WO2004039972A1 - Animal transgenique h17t213, proteine h17t213 et adn correspondant - Google Patents

Animal transgenique h17t213, proteine h17t213 et adn correspondant Download PDF

Info

Publication number
WO2004039972A1
WO2004039972A1 PCT/JP2003/013781 JP0313781W WO2004039972A1 WO 2004039972 A1 WO2004039972 A1 WO 2004039972A1 JP 0313781 W JP0313781 W JP 0313781W WO 2004039972 A1 WO2004039972 A1 WO 2004039972A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
acid sequence
protein
hi7t213
Prior art date
Application number
PCT/JP2003/013781
Other languages
English (en)
Japanese (ja)
Inventor
Yoshihiko Kaisho
Takuya Watanabe
Yoshitaka Yasuhara
Ikuo Mori
Shigehisa Taketomi
Original Assignee
Takeda Pharmaceutical Company Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Pharmaceutical Company Limited filed Critical Takeda Pharmaceutical Company Limited
Priority to AU2003275712A priority Critical patent/AU2003275712A1/en
Publication of WO2004039972A1 publication Critical patent/WO2004039972A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/12—Ophthalmic agents for cataracts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A61P29/02—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID] without antiinflammatory effect
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to a non-human mammal into which an HI7T213 gene has been introduced, a novel HI7T213 protein, DNA encoding the protein, and uses thereof.
  • G-protein coupled receptor 7-transmembrane receptors
  • G protein-coupled receptors not only have seven transmembrane domains, but also have many consensus sequences in their nucleic acids or amino acids. Can be classified as On the other hand, polymerase 'chain' reaction utilizing such structural similarity
  • Such a G protein-coupled receptor gene has also been obtained by the method (Polymerase Chain Reaction: hereinafter abbreviated as PCR).
  • PCR Polymerase Chain Reaction
  • the G protein-coupled receptors obtained in this way there are some subtypes with high structural homology to known receptors, and their ligands can be easily predicted. However, in most cases the endogenous ligand is unpredictable, and no corresponding ligand has been found for these receptors. For this reason, these receptors are called orphan receptors. Such unidentified endogenous ligands of the orphan receptor may be involved in biological phenomena for which the ligand was not known and thus not fully analyzed.
  • MCH MCH receptor
  • the Aubuan receptor or its ligand is involved in a new physiological action, and its elucidation is expected to lead to new drug development.
  • there are many difficulties in searching for orphan receptor ligands and while only a few receptors have been identified so far, their ligands have been identified. .
  • exogenous HI7T213 gene is a gene encoding human-derived HI7T213 consisting of the amino acid sequence represented by SEQ ID NO: 3.
  • a medicament for preventing and / or treating cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, comprising a substance obtained by using the screening method described in [9] above.
  • HI7T213agonist obtained by using the screening method according to the above [6] for producing a preventive and / or therapeutic agent for wound, spinal cord injury or analgesia, or a regenerative agent for kidney.
  • a cancer a renal disorder, a cataract, a dermatitis, a chronic pain, Prevention and / or treatment of hyperalgesia,
  • [17] A method for screening substances used for the prevention and / or treatment of cancer, nephropathy, cataract, dermatitis, chronic pain or hyperalgesia, as described in [1] to [5] above. Use of any of the animals or any part thereof,
  • a G protein-coupled receptor protein or a salt thereof which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5;
  • a polynucleotide comprising the polynucleotide encoding the G protein-coupled receptor protein or the partial peptide thereof according to the above [25],
  • a pharmaceutical comprising the G protein-coupled receptor protein according to the above [25], a partial peptide or a salt thereof,
  • a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A preventive and / or therapeutic agent for wounds, spinal cord injury or analgesia or a renal regeneration agent containing the salt thereof,
  • G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7
  • a diagnostic agent for wound, spinal cord injury, analgesia, cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising a polynucleotide containing a polynucleotide encoding a partial peptide thereof,
  • the antibody of the above-mentioned [39] which is a neutralizing antibody that inactivates signal transmission of the G protein-coupled receptor protein of the above-mentioned [25];
  • a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7,
  • a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antibody against the partial peptide or a salt thereof,
  • a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, Wounds, spinal cord injuries, analgesia, cancer, renal disorders, cataracts, dermatitis, chronic pain or hyperalgesia diagnostics containing antibodies to the partial peptides or their salts,
  • a polynucleotide comprising a nucleotide sequence complementary to the polynucleotide of the above-mentioned [28] or a part thereof;
  • G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7
  • a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7,
  • a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antagonist to the partial peptide or a salt thereof,
  • [55] The G protein-coupled receptor protein or a partial peptide thereof according to [25], which can be obtained by using the screening method according to [53] or the screening kit according to [54].
  • [56] contains an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A preventive and / or therapeutic agent for wound, spinal cord injury or analgesia, or a renal regenerating agent, which contains a substance that increases the expression level of G protein-coupled receptor protein or its partial peptide.
  • G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 Or a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, which contains a substance that reduces the expression level of its partial peptide,
  • a mammal comprising: (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7; A G protein-coupled receptor protein, a partial peptide or a salt thereof, (ii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A polynucleotide containing a G protein-coupled receptor protein containing the same amino acid sequence or a polynucleotide encoding a partial peptide thereof, (iii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or A G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, a part thereof A ligand or agonist for the peptide or a salt thereof, or (iv) identical or substantially identical to the amino acid sequence represented by S
  • a mammal comprising: (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7; (Ii) an antibody to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; A polynucleotide comprising a base sequence complementary to a polynucleotide comprising a polynucleotide encoding a G protein-coupled receptor protein or a partial peptide thereof having a substantially identical amino acid sequence or a part thereof, ( iii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO
  • FIG. 1 shows the expression of the endogenous hHI7T213 gene in each mouse tissue.
  • the upper panel shows the expression of the # 8 gene, and the lower panel shows the expression of the # 11 gene.
  • P0, E18, Ad, D, B, I, M, H, C, K, L, S, and T are neonatal mice, 18-day-old fetal mice, adult mice, and dorsal root nerves, respectively. Represents nodes, brain, small intestine, muscle, heart, cortex, kidney, liver, spleen and testis.
  • FIG. 2 is a construction diagram of an expression vector pCAG213-1 for producing a transgenic rat.
  • FIG. 5 shows the tissue distribution of the hHI7T213 gene in 96M transgenic rats.
  • Br, He, Ki, Sp, Li, Re, Le, Sk, In, Mu, and Lu are the brain, heart, kidney, spleen, liver, retina, lens, and small intestine, respectively. , Representing muscle and lungs.
  • FIG. 6 shows the results of pathological analysis of the lens of 96 M transgenic rats.
  • Non-transgenic rats as controls are shown in the left panel (a, c, e, f, i, k) and 96 M results in the right panel (b, d, g, h, j, 1).
  • Represent. 5 W (a-d) indicates 5 weeks of age
  • P 3 (e-j) indicates 3 days of age
  • E 12 (k, 1) indicates embryonic 12 days of age.
  • FIG. 7 shows the results of pathological analysis and hHI7T213 gene expression in the kidney.
  • a and b show the results of hematoxylin / eosin staining (H & E staining) of 5-week-old non-transgenic rats and transgenic rats, respectively, and c to e show the results of 3-day-old non-transgenic rats.
  • C and the results of in situ hybridization of the hHI7T213 gene in the kidneys of transgenic rats (d and e).
  • FIG. 8 shows the results of observation of epidermal hyperplasia and parakeratosis in transgenic rats.
  • (A, b, e, f) and (c :, d, g, h) represent the results using non-transgenic rats and transgenic rats, respectively.
  • (A, c, e, g) shows the results of hematoxylin / eosin staining
  • (b, d, f, h) shows the results of in situ hybridization of the hHI7T213 gene. .
  • (A-d) is 3 days old
  • (e-h) is 7 days old.
  • FIG. 9 shows the expression level of the hHI7T213 gene in the skin of muscles of 96 M and 13 M of transgenic rats. The individual numbers correspond to Table 1.
  • FIG. 11 shows the results of observation of epidermal free nerve endings of the transgenic rat 96M at the age of 7 days. Keratin6 and PGP9.5 indicate that a mouse anti-keratin 6 antibody and a heron anti-PGP9.5 antibody were used, respectively.
  • Non (ac) represents a control rat (non-transgenic rat) and Tg (di) represents a transgenic rat, and the border of the epidermis is indicated by a dotted line.
  • the transgenic animal of the present invention includes, for example, fertilized eggs of non-human mammals, unfertilized eggs, spermatozoa and their progenitors (primordial germ cells, oocytes, oocytes, oocytes, spermatogonia, spermatozoa, In the early stage of embryo development of a fertilized egg (more preferably, before the 8-cell stage), calcium phosphate co-precipitation, electroporation (electo-portion), lipofection, etc.
  • Use the gene transfer method such as agglutination method, microinjection (microphone injection) method, gene gun (particle gun) method, DEAE-dextran method, etc.
  • a target DNA can be introduced into somatic cells, tissues, organs, and the like of a non-human mammal, and the resulting DNA can be used for cell culture, tissue culture, and the like.
  • Transgenic animals can also be created by fusing embryo (or germ) cells using known cell fusion methods.
  • the DNA of interest is introduced into non-human mammal embryonic stem cells (ES cells) using the above-described gene transfer method in the same manner as in the case of producing knockout animals, and the DNA is stably assembled in advance.
  • a part for example, (i) a cell, a tissue, an organ, or the like having a DNA incorporating the exogenous HI7T2113 gene or its mutant gene
  • various proteins or DNAs that can be isolated from the transgenic animal, such as those obtained by culturing cells or tissues derived therefrom and subculturing as necessary, and the like.
  • the part of the non-human mammal having a DNA into which the sex HI7T213 gene or its mutant gene has been incorporated is referred to as the ⁇ exogenous HI7T213 gene or its part '' of the present invention. It can be used for the same purpose as "a non-human mammal having DNA into which a mutant gene has been incorporated".
  • Cells that are part of the transgenic animal include, but are not limited to, skin, liver Cells such as kidney, heart, spleen, lung, adrenal gland, testis, ovary and eyeball are preferred.
  • the exogenous HI7T213 gene to be introduced into the target non-human mammal includes, for example, human, pig, sheep, goat, goat, rabbit, dog, cat, guinea pig, hamster, rat, mouse HI7T213 gene derived from mammals such as HI7T213 can be used.
  • the amino acid sequence constituting HI7T213 has 1 to 30, preferably 1 to 10, More preferably, it is preferable to mutate so that substitution, addition or deletion occurs to 1 to 5, more preferably 1 or 2 amino acids, and any mutation that does not lose the function of HI7T213 is preferable. May be a mutation.
  • a gene encoding HI 7 T 2 13 described below is used, and more specifically, represented by SEQ ID NO: 1 DNA encoding human HI7T213 containing an amino acid sequence (SEQ ID NO: 2), DNA encoding human HI7T213 containing an amino acid sequence represented by SEQ ID NO: 3 (sequence No .: 4), DNA encoding mouse HI7T213 containing the amino acid sequence represented by SEQ ID NO: 5 (SEQ ID NO: 6), SEQ ID NO: No .: DNA encoding the mouse HI7T213 containing the amino acid sequence represented by 7 (SEQ ID NO: 8) and the like are used.
  • the exogenous HI7T213 gene or its mutant gene (hereinafter sometimes simply referred to as the HI7T213 gene) in the present invention is the same as the non-human mammal to be introduced or expressed. Alternatively, it may be derived from a different kind of mammal, but is preferably derived from a different kind of mammal.
  • a gene construct eg, a vector, etc. linked downstream of a promoter that can be expressed in the cells of the target animal.
  • a human HI7T213 gene when a human HI7T213 gene is introduced, various mammals having the HI7T213 gene, which is highly homologous to the human HI7T213 gene (Egret) , A dog, a cat, a guinea pig, a hamster, a rat, a mouse, or the like (preferably, a rat, etc.)), and downstream of various promoters capable of expressing the human HI7T213 gene.
  • the vector ligated into the fertilized egg eg, rat fertilized egg
  • the gene expressing the target human HI7T213 gene is highly expressed.
  • a non-human mammal introduced into the offspring can be produced. '
  • Expression vectors for the HI7T213 gene include Escherichia coli-derived plasmid, Bacillus subtilis-derived plasmid, yeast-derived plasmid, batter phage such as ⁇ phage, retrovirus such as Moroni leukemia virus, and vaccinia. Viruses or animal viruses such as baculovirus are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used, and a plasmid derived from Escherichia coli is particularly preferred.
  • Promoters that regulate gene expression of exogenous ⁇ I 7 72 13 genes include, for example, promoters of genes derived from viruses (eg, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus), various Genes derived from mammals (eg, human, egret, dog, cat, guinea pig, hamster, rat, mouse) and birds (eg, chicken) (eg, albumin, endothelin, osteocalcin, muscle creatine kinase, type I) Type II collagen, cyclic AMP-dependent protein killer "I-beta I unit, atrial sodium diuresis Sex factor, dopamine monohydroxylase, neurofilament light chain, meta-oral thionin I and IIA, meta-oral proteinase 1 tissue inhibitor, smooth muscle actin, polypeptide chain elongation factor 1a (EF1- ⁇ ), ⁇ Actin, ct and / 3 myosin heavy chains, myosin light chains 1 and 2, myel
  • a promoter capable of specifically or highly expressing an exogenous HI7T213 gene in a target tissue according to a target disease model eg, a serum amyloid P component capable of high expression in a liver
  • gene promoters such as albumin, transferrin, antithrombin III, ⁇ 1-antitrypsin; gene promoters such as ⁇ and j3 myosin heavy chains, myosin light chains 1 and 2 that can be highly expressed in the heart
  • Gene promoters such as PTH / PTH r P receptor that can be highly expressed
  • gene promoters such as ACTH receptor that can be highly expressed in the adrenal gland
  • gene promoters such as fatty acid binding protein that can be highly expressed in the digestive tract
  • Gene promoters such as possible myelin basic protein and glial fibrillary acidic protein Etc.
  • the above-described vector selects a clone into which the introduced gene has been stably integrated. It is preferable to further include a selectable marker gene (eg, a drug resistance gene such as a neomycin resistance gene, a hygromycin resistance gene, and an ampicillin resistance gene). Furthermore, if the incorporation of the transgene into a specific site of the host chromosome by homologous recombination (ie, the production of a knock-in animal) is intended, the above-mentioned vector is used to eliminate random insertion.
  • a selectable marker gene eg, a drug resistance gene such as a neomycin resistance gene, a hygromycin resistance gene, and an ampicillin resistance gene.
  • a herpes simplex virus-derived thymidine kinase gene or diphtheria toxin gene is further included as a negative selection marker gene outside the DNA sequence homologous to the site.
  • the translation region of HI7T213 is derived from the liver, kidney, and fibroblasts of various human and non-human mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, and mice) Using all or part of DNA and genomic DNA derived from various commercially available genomic DNA libraries as raw materials, or known from RNA derived from liver, kidney, and fibroblasts of human and non-human mammals It can be obtained using the complementary DNA prepared by the above method as a raw material. In addition, a translation region mutated by a point mutagenesis method or the like can also be prepared using the HI7T213 translation region obtained from the above cells or tissues. These are all materials that can be used for transgenic animals.
  • the above-mentioned translation region is ligated to a HI by a conventional genetic engineering technique in which it is linked to a downstream of the above-mentioned promoter (preferably, an upstream of a transcription termination site) as a gene construct (eg, a vector) which can be expressed in an introduced animal.
  • a gene construct eg, a vector
  • a DNA incorporating the 7T213 gene can be produced.
  • the plasmid pCXN which contains the CAG promoter containing the Nitriactin promoter, the region containing the polyA addition signal of the rabbit pig mouth, the SV40 replication initiation region, the ampicillin resistance gene, and the neomycin resistance gene.
  • pCAG2113-1 (Example 1 described later) into which the HI7T213 gene is inserted is used.
  • the expression vector containing the DNA encoding the exogenous HI7T213 obtained as described above is introduced into an early embryo of a target non-human mammal by a microinjection method.
  • a target non-human mammal For the early embryo of the target non-human mammal, an in-vivo fertilized egg obtained by mating male and female non-human mammals of the same species, or eggs collected from males and females of the same non-human mammal, respectively, are collected. And sperm can be obtained by in vitro fertilization.
  • mice preferably inbred mice such as C57BL / 6J (B6), and inbred mice with B6
  • females are about 4 to about 6 weeks old and males are about 2 to about 8 months old.
  • about 12 hours light period conditions for example, 7: 00— (9: 00) at about 1 week.
  • hCG which is generally abbreviated as hCG
  • the preferred amount and interval of administration of the hormone differ depending on the type of non-human mammal.
  • the non-human mammal is a mouse (preferably an inbred mouse such as C57BL / 6J (B6), or an F from B6 to another inbred)
  • a luteinizing hormone is preferably administered, and immediately bred with male mice to obtain fertilized eggs.
  • the dose of follicle stimulating hormone is preferably about 20 to about 50.
  • IU / individual preferably about 30 IU / individual
  • the dose of luteinizing hormone is about 0 to about 10 IUZ individual, preferably about 5 IU / individual.
  • Microinjection of DNA into a fertilized egg can be performed using a known device such as a micromanipulator according to a conventional method. Briefly, fertilized eggs placed in microdrops of embryo culture medium are aspirated and fixed with a holding pipe, and the DNA solution is injected into the male or female pronucleus, preferably using an injection pipe. Inject directly into the male pronucleus. It is preferable to use a transgene highly purified by CsC1 density gradient ultracentrifugation or the like. In addition, it is preferable that the transgene is linearized by cutting the vector portion using a restriction enzyme.
  • Fertilized eggs after DNA transfer were cultured from the 1-cell stage to the blastocyst stage in 5% carbon dioxide / 95% atmosphere by microdroplet culture in embryo culture medium, etc. Implanted into the fallopian tubes or uterus of non-human mammals.
  • the female non-human mammal for embryo transfer may be of the same species as the animal from which the early embryo to be transferred is derived.
  • an ICR female mouse preferably about (8 to about 10 weeks old) are preferably used.
  • the female receiving embryo may be of natural ovulation, or may be administered luteinizing hormone-releasing hormone (generally LHRH) or an analog thereof prior to mating with the vasectomized (ligated) male. Alternatively, those having induced fertility may be used.
  • LHR H analogs include [3,5-Dil-Tyr 5 ] -LH-RH, [Gin 8 ] -LH-RH, [D-Ala 6 ]- LH-RH, [des-Gly 10 ] -LH-RH, [D-His (Bzl) 6 ] -LH-RH and their Ethylamides.
  • the dose of LHRH or an analog thereof and the timing of mating with a male non-human mammal after its administration vary depending on the type of non-human mammal.
