WO2004055186A1 - Recepteur couple a une proteine de liaison a la guanosine triphosphate - Google Patents

Recepteur couple a une proteine de liaison a la guanosine triphosphate Download PDF

Info

Publication number
WO2004055186A1
WO2004055186A1 PCT/JP2003/016245 JP0316245W WO2004055186A1 WO 2004055186 A1 WO2004055186 A1 WO 2004055186A1 JP 0316245 W JP0316245 W JP 0316245W WO 2004055186 A1 WO2004055186 A1 WO 2004055186A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
dna
polynucleotide
present
expression
Prior art date
Application number
PCT/JP2003/016245
Other languages
English (en)
Japanese (ja)
Inventor
Makiko Suwa
Kiyoshi Asai
Yutaka Akiyama
Hiroyuki Aburatani
Original Assignee
National Institute Of Advanced Industrial Science And Technology
Toudai Tlo, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Institute Of Advanced Industrial Science And Technology, Toudai Tlo, Ltd. filed Critical National Institute Of Advanced Industrial Science And Technology
Priority to AU2003292569A priority Critical patent/AU2003292569A1/en
Publication of WO2004055186A1 publication Critical patent/WO2004055186A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel polypeptide belonging to the family 1 of a guanosine triphosphate binding protein-coupled receptor (hereinafter referred to as “GPCR”), a polynucleotide encoding the polypeptide, and production and use of these molecules.
  • GPCR guanosine triphosphate binding protein-coupled receptor
  • GPCR (Baldwin, J. J Curr. Op in. Cell Biol. 6, 180-190 (1994)., Strader, CD, et al. FASEB. J. 9, 745-754 (1995)., Bockaert, J., Pin, JP EM BO. Drugs targeting J. 18, 1723-1729 (1999).) Are the majority. For this reason, GPCR is one of the most important targets for discovering genes for drug design.
  • GPCRs are involved in signal transduction induced by specific ligands such as adrenaline and acetylcholine, and the characteristics of their binding mechanisms have been extensively investigated by experiments (Watson, S & Arkinsrtall, S. The G-prote in Linked receptor Facts Book. (Academic Press, London)).
  • the present invention has been made in view of such circumstances, and its purpose is to develop an automatic method for efficiently extracting GPCR sequences from human genome sequences, thereby comprehensively identifying novel GPCRs. There is.
  • Another object of the present invention is to provide the use of the novel GPCR identified as described above.
  • One preferred embodiment of the novel GPCR provides an application for screening for drug candidate compounds such as ligands.
  • the present invention provides a method for examining a disease using the mutation or abnormal expression of the novel GPCR as an index.
  • the present invention provides a novel GPCR or a molecule that modulates its activity for use in the treatment of diseases.
  • the first step is gene prediction, ie, translation from genomic sequence to amino acid sequence.
  • Many of the known GPCR genes do not contain introns, so 6-frame expansion of nucleotide sequences can be supported to some extent, but for sequences with multiple exons, the entire gene structure can be predicted using a gene discovery program. There is a need to.
  • the second stage consists of a triple analysis of the amino acid sequence. That is, (1) searching for sequences for known GPCR devices, (2) motif and domain assignment, and (3) transmembrane helix (TMH) prediction.
  • TMH transmembrane helix
  • the former two techniques are used to find closely related GPCR homologues, while TMH prediction is used to deal with distantly related GPCR homologues.
  • the candidate sequences are screened by taking the union of the results of each of the three analyses. The present inventors used union to maximize the number of candidate sequences at the screening stage.
  • the third step is to further refine the quality of the candidate gene by deleting duplicate sequences or fusing fragment sequences separated by misprediction.
  • This automated system allows efficient and comprehensive discovery of GPCR sequences.
  • a major advantage of this automatic system is that it can be detected even with GPCR sequences consisting of Marchexon and distantly related homolog sequences that were difficult to find with conventional methods.
  • the inventors succeeded in identifying 1215 new GPCR sequences guaranteed with high reliability from the entire human genome by using this automated system developed uniquely, and cDNA for one of these clones was identified. Isolated.
  • the discovery of new GPCR sequences is based on the discovery of ligands, antagonists or antagonists that are expected to be useful as pharmaceuticals. Enables cleaning. GPCRs are thought to have important functions in vivo, and abnormal expression or function can cause various diseases. For this reason, it is possible to examine such diseases by using inappropriate activity or expression of the identified GPCR as an index. Identified GPCRs, the polynucleotides that encode them, and ligands, antagonists or agonists for the identified GPCRs would be suitable therapeutics for these diseases.
  • the present invention relates to a novel GPCR and its gene, and their production and use. More specifically, the present invention provides the following (1) to (32).
  • the polynucleotide according to any one of (a) to (d).
  • the method for producing the polypeptide according to (5) comprising the step of culturing the host cell according to (4) and recovering the produced polypeptide from the host cell or a culture supernatant thereof. .
  • a kit comprising at least one molecule according to (a) or (b).
  • a pharmaceutical composition comprising an effective amount above.
  • a pharmaceutical composition comprising an effective amount above.
  • step (d) The process of comparing the base sequence of DM determined in step (c) with the control.
  • GPCR guanosine triphosphate binding protein-coupled receptor
  • polynucleotide means a ribonucleotide or deoxynucleotide, which is a polymer composed of a plurality of bases or base pairs.
  • Polynucleotides include single and double stranded DNA. Polynucleotides are unmodified from their naturally occurring state, and modified Is meant to include both. Modified bases include, for example, tritylated bases and special bases such as inosine.
  • polypeptide means a polymer composed of a plurality of amino acids. Thus, oligopeptides and proteins are also included in the polypeptide concept. Polypeptide is meant to include both unmodified and modified from the naturally occurring state.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, flavin covalent bond, heme moiety covalent bond, nucleotide or nucleotide derivative covalent bond, lipid or lipid derivative covalent bond, phosphatidylinositol Covalent bond, crosslinking, cyclization, disulfide bond formation, demethylation, covalent bridge formation, cystine formation, pyroglutamate formation, formylation, alpha-carboxylation, glycosylation, GPI anchor formation, RNA-mediated addition of amino acids to proteins such as hydroxylation, iodination, methylation, myristoylation, oxidation, proteolysis, phosphorylation, prenylation, racemization, selenoylation, sulfation, arginylation, Includes ubiquitination.
  • isolated refers to a substance (eg, a polynucleotide or polypeptide) that has been removed from its original environment (eg, the natural environment if it occurs naturally). It has been changed by human hands. “Isolated” is meant to include compounds present in a sample substantially enriched in the compound of interest and compounds present in a sample in which Z or the compound of interest is partially or substantially purified. As used herein, the term “substantially purified” is separated from its natural environment and is free of at least 60%, preferably 75%, and most preferably 90% of other components associated with nature. Refers to a compound (eg, a polynucleotide or polypeptide).
  • a “mutation” is an amino acid change in an amino acid sequence or a base change in a base sequence (ie, single or multiple amino acids). Or nucleotide substitution, deletion, addition or insertion). Accordingly, a “variant” as used herein refers to an amino acid sequence in which one or more amino acids are changed or a base sequence in which one or more bases are changed. This change in the base sequence of the mutant may or may not change the amino acid sequence of the polypeptide encoded by the reference polynucleotide.
  • the mutant may be a naturally occurring mutant such as an allelic mutant or a mutant that is not known to exist naturally. A variant may have conservative changes in which the substituted amino acid has similar structural or chemical properties.
  • the variant may have non-conservative substitutions.
  • Guidance on determining which and how many amino acid residues to replace, insert, or delete without inhibiting biological or immunological activity is well known in the art. It can be found using a computer program such as DNA Star software.
  • a “deletion” is an amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues are not present compared to the amino acid sequence or nucleotide sequence of a naturally occurring GPCR or GPCR-related polypeptide, respectively. Any change.
  • an “insertion” or “addition” is an amino acid or nucleotide to which one or more amino acid or nucleotide residues are added, respectively, compared to the amino acid sequence or nucleotide sequence of a naturally occurring GPCR or GPCR-related polypeptide. It is a sequence change.
  • substitution is an amino acid or nucleotide sequence in which one or more amino acids or nucleotides are replaced with different amino acids or nucleotides as compared to the amino acid sequence or nucleotide sequence of a naturally occurring GPCR or GPCR-related polypeptide. It is a change.
  • hybridization refers to the process by which a nucleic acid strand binds to a complementary strand through base pairing.
  • treatment generally means obtaining a pharmacological and / or physiological effect. The effect may be prophylactic in that the disease or symptom is completely or partially prevented, or may be therapeutic in that the symptom of the disease is completely or partially treated.
  • treatment includes all treatment of diseases in mammals, particularly humans. In addition, the term includes prevention of the onset of a subject who is predisposed to the disease but has not yet been diagnosed, suppressing the progression of the disease, or reducing the disease.
  • ligand means a molecule that binds to a polypeptide of the invention.
  • Ligand includes natural and synthetic ligands.
  • Antist means a molecule that binds to and activates a polypeptide of the invention.
  • an evening gonist means a molecule that inhibits activation of the polypeptide of the present invention.
  • the present invention provides a novel polypeptide belonging to the GPCR family.
  • the nucleotide sequence of a human-derived polynucleotide identified by the present inventors contained in the present invention is shown in SEQ ID NO: 19 and the amino acid sequence of the polypeptide encoded by the polynucleotide is shown in SEQ ID NO: 20.
  • GPCR has the activity to transmit intracellular hesidanal through the activation of G protein by the action of its ligand, including genetic diseases, cranial nervous system, circulatory system, digestive system, immune system, exercise It is associated with a vast number of diseases, including the genital system and the urogenital system. Therefore, the polypeptide of the present invention can be used for screening of a ligand, an agonis moth or an antagonism moth that regulates its function, and is an important target for the development of a pharmaceutical for the above diseases.
