNAs and transfection Two different siRNA duplexes were designed (Genbank Accession no. NM D03467 which is incorporated by reference in its entirety).
• the cDNA-targeted region and the sequence of the siRNAs duplexes are as follows: 197 - AATAAAATCTTCCTGCCCACC- 217 (SEQ ID NO: 4) for siRNAI , 529 AAGGAAGCTGTTGGCTGAAAA- 549 (SEQ ID NO: 5) for siRNA2.
• the non-specific Control siRNA duplexes were purchased from Dhamacon Inc. with the same GC content as CXCR4 siRNAs (42%, D001206-10).
• SDF-1 ⁇ was added to the lower chamber to attract CXCR4-positive breast cancer cells to migrate through the matrigel. In the absence of SDF-1 , the invasion rate was very low. With 400 ng/ml of SDF-la in the bottom chamber, significantly greater numbers of MDA-MB-231 cells responded to the chemoattractant and migrated into the bottom chamber. This SDF-1 mediated invasion was suppressed by the addition of 25 ⁇ g/ml of antibody directed against the CXCR4 receptor (MAS 173, R & D) ( Figure 2).
• Ejcample 3 CXCR4 antagonist blocked breast cancer metastasis in animal model To extend our in vitro findings an experimental metastasis animal model of breast cancer metastasis was established. MDA-MB-231 cells in conjunction with the control peptide or CXCR4 antagonist were administered twice intravenously to female SCID mice supplemented with 17 ⁇ -estradiol. The CXCR4 antagonist or control peptide treatment was continued twice weekly for 55 days. All seven mice of the control group injected with MDA-MB-231 cells that were treated with control peptide developed lung metastases. Three representative pictures of lungs in figure 3 A exhibit bubble-looking lung micrometastasis in the control group (top panel). On the other hand, three out of seven mice treated with CXCR4 antagonist i.v.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Pharmacology & Pharmacy (AREA)
• Medicinal Chemistry (AREA)
• Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Epidemiology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Gastroenterology & Hepatology (AREA)
• Immunology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)
• Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (2)

Family

ID=33131767

Family Applications (1)

Country Status (5)

Cited By (33)

Families Citing this family (12)

Family Cites Families (2)

• 2004
  • 2004-03-26 JP JP2006509429A patent/JP2006524242A/ja active Pending
  • 2004-03-26 EP EP04758528A patent/EP1608318A4/en not_active Withdrawn
  • 2004-03-26 CA CA002520406A patent/CA2520406A1/en not_active Abandoned
  • 2004-03-26 WO PCT/US2004/009570 patent/WO2004087068A2/en not_active Ceased
• 2007
  • 2007-04-16 US US11/787,366 patent/US20070258893A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events