  • the non-human mammal is a mouse (preferably an ICR mouse or the like)
  • the dose of the analog is usually about 10 to 60 g / individual, preferably about 40 ⁇ g Z individual.
  • embryos are transferred to the female uterus for embryos after the morula embryo stage, or to the fallopian tubes if they are earlier (for example, 1- to 8-cell stage embryos).
  • the female for embryo reception one that has passed a certain number of days from pseudopregnancy according to the stage of development of the transplanted embryo is used as appropriate.
  • a female mouse about 0.5 days after pseudopregnancy is preferable to transfer a 2-cell embryo
  • a female mouse about 2.5 days after pseudopregnancy is preferable to transfer a blastocyst stage embryo .
  • a non-human mammal can be obtained by spontaneous delivery or cesarean section.
  • Spontaneously delivered embryonated females may be allowed to continue nursing as they are.
  • the offspring are separately prepared nursing females (for example, in the case of mice, they are usually bred by the females Preferably, an ICR female mouse, etc.) can be used for suckling.
  • BDFi mice C57BLZ6 mice and BDFi mice (C57BL / 6 mice) in which the number of eggs collected was improved by crossing with DBA / 2 ES cells established from F of C57BL / 6 and DBA / 2 can also be used favorably.
  • BD mice have the advantages of high number of eggs collected and robust eggs, as well as the advantages of C57B. Since LZ6 mice are used as background, the ES cells derived from them can be backcrossed with C57BL / 6 mice to generate C57BLBZ6 mice when creating disease model mice. It can be used advantageously in that it is possible.
  • male ES cells are generally more convenient for producing germ-line chimeras. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor.
  • An example of a method for determining the sex of ES cells is a method of detecting a gene in the sex-determining region on the Y chromosome by PCR using a PCR method.
  • this method conventionally, for example G-banding method, it requires about 1 0 6 cells for karyotype analysis, since requires only one colony extent of ES cell number (about 50)
  • the primary selection of ES cells in the early stage of culture can be performed by gender discrimination, and the early selection of male cells can greatly reduce the labor in the early stage of culture.
  • the second selection can be performed by, for example, confirming the number of chromosomes by the G-banding method.
  • the number of chromosomes in the obtained ES cells is desirably 100% of the normal number.
  • the ES cell line obtained in this way must be carefully subcultured to maintain the properties of undifferentiated stem cells.
  • a suitable feeder cell such as STO fibroblast
  • a carbon dioxide incubator preferably 5%
  • LIF 1-10000 OU / ml
  • trypsin / EDTA solution usually 0% 00 1 to 0.5% trypsin / 0.1-5mM EDTA, preferably about 0.1% tryp ImM EDTA
  • a method of seeding on the vesicle is used. Such passage is usually performed every 1 to 3 days. At this time, cells are observed. If morphologically abnormal cells are found, it is desirable to discard the cultured cells.
  • ES cells can be cultured in monolayers at high densities or in suspension cultures to form cell clumps under appropriate conditions to produce various types of cells such as parietal, visceral, and cardiac muscles. (MJ Evans and ⁇
  • exogenous HI 7 T 2 13 -expressing non-human mammals obtained by differentiating ES cells into which the gene encoding the exogenous HI 7 T 2 13 of the present invention has been introduced.
  • Cells are useful in cell biology studies of exogenous HI7T2113 in vitro.
  • Electroporation may be performed under the same conditions used for gene transfer into normal animal cells.
  • ES cells into which the transgene has been incorporated can be screened by Southern hybridization or PCR for chromosomal DNA isolated and extracted from a corneal knee obtained by culturing a single cell on a single feeder cell.
  • the greatest advantage of the transgenic system using ES cells is that the transformants can be selected at the cell level using the expression of drug-resistance gene and reporter gene as indices. .
  • the transfer vector used here is exogenous HI 7 T 21
  • a drug resistance gene eg, neomycin phosphotransferase II (npt II) gene, hygromycin phosphotransferase (hpt) gene, etc.
  • a reporter gene eg, j3-galactosidase
  • a selection marker gene such as (lacZ) gene, chloramphenicol acetyltransferase (cat) gene and the like.
  • ES cells after the gene transfer treatment are cultured in a medium containing a neomycin antibiotic such as G418, and resistant colonies that have emerged are identified. After transferring to each culture plate and repeating trypsinization and medium exchange, leave a part for cultivation, and use PCR or Southern hybridization to confirm the presence of the transgene.
  • a neomycin antibiotic such as G418, and resistant colonies that have emerged are identified.
  • ES cells in which integration of the transgene has been confirmed are returned into an embryo derived from a non-human mammal of the same species, the ES cell is integrated into the ICM of the host embryo to form a chimeric embryo. By transplanting this into a foster parent (female for embryo reception) and continuing its development, a chimeric transgenic animal can be obtained. If ES cells in chimeric animals contribute to the formation of primordial germ cells that differentiate into eggs and sperm in the future, a germline chimera will be obtained, and by crossing them, the transgene is genetically fixed. The resulting transgenic non-human mammal can be produced.
  • Methods for producing chimeric embryos include a method in which early embryos up to the morula stage are adhered and assembled (assembly chimera method), and a method in which cells are microinjected into the blastocyst blastocyst (injection chimera method) Although the latter method has been widely used in the production of chimeric embryos using ES cells, recently, there has been proposed a method for producing an assembled chimera by injecting ES cells into the zona pellucida of an 8-cell embryo.
  • the host embryo can be collected in the same manner from a non-human mammal that can be used as a female for egg collection in transferring a gene into a fertilized egg.
  • the host cells were derived from mice of a different line from the ES cell origin.
  • the embryo is collected. For example, if ES cells are derived from a 1229 mouse (hair color: Agouchi), use C57BL / 6 mouse (hair color: black) or ICR mouse (hair color: albino) as a female for egg collection.
  • ES cells are derived from C57B / 6 or D mouse (hair color: black) or TT2 cells (F of C57B / 6 and CBA, (hair color: Agouti)), rub eggs ICR mice and BALB / c mice (hair color: albino) can be used as female animals.
  • the ability to form a germline chimera greatly depends on the combination of an ES cell and a host embryo, it is more preferable to select a combination having a high ability to form a germline chimera.
  • a combination having a high ability to form a germline chimera For example, in the case of mice, it is preferable to use host embryos derived from the C57B / 6 gun for ES cells derived from the 129 line, and to use BA embryos for the ES cells derived from the C57BZ6 line. Host embryos derived from the LB / c strain are preferred.
  • the female mouse for egg collection is preferably about 4-6 weeks of age, and the male mouse for mating is preferably about 2 to about 8 months of the same strain.
  • Mating may be by natural mating, but is preferably performed after administration of gonadotropin (follicle-stimulating hormone, then luteinizing hormone) to induce superovulation.
  • a chimeric non-human mammal can be obtained by spontaneous delivery or cesarean section. Breeding females that have spontaneously delivered may be allowed to continue nursing as they are. In the case of delivery by cesarean section, offspring are transferred to separately prepared nursing females (normally mated and delivered female non-human mammals). It can be suckled.
  • Confirmation as to whether the selected chimeric non-human mammal is a germline chimera can be made based on the phenotype of the F animal obtained by crossing with a homologous animal of an appropriate strain. For example, in the case of the above chimeric mouse, since agooch is dominant to black, when crossed with a female C57B / 6 mouse, the coat color obtained when the selected male mouse is a germline chimera is Gooch.
  • a germline chimeric non-human mammal (founder) into which a gene encoding exogenous HI7T213 obtained as described above has been introduced usually has a transgene only on one of homologous chromosomes. Obtained as heterozygotes. In addition, individual finders are randomly inserted on different chromosomes unless homologous recombination is performed. In order to obtain a homozygote having a gene encoding exogenous HI7T213 on both homologous chromosomes, a heterozygote having a transgene on only one of the homologous chromosomes among the animals obtained as described above is required. All that is required is to cross the siblings of the zygote.
  • heterozygotes can be carried out, for example, by screening chromosomal DNA separated and extracted from the tail of an animal by Southern hybridization or PCR. Obtained if the transgene is integrated at only one locus F 2 animals 1/4 is homozygous.
  • the HI7T213 gene is knocked out, or the HI7T213 knockout animal-derived early embryo or ES cell produced from the ES cell according to the method described above is introduced into the ES cell according to the method described above. It can be obtained by introducing a gene encoding sex HI7T213.
  • the HI7T213 gene derived from the target non-human mammal is isolated according to a conventional method, and, for example, another DNA fragment (e.g., neomycin
  • another DNA fragment e.g., neomycin
  • the integration of the gene can be selected using drug resistance or reporter gene expression as an index), and all or part of the HI7T213 gene is cut out using the Cre-1o XP system or the F1p-frt system, and Delete the gene, insert a stop codon into the protein coding region to disable complete protein translation, or terminate gene transcription into the transcribed region DNA strand with a DNA sequence constructed to insert a DNA sequence (e.g., a poly-A addition signal) to disable complete niRNA synthesis, thereby inactivating the gene.
  • targeting vector is preferably incorporated into the HI7T213 locus of the target non-human mammal by homologous recombination.
  • Randomly inserted cells cannot grow on a ganciclovir-containing medium because they have the HSV-tk gene, but cells targeted to the endogenous HI7T2l3 locus by homologous recombination have the HSV-tk gene. , It is ganciclovir resistant and is selected.
  • a diphtheria toxin gene is ligated instead of the HSV-tk gene, cells into which the vector has been randomly inserted will be killed by the toxin produced by the vector itself. You can also choose your body.
  • the transgenic animal of the present invention in which the expression of endogenous HI7T213 is inactivated is transformed into a DNA encoding the exogenous HI7T213 gene by gene targeting using homologous recombination.
  • a knock-in animal in which the sex HI7T213 gene has been substituted may be used.
  • Knock-in animals can be prepared according to a method basically similar to that of knockout animals.
  • the exon of the HI7T213 gene derived from the target non-human mammal is excised using an appropriate restriction enzyme, and a corresponding region of the exogenous HI7T213 gene is inserted instead.
  • a targeting vector containing DNA obtained by the above method is introduced into ES cells derived from a target non-human mammal according to the above-described method, and introduced into the endogenous HI7T213 locus of the animal by homologous recombination.
  • An ES cell clone in which a gene encoding the sex HI7T2113 is integrated may be selected.
  • Clone selection can also be performed using the PCR method or the Southern method.
  • a positive selection marker gene such as a neomycin resistance gene is used in the untranslated region of the targeting vector, such as the HI7T213 gene.
  • Insertion and insertion of a negative selection marker gene such as the HSV-tk gene or diphtheria toxin gene outside the region homologous to the target sequence will allow selection of homologous recombinants using drug resistance as an index. it can.
  • exogenous HI7T2 13 into which the marker gene for positive selection has been introduced may be hindered, use a targeting vector having a 1 oxP sequence or frt sequence at both ends of the marker gene for positive selection. It is preferable to excise the marker gene for positive selection by allowing Cre or Flp recombinase or a recombinase expression vector (eg, an adenovirus vector) to act at an appropriate time after the selection of the homologous recombinant. .
  • transgenic animal of the present invention may be a disease model having one or more other genetic alterations that cause the same or similar pathology as a disease in which the activity of HI7T213 is involved.
  • a “disease involving the regulation of HI 7 T 2 13 activity” includes not only diseases caused by abnormal HI 7 T 2 13 activity or resulting in abnormal HI 7 T 2 13 activity, but also However, it should be understood as a concept including a disease in which a prophylactic and / or therapeutic effect can be obtained by modulating HI7T213 activity.
  • HI7T213 activates to prevent and prevent or Z or treatable diseases such as wounds, spinal cord injury or analgesia are prevented and / or inhibited by inhibiting HI7T213.
  • treatable diseases include cancer, kidney damage, cataract, dermatitis, chronic pain or hyperalgesia, respectively.
  • “Other genetic modification” means a genetic modification other than the introduction of a gene encoding exogenous HI7T213, such as a spontaneous disease model animal in which an endogenous gene has been modified by spontaneous mutation, Transgenic animals into which other genes have been further introduced, knockout animals in which endogenous genes have been inactivated (gene disruption by insertion mutation, etc., and introduction of DNA encoding antisense DNA or neutralizing antibody) (Includes transgenic animals whose gene expression has been reduced to an undetectable or negligible level.) And so on. Therefore, the modification of the endogenous HI7T213 gene also falls under "other genetic modifications" in the present invention.
  • Examples of the “disease model having one or more other genetic alterations that cause the same or similar pathology as a disease associated with HI7T213 activity regulation” include, for example, a hyperlipidemia or arteriosclerosis model.
  • WHHL ⁇ Egret having a mutation in low-density lipoprotein receptor (LD LR); Watanabe Y., Atherosclerosis, Vol. 36, pp. 261 (1980)), SHLM (spontaneous mouse with apoE deficient mutation; Matsushima Y Mamm. Genome, Vol. 10, p. 352, 1999), LD LR knockout mouse (Ishibashi S. et al., J. Clin. Invest., Vol. 92, p.
  • LD LR low-density lipoprotein receptor
  • non-human mammals with “other genetic modification” disease models can be purchased from, for example, the Jackson Laboratory in the United States, or can be easily created using well-known genetic modification techniques. it can.
  • the non-human mammal of the present invention may be the same or different from ⁇ one or more other genetic modifications that cause the same or similar pathology as a disease associated with HI7T213 activity regulation ''. It may have been subjected to non-genetic processing that can create other disease models. “Non-transgenic treatment” means a treatment that does not cause genetic modification in a target non-human mammal. Examples of such processing include high fat diet loading processing, glucose loading processing, starvation processing, vascular ligation Z reperfusion, and the like.
  • the method for introducing the genetic modification is not particularly limited.
  • examples include a non-human mammal into which a gene encoding exogenous HI7T213 has been introduced, and a disease involving the regulation of HI7T213 activity.
  • One or more other that cause the same or similar condition as A method of crossing with a non-human mammal of the same disease model having a genetic modification; having one or more other genetic modifications that produce the same or similar pathology as a disease involving the regulation of HI7T213 activity A method for obtaining a transgenic animal by introducing a gene encoding exogenous HI7T213 into the early embryonic ES cells of a disease model non-human mammal by the method described above; exogenous HI7T213
  • the same or similar diseases as those in which the HI7T213 activity regulation is involved can be added to the early embryonic ES cells of a non-human mammal into which the gene encoding
  • a method of introducing one or more other genetic modifications that cause the above-mentioned pathological condition A method of introducing one or more other genetic modifications that cause the above-mentioned pathological condition.
  • transgenic animal may be obtained by simultaneously or sequentially introducing the exogenous gene and the gene encoding exogenous HI7T213 into mammalian early ES cells.
  • exogenous HI7T2 The gene encoding 213 may be designed so that it can be targeted to an endogenous gene to be destroyed, and introduced into ES cells of a wild-type non-human mammal.
  • the targeting vector those exemplified for the above-described production of knock-in animals can be preferably used, except that the endogenous HI7T213 gene is replaced with the endogenous gene to be destroyed.
  • a non-human mammal into which a gene encoding exogenous HI7T213 has been introduced, and one or more other genes that cause the same or similar pathology as a disease involving the regulation of HI7T213 activity When crossing with a non-human mammal of the same type having a modification, it is desirable to cross homozygotes. For example, both genes obtained by crossing a homozygote in which the gene encoding exogenous HI7T213 is integrated at one locus and an apoE homo-deficient hyperlipidemia (arteriosclerosis) model About Hetero. This together 1/1 6 F 2 individuals obtained by sib mating is the exogenous HI 7 T 2 1 3 Homo introduction ⁇ apo E-deficient homozygous.
  • the non-human mammal of the present invention When the non-human mammal of the present invention overexpresses the exogenous ⁇ I7 ⁇ 213 gene, it has at least one of the following phenotypes.
  • PCNA-positive cells which are proliferation-related antigens, are found in the basal layer of the epidermis and near the pores. '
  • non-human mammal of the present invention Since the non-human mammal of the present invention has the above-mentioned very unique characteristics, it has the following useful uses.
  • the exogenous HI7T213 gene is highly expressed in the non-human mammal of the present invention, it can be used for evaluation of HI7T213agonist or HI7T213angonist.
  • the present invention (i) HI characterized in that a test substance is applied to the non-human mammal of the present invention or a part thereof and assayed for HI 7 T 2 13 agonist activity or HI 7 T 2 13 antagonist activity. 7 T2 13 agonist or HI 7 T 2 13 antagonist screening method,
  • the candidate compound of the HI7T213agonist can be selected, for example, by a binding experiment with HI7T213.
  • test substance is administered to the non-human mammal of the present invention.
  • the test substance may be a known synthetic compound, peptide, protein, DNA library, or the like, or, for example, a tissue extract of a mammal (eg, mouse, rat, pig, pig, sheep, monkey, human, etc.). Cell culture supernatant is used.
  • the HI7T2 13 agonist activity includes a ameliorating effect on diseases such as wounding, spinal cord injury or analgesia, or a renal regeneration effect.
  • a test substance is administered to the non-human mammal of the present invention after the above-mentioned disease has developed. And when the test substance is not administered Cancer, kidney damage, cataract, dermatitis, chronic pain when the test substance is administered
  • test substance When symptoms such as hyperalgesia are improved by about 10% or more, preferably about 30% or more, more preferably about 50% or more, the test substance is prevented and / or treated for the above-mentioned diseases. It can be selected as a substance having an effect.
  • the selected HI7T2113 antagonist can be used as a safe and low toxic prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, etc. .
  • the HI7T213agonist or HI7T213 antagonist may be in the form of a salt, and the HI7T213agonist or HI7T213 antagonist may be a physiological salt. Salts with acids (eg, inorganic acids, etc.) and bases (eg, organic acids, etc.) are used, and physiologically acceptable acid addition salts are particularly preferred.
  • acids eg, inorganic acids, etc.
  • bases eg, organic acids, etc.
  • salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).
  • the selected HI7T213 agonist or HI7T213 antagonist can be administered, for example, orally or as a sugar-coated tablet, capsule, elixir, Mike-mouth capsule, etc.