  • the present invention also provides polypeptides that are functionally equivalent to the polypeptides identified by the present inventors.
  • “functionally equivalent” means that the subject polypeptide has the same biological characteristics as the polypeptide identified by the present inventors. Means that.
  • Biological properties of GPCRs include the ability to transduce signals into cells through the binding activity of ligands and the activation of trimeric GTP-binding proteins. Trimeric GTP-binding proteins are classified into three types: GQ type that increases Ca ' 2+ , Gs type that increases cAMP, and Gi type that suppresses cAMP, depending on the type of intracellular transmission system that is activated. Classified into categories (Trends Pharmacol. Sci. (99) 20: 118). Therefore, whether or not the polypeptide of interest has the same biological characteristics as the polypeptide identified by the present inventors can be determined by, for example, determining the intracellular cAMP concentration or calcium by activation. It can be evaluated by detecting changes in concentration.
  • One embodiment of a method for preparing a polypeptide functionally equivalent to the polypeptide identified by the present inventors is a method of introducing a mutation into an amino acid sequence in a protein.
  • Such methods include, for example, site-directed mutagenesis (Current Protocols in Molecular Biology edit. Ausubel et al. (1987) Publ is h. Jhon Wily & Sons Section 8.1-8.5)).
  • amino acid mutations in polypeptides may occur in nature.
  • one or more amino acids are substituted in the amino acid sequence (SEQ ID NO: 20) of the polypeptide identified by the present inventors, whether artificial or naturally occurring.
  • the amino acid to be substituted is preferably an amino acid having properties similar to the amino acid before substitution from the viewpoint of maintaining the function of the protein.
  • Ala, Val, Leu, Ile, Pro, Met, Phe, and Tn are all classified as nonpolar amino acids, and thus are considered to have similar properties.
  • uncharged properties include Gly, Ser, Thr, Cys, Tyr, Asn, and Gin.
  • acidic amino acids include Asp and Glu
  • examples of basic amino acids include Lys, Arg, and His.
  • the number of amino acid mutations and mutation sites in these polypeptides are retained. There are no restrictions as far as possible.
  • the number of mutations will typically be within 10% of all amino acids, preferably within 5% of all amino acids, and more preferably within 1% of all amino acids.
  • the stringent hyperprecipitation conditions for isolating DNA encoding a polypeptide functionally equivalent to the polypeptide identified by the present inventors are usually “lxSSC, 0.13 ⁇ 4 SDS , 37 '', more severe conditions are ⁇ 0.5xSS 0.1 3 ⁇ 4 SDS, 42t: '', and more severe conditions are ⁇ 0.2xSSC, 0.1% SDS '' It is a condition of “about 65”. As the hybridization conditions become more severe, the isolation of DNA having a high homology with the probe sequence can be expected.
  • the above combinations of SS SDS and temperature conditions are examples, and those skilled in the art will determine the stringency of the hybridization.
  • the above-mentioned or other factors for example, probe concentration, probe length, hybridization reaction time, etc. can be combined as appropriate to achieve the same stringency as described above.
  • Polypeptides encoded by DNA isolated using such hybridization technology usually have high homology in amino acid sequence with the polypeptides identified by the present inventors.
  • High homology means at least 40% or more, preferably 60% or more, more preferably 80% or more, more preferably 90% or more, still more preferably at least 95% or more, more preferably at least 97% or more (e.g. 98-99%).
  • the identity of amino acid sequences can be determined, for example, by the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2 264-2268, 1990, Proc. Natl. Acad. Sci. USA 90: 5873-5877, by Karl in and Altschul, 1993).
  • BLASTX a product called BLASTX (Altschul et al. J. Mol. Biol. 215: 403-410, 1990).
  • score 50
  • wordlength 3 for example.
  • BLAST and Gapped BLAST programs use the default parameters of each program. Specific methods of these analysis methods are known (http: ⁇ www.ncbi.nlm.nih.gov.).
  • a primer is designed based on a part of the DNA sequence (SEQ ID NO: 19), and a DNA fragment highly homologous to the DNA sequence encoding the polypeptide identified by the present inventors is isolated, It is also possible to obtain a polypeptide functionally equivalent to the polypeptide identified by the present inventors based on DNA.
  • polypeptides of the present invention may be in the form of a “mature” protein or may be part of a larger protein, such as a fusion protein.
  • Polypeptide of the present invention may include secretory or leader sequences, pro sequences, sequences useful for purification, such as multiple histidine residues, or additional sequences that ensure stability during recombinant production.
  • the present invention also provides fragments of the polypeptides of the present invention.
  • a fragment is a polypeptide having an amino acid sequence which is entirely the same as a part of the amino acid sequence of the polypeptide of the present invention but not the same.
  • the polypeptide fragment of the present invention is a polypeptide fragment consisting of a sequence of usually 8 amino acid residues or more, preferably 12 amino acid residues or more (for example, 15 amino acid residues or more). Suitable fragments include, for example, deletion of a series of residues containing an amino terminus or a series of residues containing a carboxyl terminus, or a series of residues containing an amino terminus and a series of residues containing a carboxyl terminus.
  • fragments having amino acid sequences deleted of duplicate residues.
  • ⁇ -helix and ⁇ -helix formation region [] 3 sheet and / 3 sheet formation region, turn and turn formation region, coil and coil formation region, hydrophilic region, hydrophobic region, lyophilic region, / 3 parents
  • fragments characterized by structural or functional properties, such as fragments comprising a basal region, a variable region, a surface forming region, a substrate binding region, and a high antigen index region.
  • Other suitable fragments are biologically active fragments.
  • Biologically active fragments are those that mediate the activity of a polypeptide of the invention, including fragments with similar activity, fragments with enhanced activity, or fragments with reduced undesirable activity.
  • a fragment having an activity of binding a ligand to perform signal transduction into a cell can be mentioned.
  • fragments that are antigenic or immunogenic in animals, particularly humans are also included.
  • These polypeptide fragments preferably retain the biological activity of the polypeptide of the present invention, including antigenic activity.
  • Variants of the identified sequences and fragments also form part of the present invention.
  • Preferred variants are those that differ from the target by conservative amino acid substitutions, that is, a residue that is substituted with another residue of similar nature. Typical Such substitutions are between Ala, Val, Leu and lie, between Ser and Thr, between acidic residues Asp and G1 u, between Asn and Gin, between basic residues Lys and Arg, or aromatic Occurs between residues Phe and Tyr.
  • a fragment that binds to a ligand and does not perform signal transduction in a cell is useful because it can be a competitive inhibitor of the polypeptide of the present invention, and such a fragment is also included in the present invention.
  • polypeptides of the present invention can be produced by any suitable method.
  • Such polypeptides include an isolated naturally occurring polypeptide, a recombinantly produced polypeptide, a synthetically produced polypeptide, or a polypeptide produced by a combination of these methods. Is included. Means for the production of such polypeptides are well understood in the art.
  • a recombinant polypeptide can be prepared, for example, by introducing a vector inserted with the polynucleotide of the present invention into a suitable host cell and purifying the polypeptide expressed in the transformant.
  • a naturally-occurring polypeptide can be prepared, for example, by using a affinity ram bound with an antibody against the polypeptide of the present invention described later (Current Protocols in Molecular Biology edit. Ausubel et al. al. (1 987) Publish. John Wiley & Sons Section 16.1-16.19).
  • the antibody used for affinity purification may be a polyclonal antibody or a monoclonal antibody.
  • In vitro translation see, for example, “0n the fidelity of mRNA translation in the nuclease-treated rabbi t reticulocyte lysate syste m.
  • polypeptide of the present invention It is also possible to prepare the polypeptide of the present invention by, for example.
  • the polypeptide fragment of the present invention can be produced, for example, by cleaving the polypeptide of the present invention with an appropriate peptidase.
  • the present invention also provides a polynucleotide encoding the polypeptide of the present invention.
  • the polynucleotide of the present invention includes a polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 20; a polynucleotide comprising the coding region of the base sequence set forth in SEQ ID NO: 19; A polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 20 but comprising a base sequence different from the base sequence set forth in SEQ ID NO: 19 due to the degeneracy of the genetic code is included.
  • the polynucleotide of the present invention further encodes a polypeptide functionally equivalent to the polypeptide encoded by these polynucleotides, and is at least 40% or more, preferably 60%, in the polynucleotide sequence and its total length. More preferably, 80% or more, more preferably 90% or more, more preferably 95% or more, and even more preferably 97% or more (for example, 98 to 99%) including a polynucleotide containing the same base sequence. It is.
  • the identity of the base sequence can be determined by, for example, the algorithm BLAST (Proc. Nat l. Acad. Sci. USA 87: 2264-2268, 1990, Pro Nat l. Acad. Sci.
  • the polynucleotide of the present invention includes a polynucleotide having a base sequence complementary to the base sequence of the above-mentioned polynucleotide.
  • the polynucleotide of the present invention can be obtained by standard cloning and screening, for example, from a cDNA library derived from mRNA in cells.
  • the polynucleotide of the present invention can be obtained from a natural source such as a genomic DNA library, and can also be synthesized using known techniques that are commercially available.
  • a polynucleotide comprising a nucleotide sequence having a significant homology with the polynucleotide sequence (SEQ ID NO: 19) identified by the present inventors can be obtained by, for example, hybridization technology (Current Protocols in Molecular Biology edit. Ausubel et al.). al. (1987) Publish.
  • a primer is designed based on a part of the polynucleotide sequence (SEQ ID NO: 19) identified by the present inventors, and is highly homologous to the polynucleotide sequence.