  • additives examples include binders such as gelatin, corn starch, tragacanth, gum arabic, and crystalline cells. Excipients such as loin, leavening agents such as corn starch, gelatin, alginic acid, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharine, peppermint, cocoa oil or cherry. Such flavoring agents are used.
  • a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material.
  • Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. it can.
  • aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mantol, sodium chloride, etc.).
  • Solubilizers for example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, Polysorbate 80 TM , HCO-50, etc.) You may use together with.
  • the oily liquid include sesame oil and soybean oil, which may be used in combination with a dissolution aid such as benzyl benzoate or benzyl alcohol.
  • buffers eg, phosphate buffer, sodium acetate buffer, etc.
  • soothing agents eg, benzalkonium chloride, proforce hydrochloride, etc.
  • stabilizers eg, human serum albumin, polyethylene glycol, etc.
  • a preservative eg, benzyl alcohol, phenol, etc.
  • an antioxidant e.g, an antioxidant and the like.
  • the DNA When the selected substance is DNA, the DNA may be used alone or in a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. Or warm-blooded animals.
  • the DNA can be administered as it is or in the form of a formulation with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered by a catheter such as a gene gun or a hydrogel catheter.
  • the dose of the selected substance may vary depending on the target disease, the subject of administration, the route of administration, and the like.
  • the substance is administered from about 0.1 to 10 mg per day, preferably from about 1.0 to 5 mg, more preferably from about 1.0 to 20 mg.
  • the single dose of the substance may vary depending on the target of administration, the target disease, etc., for example, for the treatment of wounds in the form of injections for adults (with a body weight of 6 O kg).
  • the non-human mammal of the present invention has a high expression of the exogenous HI7T213 gene, and has the above-mentioned phenotype or cancer, renal disorder, cataract, dermatitis, chronic pain. Pain and hyperalgesia may develop.
  • the non-human mammal of the present invention can be used for evaluating the above phenotype-improving drug, the above-mentioned disease preventive drug or therapeutic drug.
  • test substance is administered to the non-human mammal of the present invention.
  • the test substance may be a known synthetic compound, peptide, protein, DNA library, or the like, or, for example, a tissue extract of a mammal (eg, mouse, rat, pig, pig, sheep, monkey, human, etc.). Cell culture supernatant is used.
  • a test substance when it is determined that administration of a test substance has an effect of improving the above phenotype or a disease such as cancer, renal disorder, cataract, dermatitis, chronic pain, or hyperalgesia (for example, when the phenotype or disease is improved by about 10% or more, preferably about 30% or more, more preferably about 50% or more),
  • the substance can be selected as a medicament for preventing and / or treating these diseases.
  • the substance selected in the screening method of the present invention includes, for example, a HI7T213 antagonist, a substance inhibiting (suppressing) the expression of HI7T213, and a promoter activity of the HI7T213 promoter.
  • the selected substance can be sterile, for example, orally as tablets, capsules, elixirs or microcapsules, optionally coated with sugar, or with water or other pharmaceutically acceptable liquids. It can be used parenterally in the form of injections such as aqueous solutions or suspensions.
  • a substance selected as a prophylactic and / or therapeutic drug with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, etc. It can be manufactured by mixing in the required unit dosage form.
  • the amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.
  • Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc. Swelling agents such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry.
  • a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material.
  • Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. it can.
  • Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.).
  • Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, Polysorbate 80 TM, HCO-50), etc. You may use together.
  • Oily liquids include, for example, sesame oil, soybean Oils and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.
  • the DNA is used alone or in a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. Alternatively, it can be administered to warm-blooded animals.
  • the DNA can be administered as it is or in the form of a formulation with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter.
  • the preparations obtained in this way are safe and have low toxicity, and are, for example, human or non-human warm-blooded animals (for example, rats, mice, guinea pigs, egrets, birds, sheep, pigs, pigs). , Dogs, cats, dogs, monkeys, etc.).
  • the dose of the selected substance may vary depending on the target disease, target, and route of administration. For example, when administered orally for the purpose of treating cataract, in general, for adults (with a body weight of 60 kg), About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the substance is administered per day. In the case of parenteral administration, the single dose of the substance may vary depending on the administration target, target disease, etc. For example, for the treatment of cataract, an adult in the form of an injection (with a body weight of 60 kg) If the substance is administered to the patient, about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg of the substance is injected into the affected area per day. It is expedient to administer the drug. In the case of other animals, the dose can be administered in terms of weight per 60 kg.
  • non-human mammal of the present invention can be used in an experiment for gene therapy of a patient with a HI7T213 gene abnormality.
  • transgenic mammal of the present invention is used as a cell source for tissue culture. It is also possible. Also, for example, the ability to directly analyze DNA or RNA in the tissue of the transgenic mouse of the present invention or the analysis of the protein expressed by the gene can be used to determine the relationship between the complex action of the nuclear receptor and the transcription factor. Can also be analyzed. Alternatively, culturing cells of a gene-bearing tissue by standard tissue culture techniques and using them to study the function of cells derived from tissues that are generally difficult to culture, such as cells forming adipose tissue. You can also. Further, by using the cells, for example, it is possible to select a drug that enhances the function of the cells. In addition, if there is a high expression cell line, it is possible to isolate and purify HI7T213 in a large amount, and to produce an antibody thereof.
  • the G protein-coupled receptor protein (hereinafter sometimes abbreviated as HI7T213) used in the present invention is represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7.
  • HI7T213 is, for example, a human non-human mammal (eg, a guinea pig, a rat, a mouse, a heron, a septa, a sheep, a pig, a monkey, etc.), and any cell (eg, a spleen cell).
  • a human non-human mammal eg, a guinea pig, a rat, a mouse, a heron, a septa, a sheep, a pig, a monkey, etc.
  • any cell eg, a spleen cell
  • Nerve cells glial cells, kidney cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T Cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, bone cells, osteoblasts, osteoclasts, mammary gland Cells, hepatocytes or stromal cells, or their precursors, stem cells or cancer cells), blood cells, or any tissue where these cells are present, such as the brain, Each part of the brain (e.g., olfactory bulb, acrosomal nucleus, basal cerebral sphere, hippocampus, thalamus, hypothalamus, hypothalamus, cerebral cortex, medulla, cerebellum, occip
  • amino acid sequence substantially identical to the amino acid sequence include, for example, about 76% or more, preferably about 76% or more of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. Is an amino acid sequence having a homology of 80% or more, more preferably about 90% or more, and still more preferably about 95% or more.
  • Examples of the protein having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 according to the present invention include, for example, SEQ ID NO: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 5 A protein having substantially the same activity as the amino acid sequence represented by No. 7 is preferred.
  • substantially the same activity include a ligand binding activity and a signal transduction activity. Substantially the same means that their activities are the same in nature. Therefore, the activities such as ligand binding activity and signal information transmission activity are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 20 times). However, the quantitative factors such as the degree of activity and the molecular weight of the protein may be different.
  • the activities such as the ligand binding activity and the signal transduction activity can be measured according to known methods. For example, they can be measured according to the screening method described later.
  • the HI7T2113 includes: a ) one or more (preferably, one or more) of the amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; About 30 amino acids, more preferably about 1-10 amino acids, still more preferably several (1-5) amino acids are deleted, b) SEQ ID NO: 1, SEQ ID NO: 3, sequence No.
  • HI 7 T 21 3. has an N-terminus (amino terminus) at the left end and a C-terminus (caprolactyl terminus) at the right end, according to the convention of peptide labeling.
  • HI7T213, including HI7T213 containing the amino acid sequence represented by SEQ ID NO: 1, has a C-terminal carboxyl group (one COOH), carboxylate (one COO, one amide) one CONH 2) or, as R in the ester may be any ester (one COOR), for example, methyl, Echiru, n- propyl, CI- 6 alkyl group such Isopuropiru or n- heptyl, for example, Shikurobe pentyl, C 3- 8 cycloalkyl groups such as cyclohexyl, for example, phenylene Honoré, C 6 12 ⁇ Li one Honoré groups, such as single-naphthyl, for example, Benjinore, full of
  • HI 7T 21 3 in the protein described above, Amino group protecting groups Mechio Nin residues of N-terminal (e.g., formyl group, etc. C 6 Ashiru group such as C 2 _ 6 Al Kanoiru group such Asechiru ), The glutamyl group formed by cleavage of the N-terminus in vivo and pyroglutamine oxidation, the substituent on the side chain of the amino acid in the molecule (eg, 1 OH, 1 SH, amino acid) Group, imidazole group, Indole group, etc.
  • Mechio Nin residues of N-terminal e.g., formyl group, etc. C 6 Ashiru group such as C 2 _ 6 Al Kanoiru group such Asechiru
  • the glutamyl group formed by cleavage of the N-terminus in vivo and pyroglutamine oxidation, the substituent on the side chain of the amino acid in the molecule eg, 1 OH, 1 SH, amino
  • Guanijino group appropriate protecting groups (e.g., formyl group, C 2, such as ⁇ Se Chill - 6 such as C _ 6 Ashiru group such Arukanoiru group) those are protected by, a sugar chain bound Complex proteins such as so-called glycoproteins are also included.
  • protecting groups e.g., formyl group, C 2, such as ⁇ Se Chill - 6 such as C _ 6 Ashiru group such Arukanoiru group
  • a sugar chain bound Complex proteins such as so-called glycoproteins are also included.
  • the partial peptide of HI 7 T 2 13 may be any of the partial peptides of HI 7 T 2 13 described above.
  • partial peptide for example, among HI7T213 protein molecules, those which are exposed outside the cell membrane and have substantially the same receptor binding activity are used.
  • the number of amino acids of the partial peptide of the present invention is at least 20 or more, preferably 50 or more, more preferably 100 or more of the amino acid sequences constituting the receptor protein of the present invention. Peptides having a sequence are preferred.
  • a substantially identical amino acid sequence has a homology of about 76% or more, preferably about 80% or more, more preferably about 90% or more, and even more preferably about 95% or more with these amino acid sequences. 1 shows the amino acid sequence of the protein.
  • the C-terminus may be any of a hydroxyl group (one COOH), a carboxylate (one COO—), an amide (one CONH 2 ) or an ester (one COOR).
  • the partial peptide of the present invention has a lipoxyl group (or carboxylate) at a position other than the C-terminus
  • the amide or esterified lipoxyl group is also included in the partial peptide of the present invention. It is.
  • the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.
  • the partial peptide of the present invention has a N-terminal methionine residue whose amino group is protected by a protecting group, and a N-terminal side that is cleaved in vivo, as in the case of HI7T213 described above.
  • Compounds such as those in which the generated daltamyl group is oxidized by pyroglutamine, those in which the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or those in which a sugar chain is bonded to a so-called glycopeptide. Beptides are also included.
  • Examples of the salt of the HI 7 T 2 13 or a partial peptide thereof of the present invention include a physiologically acceptable salt with an acid or a base, and a physiologically acceptable acid addition salt is particularly preferable.
  • Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid
  • the HI 7 T 2 13 or a salt thereof of the present invention can also be produced from the above-mentioned human mammalian cell or tissue by a known method for purifying a receptor protein. Alternatively, it can be produced by culturing a transformant containing a DNA encoding HI7T213 of the present invention described later. In addition, the protein can be produced according to the protein synthesis method described later or according to the method.
  • a commercially available resin for protein synthesis can be usually used.
  • a resin for protein synthesis examples include chloromethyl resin, hydroxymethyl resin, benzylhydramine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, Hydroxymethylmethylphenylacetamide methyl resin, polyacrylamide resin, 4- (2 ', 4, dimethoxyphenoxyhydroxymethyl) phenoxy resin, 4- (2,, 4, -dimethoxyphenyl) Fmoc aminoethyl) phenoxy resin and the like.
  • an amino acid having an ⁇ -amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target protein according to various known condensation methods.
  • the protein is cleaved from the resin and, at the same time, various protecting groups are removed.
  • an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the target protein or its amide.
  • solvent used for activation of the protected amino acid or condensation with the resin It can be appropriately selected from solvents known to be usable for the condensation reaction. For example,
  • Acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylvirolidone, halogenated hydrocarbons such as methylene chloride and chloroform, trifluoroethanol, etc.
  • Alcohols, sulphoxides such as dimethylsulfoxide, ethers such as pyridine, dioxane, tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate;
  • the reaction temperature is appropriately selected from the range known to be usable for the protein bond formation reaction, and is usually selected from the range of about 120 ° C to 50 ° C.
  • the activated amino acid derivative is usually used in a 1.5- to 4-fold excess.Results of the test using the ninhydrin reaction If the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group.If sufficient condensation is not obtained even after repeating the reaction, acetic anhydride or Unreacted amino acids can be acetylated using acetylimidazole.
  • Examples of the protecting group for the amino group of the starting material include Z, Boc, tertiary pentoxycarbonyl compound, isobornyloxycanole compound, 4-methoxypentzinoxycarbonyl, C1Z, Br — Z, adamantyloxycarponyl, trifluorfluoroacetyl, phthaloynole, forminole, 2-nitrophenylenolesnorrephene27, diphenylphosphinoinoyl oil, Fmoc, etc. are used.
  • the carboxyl group can be, for example, alkyl esterified (for example, methyl, ethyl, propyl, pentinole, tertiary butynole, pentopene, hexinole, cycloheptyl, cyclooctyl, 2-adamantyl, etc.
  • alkyl esterified for example, methyl, ethyl, propyl, pentinole, tertiary butynole, pentopene, hexinole, cycloheptyl, cyclooctyl, 2-adamantyl, etc.
  • Branched or cyclic alkyl esterification branched or cyclic alkyl esterification
  • aralkyl esterification e.g., benzyl ester, 4-trobenzizole ester, 4-methoxybenzino ester, 4-methyl benzyl ester, Benzhydryl esterification
  • phenacyl esterification benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like.
  • protecting groups for Fuwenoru hydroxyl group of tyrosine for example, B z 1, C l 2 - B zl, 2 _ nitrobenzyl, B r- Z, as a protecting group for imidazole histidines such tertiary heptyl is used,
  • B z 1, C l 2 - B zl, 2 _ nitrobenzyl, B r- Z as a protecting group for imidazole histidines such tertiary heptyl is used.
  • Tos 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.
  • Examples of the activated carbonyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) Phenol, cyanometinole alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimid, ester with HOBt).
  • active ester alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) Phenol, cyanometinole alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimid, ester with HOBt).
  • active ester alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) Phenol, cyanometinole alcohol, paranitrophenol, HONB, N-hydroxysucc
  • Methods for removing (eliminating) protecting groups include, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, hydrogen anhydride, methanesulfonic acid, and the like.
  • a catalyst such as Pd-black or Pd-carbon, hydrogen anhydride, methanesulfonic acid, and the like.
  • Acid treatment with trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and sodium in liquid ammonia Reduction is also used.
  • the elimination reaction by the above-mentioned acid treatment is generally carried out at a temperature of about 120 ° C to 40 ° C.
  • a force-thione scavenger such as 1,4-butanedithiol or 1,2-ethanedithionole.
  • a force-thione scavenger such as 1,4-butanedithiol or 1,2-ethanedithionole.
  • the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment
  • the formyl group used as an indole protecting group of tributofan is the above 1,1.
  • alkali treatment with dilute sodium hydroxide solution, dilute ammonia, etc.
  • the protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.
  • an amide form of a protein for example, first, amidating and retaining the ⁇ -hydroxyl group of the amino acid at the terminal end of the amino acid, a peptide (protein) chain is attached to the amino group side. After elongation to the desired chain length, a protein in which only the protecting group of the amino group at the ⁇ -terminus of the peptide chain is removed and a protein in which only the protecting group of the carboxy group at the C-terminus is removed are produced.
  • the condensation is carried out in the above-mentioned mixed solvent. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude protein. This crude protein is purified by using various known purification means, and the main fraction is lyophilized to obtain an amide of the desired protein.
  • the desired protein in order to obtain an ester of a protein, for example, after condensing the ⁇ -carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, the desired protein can be obtained in the same manner as the amide of a protein.
  • the partial peptide of ⁇ I 7 ⁇ 213 of the present invention or a salt thereof can be prepared by a known peptide synthesis method or by cleaving HI 7T213 of the present invention with an appropriate peptide.
  • a method for synthesizing a peptide for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide is produced by condensing a partial peptide or amino acid capable of constituting HI7T213 of the present invention with the remaining portion, and removing the protecting group when the product has a protecting group. can do.
  • Known condensation methods and elimination of protecting groups include, for example, the methods described in the following a) to e).
  • the polynucleotide encoding the HI7T213 of the present invention includes any polynucleotide containing the above-described nucleotide sequence (DNA or RNA, preferably DNA) encoding the HI7T213 of the present invention. It may be something.
  • the polynucleotide is RNA, such as DNA or mRNA, encoding HI7T213 of the present invention, and may be double-stranded or single-stranded. In the case of double-stranded, it may be double-stranded DNA, double-stranded RNA or DNA: RNA hybrid. In the case of a single strand, it may be a sense strand (that is, a coding strand) or an antisense strand (that is, a non-coding strand).
  • the DNA encoding the HI7T213 of the present invention which can quantify the mRNA of the HI7T213 of the present invention, includes genomic DNA, genomic DNA library, cDNA derived from the above cells or tissues, Any of the above-mentioned cells or tissue-derived cDNA library and synthetic DNA may be used.
  • the vector used for the library may be any of pacteriophage, plasmid, cosmid, and phagemid.
  • total cells Amplification can also be carried out directly by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using the prepared RNA or mRNA fraction.
  • RT-PCR method Reverse Transcriptase Polymerase Chain Reaction
  • the hybridization can be performed by a known method or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. SambrooK et al., Cold Spring Harbor Lab. Press, 1989).
  • the method can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringent conditions.
  • the high stringent conditions include, for example, a sodium concentration of about 19 to 40. mM, preferably about 19-20 mM, and a temperature of about 50-70 ° C, preferably about 60-65 ° C.
  • a sodium concentration of about 19 to 40. mM, preferably about 19-20 mM
  • a temperature of about 50-70 ° C, preferably about 60-65 ° C.
  • the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C is most preferable.
  • the DNA encoding human-derived HI7T213 (hHI7T213) consisting of the amino acid sequence represented by SEQ ID NO: 1 is represented by SEQ ID NO: 2
  • a DNA consisting of a nucleotide sequence or the like is used.
  • Examples of the DNA encoding human-derived HI7T213 (hHI7T213) comprising the amino acid sequence represented by SEQ ID NO: 3 include DNA comprising the base sequence represented by SEQ ID NO: 4. Used.
  • the DNA encoding mouse-derived HI7T213 (# 11) having the amino acid sequence represented by SEQ ID NO: 5 a DNA having the base sequence represented by SEQ ID NO: 6 and the like are used.
  • As the DNA encoding mouse-derived HI7T213 (# 8) having the amino acid sequence represented by SEQ ID NO: 7, a DNA having the base sequence represented by SEQ ID NO: 8 and the like are used.
  • a polynucleotide comprising a part of the base sequence of the DNA encoding HI7T213 of the present invention or a part of the base sequence complementary to the DNA is a part of the present invention described below. It is used to include not only DNA encoding a peptide but also RNA.
  • terminal untranslated region polypeptide translation initiation codon, protein
  • the coding region, the ORF translation initiation codon, the 3'-end untranslated region, the 3'-end palindromic region, and the 3'-end hairpin loop may be selected as preferred regions of interest, although any within the HI7T2 13 gene Regions may also be selected for antisense 'polynucleotides.
  • Antisense polynucleotides are polydexoxy liponucleotides containing 2-dexoxy D-report, polyribonucleotides containing D-report, N-daricosides of purine or pyrimidine bases, etc.
  • polymers having a non-nucleotide backbone eg, commercially available proteins, nucleic acids or nucleic acid polymers specific to synthetic sequences
  • polymers containing special bonds provided that the polymer Include base pairs that are found in DNA and RNA (contain nucleotides that have a configuration that allows base attachment).
  • They can be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, and also DNA: RNA hybrids, and can be unmodified polynucleotides (or unmodified oligonucleotides), or even known.
  • nucleoside may contain not only purine and pyrimidine bases, but also may have other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleotides and modified nucleotides may also be modified at the sugar moiety, e.g., where one or more hydroxyl groups have been replaced with halogens, aliphatic groups, etc., or ethers, amines, etc. It may have been converted to a functional group.
  • the antisense 'polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA).
  • modified nucleic acid include, but are not limited to, sulfur derivatives of nucleic acids, thiophosphate derivatives, and those that are resistant to degradation of polynucleoside amides and oligonucleoside amides.
  • the antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, to make the antisense nucleic acid more stable in the cell, to make the antisense nucleic acid more cell permeable, to have a greater affinity for the target sense strand, and to be more toxic if it is toxic. Make sense nucleic acids less toxic.
  • the antisense nucleic acids of the present invention may contain altered or modified sugars, bases, bonds, and may be provided in special forms such as ribosomes and microspheres, applied by gene therapy, It could be given in additional form.
  • additional forms include polycations, such as polylysine, which act to neutralize the charge on the phosphate backbone, and lipids, which enhance the interaction with cell membranes or increase the uptake of nucleic acids ( For example, crude water-based substances such as phospholipids and cholesterol are exemplified.
  • Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chromate formate, cholic acid, etc.).
  • 3 can be attached to the end, and can be attached via a base, sugar, or molecular nucleoside bond.
  • Other groups include capping groups specifically located at the 3 'or 5' end of nucleic acids that prevent degradation by nucleases such as exonucleases and RNases. .
  • capping groups include, but are not limited to, hydroxyl-protecting groups known in the art, such as glycols such as polyethylene glycol and tetraethylene dalicol.
  • the inhibitory activity of an antisense nucleic acid can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of a G protein-coupled receptor protein. it can.
  • the nucleic acid can be applied to cells by various known methods.
  • the DNA encoding the partial peptide of the present invention may be any DNA as long as it contains the above-described nucleotide sequence encoding the partial peptide of the present invention.
  • any of genomic DNA, genomic DNA library, cDNA derived from the above-described cells or tissues, cDNA library derived from the above-described cells or tissues, and synthetic DNA may be used.
  • the vector used for the library may be any of pacteriophage, plasmid, cosmid, phagemid and the like.
  • amplification can be performed directly by the RT-PCR method using an mRNA fraction prepared from the cells or tissues described above.
  • DNA capable of hybridizing a base sequence include, for example, a base sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, which is about 80% or more, preferably about 90% or more, Preferably, DNA containing a nucleotide sequence having about 95% or more homology is used.
  • the homology of the nucleotide sequences can be calculated under the same conditions using the homology calculation algorithm NCB I BLAST described above.
  • the DNA base sequence can be converted by ODA-LA using PCR or a known kit, for example, Mu tan TM -suer Exress Km (Takara Shuzo), Mu tan TM -K (Takara Shuzo) or the like. It can be performed according to a known method such as the PCR method, the Gappedduplex method, the Kunke 1 method, or a method analogous thereto.
  • the cloned DNA encoding HI7T213 can be used as it is or as desired, after digestion with a restriction enzyme, or with the addition of a linker.
  • the DNA may have ATG as a translation initiation codon at its 5, terminal side, and may have TAA, TGA or TAG as a translation termination codon at its 3, terminal side. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter.
  • the HI7T213 expression vector of the present invention can be prepared by, for example, (a) cutting out a DNA fragment of interest from the DNA encoding ⁇ I7 ⁇ 213 of the present invention; It can be produced by ligating downstream of a promoter in an appropriate expression vector.
  • Escherichia coli-derived plasmids eg, pBR322, pBR325, pUC12, pUC13
  • Bacillus subtilis-derived plasmids eg, pUB110, pTP5, pC194
  • yeast-derived plasmids eg, pSH19, pSH15
  • pacteriophages such as ⁇ phage
  • animal viruses such as retrovirus, vaccinia virus, and baculovirus.
  • Other examples include pA1-11-1, ⁇ 1, RcZCMV, pRc / RSV, pcDNAI / Neo, and the like.
  • the promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression.
  • SRa promoter when animal cells are used as hosts, SRa promoter, SV40 promoter, LTR open motor, CMV promoter, HSV-TK promoter, etc. may be used.
  • the CMV promoter SR ⁇ promoter and the like.
  • the host is Eshierihia genus bacterium, trp promoter, lac flop port motor, r ec A promoter, LP L promoter, lpp promoter, etc.
  • the host is Bacillus, S PO l promoter, S P02 flop
  • yeast such as an oral motor and a pen P promoter, a PH05 oral motor, a pGK promoter, a GAP promoter, an ADH promoter and the like are preferred.
  • a polyhedrin promoter, a P10 promoter and the like are preferable.
  • the expression vector may contain, in addition to the above, an enhancer, a splicing signal, a poly-A addition signal, a selection marker, and an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), if desired. Anything can be used.
  • the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin Li down resistance gene (hereinafter sometimes abbreviated as Amp r), neomycin Resistant Gene (hereinafter sometimes abbreviated as Neor, G4 18 resistance).
  • the target gene can be selected even on a thymidine-free medium.
  • a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. If the host is a genus Escherichia, the Pho A • signal sequence, Omp A ⁇ signal sequence, etc., if the host is a Bacillus genus, the amylase 'signal sequence, subtilisin ⁇ signal sequence, etc. If the host is yeast, MF ⁇ signal sequence, SUC 2 signal sequence, etc.
  • Escherichia bacteria for example, Escherichia bacteria, Bacillus bacteria, yeast, insect cells, insects, animal cells, and the like are used.
  • Escherichia examples include Escherichia coli K12 ⁇ DH1 [Proc. Natl. Acad. Sci. USA, 60th volume, 160 (1968)], JM1. 0 3 [Nucleic Acids Research, 9 volumes, 309 (1 1981)], JA2 21 [Journal of Molecular Biology, 120 volumes, 5 17 (1 977)], HB 10 1 [Journal of Molecular Biology, Vol. 41, 459 (1969)], C600 [Genetics, Vol. 39, 440 (1954)] and the like are used.
  • Bacillus spp. include, for example, Bacillus subtilis MI114 (Gene, 24, 255 (1983)), 207—21 [Journal of Biochemistry, 95 , 8 7 (1994)].
  • yeast examples include, for example, Saccharomyces cerevisiae AH22, AH22R—, NA87-11A, DKD—5D, 20B—12, and Schizosaccharomyces bomb ( Schizosaccharomyces pombe) NCYC 1913, NCYC203, Pichia pastoris and the like are used.
  • insect cells for example, if the virus is AcNPV, Derived cell lines (Spodoptera frugiperda cell; Sf cells), MG1 cells from Trichoplusia ni midgut, High Five TM cells from Trichoplusia ni eggs, cells from Mamestra brassicae or cells from Estigmena acrea Used.
  • Sf cells silkworm-derived cell line (Bombyx mori N; BmN cell) is used.
  • Sf cell include Sf9 cell (ATCC CRL1711), Sf21 cell (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like. Is used.
  • insects for example, silkworm larvae and the like are used [Maeda et al., Nature, 315, 592 (1989)].
  • animal cells examples include monkey cells COS-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr-) cells).
  • CHO cells Chinese hamster cells CHO (hereinafter abbreviated as CHO cells)
  • dhfr- dhfr gene-deficient Chinese hamster cells CHO
  • Mouse L cells mouse AtT-20, mouse myeloma cells, rat GH3, and human FL cells.
  • Transformation of insect cells or insects can be performed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988).
  • a liquid medium is suitable as a medium for culturing, and a carbon source necessary for growth of the transformant is contained therein.
  • the carbon source include glucose, dextrin, soluble starch, and bran.
  • the nitrogen source include ammonium salts, nitrates, corn chip liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like.
  • the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride.
  • yeast extract, vitamins, growth promoting factors and the like may be added.
  • the pH of the medium is preferably about 5-8.
  • an M9 medium containing glucose and casamino acid As a medium for cultivating a bacterium belonging to the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in
  • the cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours.
  • the medium is, for example, about 5 to 20. /. MEM medium containing fetal bovine serum [Science, 122, 501 (1952)], DMEM medium [Virology, 8 volumes, 396 (1959)], RPMI 1640 [The Journal of the American Medical Association, 19 9 3 ⁇ 4 :, 5 19 (1 9 6 7)], 1 9 9 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1 9 5 0)].
  • the pH is about 6-8. Culture is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours, and aeration and stirring are added as necessary.
  • the HI7T213 of the present invention can be produced in the transformant, in the cell membrane, or outside the cell.
  • the HI7T213 of the present invention can be separated and purified from the culture by, for example, the following method.
  • the cells or cells are collected by a known method, suspended in an appropriate buffer, sonicated, lysozyme After rupture of the cells or cells by freeze-thawing or the like, a method of obtaining a crude extract of HI7T213 by centrifugation or filtration is suitably used.
  • the buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 TM. If HI7T2 13 is secreted into the culture, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected.
  • the HI7T213 thus obtained When the HI7T213 thus obtained is obtained as a free form, it can be converted to a salt by a known method or a method analogous thereto, and conversely, when it is obtained as a salt, it is known. Can be converted to a free form or another salt by the method of or a method analogous thereto.
  • HI7T213 produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed before or after purification by the action of an appropriate protein-modifying enzyme. You can also.
  • the protein modifying enzyme for example, trypsin, chymotrypsin, anoreginyl endopeptidase, proteinase, glycosidase and the like are used.
  • the activity of the thus produced HI7T213 of the present invention can be measured by a binding experiment with a labeled ligand, an enzymimnoassay using a specific antibody, or the like.
  • the antibody against HI7T213 of the present invention may be any of a polyclonal antibody and a monoclonal antibody as long as it can recognize HI7T213 of the present invention.
  • the antibody against HI7T213 of the present invention can be produced according to a known antibody or antiserum production method using HI7T213 of the present invention as an antigen.
  • the HI7T213 of the present invention is administered to a mammal at a site capable of producing an antibody by administration, itself or together with a carrier and a diluent.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance antibody production upon administration.
  • the administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. Examples of mammals to be used include monkeys, puppies, dogs, guinea pigs, mice, rats, sheep, and goats, and mice and rats are preferably used.
  • a warm-blooded animal immunized with the antigen for example, a mouse with an antibody titer is selected from the mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization.
  • the monoclonal antibody-producing hybridoma can be prepared by fusing the antibody-producing cells contained in the above with myeloma cells.
  • the antibody titer in the antiserum can be measured, for example, by reacting a labeled receptor protein described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody.
  • the fusion operation can be carried out according to a known method, for example, the method of Koehler and Millstein (Nature, 256, 495 (1975)).
  • the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used.
  • myeloma cells examples include NS_1, P3U1, SP2 / 0 and the like, and P3U1 is preferably used.
  • the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably, PEG 1000 to PEG6000) is about 10 to 80%.
  • Cell fusion can be carried out efficiently by adding at a concentration of about 20 to 40 ° C, preferably at about 30 to 37 ° C, for about 1 to 10 minutes.
  • the hybridoma culture supernatant is added to a solid phase (eg, microplate) on which the antigen of the receptor protein is directly or adsorbed together with a carrier. Then, add an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cells used for cell fusion are mice) or tin A, which is labeled with a radioactive substance or enzyme, and bind to the solid phase.
  • a solid phase eg, microplate
  • an anti-immunoglobulin antibody anti-mouse immunoglobulin antibody is used if the cells used for cell fusion are mice
  • tin A which is labeled with a radioactive substance or enzyme
  • RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal bovine serum, GIT medium containing 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.)
  • serum-free medium for hybridoma culture SFM-101, Nissui Pharmaceutical Co., Ltd.
  • the culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C.
  • the culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks.
  • the culture can be usually performed under 5% carbon dioxide.
  • the antibody titer of the culture supernatant of the hybridoma can be measured in the same manner as the measurement of the antibody titer in anti-blood cells described above.
  • Monoclonal antibodies can be separated and purified in the same manner as normal polyclonal antibodies. [Examples: salting out, alcohol precipitation, isoelectric focusing, electrophoresis, ion exchangers (ex. , DEAE), ultracentrifugation, gel filtration, antigen-binding solid phase or specific antibody obtained by collecting only the antibody with an active adsorbent such as protein A or protein G and dissociating the bond to obtain the antibody. Purification method].
  • the polyclonal antibody of the present invention can be produced according to a known method or a method analogous thereto. For example, a complex of an immunizing antigen (HI7T213 antigen) and a carrier protein is formed, and a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody.
  • the antibody can be produced by collecting an antibody containing 7T213 and separating and purifying the antibody.
  • the type of the carrier protein and the mixing ratio of the carrier and the hapten are different from those of the hapten immunized by cross-linking the carrier.
  • Any antibody may be cross-linked at any ratio as long as the antibody can be efficiently produced.
  • serum albumin, ossein globulin, keyhorn, lindet, hemocyanin, etc. A method of coupling the hapten at a ratio of about 0.1 to 20 and preferably about 1 to 5 with respect to 1 of the hapten is used.
  • various condensing agents may be used for force coupling between the hapten and the carrier.
  • an active ester reagent containing a daltaraldehyde-carboimide, a maleimide active ester, a thiol group, or a dithioviridyl group is used.
  • the condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible.
  • Complete Freund's adjuvant / incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration.
  • the administration can usually be performed once every about 2 to 6 weeks, for a total of about 3 to 10 times.
  • the polyclonal antibody can be collected from blood, ascites, etc., preferably from blood, of the mammal immunized by the above method.
  • the measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the serum described above.
  • the polyclonal antibody can be separated and purified according to the same method for separating and purifying immunoglobulins as in the above-described method for separating and purifying a monoclonal antibody.
  • HI 7 T 2 13 of the present invention DNA encoding HI 7 T 2 13 (hereinafter sometimes abbreviated as DNA of the present invention), an antibody against HI 7 T 2 13 (hereinafter, the present invention)
  • Antisense DNA against the DNA of the present invention has the following uses.
  • a drug containing a DNA encoding HI7T2113 or HI7T2113, a DNA encoding HI7T213 or HI7T213 is, for example, a wound, a spinal cord injury, It can be used as a prophylactic and / or therapeutic agent for analgesia and the like, or a medicament such as a renal regenerating agent.
  • DNA encoding HI7T213 or HI7T213 is used as a medicament as described above, it can be carried out in a conventional manner.
  • a sterile solution orally as a tablet, a capsule, an elixir, a microcapsule, or the like, coated with a sugar coating or an enteric coating as necessary, or with water or another pharmaceutically acceptable liquid Alternatively, they can be used parenterally in the form of injections such as suspensions.
  • the compound or a salt thereof may be combined with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc., in a unit dosage form required for generally accepted pharmaceutical practice. And can be produced by mixing.
  • the amount of the active ingredient is such that an appropriate dose in the specified range can be obtained.
  • the DNA encoding HI7T213 can be obtained by (i) administering DNA encoding HI7T213 to the patient and expressing it, or (DNA) introducing DNA encoding HI7T213 into cells or the like. After the expression, the amount of HI7T213 in the cells of the patient can be increased by transplanting the cells into the patient, and the effect of the ligand can be sufficiently exerted.
  • DNA encoding HI 7T213 the DNA should be used alone or after having been inserted into an appropriate vector such as a retrovirus vector, adenowinoresetter, or adenovirus associated vector, and then carried out in a conventional manner. Can be.
  • Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc.
  • binders such as gelatin, corn starch, tragacanth gum, gum arabic
  • excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc.
  • a swelling agent such as magnesium stearate
  • a sweetening agent such as sucrose, lactose or saccharin
  • a flavoring agent such as peppermint, cocoa oil or cherry
  • a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material.
  • Sterile compositions for injection should be formulated according to standard pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil.
  • aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mantol, sodium chloride, etc.).
  • solubilizers such as alcohols (eg, ethanol), polyanolecol (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80 ( ⁇ ), HCO-150) Is also good.
  • Oily liquids include sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.
  • buffers eg, phosphate buffer, sodium acetate buffer
  • soothing agents E.g., benzalco-chloride, proforce hydrochloride, etc.
  • stabilizers e.g., human blood albumin, polyethylene glycol, etc.
  • preservatives e.g., benzyl alcohol, phenol, etc.
  • antioxidants etc. May be.
  • the prepared injection solution is usually filled in an appropriate ampoule.
  • the preparations obtained in this way are safe and have low toxicity, for example, in humans and non-human warm-blooded animals (eg mice, rats, monoremots, egrets, birds, higgies, pigs, pigs, cats). , Dogs, sanoles, baboons, chimpanzees, etc.).
  • the dosage of HI7T213 or the DNA encoding HI7T213 varies depending on the symptoms and the like.
  • oral administration in general, in an adult wound patient (assuming a body weight of 60 kg), About 0.1 to 10 Omg per day, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg.
  • the single dose varies depending on the target, target organ, symptoms, and administration method.
  • an adult wound patient with a body weight of 60 kg
  • the dose can be administered in terms of weight per 60 kg.
  • animals expressing high HI 7 T 213 may develop cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, etc.
  • An antibody having an activity to neutralize the activity can be used as a prophylactic and / or therapeutic agent for cancer, kidney damage, cataract, dermatitis, chronic pain, hyperalgesia and the like.
  • the prophylactic and / or therapeutic agent for the above-mentioned diseases containing the antibody (eg, neutralizing antibody) of the present invention can be used as it is as a liquid or as a pharmaceutical composition in an appropriate dosage form, in a human or non-human mammal (eg, , Rats, puppies, sheep, pigs, cats, cats, dogs, monkeys, etc.).
  • a human or non-human mammal eg, Rats, puppies, sheep, pigs, cats, cats, dogs, monkeys, etc.
  • the dose varies depending on the administration subject, target disease, symptoms, administration route, and the like.
  • the antibody of the present invention when used in adults for the treatment of cataract, is usually used in a dose of 0.0 l to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably Is conveniently administered by intravenous injection about 1 to 3 times a day.
  • an equivalent dose can be administered. If the symptoms are particularly severe, the dose may be increased accordingly.
  • the antibody of the present invention can be administered by itself or as a suitable pharmaceutical composition.
  • the pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient.
  • Such compositions are provided in dosage forms suitable for oral or parenteral administration.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). ), Syrups, emulsions, suspensions and the like.
  • Such a composition is produced by a known method, and contains a carrier, diluent or excipient commonly used in the field of pharmaceuticals.
  • a carrier or excipient for tablets lactose, starch, sucrose, magnesium stearate and the like are used.
  • compositions for parenteral administration for example, injections, suppositories, etc. are used.
  • Injections are in the form of intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. Is included.
  • Such injections are prepared according to known methods, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections.
  • aqueous liquid for injection for example, physiological saline, isotonic solution containing glucose and other adjuvants, and the like, suitable solubilizing agents, for example, alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (o Omo ⁇ adduct of hydrogenated castor oil)), etc.).
  • suitable solubilizing agents for example, alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (o Omo ⁇ adduct of hydrogenated castor oil)), etc.).
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (o
  • compositions are conveniently prepared in dosage unit forms to be compatible with the dosage of the active ingredient.
  • dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories, etc., and usually 5 to 500 mg, especially injection, for each dosage unit dosage form.
  • the drug preferably contains 5 to 10 Omg of the above antibody, and other dosage forms contain 10 to 25 Omg of the above antibody.
  • compositions may contain other active ingredients as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.
  • the antibody of the present invention is competitively reacted with a test solution and labeled HI7T213, and the ratio of labeled HI7T213 bound to the antibody is measured.
  • the present invention provides a method for quantifying HI 7 T 2 13 in a test solution, which comprises:
  • one antibody is an antibody that recognizes the N-terminus of HI7T2113, and the other antibody is an antibody that reacts with the C-terminus of HI7T213. Desirably.
  • HI7T213 can be quantified using a monoclonal antibody against HI7T213, and detection by tissue staining or the like can also be performed.
  • the antibody molecule itself may be used, or F (ab,) 2 , Fab, or Fab fraction of the antibody molecule may be used.
  • the method for quantifying HI 7 T 2 13 using the antibody of the present invention is not particularly limited, and an antibody corresponding to the amount of antigen in the test solution (for example, HI 7 T 2 13), Anti Any method that detects the amount of the original or antibody-antigen complex by chemical or physical means, and calculates this from a standard curve prepared using a standard solution containing a known amount of antigen Method may be used.
  • nephrometry, a competitive method, an immunometric method, and a sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later.
  • the antibody used for the solid phase antibody or the labeling antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity and the like. May be used.
  • the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is an antibody in which the binding site of ⁇ I7 ⁇ 213 is different. Is preferably used.
  • the antibody used in the primary reaction and the secondary reaction is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of HI7T213, the antibody used in the primary reaction is Preferably, an antibody that recognizes other than the C-terminal, for example, the ⁇ -terminal is used.
  • the monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method or a nephelometry.
  • a competition method the antigen in the test solution and the labeled antigen compete with the antibody.
  • the unreacted labeled antigen (F) and the labeled antigen bound to the antibody ( ⁇ ) are separated (BZF separation), and the amount of B or F label is measured. Quantify the amount of antigen in.
  • a soluble antibody is used as an antibody
  • B / F separation is performed using polyethylene glycol
  • a liquid phase method using a second antibody against the antibody and a solid phase antibody is used as the first antibody.
  • an immobilization method using a soluble first antibody and an immobilized antibody as the second antibody is used.
  • the antigen in the test solution and the immobilized antigen are subjected to a competitive reaction with a fixed amount of the labeled antibody, and then the solid phase and the liquid phase are separated.
  • the antigen is allowed to react with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated.
  • the amount of the label in either phase is measured to determine the amount of the antigen in the test solution.
  • the amount of insoluble sediment resulting from an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry using laser scattering is preferably used.
  • HI7T213 of the present invention can be quantified with high sensitivity by using the antibody of the present invention.
  • a disease caused by overexpression of HI7T213, such as cancer, renal disorder, cataract, dermatitis, It can be diagnosed as having sexual pain, hyperalgesia, or a high likelihood of future illness.
  • DNA encoding HI7T213 can be used, for example, in a human or non-human mammal (eg, rat, mouse, guinea pig, egret, sheep, sheep, puta, pig, pig) by using it as a probe.
  • HI 7 T 2 Abnormality (genetic abnormality) of DNA or mRNA encoding 13 can be detected, for example, damage, mutation or decreased expression of the DNA or mRNA, increase or excessive expression of the DNA or mRNA, etc. It is useful as a genetic diagnostic agent.
  • the above-described genetic diagnosis using DNA encoding HI7T213 or an antisense 'polynucleotide thereto can be performed, for example, by a known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, 874). ⁇ 879 (1989), Proceedings oi the National Academy of Sciences of the United States of America, Vol. 86, 276-6-277 (pp. 1989)) It can be implemented by such as.
  • HI7T213 if overexpression of HI7T213 is detected by Northern hybridization, it is likely that the disease is a disease such as cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, or It can be diagnosed as having a high possibility of contracting in the future.
  • Antisense to DNA encoding HI 7 T 2 13 DN A can suppress the expression of HI 7 T 2 13 so that cancer, renal disorder, cataract, dermatitis, chronic pain, pain
  • the antisense DNA when used as a preventive and / or therapeutic agent for hypersensitivity or the like, when the above antisense DNA is used as the above preventive and / or therapeutic agent, the antisense DNA is coded as HI7T213. It can be formulated in the same manner as DNA.
  • the preparations obtained in this way are of low toxicity and are intended for oral or non-human mammals (eg, rats, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.). It can be administered parenterally.
  • oral or non-human mammals eg, rats, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.
  • the antisense DNA may be used as it is or as an auxiliary agent for promoting uptake. It can be administered via a catheter, such as a gene gun or hydrogel catheter, together with any physiologically acceptable carrier.
  • the dosage of the antisense DNA varies depending on the target disease, the administration subject, the administration route, and the like.
  • antisense DNA may be used in organs (eg, liver, lung, heart, kidney, etc.).
  • organs eg, liver, lung, heart, kidney, etc.
  • When topically administered to an adult (body weight 6 O kg) per day is about 0.1 to 100 mg.
  • RNAi double-stranded RNA
  • RNAi RNA interference method
  • a lipozyme or the like containing a part of the same can suppress the expression of DNA encoding HI7T213 as in the case of the above-mentioned antisense DNA, and can inhibit ligand or HI7T213 in vivo.
  • the function of the encoding DNA can be suppressed.
  • Double-stranded RNA can be designed and manufactured based on the sequence of the DNA of the present invention according to a known method (eg, Nature, vol. 411, p. 494, 2001).
  • the lipozyme can be produced by designing based on the DNA sequence of HI7T213 according to a known method (eg, TRENDS in Molecular Medicine, Vol. 7, pp. 221, 2001). For example, it can be produced by ligating a known lipozyme to a part of RNA encoding HI7T213.
  • a part of the RNA encoding HI7T213 includes a portion (RNA fragment) adjacent to the cleavage site on HI7T213 RNA which can be cleaved by a known lipozyme.
  • RNA or lipozyme When the above double-stranded RNA or lipozyme is used as the above prophylactic and / or therapeutic agent, it can be formulated and administered in the same manner as antisense DNA.
  • the screening method of the present invention comprises:
  • (6A-2) A method for screening a substance that regulates the expression level of HI 7T 213, which comprises using 08 encoding 111 7 213.
  • the binding between the ligand and HI7T213 is changed.
  • the substance to be screened can be screened.
  • Such substances include cell stimulatory activity via HI7T213 (eg, arachidonic acid release, acetylcholine release, cytosolic Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate
  • HI7T213 eg, arachidonic acid release, acetylcholine release, cytosolic Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate
  • a substance having an activity of promoting or inhibiting production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, reduction of pH, etc. ie, HI 7T 213 agonist
  • the cell Substances having no stimulatory activity ie, HI 7T 213 antagonist
  • “Altering the binding between ligand and HI 7T213” includes both cases where the binding between ligand and HI 7T213 is inhibited and cases where the
  • the present invention relates to a ligand characterized by comparing (i) a case in which a ligand is brought into contact with HI7T213 and (ii) a case in which a ligand and a test compound are brought into contact with HI7T213. ⁇ Provide a method of screening for a substance that alters the binding to 7T213.
  • binding of a ligand to HI7T213 and (ii) binding of a ligand and a test compound to HI7T213, for example, binding of a ligand to HI7 ⁇ 213 Measure the amount, cell stimulating activity, etc. and compare.
  • the screening method of the present invention comprises:
  • a screening method for a substance that alters the binding property (iii) applying a labeled ligand to HI7T213 expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213. The place where they touched And contacting the labeled ligand and a test compound with HI7T213 expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213.
  • HI 7 T 213 activating compounds eg, ligands, agonists
  • ⁇ I 7 ⁇ 213 activating compounds are exposed to cells containing ⁇ I 7 ⁇ 213, and ⁇ I 7 ⁇ 213 activating compounds are tested.
  • HI 7 T213-mediated cell stimulating activity eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular c
  • (V) HI7T expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213 with a compound (eg, ligand, agonist) that activates HI7T213.
  • a compound eg, ligand, agonist
  • HI 7T 213-activating compound and a test compound were cultured on a transformant containing DNA encoding HI 7T 213, and HI 7T 213 expressed on the cell membrane was cultured.
  • HI7T213 eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane Potential fluctuation, phosphorylation of intracellular protein, activation of c_fos, activity to suppress or decrease pH, etc.
  • HI7T2113 eg, arachidonic acid release, acetylcholine release, intracellular Ca 2+ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane Potential fluctuation, phosphorylation of intracellular protein, activation of c_fos, activity to suppress or decrease pH, etc.
  • HI7T213 used in the screening method of the present invention may be any one containing HI7T213 described above.
  • a membrane fraction of an organ is suitable.
  • HI7T213 which is expressed in large amounts using recombinants, is suitable for screening.
  • the preparation method described later when a cell containing HI7T213 or a cell membrane fraction thereof is used, the preparation method described later may be followed.
  • the cells When cells containing HI7T213 are used, the cells may be immobilized with daltaraldehyde, formalin, or the like.
  • the immobilization method can be performed according to a known method.
  • the cell containing HI7T213 refers to a host cell expressing HI7T213.
  • Examples of the host cell include the aforementioned Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like.
  • the membrane fraction refers to a fraction containing a large amount of cell membrane obtained by a known method after crushing cells.
  • Cell crushing methods include a method in which cells are crushed with a Potter-Elvehjem homogenizer, a Warlinda blender ⁇ polytron (
  • centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used.
  • the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically about 1 to 10 minutes), and the supernatant is further centrifuged at a higher speed (150 000 rpm to 30000 rpm). Centrifuge for 30 minutes to 2 hours. This is the membrane fraction.
  • the membrane fraction is rich in expressed HI7T213 and membrane components such as cell-derived phospholipids and membrane proteins.
  • the amount of HI7T213 in the cells or membrane fraction containing HI7T213 is preferably 10 3 to 10 8 molecules per cell, more preferably 10 5 to 10 7 molecules per cell. is there.
  • an appropriate HI7T213 fraction and a labeled ligand are used.
  • the HI7T213 fraction is preferably a natural HI7T213 fraction or a recombinant HI7T213 fraction having an activity equivalent to that of the natural HI7T213 fraction.
  • “equivalent activity” means equivalent ligand binding activity.
  • a labeled ligand, a labeled ligand analog compound, or the like is used as the labeled ligand. For example [3 H], [125 I], [14 C], can be utilized like-labeled ligand, etc. [35 S].
  • cells containing HI7T213 or a membrane fraction of the cells are suitable for screening.
  • the buffer may be any buffer that does not inhibit the binding of the ligand to HI7T213, such as a phosphate buffer of pH 4 to 10 (preferably pH 6 to 8) or a buffer of Tris-monohydrochloride.
  • surfactants such as CHAPS, Tween-80 TM (Kao Ichi Atlas), digitonin, and dexcholate can be added to the buffer to reduce non-specific binding.
  • a protease inhibitor such as PMSF, leptin, E-64 (manufactured by Peptide Research Institute), and pepstatin can be added for the purpose of suppressing the degradation of HI7T213 and ligand by the protease.
  • 0.0 to the HI 7 T 21 3 solution lml ⁇ l Om 1 were added labeled ligand a certain amount (5000 c pm ⁇ 5 OOOOO cm), coexist simultaneously 10-4 to 10-the test compound.
  • Non-specific binding Prepare a reaction tube containing a large excess of unlabeled ligand to determine (NSB). The reaction is carried out at about 0 ° C. to about 50 ° C., preferably at about 4 ° C.
  • cells that have expressed the appropriate HI7T213 are required.
  • the cells expressing the HI7T213 of the present invention the above-mentioned recombinant HI7T213-expressing cell line and the like are desirable.
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, Examples include a synthetic compound, a fermentation product, a cell extract, a plant extract, an animal tissue extract, and plasma. These compounds may be novel compounds or known compounds.
  • the test compound may form a salt.
  • a salt with a physiologically acceptable acid eg, an inorganic acid, etc.
  • a base eg, an organic acid, etc.
  • physiologically acceptable acid addition salts are particularly preferred.
  • salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.), and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, maleic acid) Acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.
  • organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, maleic acid
  • Acid succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.
  • a screening kit for a substance that changes the binding property between a ligand and HI7T213 includes HI7T213, a cell containing HI7T213 or a membrane fraction of the cell, and / or a ligand containing the ligand. It is.
  • CHO cells expressing HI 7 T 213 were subcultured into 12-well plates in 5 ⁇ 10 5 wells. C, 5% C0 2, followed by culturing for 2 days at 95% air.
  • the substance obtained by using the screening method or the screening kit of the present invention is a substance that changes the binding between a ligand and HI7T213 (inhibits or promotes the binding), Specifically, a substance having a cell stimulating activity via HI 7 T 2 13 (so-called ⁇ I 7 ⁇ 13 agonist) or a substance not having the stimulating activity (so-called HI 7 T 2 13 antagonist) is there.
  • Examples of the substance include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product selected from the test compounds described above. These compounds may be a novel compound or a known compound. You may.
  • the specific method of evaluating whether the subject is an HI 7 T 2 13 agonist or an antagonist may be in accordance with the following (i) to (iv).
  • the binding method shown in the screening methods (i) to (iii) above After performing an ingestion to obtain a substance that changes the binding property of the ligand to HI7T213 (particularly, inhibits the binding), the substance is mediated by HI7T213 as described above. It is determined whether or not it has cell stimulating activity.
  • the substance having the cell stimulating activity is HI7T2 13 agonist, and the substance having no such activity is HI7T2 13 antagonist.
  • test compound is brought into contact with cells containing HI7T213, and the cell stimulating activity via HI7T213 is measured.
  • the substance having cell stimulating activity is HI7T213agonist.
  • test compound is applied to the non-human mammal of the present invention or a part thereof, and the HI7T2133 agonist activity is assayed.
  • the substance having agonist activity is HI 7 T 2 13 agonist.