  • the polynucleotide can be isolated. Therefore, the present invention includes a polynucleotide that hybridizes with the polynucleotide having the base sequence of SEQ ID NO: 19 under stringent conditions. Stringent-end hybridization conditions are usually about “lxSS 0.13 ⁇ 4 SDS, 37”, and more severe conditions are about “0.5xSS 0.13 ⁇ 4 SDS, 42”. For example, the condition is about 0.2xSS (:, 0.13 ⁇ 4 SDS, 65).
  • a polynucleotide comprising a nucleotide sequence having significant homology with the polynucleotide sequence identified by the present inventors is mutated to the nucleotide sequence set forth in SEQ ID NO: 19 (For example, site-specific mutagenesis (Current Protocols in Molecular Biology ed. Ausube let al. (1987) Publ i sh. John Wiley & Sons Sect i on 8.1) -8. It can also be prepared using 5)).
  • Such polynucleotides can also be caused by mutations in nature.
  • polypeptide in which one or a plurality of amino acids in the amino acid sequence shown in SEQ ID NO: 20 is substituted, deleted, inserted and / or added due to such mutation of the base sequence is used.
  • a polynucleotide that encodes is included.
  • the polynucleotide of the present invention when used for the recombinant production of the polypeptide of the present invention, the polynucleotide includes a mature polypeptide coding sequence or a fragment thereof alone, other coding sequences (eg, leader or secretory sequence). , Pre-, pro-, or pre-mouth protein sequences, or coding sequences for mature polypeptides that are in the same reading frame as those that encode other fusion peptide moieties) or fragments thereof. For example, a marker sequence that facilitates purification of the fusion polypeptide can be encoded.
  • the marker sequence is provided by the pcDNA3.1 / Myc-His vector (Invitrogen) and Gentz et al., Proc. Natl. Acad. Sci. USA ( 1989) 86:82 ⁇ 824. Hexa-histidine peptide as described in Myc tag.
  • the polynucleotide may also include 5 'and 3' non-coding sequences, such as transcribed but not translated sequences, splicing and polyadenylation signals, ribosome binding sites, and mRNA stabilizing sequences.
  • the present invention relates to a nucleotide having a chain length of at least 15 nucleotides, which is complementary to the polynucleotide identified by the present inventors (polynucleotide comprising the base sequence described in SEQ ID NO: 19 or its complementary strand).
  • polynucleotide comprising the base sequence described in SEQ ID NO: 19 or its complementary strand.
  • complementary strand refers to the other strand of one strand of a double-stranded nucleic acid consisting of A: T (U in the case of RNA) and G: C base pairs.
  • “Complementary” means at least 15 consecutive It is not limited to a completely complementary sequence in the nucleotide region, and at least 70%, preferably at least 80%, more preferably 90%, and even more preferably 95% or more of the homology on the base sequence is sufficient. .
  • the algorithm described in this specification may be used.
  • Such a nucleotide can be used as a probe for detecting and isolating the polynucleotide of the present invention and as a primer for amplifying the nucleotide of the present invention. When used as a primer, it usually has a chain length of 15 to 100 nucleotides, preferably 15 to 35 nucleotides.
  • nucleotides having a chain length of at least 15 nucleotides, preferably at least 30 nucleotides, including at least a part or all of the sequence of the DNA of the present invention are used.
  • Such nucleotides are preferably those that specifically hybridize to the DNA encoding the polypeptide of the present invention.
  • “Specifically hybridize” means to hybridize with the nucleotide (SEQ ID NO: 19) identified by the present inventors under normal hybridization conditions, preferably under stringent conditions. It means not hybridizing with DNA encoding another polypeptide.
  • nucleotides include polynucleotides that suppress the expression of the gene encoding the polypeptide of the present invention.
  • polynucleotides include antisense DNA (DNA encoding antisense RNA complementary to the transcription product of the gene encoding the polypeptide of the present invention) or ribozyme (transcription of gene encoding the polypeptide of the present invention).
  • transcription initiation inhibition by triplex formation, and formation of a hybrid with a site where an open loop structure was locally created by RNA polymerase Transcriptional suppression by RNA Transcriptional inhibition by hybridization with RNA, which is being synthesized
  • Splicing suppression by formation of hybrid at the junction of intron and exon Splicing suppression by formation of hybrid with spliceosome formation site
  • Splicing with mRNA Suppression of transition from nucleus to cytoplasm due to hybridization suppression of splicing by hybridization with a capping site or poly (A) addition site, suppression of translation initiation by formation of a hybrid with a translation initiation factor binding site, ribosome binding site near the initiation codon Translational inhibition by the formation of hyperids, inhibition of peptide chain elongation by the formation of hybrids with mRNA translation regions and polymerase binding sites, and suppression of gene expression by the formation of hybrids between nucleic acid
  • the antisense DNA used in the present invention may suppress the expression of the target gene by any of the actions described above.
  • designing an antisense sequence complementary to the untranslated region near the 5 'end of the mRNA of a gene would be effective in inhibiting gene translation.
  • a sequence complementary to the coding region or 3 'untranslated region is also used.
  • the DNA containing the antisense sequence of not only the translated region of the gene but also the sequence of the untranslated region is also included in the antisense DNA used in the present invention.
  • the antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side.
  • the sequence of the antisense DNA is preferably a sequence complementary to the target gene or a part thereof, but may not be completely complementary as long as the gene expression can be effectively inhibited.
  • the transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcription product of the target gene.
  • the antisense DNA has a chain length of at least 15 bp, preferably 100 bp, more preferably 500 bp or more in order to cause an antisense effect. Have Usually, it has a chain length of 3000 bp or less, preferably 2000 bp or less.
  • antisense DNA may be applied to gene therapy for diseases caused by abnormality (functional abnormality or expression abnormality) of the polypeptide of the present invention.
  • the antisense DNA is, for example, based on the sequence information of DNA encoding the polypeptide of the present invention (for example, SEQ ID NO: 19) (Stein, 1988 Physicochemi cal roperties of phosphorothioate oligodeoxynucleotides. Nucleic Acids). Res 16, 3209-21 (1988)) and the like.
  • ribozyme is an RNA molecule that has catalytic activity.c Some ribozymes have various activities. Among them, research on ribozymes as enzymes that cleave RNA has made site-specific cleavage of RNA possible. The target ribozyme can be designed.
  • Liposomes include group I introns and M1RNAs of RNaseP that are over 400 nucleotides in size, but the hammer-head type hairpin type has an active domain of about 40 nucleotides. Some have (Makoto Koizumi and Eiko Otsuka, (1990) Protein Nucleic Acid Enzymes, 35: 2191).
  • the self-cleaving domain of the hammerhead ribozyme cleaves on the 3 'side of C15 of G13U14C15, but it is important for activity that U14 forms a base pair with A at position 9, and the base at position 15 Has been shown to be cleaved by A or cocoons in addition to C (M. Koizum i et al., (1988) FEBS Lett. 228: 225).
  • the ribozyme substrate binding site is designed to be complementary to the RNA sequence in the vicinity of the target site, a restriction enzyme-like RNA cleavage ribozyme that recognizes the U (:, UU or M sequence in the target RNA can be created.
  • Hairpin ribozymes are also useful for the purposes of the present invention.
  • Type ribozymes are found, for example, in the negative strand of satellite RNA of tobacco ring spot virus (JMBuzayan Nature 323: 349, 1986) D It has been shown that this liposome can also be designed to cause target-specific RNA cleavage (Y. Kikuchi and N. Sasaki (1992) Nucleic Acids Res. 19: 6751, Hiroshi Kikuchi, (1992) Chemistry and Biology 30: 112).
  • the polynucleotide that suppresses the expression of the gene encoding the polypeptide of the present invention can be used for gene therapy, for example, a viral vector such as a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector.
  • a viral vector such as a retrovirus vector, an adenovirus vector, and an adeno-associated virus vector.
  • -It is possible to administer to patients by ex vivo or in method using non-viral vectors such as
  • the present invention also provides a vector containing the polynucleotide of the present invention, a host cell carrying the polynucleotide of the present invention or the vector, and a method for producing the polypeptide of the present invention using the host cell. .
  • the vector of the present invention is not particularly limited as long as it stably holds the inserted DNA.
  • E. coli is used as the host
  • the pBluescript vector (Stratagene) is used as the cloning vector. Is preferred.
  • an expression vector is particularly useful.
  • the expression vector is not particularly limited as long as it is a vector that expresses the polypeptide in vitro, in E. coli, in cultured cells, or in organisms.
  • the PBEST vector Promega PET vector (Invitrogen) for E. coli
  • pME18S-FL3 vector GenBank Accession No.
  • telomere sequence for cultured cells, pME18S vector (Mol Cell Biol. 8 for organisms) : 4 66-472 (1988)).
  • the DNA of the present invention can be inserted into the vector by a conventional method, for example, by a ligase reaction using a restriction enzyme site (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish). . John Wiley & Sons. Sect ion 11. 4-11. 11).
  • the host cell into which the vector of the present invention is introduced is not particularly limited, and various host cells can be used depending on the purpose.
  • the cells for expressing the polypeptide include bacterial cells (eg, Streptococcus, St. phyllococcus, E. coli, Streptomyces, Bacillus subtilis), fungal cells (eg, yeast, Aspergillus), insect cells (eg, Drosophila S2). Spodoptera SF9), animal cells (eg, CH0, COS, HeLa, C127, 3T3, BHK, HEK293, Bowes melanoma cells) and plant cells.
  • bacterial cells eg, Streptococcus, St. phyllococcus, E. coli, Streptomyces, Bacillus subtilis
  • fungal cells eg, yeast, Aspergillus
  • insect cells eg, Drosophila S2). Spodoptera SF9
  • animal cells eg, CH0, COS, HeLa
  • Vectors can be introduced into host cells by, for example, calcium phosphate precipitation method, electric pulse perforation method (Current protocol s in Mol e biar biology ed. Ausube let al. (1987) Publ i sh. John Wiley & Sons. Sec t ion 9. 1-9. 9), a ribofectamine method (GIBCO-BRL), a microinjection method and the like.
  • an appropriate secretion signal can be incorporated into the polypeptide of interest.
  • These signals may be endogenous to the polypeptide of interest or they may be heterologous signals.
  • the polypeptide of the present invention is recovered when the polypeptide of the present invention is secreted into the medium.
  • the polypeptide of the present invention is produced intracellularly, the cell is first lysed, and then the polypeptide is recovered.