  • test compound is applied to the non-human mammal of the present invention or a part thereof, and the ameliorating effect of a disease such as wound, spinal cord injury or analgesia or the renal regeneration effect is assayed.
  • a disease such as wound, spinal cord injury or analgesia or the renal regeneration effect.
  • the substance which has been shown to have the effect of improving the disease or the effect of regenerating the kidney is HI7T213 agonist.
  • test compound is administered to a non-human mammal of the present invention or a part thereof which has the above-mentioned phenotype or diseases such as cancer, renal disorder, cataract, dermatitis, chronic pain, and hyperalgesia. Apply and test the phenotypic or disease ameliorating effect.
  • the substance that has been shown to have the above phenotypic or disease ameliorating effect is HI7T213 antagonist.
  • the substance (eg, agonist, antagonist) obtained using the above-described screening method or screening kit may form a salt, such as a pharmaceutically acceptable salt.
  • a salt such as a pharmaceutically acceptable salt.
  • Specific examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids.
  • the salt with an inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, as well as aluminum salt and ammonium salt. .
  • the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-alutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, ⁇ , ⁇ , and salts with dibenzylethylenediamine.
  • salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like.
  • salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid And the like.
  • Preferable examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, and olginine
  • preferable examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. can give.
  • the dosage of HI 7 T 2 13 agonist varies depending on the symptoms and the like.
  • the single dose varies depending on the subject, target organ, symptoms, administration method, etc. In this case, it is convenient to administer about 0.01 to 3 Omg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 1 Omg by intravenous injection. .
  • the dose can be administered in terms of weight per 6 O kg.
  • the dose of HI7T213 antagosto varies depending on the symptoms and the like.
  • the dosage administered When administered parenterally, the dosage administered once varies depending on the subject of administration, target organ, symptoms, administration method, and the like. It is convenient to administer about 0.01 to 3 Omg / day, preferably about 0.1 to 20 mg / day, more preferably about 0.1 to 1 Omg / day by intravenous injection. You. In the case of other animals, the dose can be administered in terms of 60 kg of body weight.
  • the starling method of the present invention comprises the steps of: (i) culturing cells capable of expressing HI7T213 in the presence and absence of a test compound in the presence of each HI7
  • Cells or tissues that can express HI7T213 include human non-human warm-blooded animals (eg, guinea pigs, rats, mice, -birds, rabbits, swine, pigs, hidges, chickens, monkeys, etc.).
  • human non-human warm-blooded animals eg, guinea pigs, rats, mice, -birds, rabbits, swine, pigs, hidges, chickens, monkeys, etc.
  • the method for culturing cells capable of expressing HI7T213 is the same as the above-described method for culturing a transformant.
  • the expression level of HI7T213 can be measured by a known method such as an immunochemical method using an antibody or the like, or a ligand can be encoded! nRNA can also be measured by a known method using the Northern hybridization method, RT-PCR or TaqMan PCR.
  • DNA encoding HI 7 T 213 or a part thereof, or antisense of the present invention •
  • the amount of mRNA bound to the DNA encoding HI7T213 or a part thereof or the antisense polynucleotide of the present invention can be reduced. Can be easily measured.
  • the radioactive isotope for example, 32 P, 3 H, or the like is used. Fluorescent dyes such as ROX (manufactured by PE Biosystems), Cy5 (manufactured by Amersham), and Cy3 (manufactured by Amersham) are used.
  • the amount of mRNA is determined by converting RNA extracted from cells into cDNA using reverse transcriptase, and then using DNA encoding HI7T213 or a part thereof or the antisense polynucleotide of the present invention as a primer.
  • the PCR can be performed by measuring the amount of cDNA to be amplified.
  • a test compound that increases the amount of mRNA encoding HI7T213 can be selected as a substance having an activity of promoting the expression of HI7T213, and A test compound that reduces the amount of encoded mRNA can be selected as a substance having an activity of inhibiting HI 7T213 expression.
  • Reporter genes include, for example, 1 ac Z (J3-galactosidase gene), chloramphenicol acetyltransferase (CAT), luciferase, growth factor, ⁇ -glucuronidase, anorecali phosphatase, Green fluorescent protein (GFP) , J3-lactamase and the like are used.
  • a test compound that increases the amount of the reporter gene product can be assayed for the activity of the HI7T213 promoter or enhancer of the present invention.
  • Control Specific HI 7 T 2 13, ie, a substance having an activity of promoting the expression of HI7T213.
  • a test compound that reduces the amount of the reporter gene product is used to control (particularly inhibits) the activity of the HI7T213 promoter or enhancer, ie, the expression of HI7T213 is inhibited.
  • the culturing of the transformant can be performed in the same manner as the above-mentioned transformant.
  • the vector construction of the reporter gene and the Atsey method can be performed according to a known technique (for example, Molecular Biotechnology 13, 29-43, 1999).
  • Substances having the activity of promoting the expression of HI7T213 are used as preventive and / or therapeutic agents for wounds, spinal cord injury, analgesia, etc. Can be used as
  • Substances that have the activity of inhibiting the expression of HI7T213 include the prophylactic and / or therapeutic agents for cancer, kidney damage, cataract, dermatitis, chronic pain, hyperalgesia, etc. It can be used as a medicine.
  • the substance obtained by using the screening method of the present invention is a substance selected from the test compounds described above.
  • the salt of the substance obtained by using the screening method of the present invention the same salt as the salt of the substance obtained by using the agonist or antagonist screening method described above is used.
  • the substance obtained by using the screening method of the present invention is used as the above-mentioned prophylactic and / or therapeutic agent, it can be carried out according to a conventional means.
  • tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be prepared in the same manner as in the above-mentioned pharmaceutical composition containing the ligand.
  • the preparations obtained in this way are safe and have low toxicity, for example, in humans or non-human warm-blooded animals (eg, mice, rats, rabbits, rabbits, sheep, pigs, horses, birds, birds, cats). , Dogs, monkeys, chimpanzees, etc.) may vary depending on the action, target disease, administration target, administration route, etc. Although there are differences, for example, when a substance that promotes the expression of HI7T213 is orally administered for the purpose of treating a wound, generally the adult (per 60 kg of body weight) The substance is administered from about 0.1 to: L 0 mg, preferably about 1.0 to 5 Omg, more preferably about 1.0 to 20 mg.
  • L 0 mg preferably about 1.0 to 5 Omg, more preferably about 1.0 to 20 mg.
  • the single dose of the substance may vary depending on the subject of administration, target disease, etc.
  • injection of a substance that promotes the expression of HI7T213 for the purpose of treating wounds When administered to a normal adult (per 60 kg body weight) in the form of a drug, the substance is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 30 mg per day. It is convenient to administer about 0.1 to about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of the body weight of 6 O kg.
  • a substance that inhibits the expression level of HI7T213 is orally administered for the purpose of treating cataract
  • the substance is used daily.
  • About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg is administered.
  • the dosage of the substance may vary depending on the administration target, the target disease, etc.
  • a substance that inhibits the expression of HI7T213 for the purpose of treating cataracts When usually administered to adults (per 60 kg) in the form of injections, the substance is administered in an amount of about 0.01 to 30 mg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg. It is convenient to administer about 0.1 to about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of the body weight of 60 kg.
  • These drugs can be formulated and used in the same manner as the above-mentioned drugs containing HI7T213.
  • the present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention is inactivated and a non-human mammal deficient in expression of the DNA of the present invention.
  • a non-human mammal deficient in expression of the DNA, wherein the DNA of the present invention is inactivated is inactivated.
  • the DNA is inactivated by introducing a reporter gene (eg, a monogalactosidase gene derived from Escherichia coli).
  • a reporter gene eg, a monogalactosidase gene derived from Escherichia coli.
  • the non-human mammal according to (vi), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention
  • non-human mammal the same one as described above is used.
  • the method of artificially adding a mutation to the DNA of the present invention can be performed, for example, by deleting a part or all of the DNA sequence and inserting or substituting another DNA sequence by a genetic engineering technique.
  • the knockout DNA of the present invention may be prepared by, for example, shifting the codon reading frame or disrupting the function of the promoter or exon by these mutations.
  • a DNA sequence that terminates transcription of the gene for example, a poly-A addition signal
  • a DNA chain having a DNA sequence constructed so as to disrupt DNA is introduced into the chromosome of the animal by, for example, a homologous recombination method.
  • Southern hybridization analysis or targeting vector using the DNA sequence above or near it as a probe The DNA sequence and the targeting vector obtained by analyzing the DNA sequence of the neighboring region other than the DNA of the present invention used in the preparation by the PCR method using primers, and selecting the knockout ES cells of the present invention. be able to.
  • ES cells from which the DNA of the present invention is inactivated by the homologous recombination method or the like for example, those already established as described above may be used, or the known Evans and Kaufman method may be used. It may be newly established according to. For example, in the case of mouse ES cells, the 129-line ES cells are generally used at present. However, since the immunological background is not clear, it is necessary to use a pure line instead of immunologically.
  • BDF mice have the advantage of large number of eggs collected and robust eggs. Since the ES cells obtained using this mouse have a background of 5 7 BL / 6 mice, the genetic background of the ES cells obtained by creating a pathological model mouse by back-crossing with C 57 B LZ6 mice was / 6 mouse can be used advantageously.
  • ES cells when ES cells are established, blastocysts 3.5 days after fertilization are generally used. Many early embryos can be obtained. Although either male or female ES cells may be used, male ES cells are generally more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce the complexity of culturing.
  • a method for determining the sex of ES cells a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by the PCR method can be given as an example.
  • this method conventionally, for example G-banding method, it requires about 1 0 6 cells for karyotype analysis, since suffices ES cell number of about 1 colony (about 5 0)
  • the primary selection of ES cells in the early stage of culture can be performed by gender discrimination, and the early stage of culture can be greatly reduced by enabling the selection of male cells at an early stage.
  • the secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method.
  • ES cells can be cultured in monolayers up to high densities or in suspension cultures to form cell clumps under appropriate conditions to produce various types of cells such as parietal, visceral, and cardiac muscles.
  • MJ Evans and MH Kauf man Nature 292, 154, 1981; GR Martin, Proc. Natl. Acad. Sci. USA, 78, 7634, 1981; TC Doetschman et al., Journal of embryology and experimental morp. 87, 27, 1985
  • DNA-deficient cells of the present invention obtained by differentiating the ES cells of the present invention are useful in the cell biological examination of HI7T213 of the present invention in vitro. is there.
  • the non-human mammal deficient in DNA expression of the present invention can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level.
  • non-human mammal those similar to the above can be used.
  • the non-human mammal deficient in DNA expression of the present invention can be obtained, for example, by introducing the targeting vector prepared as described above into a mouse embryonic stem cell or a mouse egg cell and introducing the targeting vector of the present invention into a non-human mammal.
  • the DNA of the present invention can be knocked out by causing the activated DNA sequence to undergo homologous recombination to replace the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination.
  • the cells in which the DNA of the present invention has been knocked out are the DNA sequence on the southern hybridization analysis or targeting vector using the DNA sequence on or near the DNA of the present invention as a probe, and the mouse used for the targeting vector. It can be determined by analysis by a PCR method using, as a primer, a DNA sequence of a neighboring region other than the DNA of the present invention derived from the DNA.
  • a cell line in which the DNA of the present invention has been inactivated is cloned by homologous recombination, and the cells are cloned at an appropriate time, for example, at the 8-cell stage.
  • the chimeric embryo is injected into a human mammalian embryo or blastocyst, and the resulting chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal.
  • the produced animal is a chimeric animal composed of both cells having the normal DNA locus of the present invention and cells having the artificially altered DNA locus of the present invention.
  • all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual.
  • An individual composed of cells having the added DNA locus of the present invention For example, it can be obtained by sorting based on the judgment of coat color.
  • the individual thus obtained is usually an individual having a heterozygous expression of the peptide of the present invention, which is crossed with an individual having a heterozygous expression of the peptide of the present invention. Can be obtained.
  • a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into the nucleus of an egg cell by a microinjection method. Compared to a human mammal, it can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination of the gene.
  • the individual in which the DNA of the present invention has been knocked out can be bred in an ordinary breeding environment after confirming that the DNA has been knocked out in the animal individual obtained by mating. .
  • germline acquisition and retention may be performed in accordance with a standard method. That is, by crossing male and female animals having the inactivated DNA, a homozygous animal having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animal can be efficiently obtained by rearing the mother animal in a state where one normal individual and plural homozygous animals are obtained. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and subcultured.
  • the non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing the non-human mammal deficient in expressing the DNA of the present invention.
  • the non-human mammal deficient in expression of the DNA of the present invention lacks various biological activities that can be induced by the peptide of the present invention
  • the non-human mammal may be caused by inactivation of the biological activity of the peptide of the present invention. It is useful for investigating the causes of these diseases and examining therapies, because they can serve as models for the diseases that occur.
  • the present invention comprises administering a test compound to a non-human mammal deficient in expression of the DNA of the present invention, and observing and measuring changes in the animal.
  • a method for screening a substance having a prophylactic and / or therapeutic effect or a renal regeneration effect on a disease caused by the disease for example, wound, spinal cord injury, analgesia and the like.
  • Examples of the non-human mammal deficient in DNA expression of the present invention used in the screening method include the same as described above.
  • test compound when administered to a test animal, symptoms such as wound, spinal cord injury, and analgesia of the test animal are about 10% or more, preferably about 30% or more, and more preferably about 30% or more. If the improvement is 50 ° / 0 or more, the test compound can be selected as a substance having a prophylactic and / or Z- or therapeutic effect on the above-mentioned diseases.
  • the test compound can be used as a prophylactic and / or therapeutic agent for wounds, spinal cord injury, analgesia, etc., or as a medicament such as a renal regenerating agent.
  • the substance is a substance selected from the above-mentioned test compounds, and has a preventive and / or therapeutic effect on a disease caused by deficiency or damage of HI7T213, so that it is safe and low toxic to the disease. It can be used as a medicament such as a sexual prophylactic and / or therapeutic agent. Further, a compound derived from the substance obtained by the above screening may be used in the same manner. Can be.
  • the substance obtained by the screening method may form a salt.
  • the salt of the substance include physiologically acceptable acids (eg, inorganic acids, organic acids, etc.) and bases (eg, alkali metal And the like, and especially preferred are physiologically acceptable acid addition salts.
  • physiologically acceptable acids eg, inorganic acids, organic acids, etc.
  • bases eg, alkali metal And the like, and especially preferred are physiologically acceptable acid addition salts.
  • physiologically acceptable acids eg, inorganic acids, organic acids, etc.
  • bases eg, alkali metal And the like, and especially preferred are physiologically acceptable acid addition salts.
  • such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid
  • the preparations obtained in this way are safe and low toxic and can be used, for example, in humans or non-human mammals (for example, rats, mice, guinea pigs, egrets, sheep, butter, pigeons, horses, horses, Cats, dogs, monkeys, etc.).
  • the dose of the substance varies depending on the target disease, the administration target, the administration route, and the like.
  • the substance is orally administered for the purpose of treating a wound, it is generally an adult patient (assuming a body weight of 60 kg).
  • about 0.1 to 10 Omg preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the compound is administered per day.
  • the single dose of the substance may vary depending on the administration subject, target disease, etc.
  • the substance is usually administered in the form of an injection to an adult patient (body weight) for the purpose of treating wounds. (As 6 O kg), about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, and more preferably about 0.1 to 10 mg of the substance It is conveniently administered by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.
  • the present invention provides a test compound administered to a non-human mammal deficient in expression of a DNA of the present invention, and detects the expression of a reporter gene.
  • the non-human mammal deficient in expression of the DNA of the present invention may be a non-human mammal deficient in expression of the DNA of the present invention, wherein the DNA of the present invention introduces a reporter gene.
  • a reporter gene that can be expressed under the control of the promoter for the DNA of the present invention is used.
  • test compound examples include the same compounds as described above.
  • the reporter gene the same one as described above is used, and a 1 ac Z gene, a soluble alkaline phosphatase gene, a luciferase gene, and the like are preferable.
  • the reporter gene is under the control of the promoter for the DNA of the present invention. By tracing the expression, the activity of the promoter can be detected.
  • the tissue that expresses the peptide of the present invention should be used instead of the peptide of the present invention.
  • 3-galactosidase is expressed. Therefore, by staining with a reagent that serves as a substrate for -galactosidase, such as, for example, 5-bromo-1-chloro-3- ⁇ f-ndolyl-1] 3-galactopyranoside (X-ga1), In addition, the expression state of the HI7T213 of the present invention in an animal body can be observed.
  • the substance obtained by using the above-mentioned screening method is a substance selected from the above-described test compounds, and is a substance that promotes or inhibits the promoter activity for the DNA of the present invention.
  • the substance obtained by the screening method may form a salt
  • the salt include salts with physiologically acceptable acids (eg, inorganic acids, etc.) and bases (eg, organic acids, etc.), and particularly preferred are physiologically acceptable acid addition salts.
  • physiologically acceptable acids eg, inorganic acids, etc.
  • bases eg, organic acids, etc.
  • physiologically acceptable acid addition salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).
  • the substance of the present invention that promotes the promoter activity for DNA can promote the expression of HI7T213 and promote the function of HI7T213, for example, wound, spinal cord injury, analgesia It can be used as a medicament such as a preventive and / or remedy for diseases and renal regenerating agents.
  • the substance of the present invention that inhibits the promoter activity on DNA can inhibit the expression of HI7T213 and inhibit the function of HI7T213. It can be used as a medicament such as a preventive and / or therapeutic agent for renal disorder, cataract, dermatitis, chronic pain, hyperalgesia and the like.
  • substances derived from the substances obtained by the above screening can be used in the same manner.
  • a drug containing the substance obtained by the screening method can be produced in the same manner as the above-mentioned drug containing a ligand.
  • the single dose of the substance may vary depending on the administration subject, target disease, and the like.
  • a substance that promotes the promoter activity of the DNA of the present invention for the purpose of treating a wound may be used in an injection.
  • administered to adult patients assuming a body weight of 6 O kg
  • the equivalent dose per 60 kg body weight can be administered.
  • a substance that inhibits the promoter activity of DNA of the present invention when a substance that inhibits the promoter activity of DNA of the present invention is orally administered for the purpose of treating cataract, generally, in an adult patient (assuming a body weight of 60 kg), the substance is used in an amount of about 0.1 to 10 mg / day.
  • the dose is 10 Omg, preferably about 1.0 to 5 Omg, more preferably about 1.0 to 2 Omg.
  • the single dose of the substance varies depending on the administration subject, target disease, etc., for example, a substance that inhibits the promoter activity of the DNA of the present invention for the purpose of treating cataract.
  • the substance When administered to an adult patient (assuming a body weight of 6 O kg) in the form of an injection, the substance is administered in an amount of about 0.01 to 3 Omg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day. It is convenient to administer about 0.1 to 1 Omg by intravenous injection. For other animals, the equivalent dose per 60 kg body weight can be administered.
  • the non-human mammal deficient in expression of the DNA of the present invention is extremely useful for screening a substance that promotes or inhibits the activity of the promoter of the DNA of the present invention. It can greatly contribute to investigating the cause of various diseases caused by the disease or to develop preventive and / or therapeutic drugs.
  • genes encoding various proteins are ligated downstream thereof and injected into egg cells of an animal to produce a so-called transgenic animal (gene). Creating an introduced animal) would allow the specific synthesis of the peptide and study its effects on the organism. Furthermore, by linking an appropriate reporter gene to the above promoter portion and establishing a cell line that expresses the same, a low molecule having an action of specifically promoting or suppressing the production ability of the peptide itself of the present invention in the body. Can be used as a search system for compounds.
  • sequence numbers in the sequence listing of the present invention indicate the following sequences.
  • SEQ ID NO: 3 This shows the amino acid sequence of human HI7T2113, in which the 169th Asp in the amino acid sequence represented by SEQ ID NO: 1 has been changed to Asn. .
  • 1 shows the nucleotide sequence of NA.
  • [SEQ ID NO: 5] This shows the amino acid sequence of mouse H I 7 T 2 13 (# 11).
  • SEQ ID NO: 6 This shows the base sequence of cDNA encoding mouse HI7T213 (# 11).
  • SEQ ID NO: 10 This shows the base sequence of one primer used in the PCR method performed in Example 1 described later.
  • SEQ ID NO: 12 This shows the base sequence of one primer used in the PCR method performed in Example 1 described later.
  • SEQ ID NO: 21 This shows the base sequence of one primer used in the PCR method performed in Example 8 described later.
  • SEQ ID NO: 25 This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.
  • SEQ ID NO: 27 This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.
  • SEQ ID NO: 30 This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.
  • SEQ ID NO: 31 This shows the base sequence of one primer used in the PCR method performed in Example 15 described later.
  • bases and amino acids are indicated by abbreviations, the abbreviations in IUPAC-IUB Commission on Biochemical Nomenclature are based on common abbreviations in the art, and examples thereof are as follows. .
  • a 1 a Aranine
  • HOB t 1—Hydroxybenztriazole
  • Ml 0 9 / p C AG 2 1 3—1 is from 1/02/2005, 1/15, Tsukuba East 1-chome, Ibaraki Pref. 1 1 Central No. 6 (Zip code 3 0 5 _ 8 5 6 6) It has been deposited with the National Institute of Advanced Industrial Science and Technology (AIST) under the deposit number F ERM BP—8207.
  • Plaque hybridization was performed on a mouse genomic library (129 / SvJ, Toyobo) using the hHI7T213 gene as a probe to obtain the mouse-type hHI7T213 gene.
  • the cells were washed at a final salt concentration of 0.5 ⁇ SSC at 65 ° C. to obtain single plaques (# 8 SEQ ID NO: 8, # 11 SEQ ID NO: 6).
  • # 8 gene corresponding to niMrgA6
  • the # 11 gene similar to mMrgA4 were examined for their intrinsic gene expression in each tissue ( Figure 1).
  • a primer set (PIWY primer: TGCCTGTCTGT (C / A) CT (G / C)) based on the amino acid sequence common to # 8 and # 11 (CLSV (M / L) / A) TGCCC (C / T) ATCTGGTAT (SEQ ID NO: 9) and CGLP primer: GGGC
  • AA C / T
  • CC G / A
  • CAGAGGA G / A
  • AAAAACCAAAA SEQ ID NO: 10
  • oligo DNA (# 8 probe: TACCAAATATGAAGATGA CTATGG (SEQ ID NO: 11), # 11 probe) corresponding to the amino acid sequence (# 8: TKYEDDY G, # 11: GPKYVIDS) specific to both factors : GGTCCCAAATATGTAATTGACTCT (SEQ ID NO: 12)) was used as a probe for Southern hybridization to examine tissues expressing both factors.
  • Oligo 'dT tailing kit (Roche) was used for labeling the probe, and washing after hybridization was performed at 42 ° C using 2xSSC solution.
  • the # 8 gene was expressed in the brain from an early age, and was clearly expressed in the mature brain and testis.
  • the # 11 gene was also clearly expressed in the dorsal root ganglia from an early age, and was also expressed in the mature brain, muscle, heart, and testis.
  • An expression vector for producing transgenic rats, pCAG2131, was constructed according to a conventional method (FIG. 2).
  • a DNA fragment (SEQ ID NO: 4) encoding the hHI7T213 gene was inserted into the EcoRI site of pCXN2.
  • the preparation of the hHI7T213 gene and the contents of plasmid pCXN2 are shown in (1) and (2) below.
  • hHI7T213 gene DNA encoding human-derived hHI7T213 gene (SEQ ID NO: 4, JP-A-2000-166656)
  • the PCR method was carried out using primers of TTG AATTCGCCACCATGGATTCAACCATCCCAGTCT (SEQ ID NO: 13) and TTGAATTCTT ATCACTGCTCCAATCTGCTTCCCGACAGCT (Toshimi IJ number: 14), and the obtained fragment was digested with EcoRI. 70 bp fragment.
  • PCAG213-1 was transformed into Escherichia coli JM109 to obtain Escherichia coli JM109 / p CAG213-13-1.
  • pCAG2113-1 was digested with Sail and Pvul, and then a target fragment of 370 bp was obtained by partial digestion of BamHI.
  • Example 3 Preparation of transgenic rats transfected with hHI7T213 Injecting 30 IU PMSG intraperitoneally to female rats for egg collection (Wistar strain, 9 weeks old), 12 hours light period / 12 hours dark period After breeding in a breeding room for 2 days, 5 IU of hCG was intraperitoneally administered and mated with male rats (Wistar strain, I, 2 weeks old).
  • spermatogenic female rats (Wistar strain, 9 to 13 weeks of age) which are in spontaneous estrus were mated with vasectomized male rats (Wistar strain, 10 weeks of age or older).
  • the abdominal cavity of the female rat for egg collection confirmed to be mated by vaginal plug formation was opened, the oviduct was removed, and the HER medium containing 20% FCS (HAM-F12 powder medium (Dainippon Pharmaceutical) 3.180 g, RPM I ⁇ 1 6 4 0 powdered medium (Dainippon Pharmaceutical Co., Ltd.) 1. 04 0 g, MEM E ag 1 e powdered medium (Dainippon Pharmaceutical Co., Ltd.) 0.
  • the fertilized eggs were placed in a drop of PBS containing 20 % FCS covered with mineral oil and suction-fixed with a holding pipe.
  • the injection fragment solution (l O wg / ml) prepared in Example 2 was aspirated into an injection pipette, and the injection pipe was pierced into the male pronucleus of a fertilized egg under a stereoscopic microscope, and the injection fragment was injected.
  • fertilized eggs are placed in a drop of HER medium containing 20% FCS covered with mineral oil and incubated at 37 ° C, 5% C0 2 under until implantation into embryo reception female.
  • Anesthetized female rats confirmed to be pseudopregnant by vaginal plug formation were anesthetized with Nembutal, then the back was incised, the fat mass was pinched with forceps, pulled out, and fixed with clamp.
  • the ovary was torn with a tweezer under a stereoscopic microscope, and 8 to 13 fertilized eggs were injected into the opening of the fallopian tube using a transfer pipe. After returning the ovaries and fallopian tubes to the body and suturing the incision, they were kept in a breeding room for 12 hours light / 12 hours dark. Rats (FOs) were born 22 days after embryo transfer at day 0. Transmission of the transgene to the offspring rat was confirmed by cutting the tail with lcni scissors, isolating DNA from the tissue extract by a conventional method, and performing PCR.
  • the genomic DNAs of these six PCR-positive individuals were analyzed by Southern hybridization. That is, 5 ⁇ g of DNA was completely digested with EcoRI, electrophoresed on a 1.0% agarose gel, and then transferred to a nylon filter. This filter was hybridized with a probe labeled with a DNA labeling kit (manufactured by Roche's Diagnostics) using the DNA fragment containing the hHI7T213 gene obtained in Example 2 for 10 hours. The plate was washed twice with 2 x SSC and 0.1% SDS at room temperature, and then twice with 0.1 x SSC and 0.1% SDS at 68 ° C. For detection, a DIG fluorescence detection kit (Roche's Diagnostics) was used.
  • Example 4 When the strain (first generation (F.)) obtained in Example 4 reached the age of 12 weeks, it was bred with Wistar (CLEA Japan) strain rats to obtain the second generation (F). At the age of weeks, PCR was performed by the method described in Example 4 to select a heterozygote and used in Example 5, but the second generation was obtained for 13M, 96M, and 148M.
  • Example 6 Taq Man analysis of hHI7T2 13 mRNA in each line of transgenic rats
  • forward priraer (5, -TCCTGTCCGCTCTTAACAGCA-3 '(SEQ ID NO: 17)) and reverse primer (5' -TTTTGACGCTGCCTAAAGGAG-3 '(SEQ ID NO: 1) 8)
  • reverse primer 5' -TTTTGACGCTGCCTAAAGGAG-3 '(SEQ ID NO: 1) 8
  • TaqMan analysis was performed using the primer set of the FAM-labeled TaqMan primer (5,-TGCCAACCCCATCATTTACTTCTTCGTG-3, (SEQ ID NO: 19)).
  • rodent G3PDH set (Applied B In addition, as a negative control, an individual determined to be a wild type by the PCR performed in Example 5 was used.HHI7T213 gene expression was 13 M, The expression was found in all organs of the 96M and 148M lines (Fig. 3), although the expression pattern was the same between 96M and 13M, but the expression level was considered to be higher in 96M. Expression level is lower than 13M and 96M, and the expression Therefore, the effect of the insertion location was suggested.
  • Example 7 Observation of characteristics of transgenic rats
  • HHI7T213 gene expression level in each tissue was measured in the same manner as in Example 6. That is, 96-M 11-week-old transgenic rats (F from brain, heart, kidney, spleen, liver, retina, lens, skin, small intestine, stomach, muscle, lung, as shown in Example 6) RNA was prepared and TaqMan analysis was performed using G3PDH or actin gene as an internal standard Rodent G3PDH set (Applied Biochemicals) was used for detection of G3PDH, and Forward imer was used for detection of actin gene
  • Kidney, lens, skin, and muscle tended to be more prevalent (Figure 5).
  • Figure 5 Example 9 Pathological Analysis of Transgenic Rats and Expression of hHI7T213 Gene
  • pathological examination and hHI7T213 gene expression were performed. I checked about it. The pathological analysis was performed as follows. Rat liver, kidney, heart, spleen, lung, adrenal gland, testis, ovary, and eyeballs are excised, fixed with 10% neutral buffered formalin solution, and embedded in paraffin according to the usual method. Sliced to a thickness of / zm. Next, hematoxylin and eosin (HE) stained specimens were prepared and examined microscopically.
  • HE hematoxylin and eosin
  • Sections were fixed with 4% paraformalin-0.1 ⁇ phosphate buffer ( ⁇ 7.4), treated with Proteinase K (l / zg / ml Roche, 37 ° C for 10 minutes), 0.2 M HC1 Treatment 10 minutes, acetylation treatment A step of 10 minutes was performed. After adding the probe, perform hybridization at 55 ° C, wash with 50% formamide solution containing 2xSSC at 55 ° C, and treat with 5 g / ml RNaseA (Nitsubion Gene). The plate was washed at 55 ° C. with a final concentration of 0.4 ⁇ SSC. For signal detection, the cells were treated with anti-DIG-AP antibody (Roche) and developed with BCIP and NBA (Promega) in a box. Counterstaining was performed using eosin (Wako) or Nuclear ear red (Funakoshi) as necessary.
  • Anti-keratin6 antibody (Funakoshi), anti-keratin antibody (Cosmo Bio), anti-kerat Immunohistological staining using the inlO antibody (DAKO), anti-loricrin antibody (Funakoshi), and anti-PCNA antibody was performed as follows. That is, paraffin sections were deparaffinized using a xylene series and an alcohol series, and then boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then continued to boil for 7 minutes. After the temperature was returned to room temperature over 1 hour, 100% acetone treatment was performed for 5 minutes.
  • keratin 14 expressed in the basal cell layer
  • keratin 10 expressed in the spinous cell layer
  • loricrin gene expressed in the granular cell layer was examined.
  • keratin 14, keratin 10, and loricrin positive cells did not show any abnormalities (Fig. 10a-c)
  • keratinl4, keratinlO, and loricrin positive cells increased (Fig. 10g-i).
  • epidermal hyperplasia is associated with an increase in keratinl4, keratinlO, and loricrin positive cells.
  • the turnover time of epidermal basal layer cells decreases, and as a result, the time required for enucleation becomes insufficient, and parakeratosis, in which nuclei remain, is reduced. This is considered to have been observed as desquamation.
  • Example 12 Epidermal free nerve endings observed in transgenic rats. Epidermal free nerve endings were examined by double immunohistochemistry using a heron anti-PGP9.5 antibody and a mouse anti-keratin6 antibody.
  • Alexa488-labeled anti-saginii secondary antibody and Cy3-labeled anti-mouse secondary antibody were used as secondary antibodies. That is, a fresh frozen section having a thickness of 25 ⁇ was boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then continued to boil for 1 minute. After returning to room temperature over 1 hour or more, treatment with 100% acetone for 5 minutes was performed. The sections were treated with blocking, primary and secondary antibodies, and observed with a laser microscope (LSM510, Zeiss). The results are shown in FIG.
  • hHI7T213 gene is expressed in some of the nerve cells having free nerve terminals in spinal ganglia, and the abundant free nerve terminals found in Example 12 are It is conceivable that this may be the result of enhanced action based on the overexpression of the foreign gene in spinal cord neurons that originally express the hHI7T213 gene.
  • transgene expression in the spinal ganglia of transgenic rats Spinal ganglia, skin, eyes and kidneys were excised from 18-day-old NonTg and transgenic rats, homogenized in ISOGEN (Fujitsu Gene), and total RNA was extracted by a conventional method.
  • RNA for spinal ganglia Use 0.1 ix g of total RNA for spinal ganglia and 1 ⁇ g of total RNA for skin, eyes, and kidneys, and use First strand cDNA synthesis kit (Amersham Pharmacia Biotech). ) was used to synthesize cDNA according to the protocol and used as a template.
  • the primer for TaqMan analysis (TaqMan7700, Applied Biochemicals) is shown in Example 6.
  • Example 13 since the hHI7T213 gene was also expressed in the spinal ganglia of transgenic rats, the abundance of free nerve endings suggests that the high expression of the transgene could enhance the effect. Conceivable. Due to the enhanced action based on high expression in the spinal ganglia, only free nerve endings are specifically abundant in any of the epidermis, and there is no change in other types of nerve fibers such as CGRP-positive nerve fibers. Not expected. To elucidate this point, CGRP staining was performed to examine the distribution of nerve fibers other than free nerve endings. At this time, the transgenic rat skin was compared in both the apparently normal and abnormal specimens to determine whether the change was due to spinal ganglia or limited to abnormal epidermis. Was also done.
  • the primary antibody use a rabbit egret anti-CGRP antibody, a rabbit egret anti-PGP9.5 antibody, and a mouse anti-kerat in6 antibody. Using. The fresh frozen section having a thickness of 25 wm was boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then further boiled for 1 minute. After returning to room temperature over 1 hour or more, treatment with 100% acetone for 5 minutes was performed. The sections were subjected to blocking, primary antibody and secondary antibody treatment, and then observed with a laser microscope (LSM510, Zeiss).
  • LSM510 laser microscope
  • Example 14 Since it was suggested in Example 14 that transgenic rat skin with abnormalities might produce neurotrophic factors, the expression levels of NGF and BDNF genes in the epidermis were examined.
  • the skin of NonTg, apparently normal transgenic rats, and transgenic rats with abnormalities were excised, homogenized in ISOGEN (manufactured by Tsubon Gene), and total RNA was extracted by a conventional method.
  • ISOGEN manufactured by Tsubon Gene
  • total RNA was extracted by a conventional method.
  • cDNA was synthesized according to a protocol using a First strand cDNA synthesis kit (manufactured by Amersham Fanolemascia Biotech) according to the protocol to obtain a template.
  • the following primers were used for TaqMan analysis (TaqMan7700 s Applied Biochemicals).
  • forward primer (5′-TCCTGTCCGCTCTTAACAGCA-3, (SEQ ID NO: 17)
  • reverse primer (5, -TTTTCGACGCTGCCTAAAGGAG-3 ′ (SEQ ID NO: 18))
  • And FAM-labeled TaqMan primer (5′-TGCCAACCCCATCATTTACTTCTTCGTG-3 ′ (SEQ ID NO: 19)
  • forward primer 5, ⁇ AGGCCCACTGGACTAAACTTCAGC-3 ′ (SEQ ID NO: 23) for detection of NGF gene
  • Reverse primer (5, -GGGCACTGCGGGCTC-3, (SEQ ID NO: 24)
  • FAM-labeled TaqMan primer (5, -TTCCCTTGACACAGCCCTCCGC-3 '(SEQ ID NO: 25)
  • Forward for BDNF gene detection 5′-TCCTGTCCGCTCTTAACAGCA-3, (SEQ ID NO: 17)
  • reverse primer 5, -TTTTCGACGCTGCCTAAAGGAG-3 ′ (S
  • primer (5'-GGTG ATGCTCAGCAGTCAAGT-3, (SEQ ID NO: 26)), Reverse primer (5, -CGAACC CTCATAGACATGTTTG-3 '(SEQ ID NO: 27)), and FAM-labeled TaqMan primer (5' -TTTGGAGCCTCCTCTGCTCTTTCTGC-3 '(SEQ ID NO: 28))
  • Forward primer 5, -CGT GAAAAGATGA CCCAGATCA-3, (system U number: 29)
  • Reverse primer (5, -GC ACAGCCTGGATGGCTA-3 (SEQ ID NO: 30)
  • VIC-labeled TaqMan primer (5'-TTTGAGACCTTCAACACCCCAGCCA-3 '(SEQ ID NO: 31)
  • the transgenic non-human mammal of the present invention can be used for evaluation of preventive or therapeutic drugs for diseases such as cataracts, gene therapy experiments for patients with HI7T213 gene abnormality, and the like.
  • Cells collected from a non-human mammal into which the gene has been introduced can be cultured and used for evaluating HI7T213 inhibitors.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurosurgery (AREA)
  • Wood Science & Technology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Pain & Pain Management (AREA)
  • Neurology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Environmental Sciences (AREA)
  • Toxicology (AREA)
  • Dermatology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Animal Husbandry (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)