  • ammonium sulfate or ethanol precipitation acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, Known methods can be used, including two-dimensional chromatography, seven droxyl apatite chromatography, and lectin chromatography.
  • the present invention provides a method for examining a disease associated with abnormal expression of a gene encoding the polypeptide of the present invention or abnormal activity of the polypeptide of the present invention.
  • GPCRs are thought to have important functions in vivo, and abnormalities in their expression and function can cause various diseases. Therefore, it is possible to examine such diseases by using inappropriate activity or expression of the polypeptide of the present invention as an index.
  • “disease test” refers not only to a test for developing a treatment strategy for a subject exhibiting a symptom of a disease, but also to determine whether or not the subject is susceptible to a disease. Also included are preventive tests.
  • test method of the present invention is a method comprising detecting a mutation in a gene encoding the polypeptide of the present invention or an expression control region thereof in a subject.
  • a DNA sample is first prepared from a subject.
  • DNA samples can be prepared based on chromosomal DNA or RNA extracted from a subject's cells, such as blood, urine, saliva, tissue biopsy or autopsy material.
  • a chromosomal DNA can be cleaved with an appropriate restriction enzyme and cloned into a vector to prepare a genomic library.
  • reverse cDNA can be used to prepare a cDNA library from RNA.
  • a DNA encoding a gene encoding the polypeptide of the present invention or an expression control region thereof is isolated. Isolation of the DNA can be performed by screening a genomic library or cDNA library using a probe that hybridizes to the gene encoding the polypeptide of the present invention or DNA containing the expression control region thereof. it can. In addition, a genomic DNA library, a cDNA library, or RNA is selected using a primer that hybridizes to a gene encoding the polypeptide of the present invention or a DNA containing its expression control region. It can also be isolated by typed PCR. In this method, the base sequence of the isolated DNA is then determined. The base sequence of the selected DNA can be determined by methods known to those skilled in the art.
  • control refers to the base sequence of a DNA containing a normal (wild type) gene encoding the polypeptide of the present invention or its expression control region. If the base sequence of the subject's DNA is different from the control as a result of such comparison, the subject is determined to be suffering from or at risk of developing the disease.
  • test method of the present invention various methods can be used in addition to the method for directly determining the base sequence of DNA derived from a subject as described above.
  • a DNA sample is first prepared from a subject.
  • the prepared DNA sample is cleaved with a restriction enzyme.
  • the DNA fragments are then separated according to their size.
  • the size of the detected DNA fragment is then compared to a control.
  • a DNA sample is first prepared from a subject.
  • the gene encoding the polypeptide of the present invention or DNA containing its expression control region is amplified.
  • the amplified DNA is cleaved with a restriction enzyme.
  • the DNA fragments are then separated according to their size. The size of the detected DNA fragment is then compared to a control.
  • Such methods include, for example, restriction fragment length polymorphism in the (Res tr ict ion Fragme nt Length Polymorphi sm / RFLP) c Specifically method and PCR-RFLP method, and the like utilizing, restriction enzymes If there is a mutation at the recognition site, or if there is a base insertion or deletion in the DNA fragment produced by the restriction enzyme treatment, the size of the fragment produced after the restriction enzyme treatment will vary compared to the control. By amplifying the portion containing this mutation by PCR and treating with each restriction enzyme, these mutations can be detected as the difference in mobility of bands after electrophoresis.
  • the chromosomal DNA is treated with these restriction enzymes, electrophoresed, and then the probe DNA of the present invention.
  • the presence or absence of mutation can be detected by performing Southern blotting using.
  • the restriction enzyme used can be appropriately selected according to each mutation.
  • RNA prepared from the subject in addition to genomic DNA, can be converted to cDNA using reverse transcriptase, cut with restriction enzyme, and then subjected to Southern blotting. It is also possible to amplify a DNA encoding the polypeptide of the present invention or a DNA containing its expression control region by PCR using this cDNA as a saddle, cut it with a restriction enzyme, and then examine the difference in mobility. is there.
  • Another method is to first prepare a DNA sample from the subject. Next, a gene encoding the polypeptide of the present invention or a DNA containing its expression control region is amplified. In addition, dissociate the amplified DNA into single-stranded DNA. The dissociated single-stranded DNA is then separated on a non-denaturing gel. Compare the mobility of the separated single-stranded DNA on the gel with the control.
  • Such methods include, for example, PCR-SSCP (single-strand conformation poly morphism) (Cloning and polymerase chain reaction-signal-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics. 1992 Jan 1; 12 (1): 139-146., Detection of p5 3 gene mutations in human brain tumors by single-strand conformation pol ymorphism analysis of polymerase chain react ion products. Oncogene. 1991 Aug 1; 6 (8 ): 1313-1318 ⁇ , Multiple fluorescence-based PCR-SSCP analysis with postlabeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.).
  • PCR-SSCP single-strand conformation poly morphism
  • This method is particularly convenient for screening a large number of DNA samples because it is relatively easy to operate and has advantages such as a small amount of test sample.
  • the principle is as follows. When a double-stranded DNA fragment is dissociated into single strands, each strand forms its own higher-order structure that depends on the base sequence. When this dissociated DNA strand is electrophoresed in a polyacrylamide gel that does not contain a denaturing agent, single-stranded DNA with the same complementary strand length moves to a different position depending on the difference in each higher-order structure. To do. Monosalt The higher-order structure of this single-stranded DNA is also changed by group substitution, and shows different mobility in polyacrylamide gel electrophoresis. Therefore, by detecting this change in mobility, it is possible to detect the presence of mutations due to point mutations, deletions or insertions in DNA fragments.
  • DNA containing the gene encoding the polypeptide of the present invention or its expression control region is amplified by PCR or the like.
  • a length of about 200 to 400 bp is usually preferable.
  • the amplified DNA product can be labeled by using a primer labeled with an isotope such as 32 P, a fluorescent dye, or piotin.
  • the amplified DNA product can be labeled by adding a substrate base labeled with an isotope such as the above, a fluorescent dye, or piotin to the PCR reaction solution.
  • labeling can also be performed by adding a substrate base labeled with an isotope such as 32 P, a fluorescent dye, or piotin using a Klenow enzyme after the PCR reaction to the amplified DNA fragment.
  • the labeled DNA fragment thus obtained is denatured by applying heat or the like and electrophoresed on a polyacrylamide gel containing no denaturing agent such as urea.
  • the conditions for separating DNA fragments can be improved by adding an appropriate amount (about 5 to 10%) of glycerol to the polyacrylamide gel. Electrophoretic conditions vary depending on the nature of each DNA fragment, but are usually performed at room temperature (20 to 25). If favorable separation is not obtained, 4 to 3 (provides optimal mobility at temperatures up to TC).
  • the mobility of DNA fragments is detected by autoradiography using an X-ray film, or a scanner that detects fluorescence, etc. Bands with differences in mobility If this is detected, the band can be directly excised from the gel, amplified again by PCR, and sequenced directly to confirm the presence of the mutation. Dye the gel after electrophoresis with ethidium bromide or silver staining method. The band can be detected by.
  • Yet another method is to first prepare a DNA sample from a subject. Next, the gene encoding the polypeptide of the present invention or DNA containing its expression control region is amplified. C Further, the amplified DNA is separated on a gel in which the concentration of the DNA denaturant is gradually increased. Next, the mobility of the separated DNA on the gel is compared with the control.
  • Examples of such a method include denaturant gradient gel electrophoresis (DGGE method).
  • the DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel with a denaturing agent concentration gradient, and the DNA fragments are separated according to the difference in instability.
  • DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel with a denaturing agent concentration gradient, and the DNA fragments are separated according to the difference in instability.
  • a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to the instability.
  • the mobility of this partially dissociated DNA fragment is very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated part.
  • a gene encoding the polypeptide of the present invention or a DNA containing its expression control region is amplified by a PCR method using the primer of the present invention, and the concentration of denaturing agents such as urea is transferred. Electrophorese in a polyacrylamide gel that gradually increases as you proceed and compare to the control. In the case of a DNA fragment with mutation, the DNA fragment becomes single-stranded at a lower denaturant concentration position, and the movement speed becomes extremely slow, so the presence or absence of mutation is detected by detecting this difference in mobility. can do.
  • the allele specific oligonucleotide (ASO) hybridization method can be used for the purpose of detecting only a mutation at a specific position. If an oligonucleotide containing a nucleotide sequence that is considered to have a mutation is prepared and hybridized with this sample DNA, the hybridization efficiency will be reduced if the mutation exists. This can be detected by the Southern plot method or the method of using a special fluorescent reagent that quenches by intercalating into the hybrid gap. Also, Detection by the ribonuclease A mismatch cleavage method is also possible.
  • a DNA containing a gene encoding the polypeptide of the present invention is amplified by a PCR method or the like, and a labeled RNA and a hybridization prepared from a control cDNA incorporated into a plasmid vector or the like are used. Do. Since the hybrid has a single-stranded structure in the part where the mutation exists, the presence of the mutation can be detected by cleaving this part with liponuclease A and detecting this part by radiography etc.
  • test method of the present invention is a method comprising detecting the expression level of a gene encoding the polypeptide of the present invention.
  • gene expression includes transcription and translation.
  • expression product includes mRNA and protein.
  • RNA sample is prepared from a subject.
  • the amount of RNA encoding the polypeptide of the present invention contained in the RNA sample is measured.
  • the measured amount of RNA encoding the polypeptide of the present invention is then compared to a control.
  • Examples of such a method include Northern blotting using a probe that hybridizes to a polynucleotide encoding the polypeptide of the present invention, or RT using a primer that hybridizes to a polynucleotide encoding the polypeptide of the present invention.
  • -A PCR method etc. can be illustrated.
  • a DNA array (new genetic engineering handbook, Masaaki Muramatsu, Masaru Yamamoto, Yodosha, P280-284) can be used for the examination at the transcription level of the gene encoding the polypeptide of the present invention.
  • a cDNA sample prepared from a subject and a substrate on which a polynucleotide probe that hybridizes with a polynucleotide encoding the polypeptide of the present invention is immobilized are provided.
  • the polynucleotide probe immobilized on the substrate may be of a plurality of types in order to detect a plurality of types of polynucleotides encoding the polypeptide of the present invention.
  • CD from the subject The preparation of the NA sample can be performed by a method well known to those skilled in the art.
  • total RNA is first extracted from the subject's cells.
  • the cells for example, blood, urine, saliva, tissue biopsy or autopsy material cells can be exemplified. Extraction of c total RNA can be performed, for example, as follows. Existing methods and kits can be used as long as they can prepare high-purity total RNA. For example, after pretreatment using Ambion's RNA RNA, total RNA is extracted using Nibonbon Gene's Isoge. Specific methods may follow those attached protocols.
  • cDNA synthesis is performed using reverse transcriptase to prepare a cDNA sample.
  • Synthesis of cDNA from total RNA can be performed by methods well known to those skilled in the art.
  • the labeling substance is not particularly limited as long as it can be detected, and examples thereof include fluorescent substances and radioactive elements. Labeling can be performed by methods commonly used by those of ordinary skill in the art (L Luo et al., Gene express ion prof iles of laser-captured acent neuronal subtypes. Nat Med. 1999, 117-122). .
  • the “substrate” means a plate-like material on which a polynucleotide can be immobilized.
  • the substrate of the present invention is not particularly limited as long as the polynucleotide can be immobilized. Ifi, a substrate generally used in DNA array technology can be preferably used.
  • DNA array technology is that the amount of hybridization solution is very small, and very complex evenings containing cDNA derived from total cellular RNA can be hybridized to immobilized nucleotide probes.
  • a DNA array consists of thousands of nucleotides that are densely printed on a substrate. Usually these DNAs are printed on the surface of a non-porous substrate. The surface layer of the substrate is generally glass, but a porous membrane such as a nitrocellulose membrane can be used.
  • nucleotide immobilization There are two types, one is a polynucleotide-based array developed by Ai iymetrix, and the other is a cDNA array developed mainly at Stanford University.
  • the polynucleotides are usually synthesized in situ (/ '/ ?.
  • photoli thiographic technology Al iyme tr ix
  • inkjet Raset ta Inpharmat for immobilizing chemicals
  • the in situ synthesis method of polynucleotides by the technology etc. is already known, and any technique can be used for the production of the substrate of the present invention.
  • the polynucleotide probe of the present invention includes a polynucleotide or cDNA, as long as it specifically hybridizes with a gene that encodes a polypeptide.
  • “To hybridize” means substantially hyper-hydidized with a polynucleotide encoding the polypeptide of the present invention, Other polynucleotides mean that they do not substantially hybridize If a specific hybridization is possible, the polynucleotide probe will be completely complementary to the base sequence of the polynucleotide to be detected.
  • the length of the polynucleotide probe that binds to the substrate is usually 100 to 4000 base, preferably 200 to 4000 base, more preferably 500 to 4000 base when cDNA is immobilized. When immobilizing a synthetic polynucleotide, it is usually 15 to 500 bases, preferably 30 to 200 bases, more preferably 50 to 200 bases.
  • the power that can be printed as follows: Print several polynucleotide probes in one region of the 4.5 dragon x 4. 5 thigh, using a single pin to print each array. Therefore, when using a 48-pin tool, it is possible to print an array of 48 iterations on a standard microscope slide.
  • the cDNA sample is then brought into contact with the substrate.
  • a cDNA sample is hybridized to a nucleotide probe on a substrate that can specifically hybridize with DNA encoding the polypeptide of the present invention.
  • the hybridization reaction solution and reaction conditions may vary depending on various factors such as the length of the nucleotide probe immobilized on the substrate, it can generally be performed by methods well known to those skilled in the art.
  • the expression level of the gene encoding the polypeptide of the present invention contained in the cDNA sample is then detected by detecting the intensity of the hybridization between the cDNA sample and the nucleotide probe immobilized on the substrate. Measure. Further, the measured expression level of the gene encoding the polypeptide of the present invention is compared with the control.
  • the expression level of the gene encoding the polypeptide of the present invention can be measured by detecting the strength of hybridization between the polynucleotide probe and the cDNA. Detection of the intensity of hybridization between the polynucleotide probe and the cDNA can be appropriately performed by those skilled in the art depending on the type of substance labeled with the cDNA sample. For example, when cDNA is labeled with a fluorescent substance, it can be detected by reading a fluorescent signal with a scanner.
  • a cDNA sample derived from a subject and a control is labeled with a different fluorescent substance, so that the gene encoding the polypeptide of the present invention in each measurement can be obtained in a single measurement.
  • the expression level can be measured simultaneously.
  • one of the above cDNA samples can be labeled with Cy5 as a fluorescent substance and the other with Cy3.
  • the relative intensity of each fluorescent signal indicates the relative amount according to the expression level of the gene encoding the polypeptide of the present invention in the subject and the control (Duggan et al., Nat. Genet. 21: 10- 14, 1999).
  • a polypeptide sample is prepared from the subject.
  • the polypep The amount of the polypeptide of the present invention contained in the tide sample is measured.
  • the measured amount of the inventive polypeptide is then compared to a control.
  • Such methods include SDS polyacrylamide electrophoresis and Western blotting, dot blotting, immunoprecipitation, enzyme-linked immunoassay (ELI SA) using antibodies that bind to the polypeptide of the present invention. ), And immunofluorescence.
  • ELI SA enzyme-linked immunoassay
  • the subject when the expression level of the gene encoding the polypeptide of the present invention is significantly changed compared to the control, the subject suffers from a disease associated with abnormal expression of the gene. Or is at risk of developing the disease. >
  • the present invention also provides a test for a disease associated with abnormal expression of a gene encoding the polypeptide of the present invention or abnormal activity of the polypeptide of the present invention.
  • One embodiment thereof is a test agent comprising an oligonucleotide having a chain length of at least 15 nucleotides, which hybridizes to a polynucleotide encoding the above-described polynucleotide encoding the polypeptide of the present invention or an expression control region thereof.
  • the oligonucleotide is a gene encoding the polypeptide of the present invention or an expression control region thereof as a probe for detecting the gene encoding the polypeptide of the present invention or an expression control region thereof in the test method of the present invention. It can be used as a primer for amplifying.
  • the oligonucleotide of the present invention can be prepared by, for example, a commercially available oligonucleotide synthesizer.
  • the probe can also be prepared as a double-stranded DNA fragment obtained by restriction enzyme treatment or the like.
  • the oligonucleotide of the present invention is used as a probe, it is preferably used after being appropriately labeled.
  • T4 polynucleotide kinase is used to phosphorylate the 5 ′ end of oligonucleotide with phosphorylation, and a DNA polymerase such as Klenow enzyme is used to randomly hexamer oligonucleotide.
  • Isotope such as 32 P, fluorescent dye, or piotin Examples thereof include a method of incorporating a substrate base labeled by a method such as a random prime method.
  • test drug of the present invention is a test drug containing an antibody that binds to the polypeptide of the present invention described later.
  • the antibody is used for detecting the polypeptide of the present invention in the test method of the present invention.
  • the form of the antibody is not limited as long as it can detect the polypeptide of the present invention.
  • Antibodies for testing include polyclonal antibodies and monoclonal antibodies. The antibody may be labeled as necessary.
  • oligonucleotides and antibodies which are active ingredients, for example, sterilized water, physiological saline, vegetable oils, surfactants, lipids, solubilizers, buffers, protein stabilizers (such as BSA and gelatin) ) Preservatives and the like may be mixed as necessary.
  • the present invention provides antibodies that bind to the polypeptides of the present invention.
  • “Antibodies” as used herein include polyclonal and monoclonal antibodies, chimeric antibodies, single chain antibodies, human antibodies, and Fab fragments that include the products of Fab or other immunoglobulin expression libraries.
  • polypeptides of the invention or fragments or analogs thereof, or cells expressing them can also be used as immunogens to produce antibodies that bind to the polypeptides of the invention.
  • the antibody is preferably immunospecific for the polypeptide of the invention. “Immunospecific” means that the antibody has a substantially higher affinity for a polypeptide of the invention than its affinity for other polypeptides.
  • an antibody that binds to the polypeptide of the present invention can be prepared by methods known to those skilled in the art.
  • a polyclonal antibody can be obtained as follows.
  • the polypeptide of the present invention or its fusion protein with GST Serum is obtained by immunizing small animals such as herons. This is prepared by, for example, purification using ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, affinity column in which the polypeptide of the present invention is coupled, or the like.
  • the polypeptide of the present invention is immunized to a small animal such as a mouse, the spleen is excised from the mouse, and this is ground to separate cells, and mouse myeloma cells and polyethylene dallicol.
  • a clone that produces an antibody that binds to the polypeptide of the present invention is selected from the fused cells (hypridoma) produced by the fusion with a reagent such as the above.
  • the obtained hybridoma was transplanted into the abdominal cavity of the mouse, and ascites was collected from the mouse, and the obtained monoclonal antibody was obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, the present invention. It can be prepared by purifying it with an affinity ram or the like obtained by coupling a polypeptide.
  • the antibody of the present invention can be used for isolation, identification, and purification of the polypeptide of the present invention and cells expressing the polypeptide.
  • the antibody that binds to the polypeptide of the present invention can also be used for measuring the expression level of the polypeptide of the present invention in the examination of diseases associated with abnormal expression of the polypeptide of the present invention.
  • polypeptides of the invention can be used in the identification of their ligands, agonists or antagonists. These molecules to be identified may be of natural origin or may be artificially synthesized structural or functional mimetics.
  • the polypeptides of the present invention are responsible for many biological functions, including many pathologies. Accordingly, it is desirable to discover compounds that activate the polypeptides of the present invention and compounds that can inhibit the activation of the polypeptides of the present invention.
  • the polypeptide of the present invention is brought into contact with the candidate compound, and then whether or not the candidate compound binds to the polypeptide of the present invention is detected.
  • the test sample is not particularly limited.
  • various known compounds and peptides with unknown GPCR ligand activity for example, those registered in a chemical file
  • phage display method J. Mol. Biol. (1991) 222, 301-31 0
  • culture supernatants of microorganisms and natural components derived from plants and marine organisms are also subject to screening.
  • Other examples include, but are not limited to, biological tissue extracts such as brain, cell extracts, and gene library expression products.
  • binding to a candidate compound can be detected using the purified polypeptide of the present invention.
  • a method in which a test sample is brought into contact with the affinity column of the polypeptide of the present invention to purify a compound that binds to the polypeptide of the present invention and many well-known methods such as West Western plotting are used. The method can be used.
  • the candidate compound is appropriately labeled, and binding to the polypeptide of the present invention can be detected using this label.
  • a cell membrane that expresses the polypeptide of the present invention is prepared, immobilized on a chip, and the dissociation of the trimeric GTP-binding protein upon ligand binding is indicated by surface plasmon resonance.
  • the binding activity between the candidate compound and the polypeptide of the present invention can be detected using a signal serving as an index of activation of the polypeptide of the present invention as an index.
  • signals include, for example, changes in intracellular Ca "levels, changes in intracellular cAMP levels, changes in intracellular pH, changes in intracellular adenylate cyclase levels, It is not limited to these.
  • a cell membrane expressing the polypeptide of the present invention is labeled with 35 S in 2 OmM HEPES (pH 7.4), lOOm NaCl, lOmM MgCl 2 , 50 i M GDP solution. After mixing with GTP r S 400pM, incubating in the presence and absence of the test sample, filtration (fil trat ion) is performed, and the radioactivity of the bound GTP r S is compared. Can be.
  • GPCRs also share a system that transmits signals into cells through the activation of trimeric GTP-binding proteins.
  • Trimeric GTP-binding proteins are classified into three types, GQ type that increases Ca 2+ , Gs type that increases cAMP, and Gi type that suppresses cAMP, depending on the type of intracellular transmission system that is activated. Applying this, chimerize GQ protein and other G protein ⁇ subunits, or use the promiscuous Ga protein, Gal5, G ⁇ 16 to give positive signals for ligand screening in GQ cells It can be attributed to Ca 2+ elevation, an internal transmission pathway.
  • Elevated Ca "levels indicate changes in reporter gene systems with upstream TRE (TPA responsive element) or MRE (multiple responsive element), staining indicators such as Fura-2 and Fluo-3, and fluorescent protein aequorin Similarly, Gs protein ⁇ -subunit and chimera of other G protein ⁇ -subunit are chimerized, and the positive signal is attributed to the increase of cAMP, the intracellular transmission pathway of Gs, and CRE (cAMP-responsiv e It is also possible to use changes in the repo overnight gene system having (element) upstream as an index (Trends Pharmacol. Sci. (99) 20: 118).
  • the host cell that expresses the polypeptide of the present invention there are no particular limitations on the host cell that expresses the polypeptide of the present invention, and various host cells may be used depending on the purpose.
  • mammals such as COS cells, CH0 cells, HEK293 cells, etc.
  • Examples include animal cells, yeast, Drosophila cells, or E. coli cells.
  • Examples of the vector for expressing the polypeptide of the present invention in vertebrate cells include a promoter located upstream of the gene encoding the polypeptide of the present invention, an RNA splice site, a polyadenylation site, and a transcription termination sequence.
  • Those having a replication origin and the like can be suitably used.
  • pSV2dhfr Mol. Cell. Biol.
  • Encodes the polypeptide of the present invention into vector DNA insertion can be performed by a ligase reaction using a restriction enzyme site by a conventional method (Current protocol s in Molecular Biology ed i.Ausube l et al. (198 7) Publ i sh. John Wi l ey & Sons. Sect ion 11.4-11.11).
  • vector introduction into host cells can be performed by, for example, calcium phosphate precipitation method, electric pulse perforation method (Curren t protocol in Molecule Biology ed. Ausube let al. (1987) Publ i sh. Jo hn Wiley & Sons. Section 9. 1-9. 9), Lipofuectamine method (GIBC0-BRL), FuGENE6 reagent (Boehringer Mannheim), microinjection method and the like.
  • a cell expressing the polypeptide of the present invention is brought into contact with the candidate compound, and the candidate compound outputs a signal that serves as an indicator of activation of the polypeptide of the present invention. Detect whether to generate. That is, in the above-described method for identifying a ligand using a cell that expresses the polypeptide of the present invention, a compound that generates a signal that serves as an indicator of activation of the polypeptide of the present invention by the action of a candidate compound. Identify. Such a compound is a candidate for agonis for the polypeptide of the present invention.
  • a cell expressing the polypeptide of the present invention is contacted with an agonist to the polypeptide of the present invention in the presence of the candidate compound. It is detected whether or not the signal indicating the activation of the polypeptide of the present invention is decreased as compared with the case where it is detected in the absence of the compound (control). That is, in the above-described method for identifying a ligand using a cell that expresses the polypeptide of the present invention, the cell of the polypeptide of the present invention in response to agonist stimulation is prepared by allowing agonis to act on the cell in addition to the candidate compound. Identify compounds that suppress the generation of signals that are indicators of activation.
  • Such a compound is a candidate for an antagonist to the polypeptide of the present invention.
  • potential antagonists of the polypeptides of the present invention include antibodies, in some cases, polypeptides closely related to the ligand (eg, fragments of the ligand), or polypeptides of the present invention. Small molecules that bind to the peptide but do not induce a response (thus preventing the activity of the receptor).
  • the present invention also provides a kit for use in the identification method.
  • This kit includes a polypeptide of the present invention or a cell expressing the polypeptide of the present invention or a cell membrane thereof.
  • the kit may contain a GPCR ligand, agonist, or compound that is a candidate for an antagonist.
  • the present invention provides a pharmaceutical composition for treating a patient in need of increasing or suppressing the activity or expression of the polypeptide of the present invention.
  • an agonist for the polypeptide of the present invention, the polynucleotide of the present invention, and a vector into which the polynucleotide of the present invention is inserted. Can be used.
  • an antagonist of the polypeptide of the present invention an endogenous polypeptide of the present invention in vivo Polynucleotides that suppress the expression of the encoded gene can be used.
  • Antagonists include soluble forms of the polypeptide of the invention that are capable of binding a ligand in competition with an endogenous polypeptide of the invention.
  • a typical example of such a competitor is a fragment of the polypeptide of the present invention.
  • the polynucleotide that suppresses the expression of the gene encoding the polypeptide of the present invention includes the above-described antisense DNA and ribozyme.
  • a therapeutic compound When a therapeutic compound is used as a pharmaceutical, it can be administered as a pharmaceutical composition formulated by a known pharmaceutical method, in addition to directly administering the compound itself to a patient.
  • pharmaceutical compositions or tablets obtained by mixing with pharmacologically acceptable carriers (excipients, binders, disintegrants, flavoring agents, flavoring agents, emulsifiers, diluents, solubilizers, etc.), pills , Powder, granule, capsule, troche, syrup, liquid Prescription in a form suitable for oral or parenteral use as a preparation for preparations, emulsions, suspensions, injections (solutions, suspensions, etc.), suppositories, inhalants, transdermal absorption agents, eye drops, eye ointments, etc. Is done.
  • pharmacologically acceptable carriers excipients, binders, disintegrants, flavoring agents, flavoring agents, emulsifiers, diluents, solubilizer
  • Administration to a patient can be generally performed by methods known to those skilled in the art, such as intraarterial injection, intravenous injection, and subcutaneous injection.
  • the dose varies depending on the weight and age of the patient, the administration method, etc., but those skilled in the art can appropriately select an appropriate dose.
  • the compound can be encoded by DNA, it can be considered to incorporate the DNA into a gene therapy vector and perform gene therapy.
  • vector therapy vectors examples include retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, and non-viral vectors such as liposomes.
  • the target DNA can be administered to the patient by ex w'ra method or /// r / ra method.
  • the present invention provides a mammal into which the polynucleotide of the present invention has been introduced or a mammal in which the expression of the endogenous polynucleotide is artificially suppressed. Production of these mammals can be performed by techniques known to those skilled in the art. These mammals are preferably rodents, most preferably mice. These mammals can be used as, for example, model animals for diseases associated with the polynucleotide of the present invention. Brief Description of Drawings
  • FIG. 1 shows the relationship between a pair of GPCR sequences that were plotted against E values when a known GPCR sequence was searched against an evaluation database containing 1,054 GPCR sequences and 64,154 non-GPCR sequences.
  • FIG. 5 is a diagram showing the number and the number of pairs of GPCR sequences and non-GPCR sequences.
  • Figure 2 is an electrophoretogram showing the results of analyzing the expression of clone 13860 in each organ.
  • the graph is from left, heart, brain, placenta, lung, liver, skeletal muscle, kidney, kidney, Spleen, thymus, prostate, testis, ovary, small intestine, large intestine, white blood cell, lung cancer, colon cancer, lung cancer, prostate cancer, colon cancer, ovarian cancer, knee cancer.
  • FIG. 3 is a graph showing the results of FIG. BEST MODE FOR CARRYING OUT THE INVENTION
  • the present inventors have found all candidates of 6-frame translation sequences existing between the start codon and the stop codon from the rabbit genome sequence.
  • (6F expansion sequence) The longest sequence was selected when multiple starting codons (ATG) were found on the same sequence.
  • a gene discovery program (GeneDecoder) (Asai, K., et al. Pacific Symposium on Biocomputing 98, pp. 228-239 (PSB9 8, 1998) ).) was used to discover the protein coding region (GD sequence). Since GPCR protein has seven transmembrane helices of about 20 residues in length, we set the condition that both sequences require more than 150 residues (> 20 * 7).
  • 375,412 sequences were predicted by 6-frame translation and 95,900 sequences were predicted by GeneDecoder.
  • the former sequence corresponds to the case where no intron is included, and the latter is mainly composed of multiple exons.
  • GeneDecoder is a gene discovery program using a Hidden Markov Model (HMM), which also uses information on sequence similarity and exon length distribution.
  • HMM Hidden Markov Model
  • PFAM is a protein domain design described by the Hidden Markov Model (HMM).
  • HMM Hidden Markov Model
  • HMMER Bossar, A., et al. Nucleic Acids Res. 28, 263-2 66 (2000).
  • PR0SITE is a motif pattern described by regular expressions.
  • the present inventors used the (P value) multiplied by the appearance probability of each residue as an index. For example, the regular expression pattern A- [T, S] if a -G, P value is P A * (P t + P s I * P G.
  • TMWindows is the inventor's original program for TMH prediction. This is based on the hydrophobicity index of En gelman-Stai tz-Goldman (Engelman, DM, et al. Annual Review of Biophysics and Biophysical Chemistry. 15, 321-353. (1986)) for each amino acid residue. And scan the entire sequence with nine different window widths (19-27 residues). This index is the most suitable index for membrane protein analysis through comparison of all indices included in the AAindex database (Tomi i, K. & Kanehi sa, M. Protein Eng. 9, 27-36 (1996).) As determined. For each window width, a continuous region with an average hydrophobicity index> 2.5 is predicted as the transmembrane helix. The number predicted for each different window set means the range of the number of helices. On the other hand, Mitaku's method predicts the number of helices using physical chemistry parameters.
  • the threshold values used in these analyzes were obtained by the inventor's evaluation of each method.
  • the reference data set used for the evaluation was obtained by excluding the fragment sequence from SWISSPR0T version 39 (Ba i roch, A. & Apweiler, R. Nucleic Acids Res. 28, 45-48 (2000).) The obtained sequence. This includes 1,054 known GPCR sequences and 64,154 non-GPCR sequences. The specific evaluation procedure for the analysis method is shown below.
  • TMH prediction tools are generally not very accurate in predicting the true number of helices. However, if the expected number of helices is wide, such as 6-8, 5-9, or 4-10, etc., the sensitivity to detect true seven transmembrane helix types can be increased. It can obviously increase. For both TMWindows and Mitaku methods, we consider 4 ranges, 7, 6-8, 5-9, 4-10, and true for all combinations of each other (16 ways). The sensitivity and selectivity of detecting 7 transmembrane helices were calculated.
  • the best sensitivity threshold is intended to achieve near 100% sensitivity with minimal false positives, while the latter is intended to achieve nearly 100% selectivity with minimal false negatives. .
  • Figure 1 shows the evaluation of the BLASTP threshold.
  • the line indicated by the left arrow indicates the number of pairs of GPCRs, and the line indicated by the right arrow indicates a pair of GPCR and non-GPCR sequence.
  • the E value is less than 10-5Q
  • almost all pairs were between GPCR sequences except for some unrelated pairs around the boundary. This corresponds to the best selectivity threshold.
  • these false positives were caused by matching the LDL receptor domain or the EGF factor domain that is characteristic of receptors with only one transmembrane helix.
  • the E value was less than 10-1 kg , there were 115 false positives, but almost all GPCRs were included. This boundary area corresponds to the best sensitivity threshold.
  • the most reliable data is the union of sequences obtained from the best selectivity thresholds of BLASTP, PF AM, and PROSITE.
  • GPCR candidates were screened from the sequences generated in the first stage using the thresholds shown in Table 1. However, these sequences still included the following duplicate examples, so it was necessary to narrow down the number of candidates in the end.
  • Case 1 Perfect match or overlap at the same gene position. They consist of two sequence generation methods: (1) 6-frame translation and (2) GeneDecoder The result of the prediction. We considered them to be the same gene.
  • Case 3 Two or more sequences that partially hit some long known sequence. The reason why these were generated is thought to be mis-splicing by the gene discovery program. The inventors of the present invention originally decided to fuse them as the same gene.
  • the present inventors first raised the accuracy of candidate genes by examining each of the above cases.
  • Vasopressin / oxytocin receptors 4 ⁇ 1 883 We classified the sequences by 30% sequence similarity. This is generally considered to be an evolutionarily related family threshold. The largest family was an olfactory receptor containing 53 7 members. Major families of more than 20 members include adrenaline, dopamine and serotonin receptors (38), family 2B receptors (20), family 3 C receptors (30) chemokines and chemotaxis receptors (31), and orphans It was a receptor (76).
  • Sequences A, B, and C are based on the best selectivity data set (level A), level B data set, and level C data set, respectively. After refining, the new sequence was obtained by searching the UNIGENE and nr-aa databases.
  • the cDNA of clone 13860 was similarly isolated using the 5′-RACE, 3′-RACE method.
  • the 3'-end cDNA is 3, by the -RACE method, Marathon-Ready cDNA (CLONT ECH) derived from H. Hela cells is used as a saddle, and API (SEQ ID NO: 1 1) and 3 'R13860 (sequence) No. 1) was used as a primer for the first PCR, and in the second PCR, AP2 (SEQ ID NO: 1 2) and 3 ′ R13860-nest (SEQ ID NO: 2) were used as primers.
  • the 5'-end cDNA was converted to the first PCR using 5'-RACE method, using Marathon-Ready cDNA derived from H. Hela cells as a saddle, and API and 5 'R13860 (SEQ ID NO: 3) as primers.
  • AP2 and 5 ′ R13860-nest (SEQ ID NO: 4) were used as primers.
  • Advantage 2 Polymerase Mix manufactured by CLONOTECH
  • CLONOTECH Advantage 2 Polymerase Mix
  • cDNA prepared from human brain (manufactured by Clontech) was used as the vertical DNA, Amplification was attempted by PCR.
  • the PCR primer 13860-8 (SEQ ID NO: 7) used for the first PCR in 5'-RACE and the PCR primer 13860-6 (SEQ ID NO: 8) used for the second PCR were designed.
  • Marathon-Ready cDNA manufactured by Clontech
  • 5′-RACE was performed in the same manner as described above.
  • 13860-8 (SEQ ID NO: 7) and API primer were used, and in the second PCR, 13860-6 (SEQ ID NO: 8) and AP2 primer were used.
  • the approximately 1 kbp product amplified by PCR was inserted into the PGEM-T Easy vector, and the nucleotide sequence was determined (SEQ ID NO: 17).
  • the translation start codon The amino acid sequence was inferred from a single reading frame (SEQ ID NO: 1 8), and a sequence considered to be an extracellular secretion signal sequence was also found at the amino terminus. It was.
  • PCR of the region assumed to be the coding region of 13860 Amplification and confirmation of the nucleotide sequence were performed.
  • the primer used for PCR is 13860- ATG (SEQ ID NO: 9) designed to hybridize to the sequence near the translation initiation codon as a primer in the sense direction and to have the restriction enzyme EcoRI recognition sequence and the Kozak sequence (CCACC).
  • 13860-TGA2 As a primer in the antisense direction, 13860-TGA2 (SEQ ID NO: 1 0) designed to hybridize to the sequence downstream of the expected nucleotide end of 13860 and to have the restriction enzyme Sail recognition sequence, respectively.
  • the PCR conditions used were as follows.
  • PCR reaction solution was desalted using PCR Purification Kit (manufactured by QIAGEN), PCR primers were removed, elution was performed with 40 zL of TE solution, and secondary amplification with PCR was performed again. That is, 5 L of 10 X PCR buffer (manufactured by Toyobo Co., Ltd.), dNTPs (2 mM each), 2 L of 25 mM magnesium sulfate, 10 pmole of 13860-ATG Prepared to contain 13860-TGA2 primer, 10 xL of the first PCR-purified product, and L KOD-Plus DNA polymerase (Toyobo) First, incubate at 94 ° C for 2 minutes, then perform 10 cycles of 94 for 15 seconds, 60 for 30 seconds, 72 ° C for 2 minutes 30 seconds, and finally 72 minutes for 2 minutes.
  • R13860 nest GCTGGCAAAGCACCGAGTTCTC (SEQ ID NO: 2)
  • R13860 nes t AGGTAGAGCCCCAGGGTGACAC (SEQ ID NO: 4)
  • MRNA expression in human organs and tumor tissues of clone 13860 was analyzed by RT-PCR.
  • MTC multi-tip cDNA panes (Human I, Human I I, Human Tumor, CLONTECH) were used, and the target clone was amplified under the following PCR conditions.
  • the present invention provides a novel GPCR, a polynucleotide encoding the polypeptide, a vector containing the polynucleotide, a host cell containing the vector, and a method for producing the polypeptide. Further provided are methods for identifying compounds that bind to the polypeptide or modify its activity.
  • the polypeptide or polynucleotide of the present invention, or a compound that binds to or modifies the activity of the polypeptide of the present invention is expected to be used for the development of new preventive or therapeutic agents for diseases associated with the polypeptide of the present invention. Is done.
  • the present invention provides a method for examining a disease comprising detecting mutation or expression of a gene encoding the polypeptide of the present invention.
  • GPCR is one of the most important and attracting attention in the fields of drug development and medicine. The comprehensive provision of new GPCRs in the present invention is expected to make dramatic progress in these fields. Even for GPCR researchers, the present invention will be a valuable source

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un système automatique de recherche d'une séquence GPCR de propriété exclusive, permettant d'identifier avec succès de nouveaux GPCRs à partir de la totalité du génome humain. Un ADN complémentaire est isolé dans un de ces clones.
PCT/JP2003/016245 2002-12-18 2003-12-18 Recepteur couple a une proteine de liaison a la guanosine triphosphate WO2004055186A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003292569A AU2003292569A1 (en) 2002-12-18 2003-12-18 Guanosine triphosphate-binding protein-coupled receptor

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2002366417 2002-12-18
JP2002-366417 2002-12-18
JP2003055691A JP2004242644A (ja) 2002-12-18 2003-03-03 グアノシン三リン酸結合タンパク質共役型の受容体
JP2003-055691 2003-03-03

Publications (1)

Publication Number Publication Date
WO2004055186A1 true WO2004055186A1 (fr) 2004-07-01

Family

ID=32599279

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2003/016245 WO2004055186A1 (fr) 2002-12-18 2003-12-18 Recepteur couple a une proteine de liaison a la guanosine triphosphate

Country Status (3)

Country Link
JP (1) JP2004242644A (fr)
AU (1) AU2003292569A1 (fr)
WO (1) WO2004055186A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006238757A (ja) * 2005-03-02 2006-09-14 Eiken Chem Co Ltd 癌を検出するためのマーカー

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001087932A2 (fr) * 2000-05-12 2001-11-22 Lexicon Genetics Incorporated Sept protéines transmembranaires et polynucléotides les codant
WO2002046230A2 (fr) * 2000-12-08 2002-06-13 Incyte Genomics, Inc. Récepteurs couplés à la protéine g
WO2002053593A1 (fr) * 2000-12-28 2002-07-11 Takeda Chemical Industries, Ltd. Nouvelle proteine de recepteur couple a la proteine g et adn de celle-ci
WO2002063005A2 (fr) * 2001-02-06 2002-08-15 Incyte Genomics, Inc. Molecules associees a des lipides
WO2002063004A2 (fr) * 2001-02-07 2002-08-15 Incyte Genomics, Inc. Recepteurs couples a la proteine g
WO2002099106A2 (fr) * 2001-06-04 2002-12-12 Bayer Aktiengesellschaft Regulation de gpcr de type secretine humaine

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001087932A2 (fr) * 2000-05-12 2001-11-22 Lexicon Genetics Incorporated Sept protéines transmembranaires et polynucléotides les codant
WO2002046230A2 (fr) * 2000-12-08 2002-06-13 Incyte Genomics, Inc. Récepteurs couplés à la protéine g
WO2002053593A1 (fr) * 2000-12-28 2002-07-11 Takeda Chemical Industries, Ltd. Nouvelle proteine de recepteur couple a la proteine g et adn de celle-ci
WO2002063005A2 (fr) * 2001-02-06 2002-08-15 Incyte Genomics, Inc. Molecules associees a des lipides
WO2002063004A2 (fr) * 2001-02-07 2002-08-15 Incyte Genomics, Inc. Recepteurs couples a la proteine g
WO2002099106A2 (fr) * 2001-06-04 2002-12-12 Bayer Aktiengesellschaft Regulation de gpcr de type secretine humaine

Also Published As

Publication number Publication date
JP2004242644A (ja) 2004-09-02
AU2003292569A8 (en) 2004-07-09
AU2003292569A1 (en) 2004-07-09

Similar Documents

Publication Publication Date Title
JP2008200045A (ja) グアノシン三リン酸結合タンパク質共役型の受容体
US20070082345A1 (en) Secretory protein or membrane protein
JP2006523440A (ja) 若年性ヘモクロマトーシス遺伝子（ｈｆｅ２ａ）、その発現産物および使用法
WO2001048189A1 (fr) Nouveaux recepteurs couples a une proteine de liaison au guanosine triphosphate, genes de ces derniers, et production et utilisation de ces derniers
US20070009916A1 (en) Guanosine triphosphate-binding protein coupled receptors
JPH07508643A (ja) 哺乳動物メラニン細胞刺激ホルモン受容体およびその使用
WO2006014999A2 (fr) Compositions et methodes d'utilisation de modulateurs de nectine 4, de semaphorine 4b, d'igsf9 et de kiaa0152 dans le traitement de maladies
JP2004531213A (ja) 輸送体及びイオンチャネル
JP3813156B2 (ja) オピオイド受容体と、その組成物および製造方法
JP2004533222A (ja) 免疫グロブリンスーパーファミリータンパク質
US20060137029A1 (en) Novel G protein-coupled receptor encoding gene and diagnostic uses therefor
JP2003284573A (ja) グアノシン三リン酸結合タンパク質共役型の受容体
EP1284289A1 (fr) Methode d'etude de maladies allergiques
JP2004537283A (ja) 輸送体及びイオンチャネル
US20040086913A1 (en) Human genes and gene expression products XVI
WO2004055186A1 (fr) Recepteur couple a une proteine de liaison a la guanosine triphosphate
KR100977824B1 (ko) Ｅｐｆ 수용체 에세이, 화합물 및 치료학적 조성물
US20030175754A1 (en) RVP-1 variant differentially expressed in crohns disease
JP2004516813A (ja) 関連腫瘍マーカー
JP2005503790A (ja) 輸送体及びイオンチャネル
AU1239701A (en) Nope polypeptides, encoding nucleic acids and methods of use
US20040214990A1 (en) Transmembrane protein differentially expressed in cancer
JP2007125022A (ja) グアノシン三リン酸結合タンパク質共役型の受容体
CA2491420A1 (fr) Proteine induite par le gene rb1 (rb1cc1) et gene
US20030013156A1 (en) Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): BW GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
122 Ep: pct application non-entry in european phase