Abstract

L'invention concerne un mammifère transgénique non humain, utilisable en tant qu'animal pathologique modèle de maladies telles que la cataracte et permettant la clarification des mécanismes pathologiques de ces maladies, la discussion concernant les méthodes thérapeutiques et le criblage de préventifs et/ou de remèdes.
PCT/JP2003/013781 2002-10-29 2003-10-28 Animal transgenique h17t213, proteine h17t213 et adn correspondant WO2004039972A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2003275712A AU2003275712A1 (en) 2002-10-29 2003-10-28 H17t213-transgenic animal, novel h17t213 protein and dna thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2002314141 2002-10-29
JP2002-314141 2002-10-29

Publications (1)

Publication Number Publication Date
WO2004039972A1 true WO2004039972A1 (fr) 2004-05-13

Family

ID=32211604

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2003/013781 WO2004039972A1 (fr) 2002-10-29 2003-10-28 Animal transgenique h17t213, proteine h17t213 et adn correspondant

Country Status (2)

Country Link
AU (1) AU2003275712A1 (fr)
WO (1) WO2004039972A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1118620A1 (fr) * 1998-10-01 2001-07-25 Takeda Chemical Industries, Ltd. Nouvelle proteine receptrice couplee a la proteine g d'origine humaine, et son adn
WO2001083555A2 (fr) * 2000-05-04 2001-11-08 California Institute Of Technology Molecules de signalisation de la douleur

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1118620A1 (fr) * 1998-10-01 2001-07-25 Takeda Chemical Industries, Ltd. Nouvelle proteine receptrice couplee a la proteine g d'origine humaine, et son adn
WO2001083555A2 (fr) * 2000-05-04 2001-11-08 California Institute Of Technology Molecules de signalisation de la douleur

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DONG X, ET AL: "A DIVERSE FAMILY OF GPCRS EXPRESSED IN SPECIFIC SUBSETS OF NOCICEPTIVE NEURONS", CELL, vol. 106, 2001, pages 619 - 632, XP002243670 *
LEMPO P M C, ET AL: "PROENKEPHALIN A GENE PRODUCTS ACTIVATE A NEW FAMILY OF SENSORY NEUR0N-SPECIFIC GPCRS", NATURE NEUROSCIENCE, vol. 5, no. 3, March 2002 (2002-03-01), pages 201 - 209, XP002264104 *
XU X, ET AL: "DEGENERATION OF CONE PHOTORECEPTORS INDUCED BY EXPRESSION OF THE MAS1 PROTOONCOGENE", EXP NEUROL, vol. 163, 2000, pages 207 - 219, XP002974869 *

Also Published As

Publication number Publication date
AU2003275712A1 (en) 2004-05-25

Similar Documents

Publication Publication Date Title
JP6460483B2 (ja) 腎疾患の予防または治療剤
EP1352961A1 (fr) Proteine de cellule synoviale
WO2000075655A1 (fr) Procede de criblage avec cd100
US20060015954A1 (en) GPR54 knock-out mammals and screening methods using them
WO2003099331A1 (fr) Agents renforçateurs de la résistance à l'insuline
WO2006068326A1 (fr) Nouveau polypeptide et son utilisation
WO2003106683A1 (fr) Procede de criblage
JP4451158B2 (ja) 転写制御シスエレメント及びそれに特異的に結合する転写調節因子並びにそれらの用途
WO2004039972A1 (fr) Animal transgenique h17t213, proteine h17t213 et adn correspondant
WO2004048565A1 (fr) Proteine associee a l'apoptose et son utilisation
WO2003091434A1 (fr) Nouvelle proteine, et adn de cette proteine
WO2000071581A1 (fr) Nouveau polypeptide
JP2003245076A (ja) 新規タンパク質およびそのｄｎａ
WO2004074475A1 (fr) Element cis regulant la transcription, facteur regulateur de transcription se liant specifiquement a celui-ci et utilisation correspondante
JP2004166691A (ja) Ｈｉ７ｔ２１３遺伝子導入動物および新規なｈｉ７ｔ２１３タンパク質およびそのｄｎａ
WO2004111234A1 (fr) Nouvelle proteine
WO2004039405A1 (fr) Utilisation de l'homologue de sglt
WO2004014414A1 (fr) Nouvelles utilisations de rfrp et de ot7t022
JP2004075569A (ja) Ｉｌ２０受容体およびｉｌ２０の新規用途
US20030082650A1 (en) Great gene and protein
JP2001299364A (ja) 新規タンパク質およびそのｄｎａ
WO2003054190A1 (fr) Nouvelles proteines et adn correspondants
WO2003105885A1 (fr) Procede de criblage
WO2004095023A1 (fr) Nouvelle technique de criblage
JP2004131471A (ja) Ｒｆｒｐおよびｏｔ７ｔ０２２の新規用途

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP