WO2004039972A1

WO2004039972A1 - H17t213-transgenic animal, novel h17t213 protein and dna thereof

Info

Publication number: WO2004039972A1
Application number: PCT/JP2003/013781
Authority: WO
Inventors: Yoshihiko Kaisho; Takuya Watanabe; Yoshitaka Yasuhara; Ikuo Mori; Shigehisa Taketomi
Original assignee: Takeda Pharmaceutical Company Limited
Priority date: 2002-10-29
Filing date: 2003-10-28
Publication date: 2004-05-13
Also published as: AU2003275712A1

Abstract

It is intended to provide a transgenic nonhuman mammal which is usable as a pathological model animal of diseases such as cataract and enables clarification of the pathological mechanisms of these diseases, discussion on therapeutic methods therefor and screening of preventives and/or remedies therefor.

Description

Specification

HI7T213 transgenic animals and novel HI7T213 proteins and their DNA

The present invention relates to a non-human mammal into which an HI7T213 gene has been introduced, a novel HI7T213 protein, DNA encoding the protein, and uses thereof. Background art

Important functions such as maintenance of the homeostasis of the living body, reproduction, individual development, metabolism, growth, nervous system, circulatory system, immune system, digestive system, metabolic system regulation, and sensory reception are controlled by various hormones and nerves. By receiving endogenous factors such as transmitters or sensory stimuli such as light or odor through specific receptors present in the cell membrane of the living body, the cells respond accordingly. Is being done. Many of the hormone and neurotransmitter receptors involved in such function regulation are conjugated to guanine nucleotide-binding protein (hereinafter sometimes abbreviated as G protein). It is characterized by transmitting signals into cells to express various functions. These receptor proteins have seven transmembrane regions in common. These these receptors since the regulatory receptor one protein is present against the material and its various hormones and neurotransmitters in the _c thus biological functions which are generically referred to as G-protein coupled receptor or 7-transmembrane receptors It is known that they interact and play important roles, but it is often still unknown whether unknown agents (such as hormones and neurotransmitters) and their receptors exist. In recent years, the accumulation of sequence information by random sequencing of human genomic DNA or cDNA derived from various human tissues, and rapid advances in gene analysis technology have led to the rapid elucidation of human genes. Along with that, proteins with unknown functions The existence of many genes that are expected to code for quality has been revealed. G protein-coupled receptors not only have seven transmembrane domains, but also have many consensus sequences in their nucleic acids or amino acids. Can be classified as On the other hand, polymerase 'chain' reaction utilizing such structural similarity

Such a G protein-coupled receptor gene has also been obtained by the method (Polymerase Chain Reaction: hereinafter abbreviated as PCR). Among the G protein-coupled receptors obtained in this way, there are some subtypes with high structural homology to known receptors, and their ligands can be easily predicted. However, in most cases the endogenous ligand is unpredictable, and no corresponding ligand has been found for these receptors. For this reason, these receptors are called orphan receptors. Such unidentified endogenous ligands of the orphan receptor may be involved in biological phenomena for which the ligand was not known and thus not fully analyzed. If such ligands are associated with important physiological effects or pathological conditions, the development of receptor agonists or antagonists is expected to lead to the creation of innovative drugs (Stadel, J. et. al., TiPS, Vol. 18, pp. 430-437, 1997, Marchese, A. et al., TiPS, Vol. 20, pp. 370-375, 1999, Civel li, 0. et al., Brain Res., 848, 63-65, 1999). However, there have not been many cases in which ligands for orphan G protein-coupled receptors have been actually identified.

Recently, several groups have attempted to search for ligands for such orphan receptors, and reports on the isolation and structure determination of ligands, which are new bioactive peptides. Independently, Reinsheid et al. And Meunier et al. Independently expressed animal receptors by introducing cDNA encoding the orphan G protein-coupled receptor LC132 or ORL1 and expressed the receptor. A novel peptide, named orphanin FQ or nociceptin, was isolated from porcine or rat brain extracts and sequenced (Reinsheid, RK et al., Science, 270, 792-794, 1995, Meuni er, J. -C. et al., Nature, 377 vol. 532-535, 1995). This peptide was reported to be involved in pain sensation. In addition, studies of receptor knockout mice have clarified that it is involved in memory (Manabe, T. et al., Nature, 394). Vol., Pp. 577-581, 1998).

Thereafter, novel peptides such as Pr RP (prolactin rel easing pepti de), orexin, apel in, ghrel in, and GALP ^ galanm-like pept i de) were synthesized by the same method as above until now. Isolated as a receptor ligand (Hinuma, S. et al., Nature, 393, 272-276, 1998, Sakurai, T. et al., Cell, 92, 573-585, 1998 Year, Tatemoto, K. et al., Bichem. Biophys. Res.Commun., 251, 47, 476, 1998, Kojima, M. et al., Nature, 402, 656-660, 1999. Year, Ohtaki, T. et al., J. Biol. Chem., 274, 37041-37045, 1999).

On the other hand, a receptor for a bioactive peptide that has not been clarified until now may be elucidated by a similar method. It has been clarified that the receptor for motilin involved in intestinal contraction is GPR38 (Feighner, SD et al., Science, 284, 2184-2188, 1999), and SLC-1 Is melanin-concentrating hormone

(MCH) receptor (Chambers, J. et al., Nature, vol. 400, pp. 26-265, 1999, Saito, Y. et al., Nature, vol. 400, 265-269, 1999 , Shimomura, Y. et al., Biochem.Biophys. Res.Commun., Vol. 261, pp. 622-626, 1999, Lembo, PMC et al., Nature Cell Biol., Vol. 1,

267-271, 1999, Bachner, D. et al., FEBS Lett., 457, 522-524, 1999), and that GPR 14 (SENR) is a receptor for urotens in II (Ames, RS et al., Nature, 401, 282-286, 1999, Mori, M. et al., Biochem. Biophys. Res. Commun., 265, 123-129, 1999 , Nothacker, H.-P. et al., Ature Cell Biol., Vol. 1, pages 383-385, 1999, Liu, Q. et al., Biochem. Biophys. Res. Commun., 266, 174 -178 pages, 1999). MCH has been shown to be involved in obesity because its knockout mice display an emulsified phenotype (Shimada, M. et al.,

Nature, 396, 670-674, 1998). As a result, it has become possible to search for a receptor antagonist having a potential as an anti-obesity drug. In addition, it has been reported that urotensin ΙΓ exerts a potent effect on the cardiovascular system because it induces cardiac ischemia when administered intravenously to monkeys (Ames, RS et al., Ature, 401, 282- 286, 1999).

As described above, in many cases, the Aubuan receptor or its ligand is involved in a new physiological action, and its elucidation is expected to lead to new drug development. However, there are many difficulties in searching for orphan receptor ligands, and while only a few receptors have been identified so far, their ligands have been identified. .

As one of the orphan receptors, hHI7T2113 is known (SEQ ID NO: 1 and SEQ ID NO: 3; Japanese Patent Application Laid-Open No. 2000-166566) (Patent Document 1 )). In addition, as orphan receptors, Mr g X 3 (human type), Mr g A4 (mouse type), and Mrg A 6 (mouse type) are known to be orphan receptors (Nature Neuroscience, 5, 201-209 (2002) ) (Non-patent document 1), Cell, 106, 619-632 (2001) (Non-patent document 2)). have. Furthermore, hHI7T213 has about 30% homology with the oncogene mas at the amino acid level. Disclosure of the invention

New gene transfer (transgenic) Animals enable the development of new medicines that can help prevent and treat various diseases.

Therefore, in the field of the present invention, HI7T213 gene-introduced non-human animals (hereinafter sometimes referred to as transgenic animals) have been identified, and have been used for cancer, cataract, dermatitis, chronic pain or hyperalgesia, etc. Development of a method for producing large numbers of disease model animals was desired.

The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, produced a novel transgenic mouse expressing exogenous HI 7 T 2 13, which resulted in cataract, crude hair, skin It was found to show phenotypes such as rash and desquamation. Furthermore, the present inventors have developed a novel mouse-derived HI that differs in some amino acids from the known Mr g A4. Cloning of a novel c DAN encoding each of 7 T 213 (SEQ ID NO: 5) was successful. The present inventors have conducted further studies based on these findings, and as a result, have completed the present invention.

That is, the present invention

[1] a non-human mammal having a DNA incorporating an exogenous HI7T213 gene or a mutant gene thereof, or a part thereof,

[2] The animal of the above-mentioned [1], wherein the non-human mammal is a rat, or a part thereof; C 3] The exogenous HI 7 T 213 gene is SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or The animal according to [1] or a part thereof, which is a gene encoding HI7T213 having the same or substantially the same amino acid sequence as the amino acid sequence represented by No. 7;

[4] The animal or a part thereof according to the above [1], wherein the exogenous HI7T213 gene is a gene encoding human-derived HI7T213 consisting of the amino acid sequence represented by SEQ ID NO: 3. ,

[5] (1) have cataracts;

(2) has developed coarse hair,

(3) transient skin rash or desquamation is observed,

(4) melting / degeneration of lens fibers is observed in the eyeball,

(5) lens fiber abnormalities are observed in the eyeball,

(6) stratification of the lens epithelium at the anterior lens of the lens is seen,

(7) basophils are increasing in the kidney,

(8) cell damage occurs in the kidney,

(9) high proliferation promoting activity of tubular cells,

(10) In young skin, epidermal thickening and parakeratosis are observed,

(11) PCNA-positive cells, which are growth-associated antigens, are found in the basal layer of the epidermis and near the pores.

(12) An increase in keratin 6 gene-expressing cells or an increase in PCNA-positive cells is observed,

(13) cell growth promoting activity is enhanced, (14) Abnormal epidermal differentiation with increased expression of keratin 14, keratin 10 or oral ricklin is observed,

(15) keratin 6-positive sites are rich in epidermal free nerve endings,

'' (1 6) Enhanced expression of neurotrophic factor group in abnormal epidermis, and

(17) abnormal differentiation associated with proliferation promoting activity,

The animal or a part thereof according to [1] to [4] above, which shows at least one phenotype selected from:

[6] Apply the test substance to the animal or a part thereof according to any of [1] to [4] above and assay for HI7T213 agonist activity or HI7T213 antagoest activity HI 7 T 2 13 agonist or HI 7 T 2 13 antagonist screening method,

[7] HI7T213agonist obtainable by the screening method described in [6] above,

[8] An agent for preventing and / or treating a wound, spinal cord injury or analgesia that contains the HI7T213agonist, which can be obtained by the screening method described in the above [6], or a kidney. Regenerating agents,

[9] The test substance is applied to the animal or a part thereof according to any of [1] to [5] above, and the phenotype or cancer, renal disorder, cataract, dermatitis, chronic condition described in [5] above is applied. Screening of substances used to prevent and treat cancer, renal disorders, cataracts, dermatitis, chronic pain or hyperalgesia, characterized by assessing the effect of improving pain or hyperalgesia Method,

[10] A substance used for prevention or treatment of cancer, nephropathy, cataract, dermatitis, chronic pain or hyperalgesia obtained by using the screening method described in the above [9],

[11] A medicament for preventing and / or treating cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, comprising a substance obtained by using the screening method described in [9] above.

[12] A wound or spinal cord comprising administering to a mammal an effective amount of HI7T213agonist obtained using the screening method described in [6]. Prevention or treatment of injuries or analgesia or renal regeneration,

[13] HI7T213agonist obtained by using the screening method according to the above [6] for producing a preventive and / or therapeutic agent for wound, spinal cord injury or analgesia, or a regenerative agent for kidney. Use,

[14] The animal or one of the above-mentioned [1] to [4] for screening a substance used for prevention and / or treatment of a wound, spinal cord injury or analgesia, or renal regeneration. Use of departments,

[15] a cancer, a renal disorder, a cataract, a dermatitis, a chronic pain, Prevention and / or treatment of hyperalgesia,

[16] Use of a substance obtained by using the screening method according to [9] for the manufacture of a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia,

[17] A method for screening substances used for the prevention and / or treatment of cancer, nephropathy, cataract, dermatitis, chronic pain or hyperalgesia, as described in [1] to [5] above. Use of any of the animals or any part thereof,

[18] a fertilized egg into which an exogenous HI7T213 gene or its mutant gene has been introduced, [19] a fertilized egg containing the exogenous HI7T213 gene or its mutant gene, and which expresses the gene in a non-human mammal. Vector to get,

[20] The vector of the above-mentioned [19], wherein the exogenous H I 7 T 213 gene is a gene encoding human-derived H I 7 T 213 consisting of the amino acid sequence represented by SEQ ID NO: 3.

[21] The vector according to the above [19], further comprising a CAG promoter containing a nitriatin promoter, a region containing a persimmon globin poly A addition signal, an SV40 replication initiation region, an ampicillin resistance gene and a neomycin resistance gene.

[22] the vector of the above-mentioned [1 9], which is represented by p CAG 213-1,

[23] A transformant transformed with the vector of the above-mentioned [19],

[24] Transformant is E. coli JM109 / p CAG213-1 (FERM BP -820 7), the transformant according to the above [23],

[25] a G protein-coupled receptor protein or a salt thereof, which comprises an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5;

[26] the G protein-coupled receptor protein or a salt thereof according to the above [25], comprising the amino acid sequence represented by SEQ ID NO: 5;

[27] A partial peptide or a salt thereof of the G protein-coupled receptor protein according to the above [25],

[28] A polynucleotide comprising the polynucleotide encoding the G protein-coupled receptor protein or the partial peptide thereof according to the above [25],

[29] the polynucleotide of the above-mentioned [28], which is DNA;

[30] a DNA consisting of the nucleotide sequence represented by SEQ ID NO: 6,

[31] a recombinant vector containing the polynucleotide according to the above [28],

[3 2] A transformant transformed with the recombinant vector according to the above [31], [33] A transformant according to the above [32] is cultured, and the G protein conjugate according to the above [25] is cultured. [25] The method for producing a G protein-coupled receptor protein, a partial peptide or a salt thereof according to the above [25], wherein the method produces a receptor protein or a partial peptide thereof.

[34] A pharmaceutical comprising the G protein-coupled receptor protein according to the above [25], a partial peptide or a salt thereof,

[35] a medicine comprising the polynucleotide of the above-mentioned [28],

[36] a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A preventive and / or therapeutic agent for wounds, spinal cord injury or analgesia or a renal regeneration agent containing the salt thereof,

[37] G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 Or a wound, spinal cord injury or no A prophylactic and / or therapeutic agent for analgesia, or a regenerative agent,

[38] G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 Or a diagnostic agent for wound, spinal cord injury, analgesia, cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising a polynucleotide containing a polynucleotide encoding a partial peptide thereof,

[39] an antibody against the G protein-coupled receptor protein according to the above [25], a partial peptide or a salt thereof,

[40] the antibody of the above-mentioned [39], which is a neutralizing antibody that inactivates signal transmission of the G protein-coupled receptor protein of the above-mentioned [25];

[41] a medicament comprising the antibody of the above [39],

[42] a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, A prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antibody against the partial peptide or a salt thereof,

[43] a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7, Wounds, spinal cord injuries, analgesia, cancer, renal disorders, cataracts, dermatitis, chronic pain or hyperalgesia diagnostics containing antibodies to the partial peptides or their salts,

[44] a polynucleotide comprising a nucleotide sequence complementary to the polynucleotide of the above-mentioned [28] or a part thereof;

[45] a medicament comprising the polynucleotide according to the above [44],

[46] a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A cancer, a renal disorder, a cataract, a dermatitis, which contains a polynucleotide comprising a nucleotide sequence complementary to a polynucleotide containing a polynucleotide encoding the partial peptide or a part thereof, Pride Preventive and / or therapeutic agent for sexual pain or hyperalgesia,

[47] A ligand characterized by using the G protein-coupled receptor protein described in [25] above, a partial peptide thereof or a salt thereof, and a ligand comprising the G protein-coupled receptor protein, a partial peptide thereof or a salt thereof. A method for screening a compound or a salt thereof that changes the binding property of

[48] The G protein-coupled receptor protein according to the above [25], a ligand characterized by containing a partial peptide or a salt thereof, and the G protein-coupled receptor protein, a partial peptide or a salt thereof A kit for screening a compound or a salt thereof that changes the binding property,

[49] Binding property between a ligand and the G protein-coupled receptor protein, a partial peptide thereof or a salt thereof, which can be obtained by using the screening method according to the above [47] or the screening kit according to the above [48]. Or a salt thereof,

[50] A medicament comprising the compound of the above-mentioned [49] or a salt thereof,

[51] G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A preventive and / or therapeutic agent for wounds, spinal cord injury or analgesia or a regenerative agent comprising a ligand or agonist for the partial peptide or a salt thereof,

[52] a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, A prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, comprising an antagonist to the partial peptide or a salt thereof,

[53] The method for screening a substance that alters the expression level of a G protein-coupled receptor protein or a partial peptide thereof according to [25], which comprises using the DNA according to [29].

[54] The expression level of the G protein-coupled receptor protein or the partial peptide thereof according to the above [25], which comprises the DNA according to the above [29]. A kit for the screening of substances that change the

[55] The G protein-coupled receptor protein or a partial peptide thereof according to [25], which can be obtained by using the screening method according to [53] or the screening kit according to [54]. [56] contains an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A preventive and / or therapeutic agent for wound, spinal cord injury or analgesia, or a renal regenerating agent, which contains a substance that increases the expression level of G protein-coupled receptor protein or its partial peptide.

[57] G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 Or a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, which contains a substance that reduces the expression level of its partial peptide,

[58] a mammal comprising: (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7; A G protein-coupled receptor protein, a partial peptide or a salt thereof, (ii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A polynucleotide containing a G protein-coupled receptor protein containing the same amino acid sequence or a polynucleotide encoding a partial peptide thereof, (iii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or A G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, a part thereof A ligand or agonist for the peptide or a salt thereof, or (iv) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. Prevention of wound, spinal cord injury or analgesia characterized by administering an effective amount of a substance that increases the expression level of a G protein-coupled receptor protein containing an amino acid sequence, a partial peptide or a salt thereof, and / or Or treatment, or kidney regeneration, [59] a mammal comprising: (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7; (Ii) an antibody to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; A polynucleotide comprising a base sequence complementary to a polynucleotide comprising a polynucleotide encoding a G protein-coupled receptor protein or a partial peptide thereof having a substantially identical amino acid sequence or a part thereof, ( iii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A G protein-coupled receptor protein containing the same amino acid sequence, an antagonist to a partial peptide or a salt thereof, or (iv) represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 Characterized by administering an effective amount of a substance that reduces the expression level of a G protein-coupled receptor protein, a partial peptide or a salt thereof, which contains an amino acid sequence identical or substantially identical to the amino acid sequence to be obtained. To prevent and / or treat cancer, kidney disorders, cataracts, dermatitis, chronic pain or hyperalgesia,

[60] for the manufacture of a prophylactic and / or therapeutic agent for regenerating a wound, spinal cord injury or analgesia, or a renal regenerating agent; (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or A G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, a partial peptide or a salt thereof, (ii) SEQ ID NO: 1, SEQ ID NO: : Containing a polynucleotide encoding a G protein-coupled receptor protein or a partial peptide thereof containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 (Iii) the same or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. G protein-coupled receptor protein containing the amino acid sequence of the following, a ligand or agonist for the partial peptide or a salt thereof, or (iv) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or No .: an amino acid sequence identical or substantially identical to the amino acid sequence represented by 7 Use of a substance that increases the expression level of the contained G protein-coupled receptor protein, its partial peptide or a salt thereof,

[61] (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: for producing a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia No .: 5 or G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, an antibody against a partial peptide thereof or a salt thereof, (ii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or a G protein-coupled receptor protein or its partial peptide containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7 A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide containing the coding polynucleotide or a part thereof, (iii) SEQ ID NO: 1, SEQ ID NO: No .: 3, G-protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7, Antagonist against a partial peptide or a salt thereof Or (iv) a G protein-coupled receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, Use of a substance that reduces the expression of the partial peptide or its salt,

And so on. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 shows the expression of the endogenous hHI7T213 gene in each mouse tissue. The upper panel shows the expression of the # 8 gene, and the lower panel shows the expression of the # 11 gene. P0, E18, Ad, D, B, I, M, H, C, K, L, S, and T are neonatal mice, 18-day-old fetal mice, adult mice, and dorsal root nerves, respectively. Represents nodes, brain, small intestine, muscle, heart, cortex, kidney, liver, spleen and testis.

FIG. 2 is a construction diagram of an expression vector pCAG213-1 for producing a transgenic rat.

Figure 3 shows the expression of the hHI7T213 gene in each transgenic rat strain. Shows expression. N on T g is an experiment using non-transgenic rats, and Br, He, and Ki represent brain, heart, and kidney, respectively. Error bars in the graph represent standard errors.

FIG. 4 shows the characteristics of Transdigrat 9 & M. (A) Transgenic rats are on the left and non-transgenic rats are on the right. Arrows indicate desquamation. (B) shows the results of 5-day-old transgenic rats. (C) shows the results of 9-day-old non-transgenic rats. (D) Shows the results for 9-day-old transgenic rats.

FIG. 5 shows the tissue distribution of the hHI7T213 gene in 96M transgenic rats. Br, He, Ki, Sp, Li, Re, Le, Sk, In, Mu, and Lu are the brain, heart, kidney, spleen, liver, retina, lens, and small intestine, respectively. , Representing muscle and lungs.

FIG. 6 shows the results of pathological analysis of the lens of 96 M transgenic rats. Non-transgenic rats as controls are shown in the left panel (a, c, e, f, i, k) and 96 M results in the right panel (b, d, g, h, j, 1). Represent. 5 W (a-d) indicates 5 weeks of age, P 3 (e-j) indicates 3 days of age, and E 12 (k, 1) indicates embryonic 12 days of age.

FIG. 7 shows the results of pathological analysis and hHI7T213 gene expression in the kidney. a and b show the results of hematoxylin / eosin staining (H & E staining) of 5-week-old non-transgenic rats and transgenic rats, respectively, and c to e show the results of 3-day-old non-transgenic rats. (C) and the results of in situ hybridization of the hHI7T213 gene in the kidneys of transgenic rats (d and e).

FIG. 8 shows the results of observation of epidermal hyperplasia and parakeratosis in transgenic rats. (A, b, e, f) and (c :, d, g, h) represent the results using non-transgenic rats and transgenic rats, respectively. (A, c, e, g) shows the results of hematoxylin / eosin staining, and (b, d, f, h) shows the results of in situ hybridization of the hHI7T213 gene. . (A-d) is 3 days old, (e-h) is 7 days old. FIG. 9 shows the expression level of the hHI7T213 gene in the skin of muscles of 96 M and 13 M of transgenic rats. The individual numbers correspond to Table 1.

FIG. 10 shows the results of observation of abnormal epidermal differentiation of Transduck rat 96M at the age of 7 days. (A to f) and (g to 1) represent the results using non-transgenic and transgenic rats, respectively. The staining of various antibodies and the in situ hybridization (f, 1) of the hHI7T213 gene are indicated above.

FIG. 11 shows the results of observation of epidermal free nerve endings of the transgenic rat 96M at the age of 7 days. Keratin6 and PGP9.5 indicate that a mouse anti-keratin 6 antibody and a heron anti-PGP9.5 antibody were used, respectively. Non (ac) represents a control rat (non-transgenic rat) and Tg (di) represents a transgenic rat, and the border of the epidermis is indicated by a dotted line.

FIG. 12 shows the expression of the hHI7T213 gene at the age of 18 days in embryos of the transgenic rat 96M. Non Tg is an experiment using non-transgenic rats, and D, S, E, and K represent spinal ganglia, skin, eyes, and kidney, respectively. FIG. 13 shows the observation results of nerve endings at the age of 7 days after birth of 96 ° transgenic rats. Keratin6, PGP9.5, and CGRP indicate that a mouse anti-keratin 6 antibody, a heron anti-PGP9.5 antibody, and a heron anti-CGRP antibody were used, respectively. Non nTg (a-c) indicates control rats (non-transgenic rats), Tg-Nor indicates skin of transgenic rats that are normal in appearance, and Tg-Ab indicates abnormal skin.

FIG. 14 shows the expression of the bH I 7 T2 13 gene, the NGF gene, and the BDNF gene at the age of 7 in 96M transgenic rats. NonTg (a-c) indicates the skin of a control rat (non-transgenic rat), Tg-Nor indicates the skin of an apparently normal transgenic rat, and Tg-Ab indicates the abnormal skin. The value is the average of n = 4, and SE indicates an error bar (t-TEST: ** is ρ <0.01,!) (0.001). BEST MODE FOR CARRYING OUT THE INVENTION The transgenic animal of the present invention includes, for example, fertilized eggs of non-human mammals, unfertilized eggs, spermatozoa and their progenitors (primordial germ cells, oocytes, oocytes, oocytes, spermatogonia, spermatozoa, In the early stage of embryo development of a fertilized egg (more preferably, before the 8-cell stage), calcium phosphate co-precipitation, electroporation (electo-portion), lipofection, etc. Use the gene transfer method such as agglutination method, microinjection (microphone injection) method, gene gun (particle gun) method, DEAE-dextran method, etc. to target exogenous HI7T213 gene or its mutant gene It is created by introducing it into cells and the like. Further, by the gene transfer method, a target DNA can be introduced into somatic cells, tissues, organs, and the like of a non-human mammal, and the resulting DNA can be used for cell culture, tissue culture, and the like. Transgenic animals can also be created by fusing embryo (or germ) cells using known cell fusion methods. Alternatively, the DNA of interest is introduced into non-human mammal embryonic stem cells (ES cells) using the above-described gene transfer method in the same manner as in the case of producing knockout animals, and the DNA is stably assembled in advance. After selecting the transfected clone, the ES cells were injected into the blastocyst or the ES cell mass was aggregated with the 8-cell stage embryo to produce a chimeric mouse, and the transgene was transferred to the germ line. It is also possible to obtain transgenic animals by selecting one.

In addition, a part (for example, (i) a cell, a tissue, an organ, or the like having a DNA incorporating the exogenous HI7T2113 gene or its mutant gene) of the transgenic animal thus produced is used. (Ii) various proteins or DNAs that can be isolated from the transgenic animal, such as those obtained by culturing cells or tissues derived therefrom and subculturing as necessary, and the like. The part of the non-human mammal having a DNA into which the sex HI7T213 gene or its mutant gene has been incorporated is referred to as the `` exogenous HI7T213 gene or its part '' of the present invention. It can be used for the same purpose as "a non-human mammal having DNA into which a mutant gene has been incorporated".

The tissue that is a part of the transgenic animal is not particularly limited, but is preferably skin, liver, kidney, heart, spleen, lung, adrenal gland, testis, ovary, eyeball, and the like.

Cells that are part of the transgenic animal include, but are not limited to, skin, liver Cells such as kidney, heart, spleen, lung, adrenal gland, testis, ovary and eyeball are preferred.

"Non-human mammals" that can be targeted in the present invention include porcupines, pigs, higgins, goats, puppies, dogs, cats, monoremots, hamsters, rats, mice, and the like. Preferred are egrets, dogs, cats, guinea pigs, hamsters, mice or rats, particularly rodents (Rodentia), especially rats (Wistar, SD, etc.), especially Wistar strains. Rats are the most preferred subject animals for disease model animals. In addition, birds and the like as bird animals can be used for the same purpose as the “non-human mammal” targeted in the present invention. The exogenous HI7T213 gene to be introduced into the target non-human mammal includes, for example, human, pig, sheep, goat, goat, rabbit, dog, cat, guinea pig, hamster, rat, mouse HI7T213 gene derived from mammals such as HI7T213 can be used.

The exogenous HI 7 T 2 13 gene is a gene different from the endogenous gene of the animal into which the gene is to be introduced, and specifically, HI 7 T 2 1 3 isolated and purified from the mammal described above. Three genes or a synthesized HI7T213 gene are used. Examples of the mutant gene of the exogenous HI7T213 gene of the present invention include those in which a mutation (for example, mutation, site-specific mutation, etc.) has occurred in the DNA of the present invention, specifically, the addition of a base. Or a gene in which a deletion, substitution with another base, or the like has occurred. More specifically, as a result of the addition, deletion, or substitution of another base, the amino acid sequence constituting HI7T213 has 1 to 30, preferably 1 to 10, More preferably, it is preferable to mutate so that substitution, addition or deletion occurs to 1 to 5, more preferably 1 or 2 amino acids, and any mutation that does not lose the function of HI7T213 is preferable. May be a mutation.

Specifically, as the exogenous HI 7 T 2 13 gene, for example, a gene encoding HI 7 T 2 13 described below is used, and more specifically, represented by SEQ ID NO: 1 DNA encoding human HI7T213 containing an amino acid sequence (SEQ ID NO: 2), DNA encoding human HI7T213 containing an amino acid sequence represented by SEQ ID NO: 3 (sequence No .: 4), DNA encoding mouse HI7T213 containing the amino acid sequence represented by SEQ ID NO: 5 (SEQ ID NO: 6), SEQ ID NO: No .: DNA encoding the mouse HI7T213 containing the amino acid sequence represented by 7 (SEQ ID NO: 8) and the like are used.

The exogenous HI7T213 gene or its mutant gene (hereinafter sometimes simply referred to as the HI7T213 gene) in the present invention is the same as the non-human mammal to be introduced or expressed. Alternatively, it may be derived from a different kind of mammal, but is preferably derived from a different kind of mammal. When introducing the gene into a target animal, it is generally advantageous to use the gene as a gene construct (eg, a vector, etc.) linked downstream of a promoter that can be expressed in the cells of the target animal. . Specifically, when a human HI7T213 gene is introduced, various mammals having the HI7T213 gene, which is highly homologous to the human HI7T213 gene (Egret) , A dog, a cat, a guinea pig, a hamster, a rat, a mouse, or the like (preferably, a rat, etc.)), and downstream of various promoters capable of expressing the human HI7T213 gene. By microinjecting the vector ligated into the fertilized egg (eg, rat fertilized egg) of the target non-human mammal, the gene expressing the target human HI7T213 gene is highly expressed. A non-human mammal introduced into the offspring can be produced. '

Expression vectors for the HI7T213 gene include Escherichia coli-derived plasmid, Bacillus subtilis-derived plasmid, yeast-derived plasmid, batter phage such as λ phage, retrovirus such as Moroni leukemia virus, and vaccinia. Viruses or animal viruses such as baculovirus are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used, and a plasmid derived from Escherichia coli is particularly preferred.

Promoters that regulate gene expression of exogenous ΗI 7 72 13 genes include, for example, promoters of genes derived from viruses (eg, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus), various Genes derived from mammals (eg, human, egret, dog, cat, guinea pig, hamster, rat, mouse) and birds (eg, chicken) (eg, albumin, endothelin, osteocalcin, muscle creatine kinase, type I) Type II collagen, cyclic AMP-dependent protein killer "I-beta I unit, atrial sodium diuresis Sex factor, dopamine monohydroxylase, neurofilament light chain, meta-oral thionin I and IIA, meta-oral proteinase 1 tissue inhibitor, smooth muscle actin, polypeptide chain elongation factor 1a (EF1-α), β Actin, ct and / 3 myosin heavy chains, myosin light chains 1 and 2, myelin basic protein, serum amyloid P component, renin, etc.), among which CAG containing-ヮ triactin promoter It is better to use a promoter or the like.

More preferably, a promoter capable of specifically or highly expressing an exogenous HI7T213 gene in a target tissue according to a target disease model (eg, a serum amyloid P component capable of high expression in a liver) SAP), gene promoters such as albumin, transferrin, antithrombin III, α1-antitrypsin; gene promoters such as α and j3 myosin heavy chains, myosin light chains 1 and 2 that can be highly expressed in the heart; Gene promoters such as PTH / PTH r P receptor that can be highly expressed; gene promoters such as ACTH receptor that can be highly expressed in the adrenal gland; gene promoters such as fatty acid binding protein that can be highly expressed in the digestive tract; Gene promoters such as possible myelin basic protein and glial fibrillary acidic protein Etc.) can be appropriately selected. For example, when the transgenic animal of the present invention is a renal disease model, it is preferable to use a promoter that can be highly expressed in the kidney.

The vector preferably has a sequence (poly A, generally called terminator 1) that terminates transcription of the target mRNA in a transgenic mammal, and includes, for example, viruses, various mammals and birds Gene expression can be manipulated using the sequence of each gene derived from the gene. Preferably, a Simian virus SV40 terminator or the like is used. In addition, in order to further express the gene of interest, the splicing signal of each gene, the enhancer region, and a part of the intron of the eukaryotic gene are transferred to the 5, 5, upstream of the promoter region, between the promoter region and the translation region, or in the translation region. It is also possible to connect 3 'downstream according to the purpose.

In addition, the above-described vector selects a clone into which the introduced gene has been stably integrated. It is preferable to further include a selectable marker gene (eg, a drug resistance gene such as a neomycin resistance gene, a hygromycin resistance gene, and an ampicillin resistance gene). Furthermore, if the incorporation of the transgene into a specific site of the host chromosome by homologous recombination (ie, the production of a knock-in animal) is intended, the above-mentioned vector is used to eliminate random insertion. It is preferable that a herpes simplex virus-derived thymidine kinase gene or diphtheria toxin gene is further included as a negative selection marker gene outside the DNA sequence homologous to the site. These embodiments will be described later in detail.

The translation region of HI7T213 is derived from the liver, kidney, and fibroblasts of various human and non-human mammals (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, and mice) Using all or part of DNA and genomic DNA derived from various commercially available genomic DNA libraries as raw materials, or known from RNA derived from liver, kidney, and fibroblasts of human and non-human mammals It can be obtained using the complementary DNA prepared by the above method as a raw material. In addition, a translation region mutated by a point mutagenesis method or the like can also be prepared using the HI7T213 translation region obtained from the above cells or tissues. These are all materials that can be used for transgenic animals.

The above-mentioned translation region is ligated to a HI by a conventional genetic engineering technique in which it is linked to a downstream of the above-mentioned promoter (preferably, an upstream of a transcription termination site) as a gene construct (eg, a vector) which can be expressed in an introduced animal. A DNA incorporating the 7T213 gene can be produced.

Specifically, the plasmid pCXN, which contains the CAG promoter containing the Nitriactin promoter, the region containing the polyA addition signal of the rabbit pig mouth, the SV40 replication initiation region, the ampicillin resistance gene, and the neomycin resistance gene. In p.2, pCAG2113-1 (Example 1 described later) into which the HI7T213 gene is inserted is used.

In a preferred embodiment, the expression vector containing the DNA encoding the exogenous HI7T213 obtained as described above is introduced into an early embryo of a target non-human mammal by a microinjection method. You. For the early embryo of the target non-human mammal, an in-vivo fertilized egg obtained by mating male and female non-human mammals of the same species, or eggs collected from males and females of the same non-human mammal, respectively, are collected. And sperm can be obtained by in vitro fertilization.

The age and breeding conditions of the non-human mammal to be used vary depending on the animal species. For example, mice (preferably inbred mice such as C57BL / 6J (B6), and inbred mice with B6 When used, it is preferable that females are about 4 to about 6 weeks old and males are about 2 to about 8 months old. Also, about 12 hours light period conditions (for example, 7: 00— (9: 00) at about 1 week.

In vivo fertilization may be by natural mating, but after inducing excessive ovulation by administering gonadotropin to female non-human mammals for the purpose of regulating the estrous cycle and obtaining many early embryos from one individual Preferred is a method of mating with a male non-human mammal. Methods for inducing ovulation in female non-human mammals include, for example, follicle-stimulating hormone (pregnant mare serum gonadotropin, generally abbreviated as PMS G) first, followed by luteinizing hormone (human chorionic gonadotropin). , Which is generally abbreviated as hCG), for example, by intraperitoneal injection or the like, but the preferred amount and interval of administration of the hormone differ depending on the type of non-human mammal. For example, if the non-human mammal is a mouse (preferably an inbred mouse such as C57BL / 6J (B6), or an F from B6 to another inbred), Approximately 48 hours after administration of follicle stimulating hormone, a luteinizing hormone is preferably administered, and immediately bred with male mice to obtain fertilized eggs. The dose of follicle stimulating hormone is preferably about 20 to about 50. IU / individual, preferably about 30 IU / individual, the dose of luteinizing hormone is about 0 to about 10 IUZ individual, preferably about 5 IU / individual.

After a certain period of time, open the abdominal cavity of a female non-human mammal that has been confirmed to have mated by examining vaginal plugs, remove the fertilized egg from the fallopian tube, and culture the embryo for culture (eg, Ml6 medium, modified Whitten medium, BWW Medium, M2 medium, WM-HE PES medium, BWW-HE PES medium, etc.) to remove cumulus cells, and microdrop injection method, etc. 5% CO 2 Z 9 DNA microinjection under 5% atmosphere Culture until If microinjection is not performed immediately, the collected fertilized eggs can be stored frozen by the slow method or the ultra-rapid method. On the other hand, in the case of in vitro fertilization, female non-human mammals for egg collection (the same Is preferably used) to induce ovulation by administering follicle-stimulating hormone and luteinizing hormone in the same manner as above, then collect the eggs and use them in a fertilization medium (eg, in TYH medium until microin vitro fertilization). Cultivate in a 5% carbon dioxide / 95% atmosphere by drop culture method, etc. On the other hand, the epididymis of the same male non-human mammal (the same as that used for in-vivo fertilization is preferably used) Remove, collect the sperm mass, and pre-culture in the fertilization medium Add the spermatozoa after the pre-culture to the fertilization medium containing the ovum, and in a 5% carbon dioxide gas / 95% air atmosphere by microdrop culture method etc. After culturing, select a fertilized egg with two pronuclei under a microscope If the DNA is not to be immediately microinjected, cryopreserve the obtained fertilized egg by the slow method or ultra-rapid method Is also possible.

Microinjection of DNA into a fertilized egg can be performed using a known device such as a micromanipulator according to a conventional method. Briefly, fertilized eggs placed in microdrops of embryo culture medium are aspirated and fixed with a holding pipe, and the DNA solution is injected into the male or female pronucleus, preferably using an injection pipe. Inject directly into the male pronucleus. It is preferable to use a transgene highly purified by CsC1 density gradient ultracentrifugation or the like. In addition, it is preferable that the transgene is linearized by cutting the vector portion using a restriction enzyme.

Fertilized eggs after DNA transfer were cultured from the 1-cell stage to the blastocyst stage in 5% carbon dioxide / 95% atmosphere by microdroplet culture in embryo culture medium, etc. Implanted into the fallopian tubes or uterus of non-human mammals. The female non-human mammal for embryo transfer may be of the same species as the animal from which the early embryo to be transferred is derived. For example, when transplanting an early mouse embryo, an ICR female mouse (preferably about (8 to about 10 weeks old) are preferably used. Methods for bringing a female non-human mammal for embryo reception into a pseudopregnant state include, for example, allergic vasectomy (ligation) male non-human mammal (for example, in the case of a mouse, an ICR male mouse (preferably about There is a known method of mating with veterinary plugs that have been confirmed to have a vaginal plug.

The female receiving embryo may be of natural ovulation, or may be administered luteinizing hormone-releasing hormone (generally LHRH) or an analog thereof prior to mating with the vasectomized (ligated) male. Alternatively, those having induced fertility may be used. Examples of LHR H analogs include [3,5-Dil-Tyr ⁵ ] -LH-RH, [Gin ⁸ ] -LH-RH, [D-Ala ⁶ ]- LH-RH, [des-Gly ¹⁰ ] -LH-RH, [D-His (Bzl) ⁶ ] -LH-RH and their Ethylamides. The dose of LHRH or an analog thereof and the timing of mating with a male non-human mammal after its administration vary depending on the type of non-human mammal. For example, when the non-human mammal is a mouse (preferably an ICR mouse or the like), it is usually preferable to cross the mouse with a male mouse about 4 days after administration of LHRH or an analog thereof. Alternatively, the dose of the analog is usually about 10 to 60 g / individual, preferably about 40 μg Z individual.

Normally, embryos are transferred to the female uterus for embryos after the morula embryo stage, or to the fallopian tubes if they are earlier (for example, 1- to 8-cell stage embryos). As the female for embryo reception, one that has passed a certain number of days from pseudopregnancy according to the stage of development of the transplanted embryo is used as appropriate. For example, in the case of a mouse, a female mouse about 0.5 days after pseudopregnancy is preferable to transfer a 2-cell embryo, and a female mouse about 2.5 days after pseudopregnancy is preferable to transfer a blastocyst stage embryo . After anesthetizing a female to receive embryos (preferably using Avertin, etc.), incisions are made to extract the ovaries, and embryos (approximately 5 to approximately 10) suspended in an embryo culture medium are used for embryo transfer Inject into the abdominal cavity of the fallopian tube or near the fallopian tube junction in the uterine horn using a pipette.

If the transferred embryo is successfully implanted and the recipient female becomes pregnant, a non-human mammal can be obtained by spontaneous delivery or cesarean section. Spontaneously delivered embryonated females may be allowed to continue nursing as they are. In the case of delivery by cesarean section, the offspring are separately prepared nursing females (for example, in the case of mice, they are usually bred by the females Preferably, an ICR female mouse, etc.) can be used for suckling.

Introduction of the gene encoding exogenous HI7T213 at the fertilized egg cell stage ensures that the transgene is present in all germline and somatic cells of the subject non-human mammal. Whether or not the transgene is integrated into the chromosomal DNA can be determined by, for example, screening chromosomal DNA separated and extracted from the tail of the offspring by Southern hybridization or PCR. The presence of the gene encoding exogenous HI7T213 in the germline cells of the offspring non-human mammal (F.) obtained as described above confirms that the progeny (all F animals) It means that the gene encoding exogenous HI7T213 is present in all germline and somatic cells. Usually F. Animals are obtained as heterozygotes having the transgene on only one of the homologous chromosomes. Also individual F. Individuals are inserted randomly on different chromosomes, unless by homologous recombination. To obtain a homozygote having a gene encoding exogenous HI 7T213 on both homologous chromosomes, F. et al. An animal can be produced by crossing an animal with a non-transgenic animal, and then heterozygous siblings having a transgene on only one of the homologous chromosomes can be crossed. If only the transgene is incorporated into 1 locus, 1 da 4 of the resulting F ₂ animal is homozygous.

In another preferred embodiment, the expression vector containing the gene encoding exogenous HI7T213 is a non-human mammalian embryonic stem cell of interest by a known gene transfer method such as electroporation. (ES cells).

ES cells are cells that are derived from the inner cell mass (ICM) of a fertilized egg at the blastocyst stage and can be cultured and maintained in vitro in an undifferentiated state. ICM cells are by nature the cells that form the embryo body and are the stem cells that underlie all tissues, including germ cells. As the ES cell, a cell line that has already been established may be used, or a newly established cell line may be used according to the method of Evans and Kaufman (Nature, Vol. 292, p. 154, 1981). For example, in the case of mouse ES cells, ES cells derived from mouse 129 are generally used today, but the immunological background is not clear, so an alternative pure immunological system is used. For the purpose of obtaining ES cells with a clear genetic background, for example, BDFi mice (C57BLZ6 mice and BDFi mice (C57BL / 6 mice) in which the number of eggs collected was improved by crossing with DBA / 2 ES cells established from F of C57BL / 6 and DBA / 2 can also be used favorably.BD mice have the advantages of high number of eggs collected and robust eggs, as well as the advantages of C57B. Since LZ6 mice are used as background, the ES cells derived from them can be backcrossed with C57BL / 6 mice to generate C57BLBZ6 mice when creating disease model mice. It can be used advantageously in that it is possible.

Preparation of ES cells can be performed, for example, as follows. When using a female non-human mammal after mating [for example, a mouse (preferably an inbred mouse such as C57BL / 6J (B6), F of B6 with another inbred strain, etc.) Female mice of about 8 to about 10 weeks of age (about 3.5 days of pregnancy) that are bred with male mice of about 2 months or older are preferred. The blastocyst stage is collected from the uterus of the blastocyst (or the early embryo before the morula stage is collected from the fallopian tube, and the blastocyst stage Cultivated on a layer of suitable feeder cells (eg, in the case of mice, primary fibroblasts prepared from mouse embryos or a known STo fibroblast cell line), blastocysts Some of the cells collect to form an ICM that differentiates into future embryos. The inner cell mass is treated with trypsin to dissociate single cells, maintain appropriate cell density, and repeat dissociation and passage while exchanging the medium to obtain ES cells.

Although either male or female ES cells can be used, male ES cells are generally more convenient for producing germ-line chimeras. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor. An example of a method for determining the sex of ES cells is a method of detecting a gene in the sex-determining region on the Y chromosome by PCR using a PCR method. Using this method, conventionally, for example G-banding method, it requires about 1 0 ⁶ cells for karyotype analysis, since requires only one colony extent of ES cell number (about 50) However, the primary selection of ES cells in the early stage of culture can be performed by gender discrimination, and the early selection of male cells can greatly reduce the labor in the early stage of culture.

The second selection can be performed by, for example, confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, if it is difficult due to physical manipulations when establishing a cell line, normal cells (for example, It is preferable to recombine the mouse into a cell having 2 n = 40 chromosomes.

The ES cell line obtained in this way must be carefully subcultured to maintain the properties of undifferentiated stem cells. For example, on a suitable feeder cell such as STO fibroblast, in a carbon dioxide incubator (preferably 5%) in the presence of LIF (1-10000 OU / ml) known as a differentiation inhibitor. Cultivate at about 37 ° C in CO 2/95% air or 5% oxygen Z 5% CO 2 90% air). When subculturing, for example, trypsin / EDTA solution (usually 0% 00 1 to 0.5% trypsin / 0.1-5mM EDTA, preferably about 0.1% tryp ImM EDTA) A method of seeding on the vesicle is used. Such passage is usually performed every 1 to 3 days. At this time, cells are observed. If morphologically abnormal cells are found, it is desirable to discard the cultured cells.

ES cells can be cultured in monolayers at high densities or in suspension cultures to form cell clumps under appropriate conditions to produce various types of cells such as parietal, visceral, and cardiac muscles. (MJ Evans and Μ

Kaufman, Nature, 292, 154, 1981; GR Martin, Proc. Natl. Acad. Sci. USA, 78, 7634, 1981; TC Doetschman et al., Journal of embryology and experimental morphology ^ 87 Vol. 27, 1985], exogenous HI 7 T 2 13 -expressing non-human mammals obtained by differentiating ES cells into which the gene encoding the exogenous HI 7 T 2 13 of the present invention has been introduced. Cells are useful in cell biology studies of exogenous HI7T2113 in vitro.

For gene transfer into ES cells, calcium phosphate coprecipitation, electroporation, ribofusion, retrovirus infection, coagulation, microinjection (microinjection), gene gun (particle gun), DEAE —Either the dextran method or the like can be used, but the electroporation method is generally selected because it can easily treat a large number of cells. Electroporation may be performed under the same conditions used for gene transfer into normal animal cells. 1 0 ^6-1 0 ⁸ was suspended in the culture medium so that the cells / m 1 were transferred to the queue Beck DOO, exogenous HI 7 T 2 1 3 1 0~ 1 0 a vector comprising DNA encoding 0 mu It can be carried out by adding grease and applying an electric pulse of 200 to 600 V / cm.

ES cells into which the transgene has been incorporated can be screened by Southern hybridization or PCR for chromosomal DNA isolated and extracted from a corneal knee obtained by culturing a single cell on a single feeder cell. However, the greatest advantage of the transgenic system using ES cells is that the transformants can be selected at the cell level using the expression of drug-resistance gene and reporter gene as indices. . Therefore, the transfer vector used here is exogenous HI 7 T 21 In addition to the expression cassette containing the gene encoding 3, a drug resistance gene (eg, neomycin phosphotransferase II (npt II) gene, hygromycin phosphotransferase (hpt) gene, etc.) and a reporter gene (eg, j3-galactosidase) It is desirable to further include a selection marker gene such as (lacZ) gene, chloramphenicol acetyltransferase (cat) gene and the like. For example, when a vector containing the npt II gene is used as a selectable marker gene, ES cells after the gene transfer treatment are cultured in a medium containing a neomycin antibiotic such as G418, and resistant colonies that have emerged are identified. After transferring to each culture plate and repeating trypsinization and medium exchange, leave a part for cultivation, and use PCR or Southern hybridization to confirm the presence of the transgene.

When ES cells in which integration of the transgene has been confirmed are returned into an embryo derived from a non-human mammal of the same species, the ES cell is integrated into the ICM of the host embryo to form a chimeric embryo. By transplanting this into a foster parent (female for embryo reception) and continuing its development, a chimeric transgenic animal can be obtained. If ES cells in chimeric animals contribute to the formation of primordial germ cells that differentiate into eggs and sperm in the future, a germline chimera will be obtained, and by crossing them, the transgene is genetically fixed. The resulting transgenic non-human mammal can be produced.

Methods for producing chimeric embryos include a method in which early embryos up to the morula stage are adhered and assembled (assembly chimera method), and a method in which cells are microinjected into the blastocyst blastocyst (injection chimera method) Although the latter method has been widely used in the production of chimeric embryos using ES cells, recently, there has been proposed a method for producing an assembled chimera by injecting ES cells into the zona pellucida of an 8-cell embryo. As a method that does not require a micromanipulator and is easy to operate, a method of producing an aggregate chimera by co-culturing and aggregating an ES cell mass and an 8-cell stage embryo from which the zona pellucida has been removed has been performed.

In any case, the host embryo can be collected in the same manner from a non-human mammal that can be used as a female for egg collection in transferring a gene into a fertilized egg. In order to be able to determine the contribution of ES cells by coat color (coat color), the host cells were derived from mice of a different line from the ES cell origin. Preferably, the embryo is collected. For example, if ES cells are derived from a 1229 mouse (hair color: Agouchi), use C57BL / 6 mouse (hair color: black) or ICR mouse (hair color: albino) as a female for egg collection. If the ES cells are derived from C57B / 6 or D mouse (hair color: black) or TT2 cells (F of C57B / 6 and CBA, (hair color: Agouti)), rub eggs ICR mice and BALB / c mice (hair color: albino) can be used as female animals.

In addition, since the ability to form a germline chimera greatly depends on the combination of an ES cell and a host embryo, it is more preferable to select a combination having a high ability to form a germline chimera. For example, in the case of mice, it is preferable to use host embryos derived from the C57B / 6 gun for ES cells derived from the 129 line, and to use BA embryos for the ES cells derived from the C57BZ6 line. Host embryos derived from the LB / c strain are preferred.

The female mouse for egg collection is preferably about 4-6 weeks of age, and the male mouse for mating is preferably about 2 to about 8 months of the same strain. Mating may be by natural mating, but is preferably performed after administration of gonadotropin (follicle-stimulating hormone, then luteinizing hormone) to induce superovulation.

In the case of the blastocyst injection method, blastocyst stage embryos (for mice, for example, about 3.5 days after mating) are collected from the uterus of a female for egg collection (or the early embryos before the morula embryo stage are collected from the oviduct). After harvesting, the cells may be cultured in the above-mentioned embryo culture medium until the blastocyst stage), and D encoding the exogenous HI7T213 in the blastocyst using a micromanipulator. After injecting ES cells (about 10 to about 15 cells) into which NA has been introduced, the cells are transplanted into the uterus of a pseudopregnant female nonhuman mammal for embryo. A non-human mammal that can be used as a female for embryo reception in gene transfer into a fertilized egg can be used as the non-human mammal for embryo reception.

In the case of the co-culture method, embryos at the 8-cell stage and morula (eg, about 2.5 days after mating in mice) are collected from the oviduct and uterus of the female for exploration (or before the 8-cell stage). After harvesting the early embryo from the oviduct, it may be cultured up to the 8-cell stage or the morula stage in the embryo culture medium described above.) After dissolving the zona pellucida in acidic Tyrode's solution, add mineral oil. The ES cell mass (about 10 to about 15 cells) into which exogenous HI7T213-encoding DNA has been introduced is placed in microdrops of the layered embryo culture medium. Co-culture overnight with 8-cell or morula embryos (preferably 2). The obtained morula or blastocyst is transplanted into the uterus of a female non-human mammal for embryo reception in the same manner as described above.

If the transferred embryo is successfully implanted and the recipient female becomes pregnant, a chimeric non-human mammal can be obtained by spontaneous delivery or cesarean section. Breeding females that have spontaneously delivered may be allowed to continue nursing as they are. In the case of delivery by cesarean section, offspring are transferred to separately prepared nursing females (normally mated and delivered female non-human mammals). It can be suckled.

For selection of germline chimeras, first, if the sex of ES cells is previously determined, select chimeric mice of the same sex as the ES cells (male ES cells are usually used, so male chimeric mice are selected). Then, chimeric mice (for example, 50% or more) with a high ES cell contribution ratio are selected based on the phenotype such as coat color. For example, in the case of chimeric mice obtained from chimeric embryos of D3 cells, which are male ES cells derived from mouse line 129, and host embryos derived from C57B / 6 mice, the proportion of the hair color of Agouti is high. Preferably, male mice are selected. Confirmation as to whether the selected chimeric non-human mammal is a germline chimera can be made based on the phenotype of the F animal obtained by crossing with a homologous animal of an appropriate strain. For example, in the case of the above chimeric mouse, since agooch is dominant to black, when crossed with a female C57B / 6 mouse, the coat color obtained when the selected male mouse is a germline chimera is Gooch.

A germline chimeric non-human mammal (founder) into which a gene encoding exogenous HI7T213 obtained as described above has been introduced usually has a transgene only on one of homologous chromosomes. Obtained as heterozygotes. In addition, individual finders are randomly inserted on different chromosomes unless homologous recombination is performed. In order to obtain a homozygote having a gene encoding exogenous HI7T213 on both homologous chromosomes, a heterozygote having a transgene on only one of the homologous chromosomes among the animals obtained as described above is required. All that is required is to cross the siblings of the zygote. The selection of heterozygotes can be carried out, for example, by screening chromosomal DNA separated and extracted from the tail of an animal by Southern hybridization or PCR. Obtained if the transgene is integrated at only one locus F ₂ animals 1/4 is homozygous.

The transgenic animal of the present invention can express the endogenous HI 7T 213 as long as the expression level of the exogenous HI 7T 213 is secured to the extent that the effect of the test substance on the exogenous HI 7 T 213 can be quantitatively measured. There is no particular limitation on. However, when the transgenic animal of the present invention is used to evaluate a drug that can act not only on exogenous HI7T213 but also on endogenous HI7T213, the expression of endogenous HI7T213 is inactive. Is desirable. The transgenic animal of the present invention in which the expression of endogenous HI7T213 has been inactivated can be obtained by a known method (for example, Lee SS et al., Mol. Cell. Biol., Vol. 15, p. 3012, 1995). The HI7T213 gene is knocked out, or the HI7T213 knockout animal-derived early embryo or ES cell produced from the ES cell according to the method described above is introduced into the ES cell according to the method described above. It can be obtained by introducing a gene encoding sex HI7T213. As a specific means of knocking out the HI7T213 gene, the HI7T213 gene derived from the target non-human mammal is isolated according to a conventional method, and, for example, another DNA fragment (e.g., neomycin The ability to disrupt exon functions by inserting a resistance gene, a drug resistance gene such as a hygromycin resistance gene, a 1 ac Z gene, a reporter gene such as a cat gene, etc. (in this case, as described above) The integration of the gene can be selected using drug resistance or reporter gene expression as an index), and all or part of the HI7T213 gene is cut out using the Cre-1o XP system or the F1p-frt system, and Delete the gene, insert a stop codon into the protein coding region to disable complete protein translation, or terminate gene transcription into the transcribed region DNA strand with a DNA sequence constructed to insert a DNA sequence (e.g., a poly-A addition signal) to disable complete niRNA synthesis, thereby inactivating the gene. (Hereinafter, abbreviated as targeting vector) is preferably incorporated into the HI7T213 locus of the target non-human mammal by homologous recombination.

Usually, genetic recombination in mammals is largely heterologous, and the introduced DNA is inserted randomly at any position on the chromosome. Therefore, drug resistance and Depending on the selection, such as detecting the expression of the reporter gene, it is not possible to efficiently select only the clones targeted to the endogenous HI7T213 gene targeted by homologous recombination. For all clones, the integration site must be confirmed by Southern method or PCR method. Therefore, if a simple herpesvirus-derived thymidine kinase (HSV-tk) gene that confers ganciclovir sensitivity is ligated to the outside of the region homologous to the target sequence of the targeting vector, the vector can be ligated. Randomly inserted cells cannot grow on a ganciclovir-containing medium because they have the HSV-tk gene, but cells targeted to the endogenous HI7T2l3 locus by homologous recombination have the HSV-tk gene. , It is ganciclovir resistant and is selected. Alternatively, if, for example, a diphtheria toxin gene is ligated instead of the HSV-tk gene, cells into which the vector has been randomly inserted will be killed by the toxin produced by the vector itself. You can also choose your body.

Alternatively, the transgenic animal of the present invention in which the expression of endogenous HI7T213 is inactivated is transformed into a DNA encoding the exogenous HI7T213 gene by gene targeting using homologous recombination. A knock-in animal in which the sex HI7T213 gene has been substituted may be used.

Knock-in animals can be prepared according to a method basically similar to that of knockout animals. For example, the exon of the HI7T213 gene derived from the target non-human mammal is excised using an appropriate restriction enzyme, and a corresponding region of the exogenous HI7T213 gene is inserted instead. A targeting vector containing DNA obtained by the above method is introduced into ES cells derived from a target non-human mammal according to the above-described method, and introduced into the endogenous HI7T213 locus of the animal by homologous recombination. An ES cell clone in which a gene encoding the sex HI7T2113 is integrated may be selected. Clone selection can also be performed using the PCR method or the Southern method. For example, a positive selection marker gene such as a neomycin resistance gene is used in the untranslated region of the targeting vector, such as the HI7T213 gene. Insertion and insertion of a negative selection marker gene such as the HSV-tk gene or diphtheria toxin gene outside the region homologous to the target sequence will allow selection of homologous recombinants using drug resistance as an index. it can.

In addition, since the expression of exogenous HI7T2 13 into which the marker gene for positive selection has been introduced may be hindered, use a targeting vector having a 1 oxP sequence or frt sequence at both ends of the marker gene for positive selection. It is preferable to excise the marker gene for positive selection by allowing Cre or Flp recombinase or a recombinase expression vector (eg, an adenovirus vector) to act at an appropriate time after the selection of the homologous recombinant. . Alternatively, instead of using the Cre-1o XP system or the F1-frt system, sequences homologous to the target sequence are repeatedly arranged in the same direction at both ends of the positive selection gene, and the The marker gene for positive selection may be cut out by using the gene recombination in the above.

In addition, the transgenic animal of the present invention may be a disease model having one or more other genetic alterations that cause the same or similar pathology as a disease in which the activity of HI7T213 is involved.

A “disease involving the regulation of HI 7 T 2 13 activity” includes not only diseases caused by abnormal HI 7 T 2 13 activity or resulting in abnormal HI 7 T 2 13 activity, but also However, it should be understood as a concept including a disease in which a prophylactic and / or therapeutic effect can be obtained by modulating HI7T213 activity. For example, HI7T213 activates to prevent and prevent or Z or treatable diseases such as wounds, spinal cord injury or analgesia are prevented and / or inhibited by inhibiting HI7T213. Alternatively, treatable diseases include cancer, kidney damage, cataract, dermatitis, chronic pain or hyperalgesia, respectively.

"Other genetic modification" means a genetic modification other than the introduction of a gene encoding exogenous HI7T213, such as a spontaneous disease model animal in which an endogenous gene has been modified by spontaneous mutation, Transgenic animals into which other genes have been further introduced, knockout animals in which endogenous genes have been inactivated (gene disruption by insertion mutation, etc., and introduction of DNA encoding antisense DNA or neutralizing antibody) (Includes transgenic animals whose gene expression has been reduced to an undetectable or negligible level.) And so on. Therefore, the modification of the endogenous HI7T213 gene also falls under "other genetic modifications" in the present invention.

Examples of the “disease model having one or more other genetic alterations that cause the same or similar pathology as a disease associated with HI7T213 activity regulation” include, for example, a hyperlipidemia or arteriosclerosis model. WHHL ゥ Egret (having a mutation in low-density lipoprotein receptor (LD LR); Watanabe Y., Atherosclerosis, Vol. 36, pp. 261 (1980)), SHLM (spontaneous mouse with apoE deficient mutation; Matsushima Y Mamm. Genome, Vol. 10, p. 352, 1999), LD LR knockout mouse (Ishibashi S. et al., J. Clin. Invest., Vol. 92, p. 883, 1993), apo E knockout mouse (Piedrahita JA et al., Proc. Natl. Acad. Sci. USA, Vol. 89, p. 4471, 1992), human apoB-introduced mouse (Callow MJ et al., Proc. Natl. Acad. Sci. USA) , Vol. 91, pp. 2130, 1994), etc., as CD55 / CD59 dub as a model for ischemic heart disease. Transgenic mice (Co-painted PJ ". Et al., Xenotransplantation, Vol. 5, p. 18490, 1998) and others have reported CuZn-superoxide dismutase transgenic mice as a model for cerebral hemorrhage or cerebral infarction. Saito A. et al., Stroke, Vol. 2, p. 1652, 2001), etc., described an interleukin 1 transgenic mouse (Groves RW et al., Proc. Natl. Acad. Sci. USA Vol. 92, 11874) as a dermatitis model. P. 1995) and CD19 knockout mouse (Spielman J. et al., Immunity, Vol. 3, p. 39, 1995) as an immunodeficiency model, and SPC2 knockout mouse (Furuta M. et al.) As a hypoglycemic model. Natl. Acad. Sci. USA, Vol. 94, 6664, 1997) and the like, ob / ob mice (Herberg L. and Coleman D., Metabolism, 26 Vol. 59, 1977), KK Mouse (Nakamura M. and Yamada K., Diabetologia) , Vol.3, p.212, p.1967), FLS mouse (Soga M. et al., Lab. Anim. Sci., Vol.49, p.269, 1999), NOD mouse (Makino S. , Exp. Anim., Vol. 29, p. 1, 1980), BB rat (Crisa L. et al., Diabetes Metab. Rev., vol. 8, p. 4, 1992), obZob mouse, db / db mouse (Hummel L. et al., Science, Vol. 153, p. 1127, 1966), KK mouse, GK rat (Goto Y. et al., Tohoku J. Exp. Med., Vol. 119, p. 85, 1976), Zucker fatty rat (Zucker LM et al., Ann. NY Acad. Sci., Vol. 131, p. 447, 1965), OLETF rat (Kawano K. et al., Diabetes, 41 Certificates, 142 page ^2, 199 ² years) and the like, ob / ob mice as a model of obesity, db / db mice, KK mice, Zucker fatty rats, OLETF rats and the like, Mutant amyloid precursor protein gene transgenic mice, etc. were used as Alzheimer's disease models, and beta SAD (beta S-Antilles-D Punjab) transgenic mice (Trudel M. et al., EMB0J, No. 10 Pp. 3157, 1991) and Steroidogenic factor 1 knockout mouse (Zhao Shira, Development, Vol. 128, 147, 2001) as a gonadal disorder model, and p53 knockout mouse (Kemp CJ

Molecular Carcinogenesis, Vol. 12, p. 132, 1995), etc., and c-neu transgenic mice (Rao GN et al., Breast Cancer Res Treat, Vol. 48, p. 265, 1998) as breast cancer models, etc. As a model of membrane inflammation

perforin / Fas-ligand double knockout mouse (Spielman J. et al., J Immunol., Vol. 161, p. 7063, 1998) and the like.

These non-human mammals with “other genetic modification” disease models can be purchased from, for example, the Jackson Laboratory in the United States, or can be easily created using well-known genetic modification techniques. it can.

The non-human mammal of the present invention may be the same or different from `` one or more other genetic modifications that cause the same or similar pathology as a disease associated with HI7T213 activity regulation ''. It may have been subjected to non-genetic processing that can create other disease models. “Non-transgenic treatment” means a treatment that does not cause genetic modification in a target non-human mammal. Examples of such processing include high fat diet loading processing, glucose loading processing, starvation processing, vascular ligation Z reperfusion, and the like.

A non-human mammal into which a gene encoding exogenous HI7T213 has been transduced, causing one or more other The method for introducing the genetic modification is not particularly limited.Examples include a non-human mammal into which a gene encoding exogenous HI7T213 has been introduced, and a disease involving the regulation of HI7T213 activity. One or more other that cause the same or similar condition as A method of crossing with a non-human mammal of the same disease model having a genetic modification; having one or more other genetic modifications that produce the same or similar pathology as a disease involving the regulation of HI7T213 activity A method for obtaining a transgenic animal by introducing a gene encoding exogenous HI7T213 into the early embryonic ES cells of a disease model non-human mammal by the method described above; exogenous HI7T213 The same or similar diseases as those in which the HI7T213 activity regulation is involved can be added to the early embryonic ES cells of a non-human mammal into which the gene encoding A method of introducing one or more other genetic modifications that cause the above-mentioned pathological condition. In addition, when one or more other genetic modifications that cause the same or similar pathology as a disease involving the regulation of HI7T213 activity are caused by the introduction of a foreign gene or a dominant mutant gene, wild-type non-human The transgenic animal may be obtained by simultaneously or sequentially introducing the exogenous gene and the gene encoding exogenous HI7T213 into mammalian early ES cells. In addition, if one or more other genetic alterations that result in the same or a similar condition as the disease in which HI7T213 activity modulation is involved are due to endogenous gene disruption, exogenous HI7T2 The gene encoding 213 may be designed so that it can be targeted to an endogenous gene to be destroyed, and introduced into ES cells of a wild-type non-human mammal. In this case, as the targeting vector, those exemplified for the above-described production of knock-in animals can be preferably used, except that the endogenous HI7T213 gene is replaced with the endogenous gene to be destroyed. A non-human mammal into which a gene encoding exogenous HI7T213 has been introduced, and one or more other genes that cause the same or similar pathology as a disease involving the regulation of HI7T213 activity When crossing with a non-human mammal of the same type having a modification, it is desirable to cross homozygotes. For example, both genes obtained by crossing a homozygote in which the gene encoding exogenous HI7T213 is integrated at one locus and an apoE homo-deficient hyperlipidemia (arteriosclerosis) model About Hetero. This together 1/1 6 F ₂ individuals obtained by sib mating is the exogenous HI 7 T 2 1 3 Homo introduction · apo E-deficient homozygous.

Since the non-human mammal of the present invention obtained as described above expresses exogenous HI 7 T 2 13 in addition to (or instead of) endogenous HI 7 T 2 13, Exogenous that has agonist or antagonist activity against sex HI7T213 but has no activity against endogenous ΗI7Τ213 , So that its efficacy can be evaluated in vivo.

When the non-human mammal of the present invention overexpresses the exogenous ΗI7Τ213 gene, it has at least one of the following phenotypes.

(1) Cataract or rough hair has developed.

(2)-Transient skin rash and desquamation are observed.

(3) In the eyeball, melting / degeneration of lens fibers is observed. Abnormal crystal fibers are observed in the eyeball, including stratification of the lens epithelium at the anterior pole of the lens. That is, they have developed cataract.

(4) There is evidence of basophilia in the kidney. Cell damage in kidney. It has high tubular cell growth promoting activity.

(5) Epidermal thickening and parakeratosis are observed in young skin.

(6) PCNA-positive cells, which are proliferation-related antigens, are found in the basal layer of the epidermis and near the pores. '

(7) An increase in keratin 6 gene-expressing cells and an increase in PCNA-positive cells are observed. Cell proliferation promoting activity is enhanced.

(8) Abnormal epidermal differentiation accompanied by enhanced expression of keratin 14, keratin 10, and oral ricklin is observed.

(9) Epidermal free nerve endings are abundant in Keratin 6-positive sites.

(10) Expression of a group of neurotrophic factors at abnormal epidermal sites is enhanced.

(1 1) Differentiation abnormalities associated with reproductive activity.

Since the non-human mammal of the present invention has the above-mentioned very unique characteristics, it has the following useful uses.

(1) Since the exogenous HI7T213 gene is highly expressed in the non-human mammal of the present invention, it can be used for evaluation of HI7T213agonist or HI7T213angonist.

That is, the present invention (i) HI characterized in that a test substance is applied to the non-human mammal of the present invention or a part thereof and assayed for HI 7 T 2 13 agonist activity or HI 7 T 2 13 antagonist activity. 7 T2 13 agonist or HI 7 T 2 13 antagonist screening method,

(ii) applying a test substance to a non-human mammal of the present invention or a part thereof, and testing an effect of improving a disease such as a wound, spinal cord injury or analgesia or an effect of regenerating the kidney. And a method of screening HI7T213agonist used for prevention and / or treatment of the above diseases.

The candidate compound of the HI7T213agonist can be selected, for example, by a binding experiment with HI7T213.

Specifically, in the screening method of the present invention, a test substance is administered to the non-human mammal of the present invention. The test substance may be a known synthetic compound, peptide, protein, DNA library, or the like, or, for example, a tissue extract of a mammal (eg, mouse, rat, pig, pig, sheep, monkey, human, etc.). Cell culture supernatant is used.

The HI7T2 13 agonist activity includes a ameliorating effect on diseases such as wounding, spinal cord injury or analgesia, or a renal regeneration effect.

Fluctuations in the above-mentioned effects due to HI7T213 inherently possessed by the non-human mammal of the present invention can be ignored.

Specifically, in the screening method of the present invention, a test substance is administered after the non-human mammal of the present invention is damaged or the spinal cord is damaged. Then, compared to the case where the test substance is not administered, the symptoms such as wound and spinal cord injury when the test substance is administered are about 10% or more, preferably about 30% or more, more preferably about 50%. In the case of improvement as described above, the test substance can be selected as a substance having a preventive and / or therapeutic effect on the above-mentioned diseases.

On the other hand, HI7T213 antagonist activity has an effect of improving diseases such as cancer, renal disorder, cataract, dermatitis, chronic pain and hyperalgesia.

Specifically, in the screening method of the present invention, a test substance is administered to the non-human mammal of the present invention after the above-mentioned disease has developed. And when the test substance is not administered Cancer, kidney damage, cataract, dermatitis, chronic pain when the test substance is administered

When symptoms such as hyperalgesia are improved by about 10% or more, preferably about 30% or more, more preferably about 50% or more, the test substance is prevented and / or treated for the above-mentioned diseases. It can be selected as a substance having an effect.

The HI7T213 agonist selected in this way can be used as a safe and low-toxicity preventive and / or therapeutic drug for wounds, spinal cord injury, analgesia and other diseases, or as a regenerative drug. it can.

On the other hand, the selected HI7T2113 antagonist can be used as a safe and low toxic prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, etc. .

The HI7T213agonist or HI7T213 antagonist may be in the form of a salt, and the HI7T213agonist or HI7T213 antagonist may be a physiological salt. Salts with acids (eg, inorganic acids, etc.) and bases (eg, organic acids, etc.) are used, and physiologically acceptable acid addition salts are particularly preferred. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.). The selected HI7T213 agonist or HI7T213 antagonist can be administered, for example, orally or as a sugar-coated tablet, capsule, elixir, Mike-mouth capsule, etc. Alternatively, it can be used parenterally in the form of an injectable preparation such as a sterile solution with other pharmaceutically acceptable liquids or a suspension. For example, the use of a substance selected as a prophylactic and / or Z-therapeutic agent in a generally accepted formulation with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, etc. It can be manufactured by mixing in the required unit dosage form. The amount of active ingredient in these preparations is such that a suitable dose in the specified range can be obtained.

Examples of additives that can be incorporated into tablets, capsules, etc. include binders such as gelatin, corn starch, tragacanth, gum arabic, and crystalline cells. Excipients such as loin, leavening agents such as corn starch, gelatin, alginic acid, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharine, peppermint, cocoa oil or cherry. Such flavoring agents are used. When the unit dosage form is a capsule, a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. it can.

Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mantol, sodium chloride, etc.). Solubilizers, for example, alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol, etc.), nonionic surfactants (eg, Polysorbate 80 ^™ , HCO-50, etc.) You may use together with. Examples of the oily liquid include sesame oil and soybean oil, which may be used in combination with a dissolution aid such as benzyl benzoate or benzyl alcohol. Also, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, proforce hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.) , A preservative (eg, benzyl alcohol, phenol, etc.), an antioxidant and the like. The prepared injection is usually filled in an appropriate ampoule.

When the selected substance is DNA, the DNA may be used alone or in a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. Or warm-blooded animals. The DNA can be administered as it is or in the form of a formulation with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered by a catheter such as a gene gun or a hydrogel catheter.

The preparations obtained in this way are safe and of low toxicity, for example, from human or non-human warm-blooded animals (e.g., rats, mice, guinea pigs, egrets, birds, sheep, sheep, pus, , Dogs, cats, dogs, monkeys, etc.) You.

The dose of the selected substance may vary depending on the target disease, the subject of administration, the route of administration, and the like. For example, in the case of oral administration of HI7T2 13 agonist for the purpose of treating wounds, generally the adult ( (With a body weight of 6 O kg), the substance is administered from about 0.1 to 10 mg per day, preferably from about 1.0 to 5 mg, more preferably from about 1.0 to 20 mg. In the case of parenteral administration, the single dose of the substance may vary depending on the target of administration, the target disease, etc., for example, for the treatment of wounds in the form of injections for adults (with a body weight of 6 O kg). When administered, about 0.01 to 30 mg, preferably about 0.1 to 20 mg, and more preferably about 0.1 to 1 Omg of the substance is injected into the affected area per day It is expedient to administer the drug. In the case of other animals, the dose can be administered per 60 kg body weight. (2) In addition, the non-human mammal of the present invention has a high expression of the exogenous HI7T213 gene, and has the above-mentioned phenotype or cancer, renal disorder, cataract, dermatitis, chronic pain. Pain and hyperalgesia may develop.

Therefore, the non-human mammal of the present invention can be used for evaluating the above phenotype-improving drug, the above-mentioned disease preventive drug or therapeutic drug.

That is, the present invention is characterized in that a test substance is applied to the non-human mammal of the present invention or a part thereof, and the phenotypic or disease ameliorating effect is assayed. Or, a method for screening a substance used for treatment is provided.

In the screening method of the present invention, when it is determined that administration of a test substance has an effect of improving the above phenotype or a disease such as cancer, renal disorder, cataract, dermatitis, chronic pain, or hyperalgesia ( For example, when the phenotype or disease is improved by about 10% or more, preferably about 30% or more, more preferably about 50% or more), The substance can be selected as a medicament for preventing and / or treating these diseases. '

The substance selected in the screening method of the present invention includes, for example, a HI7T213 antagonist, a substance inhibiting (suppressing) the expression of HI7T213, and a promoter activity of the HI7T213 promoter. Substances that inhibit (suppress). The selected substance can be sterile, for example, orally as tablets, capsules, elixirs or microcapsules, optionally coated with sugar, or with water or other pharmaceutically acceptable liquids. It can be used parenterally in the form of injections such as aqueous solutions or suspensions. For example, the use of a substance selected as a prophylactic and / or therapeutic drug with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, etc. It can be manufactured by mixing in the required unit dosage form. The amount of the active ingredient in these preparations is such that a suitable dosage in the specified range can be obtained.

Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc. Swelling agents such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry. When the unit dosage form is a capsule, a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. it can.

Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.). Agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, Polysorbate 80 ™, HCO-50), etc. You may use together. Oily liquids include, for example, sesame oil, soybean Oils and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, proforce hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.) , A preservative (eg, benzyl alcohol, phenol, etc.), an antioxidant and the like. The prepared injection is usually filled in an appropriate ampoule.

When the selected substance is DNA, the DNA is used alone or in a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, or the like. Alternatively, it can be administered to warm-blooded animals. The DNA can be administered as it is or in the form of a formulation with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and can be administered using a gene gun or a catheter such as a hydrogel catheter. The preparations obtained in this way are safe and have low toxicity, and are, for example, human or non-human warm-blooded animals (for example, rats, mice, guinea pigs, egrets, birds, sheep, pigs, pigs). , Dogs, cats, dogs, monkeys, etc.).

The dose of the selected substance may vary depending on the target disease, target, and route of administration. For example, when administered orally for the purpose of treating cataract, in general, for adults (with a body weight of 60 kg), About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the substance is administered per day. In the case of parenteral administration, the single dose of the substance may vary depending on the administration target, target disease, etc. For example, for the treatment of cataract, an adult in the form of an injection (with a body weight of 60 kg) If the substance is administered to the patient, about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg of the substance is injected into the affected area per day. It is expedient to administer the drug. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

Furthermore, the non-human mammal of the present invention can be used in an experiment for gene therapy of a patient with a HI7T213 gene abnormality.

The above-described transgenic mammal of the present invention is used as a cell source for tissue culture. It is also possible. Also, for example, the ability to directly analyze DNA or RNA in the tissue of the transgenic mouse of the present invention or the analysis of the protein expressed by the gene can be used to determine the relationship between the complex action of the nuclear receptor and the transcription factor. Can also be analyzed. Alternatively, culturing cells of a gene-bearing tissue by standard tissue culture techniques and using them to study the function of cells derived from tissues that are generally difficult to culture, such as cells forming adipose tissue. You can also. Further, by using the cells, for example, it is possible to select a drug that enhances the function of the cells. In addition, if there is a high expression cell line, it is possible to isolate and purify HI7T213 in a large amount, and to produce an antibody thereof.

The G protein-coupled receptor protein (hereinafter sometimes abbreviated as HI7T213) used in the present invention is represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. A receptor protein containing an amino acid sequence that is the same or substantially the same as the amino acid sequence to be used.

HI7T213 is, for example, a human non-human mammal (eg, a guinea pig, a rat, a mouse, a heron, a septa, a sheep, a pig, a monkey, etc.), and any cell (eg, a spleen cell). , Nerve cells, glial cells, kidney cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle cells, fat cells, immune cells (eg, macrophages, T Cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, bone cells, osteoblasts, osteoclasts, mammary gland Cells, hepatocytes or stromal cells, or their precursors, stem cells or cancer cells), blood cells, or any tissue where these cells are present, such as the brain, Each part of the brain (e.g., olfactory bulb, acrosomal nucleus, basal cerebral sphere, hippocampus, thalamus, hypothalamus, hypothalamus, cerebral cortex, medulla, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus , Brain stain, substantia nigra), spinal cord, pituitary, stomach, kidney, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels , Heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testes, testis, ovaries, placenta, uterus, bones, joints, skeletal muscle, etc. There may be.

Represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 Examples of the amino acid sequence substantially identical to the amino acid sequence include, for example, about 76% or more, preferably about 76% or more of the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. Is an amino acid sequence having a homology of 80% or more, more preferably about 90% or more, and still more preferably about 95% or more.

Examples of the protein having an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 according to the present invention include, for example, SEQ ID NO: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 5 A protein having substantially the same activity as the amino acid sequence represented by No. 7 is preferred.

Amino acid sequence homology was determined using the homology calculation algorithm NCB IB LAST (N at 1 ona 1 C enterfor Biotechnology 丄 nformation B sic Local Alignment Scan Tool) under the following conditions (expected Value = 10; gap allowed; matrix Β LOSUM62; filtering OFF). Examples of substantially the same activity include a ligand binding activity and a signal transduction activity. Substantially the same means that their activities are the same in nature. Therefore, the activities such as ligand binding activity and signal information transmission activity are equivalent (eg, about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 20 times). However, the quantitative factors such as the degree of activity and the molecular weight of the protein may be different.

The activities such as the ligand binding activity and the signal transduction activity can be measured according to known methods. For example, they can be measured according to the screening method described later.

The HI7T2113 includes: _a ) one or more (preferably, one or more) of the amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; About 30 amino acids, more preferably about 1-10 amino acids, still more preferably several (1-5) amino acids are deleted, b) SEQ ID NO: 1, SEQ ID NO: 3, sequence No. 5 or 1 to the amino acid sequence represented by SEQ ID NO: 7 Is an amino acid sequence to which two or more (preferably about 1 to 30, more preferably about 1 to 10, and more preferably several (1 to 5)) amino acids have been added; c) sequence 1 or 2 or more (preferably about 1 to 30, more preferably 1 to 10) in the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 A protein containing an amino acid sequence in which several (1 to 5) amino acids are substituted with other amino acids, or d) an amino acid sequence obtained by combining them, is also used.

In the present specification, HI 7 T 21 3. has an N-terminus (amino terminus) at the left end and a C-terminus (caprolactyl terminus) at the right end, according to the convention of peptide labeling. HI7T213, including HI7T213 containing the amino acid sequence represented by SEQ ID NO: 1, has a C-terminal carboxyl group (one COOH), carboxylate (one COO, one amide) one CONH ₂₎ or, as R in the ester may be any ester (one COOR), for example, methyl, Echiru, n- propyl, CI- 6 alkyl group such Isopuropiru or n- heptyl, for example, Shikurobe pentyl, C 3- ₈ cycloalkyl groups such as cyclohexyl, for example, phenylene Honoré, C _{6 12} § Li one Honoré groups, such as single-naphthyl, for example, Benjinore, full of such phenethyl Eniru -C - ₂ alkyl C ₇ such as α- naphthyl one C _i-2 alkyl group such group or α- naphthylmethyl - ₁₄ other Ararukiru group, Pipa Roi Ruo Kishime used frequently as an oral ester Etc. Le group are used.

When HI7T213 has a carboxyl group (or carboxylate) at a position other than the C-terminus, HI7T213 of the present invention includes amidation or esterification of a lipoxyl group. . As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

In addition, the HI 7T 21 3, in the protein described above, Amino group protecting groups Mechio Nin residues of N-terminal (e.g., formyl group, etc. C ₆ Ashiru group such as C ₂ _ ₆ Al Kanoiru group such Asechiru ), The glutamyl group formed by cleavage of the N-terminus in vivo and pyroglutamine oxidation, the substituent on the side chain of the amino acid in the molecule (eg, 1 OH, 1 SH, amino acid) Group, imidazole group, Indole group, etc. Guanijino group) appropriate protecting groups (e.g., formyl group, C _2, such as § Se Chill - ₆ such as C _ ₆ Ashiru group such Arukanoiru group) those are protected by, a sugar chain bound Complex proteins such as so-called glycoproteins are also included.

Specific examples of the HI7213 of the present invention include, for example, human-derived HI7T213 comprising the amino acid sequence represented by SEQ ID NO: 1, and the amino acid represented by SEQ ID NO: 3 A human-derived HI7T213 comprising the sequence, a mouse-derived HI7T213 comprising the amino acid sequence represented by SEQ ID NO: 5, and a mouse-derived HI7T comprising the amino acid sequence represented by SEQ ID NO: 7 2 1 3 etc. are used. Among them, mouse-derived HI7T213 having the amino acid sequence represented by SEQ ID NO: 5 is a novel receptor protein.

The partial peptide of HI 7 T 2 13 (hereinafter sometimes abbreviated as partial peptide) may be any of the partial peptides of HI 7 T 2 13 described above. For example, among HI7T213 protein molecules, those which are exposed outside the cell membrane and have substantially the same receptor binding activity are used.

Specifically, the partial peptide of HI7T213 having the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 細胞 is a cell in hydrophobic plot analysis. It is a peptide containing a part that has been analyzed to be an outer region (hydrophilic site). Further, a peptide partially containing a hydrophobic (Hydrophobic) site can also be used. A peptide containing individual domains may be used, but a peptide containing a plurality of domains at the same time may be used. The number of amino acids of the partial peptide of the present invention is at least 20 or more, preferably 50 or more, more preferably 100 or more of the amino acid sequences constituting the receptor protein of the present invention. Peptides having a sequence are preferred. A substantially identical amino acid sequence has a homology of about 76% or more, preferably about 80% or more, more preferably about 90% or more, and even more preferably about 95% or more with these amino acid sequences. 1 shows the amino acid sequence of the protein.

Amino acid sequence homology is calculated using the same homology calculation algorithm NCBIB It can be calculated under the same conditions using LAST.

Here, “substantially the same receptor activity” has the same meaning as described above. The "substantially the same receptor activity" can be measured in the same manner as described above. Further, the partial peptide of the present invention has one or more (preferably about 1 to 10, more preferably several (1 to 5)) amino acids in the above amino acid sequence deleted. Or 1 or 2 or more (preferably, about 1 to 20, more preferably, about 1 to 10, and more preferably, several (1 to 5)) amino acids are added to the amino acid sequence. Or 1 or 2 or more (preferably about 1 to 10, more preferably several, more preferably about 1 to 5) amino acids in the amino acid sequence are replaced with other amino acids. May be.

In the partial peptide of the present invention, the C-terminus may be any of a hydroxyl group (one COOH), a carboxylate (one COO—), an amide (one CONH ₂ ) or an ester (one COOR). When the partial peptide of the present invention has a lipoxyl group (or carboxylate) at a position other than the C-terminus, the amide or esterified lipoxyl group is also included in the partial peptide of the present invention. It is. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

Furthermore, the partial peptide of the present invention has a N-terminal methionine residue whose amino group is protected by a protecting group, and a N-terminal side that is cleaved in vivo, as in the case of HI7T213 described above. Compounds such as those in which the generated daltamyl group is oxidized by pyroglutamine, those in which the substituent on the side chain of the amino acid in the molecule is protected by an appropriate protecting group, or those in which a sugar chain is bonded to a so-called glycopeptide. Beptides are also included.

Examples of the salt of the HI 7 T 2 13 or a partial peptide thereof of the present invention include a physiologically acceptable salt with an acid or a base, and a physiologically acceptable acid addition salt is particularly preferable. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid) Acids, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. The HI 7 T 2 13 or a salt thereof of the present invention can also be produced from the above-mentioned human mammalian cell or tissue by a known method for purifying a receptor protein. Alternatively, it can be produced by culturing a transformant containing a DNA encoding HI7T213 of the present invention described later. In addition, the protein can be produced according to the protein synthesis method described later or according to the method.

When producing from human mammalian tissues or cells, the human mammalian tissues or cells are homogenized, extracted with an acid, etc., and the resulting extract is subjected to reverse phase chromatography and ion exchange. Purification and isolation can be performed by combining chromatography such as chromatography.

For the synthesis of HI7T213 or its partial peptide or its salt or its amide derivative of the present invention, a commercially available resin for protein synthesis can be usually used. Examples of such a resin include chloromethyl resin, hydroxymethyl resin, benzylhydramine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, Hydroxymethylmethylphenylacetamide methyl resin, polyacrylamide resin, 4- (2 ', 4, dimethoxyphenoxyhydroxymethyl) phenoxy resin, 4- (2,, 4, -dimethoxyphenyl) Fmoc aminoethyl) phenoxy resin and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target protein according to various known condensation methods. At the end of the reaction, the protein is cleaved from the resin and, at the same time, various protecting groups are removed. Further, an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain the target protein or its amide.

Regarding the condensation of the above protected amino acids, various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. Examples of the carpoimides include DCC, N, N'-diisopropyl carpoimide, N-ethyl N, mono (3-dimethylaminoprolyl) carpoimide. For these activations, the protected amino acid may be added directly to the resin along with the racemization inhibitor additive (eg, HOBt, HOOBt), or the protected amino acid may be activated in advance as a symmetrical acid anhydride or HO Bt ester or HOOBt ester. Can be added to the resin.

As a solvent used for activation of the protected amino acid or condensation with the resin, It can be appropriately selected from solvents known to be usable for the condensation reaction. For example,

Acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylvirolidone, halogenated hydrocarbons such as methylene chloride and chloroform, trifluoroethanol, etc. Alcohols, sulphoxides such as dimethylsulfoxide, ethers such as pyridine, dioxane, tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate; The reaction temperature is appropriately selected from the range known to be usable for the protein bond formation reaction, and is usually selected from the range of about 120 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5- to 4-fold excess.Results of the test using the ninhydrin reaction If the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group.If sufficient condensation is not obtained even after repeating the reaction, acetic anhydride or Unreacted amino acids can be acetylated using acetylimidazole.

Examples of the protecting group for the amino group of the starting material include Z, Boc, tertiary pentoxycarbonyl compound, isobornyloxycanole compound, 4-methoxypentzinoxycarbonyl, C1Z, Br — Z, adamantyloxycarponyl, trifluorfluoroacetyl, phthaloynole, forminole, 2-nitrophenylenolesnorrephene27, diphenylphosphinoinoyl oil, Fmoc, etc. are used.

The carboxyl group can be, for example, alkyl esterified (for example, methyl, ethyl, propyl, pentinole, tertiary butynole, pentopene, hexinole, cycloheptyl, cyclooctyl, 2-adamantyl, etc. Branched or cyclic alkyl esterification), aralkyl esterification (e.g., benzyl ester, 4-trobenzizole ester, 4-methoxybenzino ester, 4-methyl benzyl ester, Benzhydryl esterification), phenacyl esterification, benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like.

The hydroxyl group of serine can be protected, for example, by esterification or etherification. Suitable groups for this esterification include, for example, Examples thereof include groups derived from carbonic acid, such as an aroyl group such as a lower alkanol group and a benzoyl group, a benzyloxycarbonyl group, and an ethoxycarbol group. Examples of a group suitable for etherification include a benzyl group, a tetrahydroviranyl group, and a t-butyl group.

Examples of protecting groups for Fuwenoru hydroxyl group of tyrosine, for _{example, B z 1, C l 2} - B zl, 2 _ nitrobenzyl, B r- Z, as a protecting group for imidazole histidines such tertiary heptyl is used, For example, Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc and the like are used.

Examples of the activated carbonyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) Phenol, cyanometinole alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimid, ester with HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric acid amide is used.

Methods for removing (eliminating) protecting groups include, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, hydrogen anhydride, methanesulfonic acid, and the like. Acid treatment with trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and sodium in liquid ammonia Reduction is also used. The elimination reaction by the above-mentioned acid treatment is generally carried out at a temperature of about 120 ° C to 40 ° C. It is effective to add a force-thione scavenger such as 1,4-butanedithiol or 1,2-ethanedithionole. In addition, the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tributofan is the above 1,1. In addition to deprotection by acid treatment in the presence of 2-ethanedithiol, 1,4-butanedithiol, etc., it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia, etc.

The protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means.

As another method for obtaining an amide form of a protein, for example, first, amidating and retaining the α-hydroxyl group of the amino acid at the terminal end of the amino acid, a peptide (protein) chain is attached to the amino group side. After elongation to the desired chain length, a protein in which only the protecting group of the amino group at the Ν-terminus of the peptide chain is removed and a protein in which only the protecting group of the carboxy group at the C-terminus is removed are produced. The condensation is carried out in the above-mentioned mixed solvent. Details of the condensation reaction are the same as described above. After purifying the protected protein obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude protein. This crude protein is purified by using various known purification means, and the main fraction is lyophilized to obtain an amide of the desired protein.

In order to obtain an ester of a protein, for example, after condensing the α-carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester, the desired protein can be obtained in the same manner as the amide of a protein. To obtain an ester form of

The partial peptide of ΗI 7 Τ213 of the present invention or a salt thereof can be prepared by a known peptide synthesis method or by cleaving HI 7T213 of the present invention with an appropriate peptide. Can be manufactured. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide is produced by condensing a partial peptide or amino acid capable of constituting HI7T213 of the present invention with the remaining portion, and removing the protecting group when the product has a protecting group. can do. Known condensation methods and elimination of protecting groups include, for example, the methods described in the following a) to e).

a) M. Bodanszky and MA 0ndetti, Peptide Synthesis (Peptide Synthesis), Interscience Publishers, New York (1966)

b) Schroeder and Luebke, The Peptide, Academic Press, New York (1965)

c) Nobuo Izumiya et al., Fundamentals and Experiments of Peptide Synthesis, Maruzen Co., Ltd. (1975) d) Haruaki Yajima and Shunpei Sakakibara, Biochemistry Laboratory 1, Protein Chemistry IV, 205, (1977)

e) Supervision of Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten Also, after the reaction, use a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, liquid chromatography, and recrystallization. The partial peptide of the present invention can be purified and isolated. When the partial peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when it is obtained by a salt, it can be converted to a free form by a known method. Can be.

The polynucleotide encoding the HI7T213 of the present invention includes any polynucleotide containing the above-described nucleotide sequence (DNA or RNA, preferably DNA) encoding the HI7T213 of the present invention. It may be something. The polynucleotide is RNA, such as DNA or mRNA, encoding HI7T213 of the present invention, and may be double-stranded or single-stranded. In the case of double-stranded, it may be double-stranded DNA, double-stranded RNA or DNA: RNA hybrid. In the case of a single strand, it may be a sense strand (that is, a coding strand) or an antisense strand (that is, a non-coding strand).

Using the polynucleotide encoding HI7T213 of the present invention, the method described in, for example, “New PCR and its Applications” published by the publicly known experimental medicine, 15 (7), 1997, or a method analogous thereto, can be used. The DNA encoding the HI7T213 of the present invention, which can quantify the mRNA of the HI7T213 of the present invention, includes genomic DNA, genomic DNA library, cDNA derived from the above cells or tissues, Any of the above-mentioned cells or tissue-derived cDNA library and synthetic DNA may be used. The vector used for the library may be any of pacteriophage, plasmid, cosmid, and phagemid. In addition, total cells Amplification can also be carried out directly by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using the prepared RNA or mRNA fraction.

Specifically, the DNA encoding HI7T213 of the present invention includes, for example, a nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8. Or a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, : 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, consisting essentially of the same amino acid sequence as HI7T213 (eg, ligand binding activity, signal transduction activity, etc.) Any DNA may be used as long as it encodes a receptor protein having

Examples of the DNA that can hybridize with the base sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 include, for example, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or A DNA containing a nucleotide sequence having a homology of about 80% or more, preferably about 90% or more, more preferably about 95% or more with the nucleotide sequence represented by SEQ ID NO: 8 is used.

The homology of the nucleotide sequences was determined using the homology calculation algorithm NCB IB LAST (Natlonal C enterfor Biotechnology Informa tion Basement Local Alignment Sensor Tool) under the following conditions (expected value: 10; Gap is allowed; filtering == ON; match score = 1; mismatch score =-3).

The hybridization can be performed by a known method or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. SambrooK et al., Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, the method can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringent conditions.

The high stringent conditions include, for example, a sodium concentration of about 19 to 40. mM, preferably about 19-20 mM, and a temperature of about 50-70 ° C, preferably about 60-65 ° C. In particular, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C is most preferable.

More specifically, the DNA encoding human-derived HI7T213 (hHI7T213) consisting of the amino acid sequence represented by SEQ ID NO: 1 is represented by SEQ ID NO: 2 A DNA consisting of a nucleotide sequence or the like is used. Examples of the DNA encoding human-derived HI7T213 (hHI7T213) comprising the amino acid sequence represented by SEQ ID NO: 3 include DNA comprising the base sequence represented by SEQ ID NO: 4. Used. As the DNA encoding mouse-derived HI7T213 (# 11) having the amino acid sequence represented by SEQ ID NO: 5, a DNA having the base sequence represented by SEQ ID NO: 6 and the like are used. As the DNA encoding mouse-derived HI7T213 (# 8) having the amino acid sequence represented by SEQ ID NO: 7, a DNA having the base sequence represented by SEQ ID NO: 8 and the like are used.

A polynucleotide comprising a part of the base sequence of the DNA encoding HI7T213 of the present invention or a part of the base sequence complementary to the DNA is a part of the present invention described below. It is used to include not only DNA encoding a peptide but also RNA.

According to the present invention, an antisense 'polynucleotide (nucleic acid) capable of inhibiting the replication or expression of a GPR gene is cloned or determined, and the nucleotide sequence information of the DNA encoding HI7T213 is determined. Can be designed and synthesized based on Such a polynucleotide (nucleic acid) can hybridize with the RNA of the HI7T213 gene and can inhibit the synthesis or function of the RNA, or can bind to the HI7T213-related RNA. Through the interaction, the expression of the HI7T213 gene can be regulated and controlled. Polynucleotides that are complementary to the selected sequence of the GPR-related RNA, and that can specifically hybridize to the GPR-related RNA, are derived from the HI7T213 gene in vivo and in vitro. It is useful for regulating and controlling the expression of, and for treating or diagnosing diseases. HI 7 T2 13 gene 5, terminal hairpin loop, 5, terminal 6-base spare. Repeat, 5, terminal untranslated region, polypeptide translation initiation codon, protein The coding region, the ORF translation initiation codon, the 3'-end untranslated region, the 3'-end palindromic region, and the 3'-end hairpin loop may be selected as preferred regions of interest, although any within the HI7T2 13 gene Regions may also be selected for antisense 'polynucleotides.

The relationship between the target nucleic acid and a polynucleotide that is complementary to at least a part of the target region and can hybridize can be said to be “antisense” with the target. Antisense polynucleotides are polydexoxy liponucleotides containing 2-dexoxy D-report, polyribonucleotides containing D-report, N-daricosides of purine or pyrimidine bases, etc. Or other polymers having a non-nucleotide backbone (eg, commercially available proteins, nucleic acids or nucleic acid polymers specific to synthetic sequences) or other polymers containing special bonds (provided that the polymer Include base pairs that are found in DNA and RNA (contain nucleotides that have a configuration that allows base attachment). They can be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, and also DNA: RNA hybrids, and can be unmodified polynucleotides (or unmodified oligonucleotides), or even known. With modifications of, for example, those known in the art, capped, methylated, one or more natural nucleotides replaced by analogs, intramolecular Nucleotide-modified, eg, having uncharged bonds (eg, methylphosphonate, phosphotriester, phosphoramidate, carbamate, etc.), charged or sulfur-containing bonds (eg, phosphorothioate, phosphorodi ), Such as proteins (nucleases, nucleases, inhibitors, ibises) Has side chain groups such as proteins, antibodies, signal peptides, poly-L-lysine, etc.) , Compounds containing chelating compounds (eg, metals, radioactive metals, boron, oxidizable metals, etc.), those containing alkylating agents, those with modified bonds (eg, α-anomeric Nucleic acid). Where "nucleoside", "nucleotide" and "nucleic acid" May contain not only purine and pyrimidine bases, but also may have other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleotides and modified nucleotides may also be modified at the sugar moiety, e.g., where one or more hydroxyl groups have been replaced with halogens, aliphatic groups, etc., or ethers, amines, etc. It may have been converted to a functional group.

The antisense 'polynucleotide (nucleic acid) of the present invention is RNA, DNA, or a modified nucleic acid (RNA, DNA). Specific examples of the modified nucleic acid include, but are not limited to, sulfur derivatives of nucleic acids, thiophosphate derivatives, and those that are resistant to degradation of polynucleoside amides and oligonucleoside amides. The antisense nucleic acid of the present invention can be preferably designed according to the following policy. That is, to make the antisense nucleic acid more stable in the cell, to make the antisense nucleic acid more cell permeable, to have a greater affinity for the target sense strand, and to be more toxic if it is toxic. Make sense nucleic acids less toxic.

Thus, many modifications are known in the art, for example, J. Kawakami et al., Parm Tech Japan, Vol. 8, pp. 247, 1992; Vol. 8, pp. 395, 1992; ST Crooke et al. ed., Antisense Research and Appli cat ions, CR and Press, 1993.

The antisense nucleic acids of the present invention may contain altered or modified sugars, bases, bonds, and may be provided in special forms such as ribosomes and microspheres, applied by gene therapy, It could be given in additional form. Such additional forms include polycations, such as polylysine, which act to neutralize the charge on the phosphate backbone, and lipids, which enhance the interaction with cell membranes or increase the uptake of nucleic acids ( For example, crude water-based substances such as phospholipids and cholesterol are exemplified. Preferred lipids for addition include cholesterol and its derivatives (eg, cholesteryl chromate formate, cholic acid, etc.). These are the 3, 3, or 5 , Can be attached to the end, and can be attached via a base, sugar, or molecular nucleoside bond. Other groups include capping groups specifically located at the 3 'or 5' end of nucleic acids that prevent degradation by nucleases such as exonucleases and RNases. . Such capping groups include, but are not limited to, hydroxyl-protecting groups known in the art, such as glycols such as polyethylene glycol and tetraethylene dalicol.

The inhibitory activity of an antisense nucleic acid can be examined using the transformant of the present invention, the in vivo or in vitro gene expression system of the present invention, or the in vivo or in vitro translation system of a G protein-coupled receptor protein. it can. The nucleic acid can be applied to cells by various known methods.

The DNA encoding the partial peptide of the present invention may be any DNA as long as it contains the above-described nucleotide sequence encoding the partial peptide of the present invention. In addition, any of genomic DNA, genomic DNA library, cDNA derived from the above-described cells or tissues, cDNA library derived from the above-described cells or tissues, and synthetic DNA may be used. The vector used for the library may be any of pacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, amplification can be performed directly by the RT-PCR method using an mRNA fraction prepared from the cells or tissues described above.

Specifically, the DNA encoding the partial peptide of the present invention includes, for example, (1) a nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8 DNA having a partial nucleotide sequence of DNA, or (2) hybridizes with a nucleotide sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 under high stringent conditions It has a base sequence and has substantially the same activity as HI7T213 containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7 of the present invention (eg, For example, a DNA having a partial nucleotide sequence of a DNA encoding a receptor protein having a ligand binding activity, a signal transduction action, or the like is used.

Represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 Examples of the DNA capable of hybridizing a base sequence include, for example, a base sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8, which is about 80% or more, preferably about 90% or more, Preferably, DNA containing a nucleotide sequence having about 95% or more homology is used.

The homology of the nucleotide sequences can be calculated under the same conditions using the homology calculation algorithm NCB I BLAST described above.

The hybridization method and conditions are the same as described above.

As means for closing a DNA completely encoding the HI7T213 of the present invention or a partial peptide thereof (hereinafter sometimes abbreviated as HI7T213 of the present invention), the HI of the present invention may be used. DNA that codes for a part or the whole of HI 7T 213 of the present invention by expanding the DNA by PCR using a synthetic DNA primer having a partial nucleotide sequence of 7 T 213 or by incorporating the DNA incorporated into an appropriate vector. Selection can be performed by hybridization with fragments or those labeled with synthetic DNA. The hybridization method is described, for example, in Molecular loning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press,

1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual.

The DNA base sequence can be converted by ODA-LA using PCR or a known kit, for example, Mu tan ™ -suer Exress Km (Takara Shuzo), Mu tan ™ -K (Takara Shuzo) or the like. It can be performed according to a known method such as the PCR method, the Gappedduplex method, the Kunke 1 method, or a method analogous thereto.

The cloned DNA encoding HI7T213 can be used as it is or as desired, after digestion with a restriction enzyme, or with the addition of a linker. The DNA may have ATG as a translation initiation codon at its 5, terminal side, and may have TAA, TGA or TAG as a translation termination codon at its 3, terminal side. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. The HI7T213 expression vector of the present invention can be prepared by, for example, (a) cutting out a DNA fragment of interest from the DNA encoding ΗI7Τ213 of the present invention; It can be produced by ligating downstream of a promoter in an appropriate expression vector.

Escherichia coli-derived plasmids (eg, pBR322, pBR325, pUC12, pUC13), Bacillus subtilis-derived plasmids (eg, pUB110, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), pacteriophages such as λ phage, animal viruses such as retrovirus, vaccinia virus, and baculovirus. Other examples include pA1-11-1, ρΧΤ1, RcZCMV, pRc / RSV, pcDNAI / Neo, and the like. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when animal cells are used as hosts, SRa promoter, SV40 promoter, LTR open motor, CMV promoter, HSV-TK promoter, etc. may be used.

Of these, it is preferable to use the CMV promoter, SRα promoter and the like. When the host is Eshierihia genus bacterium, trp promoter, lac flop port motor, r _ec A promoter, LP _L promoter, lpp promoter, etc. When the host is Bacillus, S PO l promoter, S P02 flop When the host is yeast, such as an oral motor and a pen P promoter, a PH05 oral motor, a pGK promoter, a GAP promoter, an ADH promoter and the like are preferred. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

The expression vector may contain, in addition to the above, an enhancer, a splicing signal, a poly-A addition signal, a selection marker, and an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), if desired. Anything can be used. As the selection marker include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin Li down resistance gene (hereinafter sometimes abbreviated as Amp ^r), neomycin Resistant Gene (hereinafter sometimes abbreviated as Neor, G4 18 resistance). In particular, when the dhfr gene is used as a selectable marker using CHO (dhfr-) cells, the target gene can be selected even on a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the receptor protein of the present invention. If the host is a genus Escherichia, the Pho A • signal sequence, Omp A · signal sequence, etc., if the host is a Bacillus genus, the amylase 'signal sequence, subtilisin · signal sequence, etc. If the host is yeast, MF α signal sequence, SUC 2 signal sequence, etc. If the host is an animal cell, the insulin signal sequence, α-interferon signal sequence, antibody molecule, signal sequence, etc. Are available respectively. A transformant can be produced using the thus-constructed vector containing the DNA encoding ΗI 7 Τ 2 13 of the present invention.

As the host, for example, Escherichia bacteria, Bacillus bacteria, yeast, insect cells, insects, animal cells, and the like are used.

Specific examples of the genus Escherichia include Escherichia coli K12 · DH1 [Proc. Natl. Acad. Sci. USA, 60th volume, 160 (1968)], JM1. 0 3 [Nucleic Acids Research, 9 volumes, 309 (1 1981)], JA2 21 [Journal of Molecular Biology, 120 volumes, 5 17 (1 977)], HB 10 1 [Journal of Molecular Biology, Vol. 41, 459 (1969)], C600 [Genetics, Vol. 39, 440 (1954)] and the like are used. Examples of Bacillus spp. Include, for example, Bacillus subtilis MI114 (Gene, 24, 255 (1983)), 207—21 [Journal of Biochemistry, 95 , 8 7 (1994)].

Examples of yeast include, for example, Saccharomyces cerevisiae AH22, AH22R—, NA87-11A, DKD—5D, 20B—12, and Schizosaccharomyces bomb ( Schizosaccharomyces pombe) NCYC 1913, NCYC203, Pichia pastoris and the like are used.

As insect cells, for example, if the virus is AcNPV, Derived cell lines (Spodoptera frugiperda cell; Sf cells), MG1 cells from Trichoplusia ni midgut, High Five ™ cells from Trichoplusia ni eggs, cells from Mamestra brassicae or cells from Estigmena acrea Used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mori N; BmN cell) is used. Examples of the Sf cell include Sf9 cell (ATCC CRL1711), Sf21 cell (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like. Is used.

As insects, for example, silkworm larvae and the like are used [Maeda et al., Nature, 315, 592 (1989)].

Examples of animal cells include monkey cells COS-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr-) cells). Mouse L cells, mouse AtT-20, mouse myeloma cells, rat GH3, and human FL cells.

For transformation of Escherichia sp., For example, Proc. Natl. Acad. Sci.

USA, 69, 2110 (1972) and Gene, 17, 107 (1982) can be used.

To transform Bacillus, for example, use Molecular & General

This can be performed according to the method described in Genetics, 168, 1111 (19779).

To transform yeast, for example, Methods in Enzymology, 194, 182-187 (11991), Proc. Natl. Acad. Sci. USA, 75, 1992 (19778).

Transformation of insect cells or insects can be performed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988).

To transform animal cells, see, for example, Cell Engineering Separate Volume 8 New Cell Engineering Experimental Protocol. 26 3—26 7 (19995) (published by Shujunsha), Virology, 52, 4 This can be performed according to the method described in 56 (1 973).

Thus, an expression vector containing DNA encoding HI7T2113 Is obtained.

When culturing a transformant whose host is a bacterium belonging to the genus Escherichia or Bacillus, a liquid medium is suitable as a medium for culturing, and a carbon source necessary for growth of the transformant is contained therein. , Nitrogen sources, inorganic substances and others. Examples of the carbon source include glucose, dextrin, soluble starch, and bran. Examples of the nitrogen source include ammonium salts, nitrates, corn chip liquor, peptone, casein, meat extract, soybean meal, potato extract, and the like. Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5-8.

As a medium for cultivating a bacterium belonging to the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in

Molecular Genetics, 431-143, Cold Spring Harbor Laboratory, New York 1972]. If necessary, an agent such as 3j3-indolylacrylic acid can be added to make the promoter work efficiently.

When the host is a bacterium belonging to the genus Escherichia, cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring can be added.

When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually carried out at about 30 to 40 ° C for about 6 to 24 hours.

When culturing a transformant in which the host is yeast, the medium may be, for example, Burkholder's minimal medium [Bostian, KL et al., Proc. Natl. Acad. Sci. USA, 77, 450 5 (1980)] or SD medium containing 0.5% casamino acid [Bitter, GA et al., Proc. Natl. Acad. Sci. USA, 81, 5330 (1994) ]. The pH of the medium is preferably adjusted to about 5-8. Cultivation is usually carried out at about 20 ° C to 35 ° C for about 24 to 72 hours, with aeration and agitation as needed.

When culturing an insect cell or a transformant whose host is an insect, the medium does not work with Grace's Insect Medium (Grace, TC, Nature, 195, 788 (1962)). An appropriately added additive such as 10% serum or the like is used. The pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and stirring are added as necessary.

When culturing a transformant in which the host is an animal cell, the medium is, for example, about 5 to 20. /. MEM medium containing fetal bovine serum [Science, 122, 501 (1952)], DMEM medium [Virology, 8 volumes, 396 (1959)], RPMI 1640 [The Journal of the American Medical Association, 19 9 ¾ :, 5 19 (1 9 6 7)], 1 9 9 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1 9 5 0)]. Preferably, the pH is about 6-8. Culture is usually performed at about 30 ° C to 40 ° C for about 15 to 60 hours, and aeration and stirring are added as necessary.

As described above, the HI7T213 of the present invention can be produced in the transformant, in the cell membrane, or outside the cell.

The HI7T213 of the present invention can be separated and purified from the culture by, for example, the following method.

When extracting the HI7T213 of the present invention from cultured cells or cells, after culturing, the cells or cells are collected by a known method, suspended in an appropriate buffer, sonicated, lysozyme After rupture of the cells or cells by freeze-thawing or the like, a method of obtaining a crude extract of HI7T213 by centrifugation or filtration is suitably used. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ™. If HI7T2 13 is secreted into the culture, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected.

The HI7T213 contained in the culture supernatant or extract thus obtained can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis. Methods that mainly use differences in molecular weight, such as methods, methods that use differences in charge, such as ion-exchange chromatography, and methods such as abundance chromatography. Methods that use specific novelty, methods that use differences in hydrophobicity such as reversed-phase high-performance liquid chromatography, and methods that use differences in isoelectric points such as isoelectric focusing are used.

When the HI7T213 thus obtained is obtained as a free form, it can be converted to a salt by a known method or a method analogous thereto, and conversely, when it is obtained as a salt, it is known. Can be converted to a free form or another salt by the method of or a method analogous thereto.

HI7T213 produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed before or after purification by the action of an appropriate protein-modifying enzyme. You can also. As the protein modifying enzyme, for example, trypsin, chymotrypsin, anoreginyl endopeptidase, proteinase, glycosidase and the like are used.

The activity of the thus produced HI7T213 of the present invention can be measured by a binding experiment with a labeled ligand, an enzymimnoassay using a specific antibody, or the like.

The antibody against HI7T213 of the present invention may be any of a polyclonal antibody and a monoclonal antibody as long as it can recognize HI7T213 of the present invention.

The antibody against HI7T213 of the present invention can be produced according to a known antibody or antiserum production method using HI7T213 of the present invention as an antigen.

[Preparation of monoclonal antibody]

(a) Preparation of monoclonal antibody-producing cells

The HI7T213 of the present invention is administered to a mammal at a site capable of producing an antibody by administration, itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance antibody production upon administration. The administration is usually performed once every 2 to 6 weeks, for a total of about 2 to 10 times. Examples of mammals to be used include monkeys, puppies, dogs, guinea pigs, mice, rats, sheep, and goats, and mice and rats are preferably used. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with the antigen, for example, a mouse with an antibody titer is selected from the mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization. The monoclonal antibody-producing hybridoma can be prepared by fusing the antibody-producing cells contained in the above with myeloma cells. The antibody titer in the antiserum can be measured, for example, by reacting a labeled receptor protein described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation can be carried out according to a known method, for example, the method of Koehler and Millstein (Nature, 256, 495 (1975)). Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used.

Examples of myeloma cells include NS_1, P3U1, SP2 / 0 and the like, and P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably, PEG 1000 to PEG6000) is about 10 to 80%. Cell fusion can be carried out efficiently by adding at a concentration of about 20 to 40 ° C, preferably at about 30 to 37 ° C, for about 1 to 10 minutes.

Various methods can be used to screen monoclonal antibody-producing hybridomas. For example, the hybridoma culture supernatant is added to a solid phase (eg, microplate) on which the antigen of the receptor protein is directly or adsorbed together with a carrier. Then, add an anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cells used for cell fusion are mice) or tin A, which is labeled with a radioactive substance or enzyme, and bind to the solid phase. A method for detecting a monoclonal antibody, a monoclonal antibody bound to a solid phase to which anti-globulin antibody or protein A is adsorbed, a hybridoma culture supernatant is added, and a receptor protein labeled with a radioactive substance or an enzyme is added. Examples include a method for detecting an antibody.

The selection of the monoclonal antibody can be carried out according to a known method or a method analogous thereto. Usually, it can be carried out in a medium for animal cells to which HAT (hypoxanthine, aminopterin, thymidine) is added. Media for selection and breeding Therefore, any medium can be used as long as the hybridoma can grow.

. For example, RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal bovine serum, GIT medium containing 1 to 10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) ) Or serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.). The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the culture supernatant of the hybridoma can be measured in the same manner as the measurement of the antibody titer in anti-blood cells described above.

(b) Purification of monoclonal antibodies

Monoclonal antibodies can be separated and purified in the same manner as normal polyclonal antibodies. [Examples: salting out, alcohol precipitation, isoelectric focusing, electrophoresis, ion exchangers (ex. , DEAE), ultracentrifugation, gel filtration, antigen-binding solid phase or specific antibody obtained by collecting only the antibody with an active adsorbent such as protein A or protein G and dissociating the bond to obtain the antibody. Purification method].

(Preparation of polyclonal antibody)

The polyclonal antibody of the present invention can be produced according to a known method or a method analogous thereto. For example, a complex of an immunizing antigen (HI7T213 antigen) and a carrier protein is formed, and a mammal is immunized in the same manner as in the above-described method for producing a monoclonal antibody. The antibody can be produced by collecting an antibody containing 7T213 and separating and purifying the antibody.

Regarding the complex of the carrier protein and the immunizing antigen used to immunize mammals, the type of the carrier protein and the mixing ratio of the carrier and the hapten are different from those of the hapten immunized by cross-linking the carrier. Any antibody may be cross-linked at any ratio as long as the antibody can be efficiently produced.For example, serum albumin, ossein globulin, keyhorn, lindet, hemocyanin, etc. A method of coupling the hapten at a ratio of about 0.1 to 20 and preferably about 1 to 5 with respect to 1 of the hapten is used.

In addition, various condensing agents may be used for force coupling between the hapten and the carrier. Although it is possible, an active ester reagent containing a daltaraldehyde-carboimide, a maleimide active ester, a thiol group, or a dithioviridyl group is used.

The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. Complete Freund's adjuvant / incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration can usually be performed once every about 2 to 6 weeks, for a total of about 3 to 10 times. The polyclonal antibody can be collected from blood, ascites, etc., preferably from blood, of the mammal immunized by the above method.

The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the serum described above. The polyclonal antibody can be separated and purified according to the same method for separating and purifying immunoglobulins as in the above-described method for separating and purifying a monoclonal antibody.

HI 7 T 2 13 of the present invention, DNA encoding HI 7 T 2 13 (hereinafter sometimes abbreviated as DNA of the present invention), an antibody against HI 7 T 2 13 (hereinafter, the present invention) Antisense DNA against the DNA of the present invention (hereinafter sometimes abbreviated as the antisense DNA of the present invention) has the following uses.

(1) A drug containing a DNA encoding HI7T2113 or HI7T2113, a DNA encoding HI7T213 or HI7T213 is, for example, a wound, a spinal cord injury, It can be used as a prophylactic and / or therapeutic agent for analgesia and the like, or a medicament such as a renal regenerating agent.

When DNA encoding HI7T213 or HI7T213 is used as a medicament as described above, it can be carried out in a conventional manner. For example, a sterile solution orally as a tablet, a capsule, an elixir, a microcapsule, or the like, coated with a sugar coating or an enteric coating as necessary, or with water or another pharmaceutically acceptable liquid, Alternatively, they can be used parenterally in the form of injections such as suspensions. For example, the compound or a salt thereof may be combined with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc., in a unit dosage form required for generally accepted pharmaceutical practice. And can be produced by mixing. These formulations The amount of the active ingredient is such that an appropriate dose in the specified range can be obtained.

The DNA encoding HI7T213 can be obtained by (i) administering DNA encoding HI7T213 to the patient and expressing it, or (DNA) introducing DNA encoding HI7T213 into cells or the like. After the expression, the amount of HI7T213 in the cells of the patient can be increased by transplanting the cells into the patient, and the effect of the ligand can be sufficiently exerted. When DNA encoding HI 7T213 is used, the DNA should be used alone or after having been inserted into an appropriate vector such as a retrovirus vector, adenowinoresetter, or adenovirus associated vector, and then carried out in a conventional manner. Can be.

Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc. For example, a swelling agent, a lubricant such as magnesium stearate, a sweetening agent such as sucrose, lactose or saccharin, a flavoring agent such as peppermint, cocoa oil or cherry are used. When the preparation unit form is a capsule, a liquid carrier such as oils and fats can be further contained in the above-mentioned type of material. Sterile compositions for injection should be formulated according to standard pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. Can be.

Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mantol, sodium chloride, etc.). In combination with solubilizers, such as alcohols (eg, ethanol), polyanolecol (eg, propylene glycol, polyethylene glycol), and nonionic surfactants (eg, polysorbate 80 (ΤΜ), HCO-150) Is also good. Oily liquids include sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.

Also, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (E.g., benzalco-chloride, proforce hydrochloride, etc.), stabilizers (e.g., human blood albumin, polyethylene glycol, etc.), preservatives (e.g., benzyl alcohol, phenol, etc.), antioxidants, etc. May be. The prepared injection solution is usually filled in an appropriate ampoule. The preparations obtained in this way are safe and have low toxicity, for example, in humans and non-human warm-blooded animals (eg mice, rats, monoremots, egrets, birds, higgies, pigs, pigs, cats). , Dogs, sanoles, baboons, chimpanzees, etc.).

For example, the dosage of HI7T213 or the DNA encoding HI7T213 varies depending on the symptoms and the like. However, in the case of oral administration, in general, in an adult wound patient (assuming a body weight of 60 kg), About 0.1 to 10 Omg per day, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. When given parenterally, the single dose varies depending on the target, target organ, symptoms, and administration method.For example, in the case of an injection, an adult wound patient (with a body weight of 60 kg) It is convenient to administer about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg per day by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

(2) a drug containing an antibody against HI7T213

As described above, animals expressing high HI 7 T 213 may develop cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, etc. An antibody having an activity to neutralize the activity can be used as a prophylactic and / or therapeutic agent for cancer, kidney damage, cataract, dermatitis, chronic pain, hyperalgesia and the like.

The prophylactic and / or therapeutic agent for the above-mentioned diseases containing the antibody (eg, neutralizing antibody) of the present invention can be used as it is as a liquid or as a pharmaceutical composition in an appropriate dosage form, in a human or non-human mammal (eg, , Rats, puppies, sheep, pigs, cats, cats, dogs, monkeys, etc.). The dose varies depending on the administration subject, target disease, symptoms, administration route, and the like.For example, when used in adults for the treatment of cataract, the antibody of the present invention is usually used in a dose of 0.0 l to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably Is conveniently administered by intravenous injection about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent dose can be administered. If the symptoms are particularly severe, the dose may be increased accordingly.

The antibody of the present invention can be administered by itself or as a suitable pharmaceutical composition. The pharmaceutical composition used for the above administration contains the above or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such compositions are provided in dosage forms suitable for oral or parenteral administration.

That is, for example, compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (soft capsules and the like). ), Syrups, emulsions, suspensions and the like. Such a composition is produced by a known method, and contains a carrier, diluent or excipient commonly used in the field of pharmaceuticals. For example, as a carrier or excipient for tablets, lactose, starch, sucrose, magnesium stearate and the like are used.

As compositions for parenteral administration, for example, injections, suppositories, etc. are used. Injections are in the form of intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, etc. Is included. Such injections are prepared according to known methods, for example, by dissolving, suspending or emulsifying the antibody or a salt thereof in a sterile aqueous or oily liquid commonly used for injections. As the aqueous liquid for injection, for example, physiological saline, isotonic solution containing glucose and other adjuvants, and the like, suitable solubilizing agents, for example, alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (o Omo 丄 adduct of hydrogenated castor oil)), etc.). As the liquid, for example, sesame oil, soybean oil, etc. are used, and benzyl benzoate, benzyl alcohol, etc. may be used in combination as a solubilizer.The prepared injection solution is usually filled in an appropriate ampoule. For suppositories used for rectal administration, the above antibody or a salt thereof is added to a usual suppository base. It is prepared by mixing.

The above-mentioned oral or parenteral pharmaceutical compositions are conveniently prepared in dosage unit forms to be compatible with the dosage of the active ingredient. Examples of such dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories, etc., and usually 5 to 500 mg, especially injection, for each dosage unit dosage form. The drug preferably contains 5 to 10 Omg of the above antibody, and other dosage forms contain 10 to 25 Omg of the above antibody.

Each of the above-mentioned compositions may contain other active ingredients as long as the composition does not cause an undesirable interaction with the above-mentioned antibody.

(3) Diagnostic agent containing antibody to HI7T213

Since antibodies against HI7T213 can specifically recognize HI7T213, quantification of HI7T213 in the test solution, especially by sandwich immunoassay It can be used for quantification and the like.

That is, the present invention

(i) The antibody of the present invention is competitively reacted with a test solution and labeled HI7T213, and the ratio of labeled HI7T213 bound to the antibody is measured. A method for quantifying HI 7 T 2 13 in a test solution, and

(ii) Simultaneously or continuously reacting the test solution with the antibody of the present invention immobilized on the carrier and another labeled antibody of the present invention, and then measuring the activity of the labeling agent on the insolubilized carrier The present invention provides a method for quantifying HI 7 T 2 13 in a test solution, which comprises: In the quantification method (ii) above, one antibody is an antibody that recognizes the N-terminus of HI7T2113, and the other antibody is an antibody that reacts with the C-terminus of HI7T213. Desirably.

In addition, HI7T213 can be quantified using a monoclonal antibody against HI7T213, and detection by tissue staining or the like can also be performed. For these purposes, the antibody molecule itself may be used, or F (ab,) ₂ , Fab, or Fab fraction of the antibody molecule may be used.

The method for quantifying HI 7 T 2 13 using the antibody of the present invention is not particularly limited, and an antibody corresponding to the amount of antigen in the test solution (for example, HI 7 T 2 13), Anti Any method that detects the amount of the original or antibody-antigen complex by chemical or physical means, and calculates this from a standard curve prepared using a standard solution containing a known amount of antigen Method may be used. For example, nephrometry, a competitive method, an immunometric method, and a sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use a sandwich method described later.

As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. As the radioisotope, for example, [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are used. As the above-mentioned enzyme, those which are stable and have a large specific activity are preferable. As the fluorescent substance, for example, fluorescamine, fluorescein isothiosinate and the like are used. As the luminescent substance, for example, luminol, luminol derivative, norreciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For the insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing HI7T213 or an enzyme or the like may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass.

In the sandwich method, a test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of HI 7 T 2 13 of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity and the like. May be used. In the method for measuring HI7T213 by the sandwich method of the present invention, the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction is an antibody in which the binding site of ΗI7Τ213 is different. Is preferably used. That is, the antibody used in the primary reaction and the secondary reaction is, for example, when the antibody used in the secondary reaction recognizes the C-terminal of HI7T213, the antibody used in the primary reaction is Preferably, an antibody that recognizes other than the C-terminal, for example, the Ν-terminal is used.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method or a nephelometry.In the competition method, the antigen in the test solution and the labeled antigen compete with the antibody. After the reaction, the unreacted labeled antigen (F) and the labeled antigen bound to the antibody (抗体) are separated (BZF separation), and the amount of B or F label is measured. Quantify the amount of antigen in. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed using polyethylene glycol, a liquid phase method using a second antibody against the antibody, and a solid phase antibody is used as the first antibody. Alternatively, an immobilization method using a soluble first antibody and an immobilized antibody as the second antibody is used.

In the immunometric method, the antigen in the test solution and the immobilized antigen are subjected to a competitive reaction with a fixed amount of the labeled antibody, and then the solid phase and the liquid phase are separated. The antigen is allowed to react with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of the label in either phase is measured to determine the amount of the antigen in the test solution.

In nephelometry, the amount of insoluble sediment resulting from an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry using laser scattering is preferably used.

In applying each of these immunological measurement methods to the quantification method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct the measurement system of {I7} 2 13 of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details on these general technical means, see Can be referred to.

For example, edited by Hiro Irie, "Radio Nonotsusei" (Kodansha, published in Showa 49), edited by Hiroshi Irie, "Radio Imunoatsushi" (Kodansha, published in 1954), Eiji Ishikawa et al. "Measurement Method" (Medical Shoin, published in 1975), edited by Eiji Ishikawa et al. "Enzyme Immunoassay" (2nd edition) (Medical Publishing, published in 1977), Eiji Ishikawa, et al. "Enzyme Immunoassay" (3rd edition) (published by Medical Shoin, Showa 62), "Methods in ENZYM0L0GY

J o

Vol. 70 (Immunochemical Techniques (Part A)), ibid.

Vol. 74 (Immunochemical Techniques (Part C)), Vol. 84 (Immunochemical Techniques (Part D: Selected Immunoassays)), Vol. 92 (Immunochemi cal Techniques) (Part E: Monoclonal Ant ibodies and General Immunoassay Methods)), | F> 3 book Vol. 121 (Immunochemical Techniques (Part I: Hybri doma Technology and Monoclonal Ant ibodies)) (above, published by Academic Press) be able to.

As described above, HI7T213 of the present invention can be quantified with high sensitivity by using the antibody of the present invention.

Further, when a decrease in the concentration of HI7T213 is detected by quantifying the concentration of HI7T213 using the antibody of the present invention, for example, HI7T213 3 can be diagnosed as having a dysfunction-related disorder, such as a wound, spinal cord injury, analgesia, or is likely to be affected in the future.

When an increase in the concentration of HI7T213 is detected, for example, a disease caused by overexpression of HI7T213, such as cancer, renal disorder, cataract, dermatitis, It can be diagnosed as having sexual pain, hyperalgesia, or a high likelihood of future illness.

(4) Gene diagnostic agent

DNA encoding HI7T213 can be used, for example, in a human or non-human mammal (eg, rat, mouse, guinea pig, egret, sheep, sheep, puta, pig, pig) by using it as a probe. HI 7 T 2 Abnormality (genetic abnormality) of DNA or mRNA encoding 13 can be detected, for example, damage, mutation or decreased expression of the DNA or mRNA, increase or excessive expression of the DNA or mRNA, etc. It is useful as a genetic diagnostic agent.

The above-described genetic diagnosis using DNA encoding HI7T213 or an antisense 'polynucleotide thereto can be performed, for example, by a known Northern hybridization or PCR-SSCP method (Genomics, Vol. 5, 874). ~ 879 (1989), Proceedings oi the National Academy of Sciences of the United States of America, Vol. 86, 276-6-277 (pp. 1989)) It can be implemented by such as.

For example, if Northern hybridization detects decreased expression of HI7T213, it is likely to be a disease, such as a wound, spinal cord injury, analgesia, or will be affected in the future It can be diagnosed as high.

For example, if overexpression of HI7T213 is detected by Northern hybridization, it is likely that the disease is a disease such as cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, or It can be diagnosed as having a high possibility of contracting in the future.

(5) DNA containing antisense DNA

Antisense to DNA encoding HI 7 T 2 13 DN A can suppress the expression of HI 7 T 2 13 so that cancer, renal disorder, cataract, dermatitis, chronic pain, pain When the above antisense DNA can be used as a preventive and / or therapeutic agent for hypersensitivity or the like, when the above antisense DNA is used as the above preventive and / or therapeutic agent, the antisense DNA is coded as HI7T213. It can be formulated in the same manner as DNA.

The preparations obtained in this way are of low toxicity and are intended for oral or non-human mammals (eg, rats, egrets, sheep, pigs, pigs, cats, dogs, monkeys, etc.). It can be administered parenterally.

The antisense DNA may be used as it is or as an auxiliary agent for promoting uptake. It can be administered via a catheter, such as a gene gun or hydrogel catheter, together with any physiologically acceptable carrier.

The dosage of the antisense DNA varies depending on the target disease, the administration subject, the administration route, and the like. For example, for the purpose of treating cataract, antisense DNA may be used in organs (eg, liver, lung, heart, kidney, etc.). ) When topically administered to an adult (body weight 6 O kg) per day is about 0.1 to 100 mg.

Furthermore, a double-stranded RNA (RNAi; RNA interference method) containing a part of RNA encoding HI7T213 and its complementary RNA, an RNA encoding HI7T213 A lipozyme or the like containing a part of the same can suppress the expression of DNA encoding HI7T213 as in the case of the above-mentioned antisense DNA, and can inhibit ligand or HI7T213 in vivo. The function of the encoding DNA can be suppressed.

Therefore, the double-stranded RNA or lipozyme can suppress the expression of HI7T213, thus preventing cancer, renal disorder, cataract, dermatitis, chronic pain, hyperalgesia, etc.ぴ Can be used as a Z or therapeutic agent.

Double-stranded RNA can be designed and manufactured based on the sequence of the DNA of the present invention according to a known method (eg, Nature, vol. 411, p. 494, 2001).

The lipozyme can be produced by designing based on the DNA sequence of HI7T213 according to a known method (eg, TRENDS in Molecular Medicine, Vol. 7, pp. 221, 2001). For example, it can be produced by ligating a known lipozyme to a part of RNA encoding HI7T213. A part of the RNA encoding HI7T213 includes a portion (RNA fragment) adjacent to the cleavage site on HI7T213 RNA which can be cleaved by a known lipozyme.

When the above double-stranded RNA or lipozyme is used as the above prophylactic and / or therapeutic agent, it can be formulated and administered in the same manner as antisense DNA.

(6) Screening method

The screening method of the present invention comprises:

(6A-1) (i) ligand and (ii) HI7T213 (hereinafter also including partial peptide) A method of screening a substance that changes the binding property between a ligand and HI7T213,

(6A-2) A method for screening a substance that regulates the expression level of HI 7T 213, which comprises using 08 encoding 111 7 213.

First, a method for screening a substance that changes the binding property between a ligand and HI7T213 will be described.

By using HI7T213 or constructing a recombinant HI7T213 expression system and using a receptor-binding assay system using the expression system, the binding between the ligand and HI7T213 is changed. The substance to be screened can be screened.

Such substances include cell stimulatory activity via HI7T213 (eg, arachidonic acid release, acetylcholine release, cytosolic Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate A substance having an activity of promoting or inhibiting production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, reduction of pH, etc. (ie, HI 7T 213 agonist) and the cell Substances having no stimulatory activity (ie, HI 7T 213 antagonist) are included. “Altering the binding between ligand and HI 7T213” includes both cases where the binding between ligand and HI 7T213 is inhibited and cases where the binding between ligand and HI 7T213 is promoted. Things.

That is, the present invention relates to a ligand characterized by comparing (i) a case in which a ligand is brought into contact with HI7T213 and (ii) a case in which a ligand and a test compound are brought into contact with HI7T213.提供 Provide a method of screening for a substance that alters the binding to 7T213.

In the screening method of the present invention, for example, (i) binding of a ligand to HI7T213 and (ii) binding of a ligand and a test compound to HI7T213, for example, binding of a ligand to HI7Τ213 Measure the amount, cell stimulating activity, etc. and compare.

Specifically, the screening method of the present invention comprises:

(i) When a labeled ligand is brought into contact with HI 7T 213, Binding of a labeled ligand to HI 7T 213 when the ligand and test compound are brought into contact with HI 7 T 213 (Ii) when a labeled ligand is brought into contact with cells containing HI7T213 or a membrane fraction of the cells, and when a labeled ligand and a test compound are contacted with HI7T213. Measuring the amount of the labeled ligand bound to the cell or the membrane fraction when the ligand is brought into contact with the cell or the membrane fraction of the cell, and comparing the ligand with HI7T213. A screening method for a substance that alters the binding property, (iii) applying a labeled ligand to HI7T213 expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213. The place where they touched And contacting the labeled ligand and a test compound with HI7T213 expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213. A method for screening a substance that changes the binding property between a ligand and HI7T213, wherein the amount of binding to 213 is measured and compared;

(iv) HI 7 T 213 activating compounds (eg, ligands, agonists) are exposed to cells containing ΗI 7 Τ213, and ΗI 7 Τ213 activating compounds are tested. HI 7 T213-mediated cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular c) when a compound is brought into contact with cells containing ΗI 7 Τ213 AMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity to suppress or decrease pH, etc.) A method for screening a substance that alters the binding property between a ligand and HI7T213, wherein

(V) HI7T expressed on the cell membrane by culturing a transformant containing DNA encoding HI7T213 with a compound (eg, ligand, agonist) that activates HI7T213. HI 7T 213-activating compound and a test compound were cultured on a transformant containing DNA encoding HI 7T 213, and HI 7T 213 expressed on the cell membrane was cultured. contact Cell stimulating activity via HI7T213 (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane Potential fluctuation, phosphorylation of intracellular protein, activation of c_fos, activity to suppress or decrease pH, etc.) and compare them with HI7T213. For example, a method of screening a substance that changes the binding property of a substance.

The specific description of the screening method of the present invention is as follows.

First, HI7T213 used in the screening method of the present invention may be any one containing HI7T213 described above. A membrane fraction of an organ is suitable. However, since it is extremely difficult to obtain human-derived organs, HI7T213, which is expressed in large amounts using recombinants, is suitable for screening.

In the screening method of the present invention, when a cell containing HI7T213 or a cell membrane fraction thereof is used, the preparation method described later may be followed.

When cells containing HI7T213 are used, the cells may be immobilized with daltaraldehyde, formalin, or the like. The immobilization method can be performed according to a known method.

The cell containing HI7T213 refers to a host cell expressing HI7T213. Examples of the host cell include the aforementioned Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like.

The membrane fraction refers to a fraction containing a large amount of cell membrane obtained by a known method after crushing cells. Cell crushing methods include a method in which cells are crushed with a Potter-Elvehjem homogenizer, a Warlinda blender ゃ polytron (

Crushing by Kinematica), crushing by ultrasonic waves, crushing by ejecting cells from a thin nozzle while applying pressure with a French press, and the like. For cell membrane fractionation, centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used. For example, the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically about 1 to 10 minutes), and the supernatant is further centrifuged at a higher speed (150 000 rpm to 30000 rpm). Centrifuge for 30 minutes to 2 hours. This is the membrane fraction. The membrane fraction is rich in expressed HI7T213 and membrane components such as cell-derived phospholipids and membrane proteins.

The amount of HI7T213 in the cells or membrane fraction containing HI7T213 is preferably 10 ³ to 10 ⁸ molecules per cell, more preferably 10 ⁵ to 10 ⁷ molecules per cell. is there. The higher the expression level, the higher the ligand binding activity (specific activity) per membrane fraction, which not only enables the construction of a highly sensitive screening system, but also enables the measurement of a large number of samples in the same port. become.

Screening a substance that changes the binding property between the ligand and HI7T213 In order to carry out the above (i) to (iii), an appropriate HI7T213 fraction and a labeled ligand are used. Can be The HI7T213 fraction is preferably a natural HI7T213 fraction or a recombinant HI7T213 fraction having an activity equivalent to that of the natural HI7T213 fraction. Here, “equivalent activity” means equivalent ligand binding activity. As the labeled ligand, a labeled ligand, a labeled ligand analog compound, or the like is used. For example ^[3 H], ^[125 I], ^[14 C], can be utilized like-labeled ligand, etc. ^[35 S].

Specifically, in order to screen a substance that changes the binding property between a ligand and HI7T213, first, cells containing HI7T213 or a membrane fraction of the cells are suitable for screening. Prepare a receptor sample by suspending in a buffer. The buffer may be any buffer that does not inhibit the binding of the ligand to HI7T213, such as a phosphate buffer of pH 4 to 10 (preferably pH 6 to 8) or a buffer of Tris-monohydrochloride. In addition, surfactants such as CHAPS, Tween-80 ™ (Kao Ichi Atlas), digitonin, and dexcholate can be added to the buffer to reduce non-specific binding. Furthermore, a protease inhibitor such as PMSF, leptin, E-64 (manufactured by Peptide Research Institute), and pepstatin can be added for the purpose of suppressing the degradation of HI7T213 and ligand by the protease. 0.0 to the HI 7 T 21 3 solution lml~l Om 1, were added labeled ligand a certain amount (5000 c pm~5 OOOOO cm), coexist simultaneously ^10-4 to 10-the test compound. Non-specific binding Prepare a reaction tube containing a large excess of unlabeled ligand to determine (NSB). The reaction is carried out at about 0 ° C. to about 50 ° C., preferably at about 4 ° C. to about 37 ° C., for about 20 minutes to about 24 hours, preferably for about 30 minutes to about 3 hours. After the reaction, the reaction solution is filtered through a glass fiber filter paper, etc., washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter paper is measured with a liquid scintillation counter or "V-counter. Count when there is no antagonistic substance When the count (BO-NS B) obtained by subtracting the non-specific binding amount (NS B) from (B 0) is set to 100%, the specific binding amount (B-NS B) becomes, for example, 50% or less. The test compound can be selected as a candidate substance capable of competitive inhibition.

Screening a substance that alters the binding property between ligand and HI7T213 To implement the above methods (iv) to (V), it is necessary to stimulate cells via HI7T213. Activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP generation, intracellular cGMP generation, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c (Activation of os, activation or suppression of pH, etc.) can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing HI7T213 are cultured on a multiwell plate or the like. Before screening, replace the medium with a fresh medium or an appropriate buffer that is not toxic to cells, add the test compound, etc., incubate for a certain period of time, and then extract cells or supernatant. Collect the liquid and quantify the product produced according to each method. When the production of a substance (for example, arachidonic acid) as an indicator of cell stimulating activity is difficult to be assayed by a degrading enzyme contained in a cell, an inhibitor for the degrading enzyme may be added to perform the assay. In addition, activities such as inhibition of cAMP production can be detected for inhibiting production of cells whose basic production has been increased with forskolin or the like.

To perform screening by measuring cell stimulating activity, cells that have expressed the appropriate HI7T213 are required. As the cells expressing the HI7T213 of the present invention, the above-mentioned recombinant HI7T213-expressing cell line and the like are desirable.

Test compounds include, for example, peptides, proteins, non-peptidic compounds, Examples include a synthetic compound, a fermentation product, a cell extract, a plant extract, an animal tissue extract, and plasma. These compounds may be novel compounds or known compounds. The test compound may form a salt. As the salt of the test compound, a salt with a physiologically acceptable acid (eg, an inorganic acid, etc.) or a base (eg, an organic acid, etc.) is used. Particularly preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.), and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, maleic acid) Acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).

A screening kit for a substance that changes the binding property between a ligand and HI7T213 includes HI7T213, a cell containing HI7T213 or a membrane fraction of the cell, and / or a ligand containing the ligand. It is.

Examples of the screening kit of the present invention include the following. 1. Screening reagent

(i) Measurement buffer and washing buffer

Hanks' Balanced Salt Solution (manufactured by Gibco) plus 0.05% serum albumin (manufactured by Sigma).

Sterilize by filtration through a filter with a pore size of 0.45 μπι, store at 4 ° C, or prepare at use.

(ii) H I 7T 213

CHO cells expressing HI 7 T 213 were subcultured into 12-well plates in ⁵ × 10 ⁵ wells. C, 5% C0 _2, followed by culturing for 2 days at 95% air.

(i ii) Labeled ligand.

^[3 H], ^[125 I], ^[14 C], ligand labeled with a ^[35 S]

Dissolve it in an appropriate solvent or buffer at 4 ° C or 120 ° C, and dilute to 1 μΜ with the measurement buffer before use.

(iv) Ligand standard solution

Dissolve the ligand in PBS containing 0.1% で serum albumin (manufactured by Sigma) to a concentration of 1 mM, and store at 120 ° C. 2. Measurement method

(i) Wash HI7T213-expressing cells cultured on a 12-well tissue culture plate twice with 1 ml of measurement buffer, and then wash 490 μl of measurement buffer. Add to each hole.

^{(Ii) 1 0- 3 ~ 1} 0- test compound ^1Q M solution 5 mu 1 after the addition, the labeled ligand 5 mu 1 was added and reacted at room temperature for 1 hour. To determine the nonspecific binding amount is left in addition 5 mu 1 to 1 0- ³ Micromax ligand instead of test compound.

(iiii) Remove the reaction solution and wash three times with 1 ml of washing buffer. The labeled ligand bound to the cells is dissolved in 0.2 N NaOH—1% SDS, and mixed with 4 ml of liquid scintillator A (Wako Pure Chemical Industries).

(iv) The radioactivity is measured using a liquid scintillation counter (manufactured by Beckman), and the Percent Maximum Binding (PMB) is determined by the following equation (Equation 1).

[Number 1]

PMB = [(B— NS B) / (B 0 -NS B)] X 1 0 0

P MB: Percent Maximum Binding

B: Value when the sample is added

NS B: Non-specific Binding

B 0: maximum binding amount

The substance obtained by using the screening method or the screening kit of the present invention is a substance that changes the binding between a ligand and HI7T213 (inhibits or promotes the binding), Specifically, a substance having a cell stimulating activity via HI 7 T 2 13 (so-called ΗI 7 Τ 13 agonist) or a substance not having the stimulating activity (so-called HI 7 T 2 13 antagonist) is there.

Examples of the substance include a peptide, a protein, a non-peptidic compound, a synthetic compound, and a fermentation product selected from the test compounds described above. These compounds may be a novel compound or a known compound. You may. The specific method of evaluating whether the subject is an HI 7 T 2 13 agonist or an antagonist may be in accordance with the following (i) to (iv).

(i) For example, the binding method shown in the screening methods (i) to (iii) above After performing an ingestion to obtain a substance that changes the binding property of the ligand to HI7T213 (particularly, inhibits the binding), the substance is mediated by HI7T213 as described above. It is determined whether or not it has cell stimulating activity. The substance having the cell stimulating activity is HI7T2 13 agonist, and the substance having no such activity is HI7T2 13 antagonist.

(ii) (a) The test compound is brought into contact with cells containing HI7T213, and the cell stimulating activity via HI7T213 is measured. The substance having cell stimulating activity is HI7T213agonist.

(b) when a compound (such as a ligand) that activates HI7T213 is brought into contact with cells containing HI7T213, a compound that activates HI7T213, and When the test compound is brought into contact with cells containing HI7T213, the cell stimulating activity via HI7T213 is measured and compared. A substance that can reduce the cell stimulating activity of the compound that activates HI7T213 is HI7T213 ant.

(iii) (a) The test compound is applied to the non-human mammal of the present invention or a part thereof, and the HI7T2133 agonist activity is assayed. The substance having agonist activity is HI 7 T 2 13 agonist.

(b) The test compound is applied to the non-human mammal of the present invention or a part thereof, and the ameliorating effect of a disease such as wound, spinal cord injury or analgesia or the renal regeneration effect is assayed. The substance which has been shown to have the effect of improving the disease or the effect of regenerating the kidney is HI7T213 agonist.

(iv) A test compound is administered to a non-human mammal of the present invention or a part thereof which has the above-mentioned phenotype or diseases such as cancer, renal disorder, cataract, dermatitis, chronic pain, and hyperalgesia. Apply and test the phenotypic or disease ameliorating effect. The substance that has been shown to have the above phenotypic or disease ameliorating effect is HI7T213 antagonist.

Since the HI7T213 agonist can activate HI7T213 similarly to the ligand for HI7T213, the HI7T213 is safe and less toxic, and has no wounds, spinal cord injury, It is useful as a prophylactic and / or therapeutic agent for analgesia or as a medicament such as a regenerative agent. Conversely, HI7T2113 antagonists can suppress the activation of ΗI7Τ213 by ligands, and are safe and low toxic, causing cancer, kidney damage, cataract, and dermatitis. It is useful as a medicament such as an agent for preventing and / or treating chronic pain and hyperalgesia.

The substance (eg, agonist, antagonist) obtained using the above-described screening method or screening kit may form a salt, such as a pharmaceutically acceptable salt. Is used. Specific examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, and salts with basic or acidic amino acids.

Preferable examples of the salt with an inorganic base include, for example, alkali metal salts such as sodium salt and potassium salt, alkaline earth metal salts such as calcium salt and magnesium salt, as well as aluminum salt and ammonium salt. .

Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-alutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, Ν, Ν, and salts with dibenzylethylenediamine.

Preferable examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like.

Preferred examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid And the like.

Preferable examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, and olginine, and preferable examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. can give.

When a substance obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned medicine, it is formulated in the same manner as the above-mentioned pharmaceutical composition containing HI7T213. be able to.

For example, the dosage of HI 7 T 2 13 agonist varies depending on the symptoms and the like. About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg per day. When administered parenterally, the single dose varies depending on the subject, target organ, symptoms, administration method, etc. In this case, it is convenient to administer about 0.01 to 3 Omg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 1 Omg by intravenous injection. . In the case of other animals, the dose can be administered in terms of weight per 6 O kg. On the other hand, the dose of HI7T213 antagosto varies depending on the symptoms and the like. 1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 2 Omg. When administered parenterally, the dosage administered once varies depending on the subject of administration, target organ, symptoms, administration method, and the like. It is convenient to administer about 0.01 to 3 Omg / day, preferably about 0.1 to 20 mg / day, more preferably about 0.1 to 1 Omg / day by intravenous injection. You. In the case of other animals, the dose can be administered in terms of 60 kg of body weight.

Next, a method for screening a substance that regulates the expression level of HI7T213 will be described.

Specifically, the starling method of the present invention comprises the steps of: (i) culturing cells capable of expressing HI7T213 in the presence and absence of a test compound in the presence of each HI7 A screening method for a substance that promotes or inhibits the expression of HI7T213, which comprises measuring and comparing the expression level of T213 or the mRNA level encoding a ligand.

Cells or tissues that can express HI7T213 include human non-human warm-blooded animals (eg, guinea pigs, rats, mice, -birds, rabbits, swine, pigs, hidges, chickens, monkeys, etc.). (E.g., neurons, endocrine cells, neuroendocrine cells, glial cells, kidney i3 cells, bone marrow cells, hepatocytes, spleen cells, mesangial cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fiber cells, muscle Cells, fat cells, immune cells (eg , Macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes, dendritic cells), megakaryocytes, synovial cells, chondrocytes, bone cells, bone Blast cells, osteoclasts, mammary cells, or stromal cells, or precursors, stem cells, or cancer cells of these cells, or any tissue in which those cells are present, for example, the brain, various parts of the brain (eg, Olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla, cerebellum), spinal cord, pituitary gland, stomach, knee, kidney, liver, gonad, thyroid, gall bladder, bone marrow, adrenal gland, Skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels, heart, thymus, spleen, salivary gland, peripheral blood, prostate, testes (testis), ovary, placenta, uterus, bone, cartilage, joints, skeletal muscle Using May be. At that time, a cell line or a primary culture system may be used. Alternatively, a transformant transformed with a recombinant vector containing the above-described DNA encoding HI7T213 may be used.

The method for culturing cells capable of expressing HI7T213 is the same as the above-described method for culturing a transformant.

As the test compound, a DNA library or the like can be used in addition to the test compounds described above.

The expression level of HI7T213 can be measured by a known method such as an immunochemical method using an antibody or the like, or a ligand can be encoded! nRNA can also be measured by a known method using the Northern hybridization method, RT-PCR or TaqMan PCR.

In order to compare the expression level of mRNA by the hybridization method, a known method or a method similar thereto, for example, Molecular Cloning 2nd (J. Sambrook et al., Cola spring Haroor Lab. Press) , 1989).

Specifically, the amount of mRNA encoding HI7T213 is determined by measuring RNA extracted from cells according to a known method, DNA or a part thereof encoding HI7T213, or the antisense of the present invention. · Contacting with a polynucleotide and measuring the amount of mRNA bound to the DNA encoding HI7T213 or a part thereof or the antisense polynucleotide of the present invention. DNA encoding HI 7 T 213 or a part thereof, or antisense of the present invention • By labeling the polynucleotide with, for example, a radioisotope, a dye, or the like, the amount of mRNA bound to the DNA encoding HI7T213 or a part thereof or the antisense polynucleotide of the present invention can be reduced. Can be easily measured. As the radioactive isotope, for example, ³² P, ³ H, or the like is used. Fluorescent dyes such as ROX (manufactured by PE Biosystems), Cy5 (manufactured by Amersham), and Cy3 (manufactured by Amersham) are used. In addition, the amount of mRNA is determined by converting RNA extracted from cells into cDNA using reverse transcriptase, and then using DNA encoding HI7T213 or a part thereof or the antisense polynucleotide of the present invention as a primer. The PCR can be performed by measuring the amount of cDNA to be amplified.

Thus, a test compound that increases the amount of mRNA encoding HI7T213 can be selected as a substance having an activity of promoting the expression of HI7T213, and A test compound that reduces the amount of encoded mRNA can be selected as a substance having an activity of inhibiting HI 7T213 expression.

Further, the present invention provides

(ii) Culture of transformants transformed with recombinant DNA in which a reporter gene is ligated downstream of the promoter region or enhancer region of the gene encoding HI7T213 in the presence and absence of a test compound The present invention provides a method for screening for a substance that promotes or inhibits the promoter activity, wherein the respective reporter activities are measured and compared in such a case.

Reporter genes include, for example, 1 ac Z (J3-galactosidase gene), chloramphenicol acetyltransferase (CAT), luciferase, growth factor, β-glucuronidase, anorecali phosphatase, Green fluorescent protein (GFP) , J3-lactamase and the like are used.

By measuring the amount of the reporter gene product (eg, mRNA, protein) using a known method, a test compound that increases the amount of the reporter gene product can be assayed for the activity of the HI7T213 promoter or enhancer of the present invention. Control (Special HI 7 T 2 13, ie, a substance having an activity of promoting the expression of HI7T213. Conversely, a test compound that reduces the amount of the reporter gene product is used to control (particularly inhibits) the activity of the HI7T213 promoter or enhancer, ie, the expression of HI7T213 is inhibited. Can be selected as a substance having an activity.

The same test compounds as described above are used.

The culturing of the transformant can be performed in the same manner as the above-mentioned transformant. The vector construction of the reporter gene and the Atsey method can be performed according to a known technique (for example, Molecular Biotechnology 13, 29-43, 1999).

Substances having the activity of promoting the expression of HI7T213 (the activity of increasing the expression level) are used as preventive and / or therapeutic agents for wounds, spinal cord injury, analgesia, etc. Can be used as

Substances that have the activity of inhibiting the expression of HI7T213 (the activity of decreasing the expression level) include the prophylactic and / or therapeutic agents for cancer, kidney damage, cataract, dermatitis, chronic pain, hyperalgesia, etc. It can be used as a medicine.

The substance obtained by using the screening method of the present invention is a substance selected from the test compounds described above. As the salt of the substance obtained by using the screening method of the present invention, the same salt as the salt of the substance obtained by using the agonist or antagonist screening method described above is used.

When the substance obtained by using the screening method of the present invention is used as the above-mentioned prophylactic and / or therapeutic agent, it can be carried out according to a conventional means. For example, tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be prepared in the same manner as in the above-mentioned pharmaceutical composition containing the ligand.

The preparations obtained in this way are safe and have low toxicity, for example, in humans or non-human warm-blooded animals (eg, mice, rats, rabbits, rabbits, sheep, pigs, horses, birds, birds, cats). , Dogs, monkeys, chimpanzees, etc.) may vary depending on the action, target disease, administration target, administration route, etc. Although there are differences, for example, when a substance that promotes the expression of HI7T213 is orally administered for the purpose of treating a wound, generally the adult (per 60 kg of body weight) The substance is administered from about 0.1 to: L 0 mg, preferably about 1.0 to 5 Omg, more preferably about 1.0 to 20 mg. When administered parenterally, the single dose of the substance may vary depending on the subject of administration, target disease, etc.For example, injection of a substance that promotes the expression of HI7T213 for the purpose of treating wounds When administered to a normal adult (per 60 kg body weight) in the form of a drug, the substance is administered in an amount of about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 30 mg per day. It is convenient to administer about 0.1 to about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of the body weight of 6 O kg.

On the other hand, for example, when a substance that inhibits the expression level of HI7T213 is orally administered for the purpose of treating cataract, generally, in an adult (per 6 kg of body weight), the substance is used daily. About 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg is administered. When administered parenterally, the dosage of the substance may vary depending on the administration target, the target disease, etc.For example, a substance that inhibits the expression of HI7T213 for the purpose of treating cataracts When usually administered to adults (per 60 kg) in the form of injections, the substance is administered in an amount of about 0.01 to 30 mg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg. It is convenient to administer about 0.1 to about 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of the body weight of 60 kg.

These drugs can be formulated and used in the same manner as the above-mentioned drugs containing HI7T213.

(7) Knock animal

The present invention provides a non-human mammalian embryonic stem cell in which the DNA of the present invention is inactivated and a non-human mammal deficient in expression of the DNA of the present invention.

That is, the present invention

(i) a non-human mammalian embryonic stem cell in which the DNA of the present invention has been inactivated,

(ii) the embryonic stem cell according to (i), wherein the DNA is inactivated by introducing a reporter gene (eg, a monogalactosidase gene derived from Escherichia coli); (iii) the embryonic stem cell of (i), which is neomycin-resistant,

(iv) the embryonic stem cell according to (i), wherein the non-human mammal is a rodent;

(V) the embryonic stem cell according to (iv), wherein the rodent is a mouse,

(vi) a non-human mammal deficient in expression of the DNA, wherein the DNA of the present invention is inactivated. (vii) the DNA is inactivated by introducing a reporter gene (eg, a monogalactosidase gene derived from Escherichia coli). The non-human mammal according to (vi), wherein the reporter gene can be expressed under the control of a promoter for the DNA of the present invention,

(viii) the non-human mammal according to (vi), wherein the non-human mammal is a rodent; (ix) the non-human mammal according to (viii), wherein the rodent is a mouse; and

(X) administering a test compound to the animal described in paragraph (vii) and detecting the expression of a reporter gene; a compound or a salt thereof that promotes or inhibits the promoter activity of DNA of the present invention. Provide a screening method.

The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are artificially mutated DNA of the present invention possessed by the non-human mammal to suppress the DNA expression ability, Alternatively, the DNA substantially does not have the ability to express the HI7T213 of the present invention by substantially eliminating the activity of the HI7T213 of the present invention encoded by the DNA ( Hereinafter, it may be referred to as the knockout DNA of the present invention.) A non-human mammal embryonic stem cell (hereinafter abbreviated as ES cell).

As the non-human mammal, the same one as described above is used.

The method of artificially adding a mutation to the DNA of the present invention can be performed, for example, by deleting a part or all of the DNA sequence and inserting or substituting another DNA sequence by a genetic engineering technique. The knockout DNA of the present invention may be prepared by, for example, shifting the codon reading frame or disrupting the function of the promoter or exon by these mutations.

Specific examples of the non-human mammalian embryonic stem cells of the present invention in which DNA is inactivated (hereinafter, abbreviated as the DNA-inactivated ES cells of the present invention or the knockout ES cells of the present invention) include, for example, The DNA of the present invention from a non-human mammal The exon function is destroyed by introducing a drug resistance gene typified by the neomycin resistance gene or hygromycin resistance gene, or a reporter gene typified by the 1 ac Z gene or cat gene into the exon part. Alternatively, by inserting a DNA sequence that terminates transcription of the gene (for example, a poly-A addition signal) into the intron between the exons, and preventing the synthesis of complete mRNA, the gene can be consequently reduced. A DNA chain having a DNA sequence constructed so as to disrupt DNA (hereinafter abbreviated as a targeting vector) is introduced into the chromosome of the animal by, for example, a homologous recombination method. Southern hybridization analysis or targeting vector using the DNA sequence above or near it as a probe The DNA sequence and the targeting vector obtained by analyzing the DNA sequence of the neighboring region other than the DNA of the present invention used in the preparation by the PCR method using primers, and selecting the knockout ES cells of the present invention. be able to.

As the ES cells from which the DNA of the present invention is inactivated by the homologous recombination method or the like, for example, those already established as described above may be used, or the known Evans and Kaufman method may be used. It may be newly established according to. For example, in the case of mouse ES cells, the 129-line ES cells are generally used at present. However, since the immunological background is not clear, it is necessary to use a pure line instead of immunologically. purpose, for example, BDF ₁ mice of C 5 7 B LZ6 mouse or C 5 7 egg number of lack of BL / 6 improved by crossing with DBA / 2, such as heat transfer manner background to get the apparent ES cells (C57B LZ6 and DB A / 2 can be used for the establishment of F. BDF mice have the advantage of large number of eggs collected and robust eggs. Since the ES cells obtained using this mouse have a background of 5 7 BL / 6 mice, the genetic background of the ES cells obtained by creating a pathological model mouse by back-crossing with C 57 B LZ6 mice was / 6 mouse can be used advantageously.

In addition, when ES cells are established, blastocysts 3.5 days after fertilization are generally used. Many early embryos can be obtained. Although either male or female ES cells may be used, male ES cells are generally more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce the complexity of culturing.

As an example of a method for determining the sex of ES cells, a method of amplifying and detecting a gene in the sex-determining region on the Y chromosome by the PCR method can be given as an example. Using this method, conventionally, for example G-banding method, it requires about 1 0 ⁶ cells for karyotype analysis, since suffices ES cell number of about 1 colony (about 5 0) However, the primary selection of ES cells in the early stage of culture can be performed by gender discrimination, and the early stage of culture can be greatly reduced by enabling the selection of male cells at an early stage.

The secondary selection can be performed, for example, by confirming the number of chromosomes by the G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number, but if it is difficult due to the physical manipulation at the time of establishment, after knocking out the gene of the ES cells, the normal cells (for example, mouse In this case, it is desirable to clone again into a cell whose chromosome number is 2 n == 40).

The embryonic stem cell line obtained in this way usually has very good growth potential, but it must be carefully subcultured because it tends to lose its ability to generate individuals. For example, on a suitable feeder cell such as STO fibroblasts, in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air) in the presence of LIF (1-10000 OU / ml) Alternatively, incubate the cells at about 37 ° C in 5% oxygen, 5% carbon dioxide, 90% air, etc. At the time of subculture, for example, trypsin ZEDTA solution (usually 0.001-0 5% trypsin / 0.1-5 mM EDTA (preferably, about 0.1% trypsin / ImM EDTA) is treated to form a single cell, which is then seeded on a newly prepared feeder cell. Such passage is usually performed every 11 to 13 days. At this time, cells are observed, and if morphologically abnormal cells are found, it is desirable to discard the cultured cells.

ES cells can be cultured in monolayers up to high densities or in suspension cultures to form cell clumps under appropriate conditions to produce various types of cells such as parietal, visceral, and cardiac muscles. [MJ Evans and MH Kauf man, Nature 292, 154, 1981; GR Martin, Proc. Natl. Acad. Sci. USA, 78, 7634, 1981; TC Doetschman et al., Journal of embryology and experimental morp. 87, 27, 1985], and the DNA-deficient cells of the present invention obtained by differentiating the ES cells of the present invention are useful in the cell biological examination of HI7T213 of the present invention in vitro. is there.

The non-human mammal deficient in DNA expression of the present invention can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level.

As the non-human mammal, those similar to the above can be used.

The non-human mammal deficient in DNA expression of the present invention can be obtained, for example, by introducing the targeting vector prepared as described above into a mouse embryonic stem cell or a mouse egg cell and introducing the targeting vector of the present invention into a non-human mammal. The DNA of the present invention can be knocked out by causing the activated DNA sequence to undergo homologous recombination to replace the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination.

The cells in which the DNA of the present invention has been knocked out are the DNA sequence on the southern hybridization analysis or targeting vector using the DNA sequence on or near the DNA of the present invention as a probe, and the mouse used for the targeting vector. It can be determined by analysis by a PCR method using, as a primer, a DNA sequence of a neighboring region other than the DNA of the present invention derived from the DNA. When non-human mammalian embryonic stem cells are used, a cell line in which the DNA of the present invention has been inactivated is cloned by homologous recombination, and the cells are cloned at an appropriate time, for example, at the 8-cell stage. The chimeric embryo is injected into a human mammalian embryo or blastocyst, and the resulting chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced animal is a chimeric animal composed of both cells having the normal DNA locus of the present invention and cells having the artificially altered DNA locus of the present invention. When a part of the germ cells of the chimeric animal has the mutated DNA locus of the present invention, all tissues are artificially mutated from a population obtained by crossing such a chimeric individual with a normal individual. An individual composed of cells having the added DNA locus of the present invention, For example, it can be obtained by sorting based on the judgment of coat color. The individual thus obtained is usually an individual having a heterozygous expression of the peptide of the present invention, which is crossed with an individual having a heterozygous expression of the peptide of the present invention. Can be obtained.

When an egg cell is used, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into the nucleus of an egg cell by a microinjection method. Compared to a human mammal, it can be obtained by selecting those having a mutation in the DNA locus of the present invention by homologous recombination of the gene.

In this way, the individual in which the DNA of the present invention has been knocked out can be bred in an ordinary breeding environment after confirming that the DNA has been knocked out in the animal individual obtained by mating. .

In addition, germline acquisition and retention may be performed in accordance with a standard method. That is, by crossing male and female animals having the inactivated DNA, a homozygous animal having the inactivated DNA on both homologous chromosomes can be obtained. The obtained homozygous animal can be efficiently obtained by rearing the mother animal in a state where one normal individual and plural homozygous animals are obtained. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated DNA are bred and subcultured.

The non-human mammalian embryonic stem cells in which the DNA of the present invention has been inactivated are extremely useful for producing the non-human mammal deficient in expressing the DNA of the present invention.

In addition, since the non-human mammal deficient in expression of the DNA of the present invention lacks various biological activities that can be induced by the peptide of the present invention, the non-human mammal may be caused by inactivation of the biological activity of the peptide of the present invention. It is useful for investigating the causes of these diseases and examining therapies, because they can serve as models for the diseases that occur.

(7a) A method for screening a substance having a prophylactic and / or therapeutic effect on a disease caused by DNA deficiency or damage according to the present invention

The non-human mammal deficient in expression of the DNA of the present invention comprises a screen of a substance having a prophylactic and / or therapeutic effect on a disease caused by deficiency or damage of the DNA of the present invention. Can be used for

That is, the present invention comprises administering a test compound to a non-human mammal deficient in expression of the DNA of the present invention, and observing and measuring changes in the animal. Provided is a method for screening a substance having a prophylactic and / or therapeutic effect or a renal regeneration effect on a disease caused by the disease, for example, wound, spinal cord injury, analgesia and the like. .

Examples of the non-human mammal deficient in DNA expression of the present invention used in the screening method include the same as described above.

The same test compounds as described above are used.

Specifically, a non-human mammal deficient in expression of the DNA of the present invention is treated with a test compound, compared with a non-treated control animal, and changes in the organs, tissues, disease symptoms, etc. of the animal are used as indices. The prophylactic and / or therapeutic effects of a test compound can be tested. As a method of treating a test animal with a test compound, for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, properties of the test compound, and the like. The dose of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.

In the screening method, when a test compound is administered to a test animal, symptoms such as wound, spinal cord injury, and analgesia of the test animal are about 10% or more, preferably about 30% or more, and more preferably about 30% or more. If the improvement is 50 ° / ₀ or more, the test compound can be selected as a substance having a prophylactic and / or Z- or therapeutic effect on the above-mentioned diseases.

Specifically, for example, the test compound can be used as a prophylactic and / or therapeutic agent for wounds, spinal cord injury, analgesia, etc., or as a medicament such as a renal regenerating agent. The substance is a substance selected from the above-mentioned test compounds, and has a preventive and / or therapeutic effect on a disease caused by deficiency or damage of HI7T213, so that it is safe and low toxic to the disease. It can be used as a medicament such as a sexual prophylactic and / or therapeutic agent. Further, a compound derived from the substance obtained by the above screening may be used in the same manner. Can be.

The substance obtained by the screening method may form a salt. Examples of the salt of the substance include physiologically acceptable acids (eg, inorganic acids, organic acids, etc.) and bases (eg, alkali metal And the like, and especially preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).

A drug containing the substance obtained by the screening method can be produced in the same manner as the drug containing HI7T213 described above.

The preparations obtained in this way are safe and low toxic and can be used, for example, in humans or non-human mammals (for example, rats, mice, guinea pigs, egrets, sheep, butter, pigeons, horses, horses, Cats, dogs, monkeys, etc.). The dose of the substance varies depending on the target disease, the administration target, the administration route, and the like. For example, when the substance is orally administered for the purpose of treating a wound, it is generally an adult patient (assuming a body weight of 60 kg). In about, about 0.1 to 10 Omg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of the compound is administered per day. In the case of parenteral administration, the single dose of the substance may vary depending on the administration subject, target disease, etc.For example, the substance is usually administered in the form of an injection to an adult patient (body weight) for the purpose of treating wounds. (As 6 O kg), about 0.01 to 30 mg, preferably about 0.1 to 2 Omg, and more preferably about 0.1 to 10 mg of the substance It is conveniently administered by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

(7b) A method for screening a substance that promotes or inhibits the activity of a promoter for DNA of the present invention

The present invention provides a test compound administered to a non-human mammal deficient in expression of a DNA of the present invention, and detects the expression of a reporter gene. To provide a method for screening substances to be cleaned. In the above-described screening method, the non-human mammal deficient in expression of the DNA of the present invention may be a non-human mammal deficient in expression of the DNA of the present invention, wherein the DNA of the present invention introduces a reporter gene. As a result, a reporter gene that can be expressed under the control of the promoter for the DNA of the present invention is used.

Examples of the test compound include the same compounds as described above.

As the reporter gene, the same one as described above is used, and a 1 ac Z gene, a soluble alkaline phosphatase gene, a luciferase gene, and the like are preferable.

In a non-human mammal deficient in expression of the DNA of the present invention in which the DNA of the present invention has been replaced with a reporter gene, the reporter gene is under the control of the promoter for the DNA of the present invention. By tracing the expression, the activity of the promoter can be detected.

For example, when a part of the DNA region encoding the peptide of the present invention is substituted with the 1acZ gene derived from Escherichia coli, the tissue that expresses the peptide of the present invention should be used instead of the peptide of the present invention. ] 3-galactosidase is expressed. Therefore, by staining with a reagent that serves as a substrate for -galactosidase, such as, for example, 5-bromo-1-chloro-3- ^ f-ndolyl-1] 3-galactopyranoside (X-ga1), In addition, the expression state of the HI7T213 of the present invention in an animal body can be observed. Specifically, the HI7T213-deficient mouse of the present invention or a tissue section thereof is fixed with dartal aldehyde or the like, washed with phosphate buffered saline (PBS), and then stained with X-ga1 staining solution. After reacting at room temperature or around 37 ° C for about 30 minutes to 1 hour, the β-galactosidase reaction is stopped by washing the tissue sample with ImM EDTA / PBS solution, and the color is observed. do it. Further, mRNA encoding 1ac c may be detected according to a conventional method.

The substance obtained by using the above-mentioned screening method is a substance selected from the above-described test compounds, and is a substance that promotes or inhibits the promoter activity for the DNA of the present invention.

The substance obtained by the screening method may form a salt, Examples of the salt include salts with physiologically acceptable acids (eg, inorganic acids, etc.) and bases (eg, organic acids, etc.), and particularly preferred are physiologically acceptable acid addition salts. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid, etc.) and organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid) Succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid, etc.).

Since the substance of the present invention that promotes the promoter activity for DNA can promote the expression of HI7T213 and promote the function of HI7T213, for example, wound, spinal cord injury, analgesia It can be used as a medicament such as a preventive and / or remedy for diseases and renal regenerating agents.

On the other hand, the substance of the present invention that inhibits the promoter activity on DNA can inhibit the expression of HI7T213 and inhibit the function of HI7T213. It can be used as a medicament such as a preventive and / or therapeutic agent for renal disorder, cataract, dermatitis, chronic pain, hyperalgesia and the like.

Furthermore, substances derived from the substances obtained by the above screening can be used in the same manner.

A drug containing the substance obtained by the screening method can be produced in the same manner as the above-mentioned drug containing a ligand.

The preparations obtained in this way are safe and low toxic and can be used, for example, in humans or non-human mammals (eg, rats, mice, guinea pigs, egrets, sheep, butter, pigeons, pigs, dogs). , Cats, dogs, monkeys, etc.). The dose of the substance varies depending on the target disease, the administration target, the administration route, and the like.For example, when a substance that promotes the promoter activity of the DNA of the present invention for the purpose of treating a wound is orally administered, it is generally used. In adult patients (assuming a body weight of 6 O kg), the substance is administered at about 0.1 to 10 Omg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 2 Omg per day. When administered parenterally, the single dose of the substance may vary depending on the administration subject, target disease, and the like.For example, a substance that promotes the promoter activity of the DNA of the present invention for the purpose of treating a wound may be used in an injection. When administered to adult patients (assuming a body weight of 6 O kg) in the form About 0.01 to 3 Omg, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 1 Omg, is administered by intravenous injection. For other animals, the equivalent dose per 60 kg body weight can be administered. On the other hand, for example, when a substance that inhibits the promoter activity of DNA of the present invention is orally administered for the purpose of treating cataract, generally, in an adult patient (assuming a body weight of 60 kg), the substance is used in an amount of about 0.1 to 10 mg / day. The dose is 10 Omg, preferably about 1.0 to 5 Omg, more preferably about 1.0 to 2 Omg. In the case of parenteral administration, the single dose of the substance varies depending on the administration subject, target disease, etc., for example, a substance that inhibits the promoter activity of the DNA of the present invention for the purpose of treating cataract. When administered to an adult patient (assuming a body weight of 6 O kg) in the form of an injection, the substance is administered in an amount of about 0.01 to 3 Omg per day, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day. It is convenient to administer about 0.1 to 1 Omg by intravenous injection. For other animals, the equivalent dose per 60 kg body weight can be administered.

As described above, the non-human mammal deficient in expression of the DNA of the present invention is extremely useful for screening a substance that promotes or inhibits the activity of the promoter of the DNA of the present invention. It can greatly contribute to investigating the cause of various diseases caused by the disease or to develop preventive and / or therapeutic drugs.

Further, using a DNA containing the promoter region of HI7T213 of the present invention, genes encoding various proteins are ligated downstream thereof and injected into egg cells of an animal to produce a so-called transgenic animal (gene). Creating an introduced animal) would allow the specific synthesis of the peptide and study its effects on the organism. Furthermore, by linking an appropriate reporter gene to the above promoter portion and establishing a cell line that expresses the same, a low molecule having an action of specifically promoting or suppressing the production ability of the peptide itself of the present invention in the body. Can be used as a search system for compounds.

The sequence numbers in the sequence listing of the present invention indicate the following sequences.

[SEQ ID NO: 1] This shows the amino acid sequence of human HI 7T213.

[SEQ ID NO: 2] _C D encoding human HI 7T213 (HI 7 T 213) Shows the nucleotide sequence of NA.

[SEQ ID NO: 3] This shows the amino acid sequence of human HI7T2113, in which the 169th Asp in the amino acid sequence represented by SEQ ID NO: 1 has been changed to Asn. .

[SEQ ID NO: 4] c D encoding human H I 7 T 2 13 (hH I 7 T 2 13)

1 shows the nucleotide sequence of NA.

[SEQ ID NO: 5] This shows the amino acid sequence of mouse H I 7 T 2 13 (# 11). [SEQ ID NO: 6] This shows the base sequence of cDNA encoding mouse HI7T213 (# 11).

[SEQ ID NO: 7] This shows the amino acid sequence of mouse H I 7 T2 13 (# 8).

[SEQ ID NO: 8] This shows the base sequence of cDNA encoding mouse HI7T213 (# 8).

[SEQ ID NO: 9] This shows the base sequence of the primer used in the PCR method performed in Example 1 described later.

[SEQ ID NO: 10] This shows the base sequence of one primer used in the PCR method performed in Example 1 described later.

[SEQ ID NO: 11] This shows the base sequence of one primer used in the PCR method performed in Example 1 described later.

[SEQ ID NO: 12] This shows the base sequence of one primer used in the PCR method performed in Example 1 described later.

[SEQ ID NO: 13] This shows the base sequence of one primer used in the PCR method performed in Example 2 described later.

[SEQ ID NO: 14] This shows the base sequence of one primer used in the PCR method performed in Example 2 described later.

[SEQ ID NO: 15] This shows the base sequence of one primer used in the PCR method performed in Example 4 described later.

[SEQ ID NO: 16] This shows the base sequence of one primer used in the PCR method performed in Example 4 described later.

[SEQ ID NO: 17] Primer used in PCR method performed in Example 6 described later 1 shows one base sequence.

[SEQ ID NO: 18] This shows the base sequence of one primer used in the PCR method performed in Example 6 described later.

[SEQ ID NO: 19] This shows the base sequence of one primer used in the PCR method performed in Example 6 described later.

[SEQ ID NO: 20] This shows the base sequence of one primer used in the PCR method performed in Example 8 described later.

[SEQ ID NO: 21] This shows the base sequence of one primer used in the PCR method performed in Example 8 described later.

[SEQ ID NO: 22] This shows the base sequence of one primer used in the PCR method performed in Example 8 described later.

[SEQ ID NO: 23] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 24] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 25] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 26] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 27] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 28] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 29] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 30] This shows the base sequence of the primer used in the PCR method performed in Example 15 described later.

[SEQ ID NO: 31] This shows the base sequence of one primer used in the PCR method performed in Example 15 described later. In the specification of the present application, when bases and amino acids are indicated by abbreviations, the abbreviations in IUPAC-IUB Commission on Biochemical Nomenclature are based on common abbreviations in the art, and examples thereof are as follows. .

DNA Deoxylipo nucleic acid

c DNA compensatory deoxyribonucleic acid

A adenine

T thymine

G Guanin

C cytosine

RNA liponucleic acid

mRNA messenger liponucleic acid

d AT P Deoxyadenosine triphosphate

d TT P Deoxythymidine triphosphate

d GT P Deoxyguanosine triphosphate

d CT P Deoxycytidine triphosphate

ATP adenosine triphosphate

EDT A Ethylenediaminetetraacetic acid

S D S Sodium dodecyl sulfate

G 1 y Daricin

A 1 a: Aranine

V a 1: Valine

Leu: Leucine

I 1 e isoleucine

S e r serine

T h r:

C y s Sistine

Me t Methionin

G 1 u Glutamic acid

As p Aspartic acid L ys • p

A r g: Arginine

HIS: Histige,>

Jr Jti e: Huenialanin

T y r.

丄 r p-Toji, Tonoan

Pro • Proline

ゝノ

A sn:, snow

: Ku, >>,

i n noretan

pGIu: pyroglutamic acid

JVL e methyl group

Etethyl group

B u butyl group

r phenyl group

し thiazolidine-1 4 (R)

Substituents and protections commonly used in this specification

I do.

T o s p—Tonoreensnorefoni

CHO Honoreminore

B z 1 Ben, Nnore

Cl ₂ Bzl 2,6-dichlorobenzene

B o m benzinoleoxymethyl

Z benzinoleoxy force

C 1-Z 2-Black benzyloxycarpole Br-Z2-Bromobenzyloxycanolepole Boc t Butoxycanolepole

DNP Zinito mouth phenol

T r t Trityl

B um t-butoxymethyl Fmo c: N—9—Funoleoreninoleme

HOB t: 1—Hydroxybenztriazole

HOOB t: 3, 4—Jihi Draw 3—Hydroxy 1 4-Oxo 1

1, 2, 3 Benzotriazine

HONB: 1-hydroxy-5-norbornene-2,3-dicarboxy

Shimid

DCC: N, N 'dicyclohexylcarbodiimide

Transformants obtained in Example 2 described later Escherircichaco1iJ

Ml 0 9 / p C AG 2 1 3—1 is from 1/02/2005, 1/15, Tsukuba East 1-chome, Ibaraki Pref. 1 1 Central No. 6 (Zip code 3 0 5 _ 8 5 6 6) It has been deposited with the National Institute of Advanced Industrial Science and Technology (AIST) under the deposit number F ERM BP—8207.

Hereinafter, the present invention will be described more specifically with reference to Examples, but it goes without saying that the present invention is not limited thereto. Example 1 Expression of Mouse hHI7T213 Gene in Tissue

Plaque hybridization was performed on a mouse genomic library (129 / SvJ, Toyobo) using the hHI7T213 gene as a probe to obtain the mouse-type hHI7T213 gene. Was. No. After hybridization, the cells were washed at a final salt concentration of 0.5 × SSC at 65 ° C. to obtain single plaques (# 8 SEQ ID NO: 8, # 11 SEQ ID NO: 6). Among the genes obtained, the # 8 gene (corresponding to niMrgA6) and the # 11 gene (similar to mMrgA4) were examined for their intrinsic gene expression in each tissue (Figure 1).

C57BL / 6 mice (Charles River Japan) RT-PCR Southern hybridization was performed on each tissue. That is, total RNA was prepared from tissues of the dorsal root ganglion, brain, small intestine, muscle, heart, cortex, kidney, liver, spleen, and testis, and treated with reverse transcriptase. Next, a primer set (PIWY primer: TGCCTGTCTGT (C / A) CT (G / C)) based on the amino acid sequence common to # 8 and # 11 (CLSV (M / L) / A) TGCCC (C / T) ATCTGGTAT (SEQ ID NO: 9) and CGLP primer: GGGC The reaction product subjected to PCR by AA (C / T) CC (G / A) CAGAGGA (G / A) AAAAACCAAAA (SEQ ID NO: 10)) was electrophoresed, and then transferred to a membrane filter. For the transferred filter, oligo DNA (# 8 probe: TACCAAATATGAAGATGA CTATGG (SEQ ID NO: 11), # 11 probe) corresponding to the amino acid sequence (# 8: TKYEDDY G, # 11: GPKYVIDS) specific to both factors : GGTCCCAAATATGTAATTGACTCT (SEQ ID NO: 12)) was used as a probe for Southern hybridization to examine tissues expressing both factors. At this time, Oligo 'dT tailing kit (Roche) was used for labeling the probe, and washing after hybridization was performed at 42 ° C using 2xSSC solution. The # 8 gene was expressed in the brain from an early age, and was clearly expressed in the mature brain and testis. In contrast, the # 11 gene was also clearly expressed in the dorsal root ganglia from an early age, and was also expressed in the mature brain, muscle, heart, and testis.

From the above results, it was clarified that among the Mrg gene group in mice, the gene was expressed not only in the dorsal root ganglia. Example 2 Construction of expression vector for transgenic rat production

An expression vector for producing transgenic rats, pCAG2131, was constructed according to a conventional method (FIG. 2).

In this plasmid, a DNA fragment (SEQ ID NO: 4) encoding the hHI7T213 gene was inserted into the EcoRI site of pCXN2. The preparation of the hHI7T213 gene and the contents of plasmid pCXN2 are shown in (1) and (2) below.

(1) hHI7T213 gene: DNA encoding human-derived hHI7T213 gene (SEQ ID NO: 4, JP-A-2000-166656) The PCR method was carried out using primers of TTG AATTCGCCACCATGGATTCAACCATCCCAGTCT (SEQ ID NO: 13) and TTGAATTCTT ATCACTGCTCCAATCTGCTTCCCGACAGCT (Toshimi IJ number: 14), and the obtained fragment was digested with EcoRI. 70 bp fragment.

(2) pCXN2: CAG promoter containing the chicken actin promoter (170

0 b ρ), a region containing the polyA additional signal (700 bp), the SV40 replication initiation region, the ampicillin resistance gene, and the neomycin resistance gene. With a total length of 5900 b t>.

PCAG213-1 was transformed into Escherichia coli JM109 to obtain Escherichia coli JM109 / p CAG213-13-1. In the production of transgenic rats, pCAG2113-1 was digested with Sail and Pvul, and then a target fragment of 370 bp was obtained by partial digestion of BamHI. Example 3 Preparation of transgenic rats transfected with hHI7T213 Injecting 30 IU PMSG intraperitoneally to female rats for egg collection (Wistar strain, 9 weeks old), 12 hours light period / 12 hours dark period After breeding in a breeding room for 2 days, 5 IU of hCG was intraperitoneally administered and mated with male rats (Wistar strain, I, ² weeks old). Separately, spermatogenic female rats (Wistar strain, 9 to 13 weeks of age) which are in spontaneous estrus were mated with vasectomized male rats (Wistar strain, 10 weeks of age or older). On the following day, the abdominal cavity of the female rat for egg collection confirmed to be mated by vaginal plug formation was opened, the oviduct was removed, and the HER medium containing 20% FCS (HAM-F12 powder medium (Dainippon Pharmaceutical) 3.180 g, RPM I ~ 1 6 4 0 powdered medium (Dainippon Pharmaceutical Co., Ltd.) 1. 04 0 g, MEM E ag 1 e powdered medium (Dainippon Pharmaceutical Co., Ltd.) 0. 9 5 0 g, N a HC 0 3 ( Wako pure Chemical 0.780 g, Penicillin-G (GIBCO BRL) 500 OU and ぴ Streptomycin (GIBCO BRL) 500 000 U dissolved in 500 ml distilled water), tweezers under a stereomicroscope And took out the fertilized egg. The fertilized egg from which the cumulus cells were removed was sucked up with a pit and covered with mineral oil at 20 ° /. Placed in a drop of HER medium containing FCS, and cultured at 37 ° C, 5% C0 ₂ under until the injection.

The fertilized eggs were placed in a drop of PBS containing ²⁰ % FCS covered with mineral oil and suction-fixed with a holding pipe. The injection fragment solution (l O wg / ml) prepared in Example 2 was aspirated into an injection pipette, and the injection pipe was pierced into the male pronucleus of a fertilized egg under a stereoscopic microscope, and the injection fragment was injected. Was injected. After Injiwekushiyon completion, fertilized eggs are placed in a drop of HER medium containing 20% FCS covered with mineral oil and incubated at 37 ° C, 5% C0 ₂ under until implantation into embryo reception female.

Anesthetized female rats confirmed to be pseudopregnant by vaginal plug formation were anesthetized with Nembutal, then the back was incised, the fat mass was pinched with forceps, pulled out, and fixed with clamp. Was. The ovary was torn with a tweezer under a stereoscopic microscope, and 8 to 13 fertilized eggs were injected into the opening of the fallopian tube using a transfer pipe. After returning the ovaries and fallopian tubes to the body and suturing the incision, they were kept in a breeding room for 12 hours light / 12 hours dark. Rats (FOs) were born 22 days after embryo transfer at day 0. Transmission of the transgene to the offspring rat was confirmed by cutting the tail with lcni scissors, isolating DNA from the tissue extract by a conventional method, and performing PCR.

The F0 individuals whose transgene transmission was confirmed were crossed with Wistar rats when they became reproductive, to obtain offspring (F1). Transmission of the transgene was confirmed in the same manner as above, and F1 individuals having the transgene were bred to siblings to obtain a homozygote for the transgene. Example 4 Genetic analysis of transgenic rats

Using the DNA collected by the method of B. Hogan et al. (Manupulating The Mouse Embryo, 1986, Cold Spring Harvor Laboratories) at the age of 4 weeks, the hHI7T213 gene ( PCR was performed using primers (5′-TGAGCTTCACGGGGCTGACGTGCATCGTTT 3, (SEQ ID NO: 15)) designed based on the nucleotide sequence of Example 2), and 5 T TGGCACTGCTGTTAAGAGCGGACAGGAAA-3, (SEQ ID NO: 16)) I went. As a result of analyzing a total of 168 litter rats, there were 6 PCR-positive individuals in which a 720 bp PCR fragment could be detected.

The genomic DNAs of these six PCR-positive individuals were analyzed by Southern hybridization. That is, 5 μg of DNA was completely digested with EcoRI, electrophoresed on a 1.0% agarose gel, and then transferred to a nylon filter. This filter was hybridized with a probe labeled with a DNA labeling kit (manufactured by Roche's Diagnostics) using the DNA fragment containing the hHI7T213 gene obtained in Example 2 for 10 hours. The plate was washed twice with 2 x SSC and 0.1% SDS at room temperature, and then twice with 0.1 x SSC and 0.1% SDS at 68 ° C. For detection, a DIG fluorescence detection kit (Roche's Diagnostics) was used. As a result, in all of these six individuals, a 970 bp fragment derived from hHI7T213 was confirmed, and introduction of the hHI7T2l3 gene was confirmed. In addition, the introduced gene The number of copies was confirmed to be 30 copies for the 13M gun, 1 copy or less for the 82F system, 1 copy or less for the 90F system, 1 copy or less for the 92M system, 5 copies for the 96M system, and 1 copy for the 148M system. Was. Example 5 Acquisition of transgenic rat of heterozygote

When the strain (first generation (F.)) obtained in Example 4 reached the age of 12 weeks, it was bred with Wistar (CLEA Japan) strain rats to obtain the second generation (F). At the age of weeks, PCR was performed by the method described in Example 4 to select a heterozygote and used in Example 5, but the second generation was obtained for 13M, 96M, and 148M. Example 6 Taq Man analysis of hHI7T2 13 mRNA in each line of transgenic rats

The 8-week-old transgenic rats obtained in Example 5 (brain, heart, kidney, and about 50 Omg isolated from F) were homogenized in ISOGEN (Fujitsu Gene Co., Ltd.), and total RNA was obtained by a conventional method. Using 5 μg of total RNA, cDNA synthesis was performed according to the protocol using First strand cDNA synthesis kit (manufactured by Masham Fanore Macyanotech Sendo) and used as a template. For detection of the hH I 7T2 13 gene, forward priraer (5, -TCCTGTCCGCTCTTAACAGCA-3 '(SEQ ID NO: 17)) and reverse primer (5' -TTTTGACGCTGCCTAAAGGAG-3 '(SEQ ID NO: 1) 8)), and TaqMan analysis (TaqMan7700, Applied Biochemicals) was performed using the primer set of the FAM-labeled TaqMan primer (5,-TGCCAACCCCATCATTTACTTCTTCGTG-3, (SEQ ID NO: 19)). For detection, rodent G3PDH set (Applied B In addition, as a negative control, an individual determined to be a wild type by the PCR performed in Example 5 was used.HHI7T213 gene expression was 13 M, The expression was found in all organs of the 96M and 148M lines (Fig. 3), although the expression pattern was the same between 96M and 13M, but the expression level was considered to be higher in 96M. Expression level is lower than 13M and 96M, and the expression Therefore, the effect of the insertion location was suggested. Example 7 Observation of characteristics of transgenic rats

In the 13M and 96M F1 individuals obtained in Example 5, individuals developing cataracts and coarse hair were observed, but the frequency and extent were high at 96M. In contrast, no abnormality was observed at 148M, where the gene expression level was low. At 96M, transient skin rash and desquamation were observed at the peak around the age of 7 days after birth (Fig. 4). Desquamation occurred in more than 50% of offspring, but the degree of desquamation varied among individuals (Fig. 4a-b). Based on the above results, it is considered that typical phenotypes of rats overexpressing the hHI7T213 gene are 13M and 96M, and since the symptoms are clear, 96M is mainly used in subsequent analyses. Was. Example 8 Tissue distribution of hHI7T213 gene in transgenic rats

HHI7T213 gene expression level in each tissue was measured in the same manner as in Example 6. That is, 96-M 11-week-old transgenic rats (F from brain, heart, kidney, spleen, liver, retina, lens, skin, small intestine, stomach, muscle, lung, as shown in Example 6) RNA was prepared and TaqMan analysis was performed using G3PDH or actin gene as an internal standard Rodent G3PDH set (Applied Biochemicals) was used for detection of G3PDH, and Forward imer was used for detection of actin gene

(5'-CGTGAAAAGATGACCCAGATCA-3 '(SEQ ID NO: 18)), Reverse primer (5, -ACACAGCCTGGATGGCTACGTA-3, (SEQ ID NO: 19)), VIC label TaqMan primer (5'-TTTGAGACCTTCAACACCCCAGCCA-3' ( SEQ ID NO: 20)) was used. HHI7T213 gene expression was observed in all organs, but the expression level was

, Kidney, lens, skin, and muscle tended to be more prevalent (Figure 5). Example 9 Pathological Analysis of Transgenic Rats and Expression of hHI7T213 Gene In a major organ of a 5-week-old rat, pathological examination and hHI7T213 gene expression were performed. I checked about it. The pathological analysis was performed as follows. Rat liver, kidney, heart, spleen, lung, adrenal gland, testis, ovary, and eyeballs are excised, fixed with 10% neutral buffered formalin solution, and embedded in paraffin according to the usual method. Sliced to a thickness of / zm. Next, hematoxylin and eosin (HE) stained specimens were prepared and examined microscopically. For fixation of the eyes, treatment with Davidson's fixative for 30 minutes was added before treatment with 10% neutral buffered formalin. h HI7T213 gene expression was examined by the in situ hybridization method. At this time, the lipoprobe labeled with DIG was produced as follows. h Plasmid pCRScript 213-2 containing a 1.0 kbp fragment containing the HI7T213 gene was prepared and cut with an overhanging restriction enzyme. Then, T3 polymerase (Xhol cut as an antisense probe was used). Were transcribed with T7 polymerase (sense probe was cut with Notl). For hybridization, frozen sections of 25 m thickness or paraffin sections of 4 μηι were used. Sections were fixed with 4% paraformalin-0.1Μ phosphate buffer (ρΗ7.4), treated with Proteinase K (l / zg / ml Roche, 37 ° C for 10 minutes), 0.2 M HC1 Treatment 10 minutes, acetylation treatment A step of 10 minutes was performed. After adding the probe, perform hybridization at 55 ° C, wash with 50% formamide solution containing 2xSSC at 55 ° C, and treat with 5 g / ml RNaseA (Nitsubion Gene). The plate was washed at 55 ° C. with a final concentration of 0.4 × SSC. For signal detection, the cells were treated with anti-DIG-AP antibody (Roche) and developed with BCIP and NBA (Promega) in a box. Counterstaining was performed using eosin (Wako) or Nuclear ear red (Funakoshi) as necessary.

Pathological examination showed no abnormalities in the liver, heart, spleen, lung, adrenal gland, testis, and ovary (Table 1).

table 1 N

(Figure 6a-d). In addition, basophils were found to increase in the kidney, suggesting that cytotoxicity occurred in the kidney or that tubule cell proliferation-promoting activity was high (Fig. 7a-b). Furthermore, a pathological search was performed on the eyes and skin of young individuals in the same manner as described above. From 3 days to 7 days after birth, the same abnormalities of the lens fibers as those at 5 weeks were observed in the eyes (Fig. 6e-j), some individuals showed stratification of the lens epithelium at the anterior pole of the lens (Fig. 6g, h), indicating that cataracts began at an early age. In young skin, epidermal thickening and parakeratosis were observed (Fig. 8a, c, e, g). When the expression of the hHI7T213 gene in these abnormal organs was examined by in situ hybridization, expression was observed in the eyeballs at the site of the future lens fiber at 12 days of embryonic age (Fig. 6k, 1). In the kidney, expression was found in the tubule or medulla rather than in the glomerulus (Fig. 7c-e), and in the skin, expression was found near the epidermis and pores (Fig. 8b, d, f, h). All of these expression sites almost coincided with histological abnormal sites. Example 10 Cataract and hHI7T213 gene expression level in transgenic rats

To clarify the relationship between hHI7T213 gene expression and phenotypic abnormalities, the correlation between hHI7T213 gene expression levels and phenotypic abnormalities was examined. That is, for 96 M and 13 M, the expression of the hHI7T213 gene in the individual used in Example 9 was examined by TawMan analysis in the same manner as in Example 8, and compared with the degree of cataract. Figure 9 shows the results.

96M, which had a higher degree of lens fiber melting / degeneration, had higher hHI7T213 gene expression in muscle and skin than 13M. Also, within the same strain, individuals with a higher degree of cataract tended to have relatively higher hHI7T213 gene expression. These results suggest that the high expression of the hHI7T213 gene may be correlated with the phenotypic abnormalities seen in transgenic rats. Example 11 1 Abnormal epidermal differentiation in transgenic rats

Anti-keratin6 antibody (Funakoshi), anti-keratin antibody (Cosmo Bio), anti-kerat Immunohistological staining using the inlO antibody (DAKO), anti-loricrin antibody (Funakoshi), and anti-PCNA antibody was performed as follows. That is, paraffin sections were deparaffinized using a xylene series and an alcohol series, and then boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then continued to boil for 7 minutes. After the temperature was returned to room temperature over 1 hour, 100% acetone treatment was performed for 5 minutes. By a conventional method of base Kuta Augustin Kit (Funakoshi), blocking, various primary antibodies, secondary _{_{antibodies, 3% H 2 0 2 -}} PBS (5 minutes), after ABC reagent processing, color development reaction by DAB staining solution (1 within 0 min , Funakoshi). Counterstaining was performed with Nuclear fast red (Bunakoshi) or hematoxylin as needed. Serial sections were used for anti-keratinU antibody, anti-keratinlO antibody, and anti-1oricrin antibody staining. The results are shown in FIG.

In the 7-day-old control rats, almost no cells expressing the keratin 6 gene, a wound- and growth-related epidermal protein, were found, and PCNA-positive cells, growth-related antigens, were found only near the basal layer of the epidermis. (Figure 10d-f). In contrast, in the epidermis region of the 7-day-old transgenic rat where the expression of hHI7T213 gene was high, the number of keratin 6 gene-expressing cells and the number of PCNA-positive cells increased (Fig. 10). j-1). Therefore, it was suggested that in the epidermis in which the hHI7T213 gene was highly expressed, the cell growth promoting activity was enhanced.

Next, to examine the differentiation state of the epidermis, the expression of keratin 14 expressed in the basal cell layer, keratin 10 expressed in the spinous cell layer, and loricrin gene expressed in the granular cell layer was examined. In NonTg, keratin 14, keratin 10, and loricrin positive cells did not show any abnormalities (Fig. 10a-c), whereas in the epidermal region where hHI7T213 gene expression was high, The number of keratinl4, keratinlO, and loricrin positive cells increased (Fig. 10g-i).

These results suggest that epidermal hyperplasia is associated with an increase in keratinl4, keratinlO, and loricrin positive cells. As the number of keratin6 and keratinl4-positive proliferating cells increases, the turnover time of epidermal basal layer cells decreases, and as a result, the time required for enucleation becomes insufficient, and parakeratosis, in which nuclei remain, is reduced. This is considered to have been observed as desquamation. Example 12 Epidermal free nerve endings observed in transgenic rats. Epidermal free nerve endings were examined by double immunohistochemistry using a heron anti-PGP9.5 antibody and a mouse anti-keratin6 antibody. Alexa488-labeled anti-saginii secondary antibody and Cy3-labeled anti-mouse secondary antibody were used as secondary antibodies. That is, a fresh frozen section having a thickness of 25 μππ was boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then continued to boil for 1 minute. After returning to room temperature over 1 hour or more, treatment with 100% acetone for 5 minutes was performed. The sections were treated with blocking, primary and secondary antibodies, and observed with a laser microscope (LSM510, Zeiss). The results are shown in FIG.

In 7-day-old control rats (Fig. 1 la-c), keratin 6 positivity was hardly observed, and free nerve endings were also frequently observed in the epidermis. On the other hand, in 7-day-old transgenic rats (Fig. Lid-f) with high keratin 6 positivity, the epidermal free nerve endings were considerably abundant compared to the control rats. Free nerve endings were abundant not only in the epidermis but also in the subcutaneous epithelium as compared to control rats (Fig. Llg-i). Example 13 Expression Analysis of hHI7T213 Gene in 13 Spinal Ganglia

It has been reported that the hHI7T213 gene is expressed in some of the nerve cells having free nerve terminals in spinal ganglia, and the abundant free nerve terminals found in Example 12 are It is conceivable that this may be the result of enhanced action based on the overexpression of the foreign gene in spinal cord neurons that originally express the hHI7T213 gene. To elucidate this point, we first examined transgene expression in the spinal ganglia of transgenic rats. Spinal ganglia, skin, eyes and kidneys were excised from 18-day-old NonTg and transgenic rats, homogenized in ISOGEN (Fujitsu Gene), and total RNA was extracted by a conventional method. Use 0.1 ix g of total RNA for spinal ganglia and 1 μg of total RNA for skin, eyes, and kidneys, and use First strand cDNA synthesis kit (Amersham Pharmacia Biotech). ) Was used to synthesize cDNA according to the protocol and used as a template. The primer for TaqMan analysis (TaqMan7700, Applied Biochemicals) is shown in Example 6. That is, for detection of the hHI 7 T 2 13 gene, Forward p rimer (5, -TCCTGTCCGCTCTTAACAGCA-3 '(SEQ ID NO: 17)), Reverse primer (5, -TTTTGACGCTGCCTAAAGGAG-3, (SEQ ID NO: 18)), and FAM-labeled TaqMan primer (5'-TGCCAACCCCATCATTTTTTCTCTTCGTG- A primer set of 3 '(Kyokusaba): 19)) was used, and a rodent G3PDH set (Applied Biochemicals) was used for detection of G3PDH as an internal standard. As shown in FIG. 12, the hHI7T213 gene was expressed in all of the spinal ganglia, skin, eyes, and kidney. Example 14 4 CGRP-positive nerve endings in transgenic rats

As can be seen from Example 13, since the hHI7T213 gene was also expressed in the spinal ganglia of transgenic rats, the abundance of free nerve endings suggests that the high expression of the transgene could enhance the effect. Conceivable. Due to the enhanced action based on high expression in the spinal ganglia, only free nerve endings are specifically abundant in any of the epidermis, and there is no change in other types of nerve fibers such as CGRP-positive nerve fibers. Not expected. To elucidate this point, CGRP staining was performed to examine the distribution of nerve fibers other than free nerve endings. At this time, the transgenic rat skin was compared in both the apparently normal and abnormal specimens to determine whether the change was due to spinal ganglia or limited to abnormal epidermis. Was also done.

For the primary antibody, use a rabbit egret anti-CGRP antibody, a rabbit egret anti-PGP9.5 antibody, and a mouse anti-kerat in6 antibody. Using. The fresh frozen section having a thickness of 25 wm was boiled in a microwave oven in 750 ml of antigen unmasking solution (Funakoshi), and then further boiled for 1 minute. After returning to room temperature over 1 hour or more, treatment with 100% acetone for 5 minutes was performed. The sections were subjected to blocking, primary antibody and secondary antibody treatment, and then observed with a laser microscope (LSM510, Zeiss).

In the skin of 7-day-old apparently normal transgenic rats, keratin 6-positive images were all the same as NonTg, and no abnormalities were observed. (Figure 12a-f). On the other hand, in the skin of abnormal transgenic rats, both the keratin 6-positive image and the PG P9.5-positive fiber are considerably abundant compared to NonTg, and at the same time, the CGRP-positive fiber is also abundant. It was rich (Fig. 12g-i). From the above results, it was also found that the phenomenon of abundance of nerve endings in transgenic rats is limited to abnormal epidermal sites and is not specific to free nerve endings including PGP9.5-positive fibers. did. Therefore, skin abnormalities in transgenic rats are not due to overexpression of the hHI7T213 gene in the spinal ganglia, but rather neurotrophic factors, which are some inducers, are expressed from the abnormal epidermis. It was suggested that it might be caused by Example 15 Enhancement of expression of neurotrophic factor group in abnormal epidermis

Since it was suggested in Example 14 that transgenic rat skin with abnormalities might produce neurotrophic factors, the expression levels of NGF and BDNF genes in the epidermis were examined. The skin of NonTg, apparently normal transgenic rats, and transgenic rats with abnormalities were excised, homogenized in ISOGEN (manufactured by Tsubon Gene), and total RNA was extracted by a conventional method. Using 5 μg of total RNA, cDNA was synthesized according to a protocol using a First strand cDNA synthesis kit (manufactured by Amersham Fanolemascia Biotech) according to the protocol to obtain a template. The following primers were used for TaqMan analysis (TaqMan7700 _s Applied Biochemicals). For detection of the hH I 7T2 13 gene, forward primer (5′-TCCTGTCCGCTCTTAACAGCA-3, (SEQ ID NO: 17)), reverse primer (5, -TTTTCGACGCTGCCTAAAGGAG-3 ′ (SEQ ID NO: 18)) , And FAM-labeled TaqMan primer (5′-TGCCAACCCCATCATTTACTTCTTCGTG-3 ′ (SEQ ID NO: 19)), and forward primer (5, −AGGCCCACTGGACTAAACTTCAGC-3 ′ (SEQ ID NO: 23) for detection of NGF gene ), Reverse primer (5, -GGGCACTGCGGGCTC-3, (SEQ ID NO: 24)), FAM-labeled TaqMan primer (5, -TTCCCTTGACACAGCCCTCCGC-3 '(SEQ ID NO: 25)), and Forward for BDNF gene detection. primer (5'-GGTG ATGCTCAGCAGTCAAGT-3, (SEQ ID NO: 26)), Reverse primer (5, -CGAACC CTCATAGACATGTTTG-3 '(SEQ ID NO: 27)), and FAM-labeled TaqMan primer (5' -TTTGGAGCCTCCTCTGCTCTTTCTGC-3 '(SEQ ID NO: 28)) Using the primer set, detection of the internal standard actin gene was performed using the Forward primer (5, -CGT GAAAAGATGA CCCAGATCA-3, (system U number: 29)), Reverse primer (5, -GC ACAGCCTGGATGGCTA-3 (SEQ ID NO: 30)) and VIC-labeled TaqMan primer (5'-TTTGAGACCTTCAACACCCCAGCCA-3 '(SEQ ID NO: 31)) were used. As shown in FIG. 14a, in transgenic rats, the expression level of the hHI7T213 gene in abnormal skin was significantly higher than that in normal skin. In addition, NGF and BDNF gene expression levels did not differ between nonTg and normal transgenic rat skin expression levels, whereas abnormal transgenic rat skin The expression level was high (Fig. 14b, c). From the above results, it was considered that PGP9.5-positive nerve fibers were enriched in transgenic rat skin with abnormal epidermal differentiation because the expression levels of neurotrophic factors such as NGF and BDNF increased. Industrial potential

The transgenic non-human mammal of the present invention can be used for evaluation of preventive or therapeutic drugs for diseases such as cataracts, gene therapy experiments for patients with HI7T213 gene abnormality, and the like. Cells collected from a non-human mammal into which the gene has been introduced can be cultured and used for evaluating HI7T213 inhibitors.

Claims

The scope of the claims

1. A non-human mammal or a part thereof having a DNA incorporating an exogenous HI7T213 gene or a mutant gene thereof.

2. The animal or a part thereof according to claim 1, wherein the non-human mammal is a rat.

3. The exogenous HI7T213 gene has an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. 2. The animal or a part thereof according to claim 1, which is a gene encoding HI7T213.

4. The animal or a part thereof according to claim 1, wherein the exogenous HI7T213 gene is a gene encoding human-derived HI7T213 consisting of the amino acid sequence represented by SEQ ID NO: 3.

5. (1) Cataract has developed,

(2) has developed coarse hair,

(3) transient skin rash or desquamation is observed,

(4) melting / degeneration of lens fibers is observed in the eyeball,

(5) lens fiber abnormalities are observed in the eyeball,

(7) basophils are increasing in the kidney,

(8) cell damage occurs in the kidney,

(9) high proliferation promoting activity of tubular cells,

(10) In young skin, epidermal thickening and parakeratosis are observed,

(11) PCNA-positive cells, which are growth-related antigens, are found in the basal layer of the epidermis and near the pores.

(13) cell growth promoting activity is enhanced,

(14) Abnormal epidermal differentiation accompanied by increased expression of keratin 14, keratin 10, or oral ricklin is observed,

(15) Rich in epidermal free nerve endings in keratin 6-positive sites, (16) expression of a group of neurotrophic factors at abnormal epidermal sites is enhanced, and

(17) abnormal differentiation associated with proliferation promoting activity,

5. The animal or a part thereof according to claim 1, which exhibits at least one phenotype selected from:

6. HI7T213 characterized in that a test substance is applied to the animal according to any one of claims 1 to 4 or a part thereof, and HI7T213agonist activity or HI7T213 antagonist activity is assayed. A method of starring the Quest or HI 7 T 213 Antagonist.

7. The test substance is applied to the animal according to any one of claims 1 to 5 or a part thereof, and the phenotype or cancer, renal disorder, cataract, dermatitis, chronic pain or pain sensation according to claim 5 is applied. A screening method for a substance used for the prevention and / or treatment of cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia, which comprises testing the effect of improving hypersensitivity.

8. Use of an animal or a part thereof according to any one of claims 1 to 4 for screening a substance used for the prevention and / or treatment of a wound or spinal cord injury or for renal regeneration.

9. The animal or the animal according to any one of claims 1 to 5, for screening a substance used for prevention and / or treatment of cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia. Its part use.

10. Fertilized eggs into which exogenous H I 7 T 213 gene or its mutant gene has been introduced. 1 1. A vector containing an exogenous HI7T213 gene or a mutant gene thereof and capable of expressing the gene in a non-human mammal.

12. The vector according to claim 11, wherein the exogenous HI7T213 gene is a gene encoding human-derived HI7T213 comprising the amino acid sequence represented by SEQ ID NO: 3.

13. The vector according to claim 11, which is represented by p CAG 213-1.

14. A transformant transformed with the vector according to claim 11.

15. The transformant according to claim 14, wherein the transformant is Escherichia coli JM109 / p CAG213-1 (FERM BP-8207).

16. G protein-coupled receptor protein, a partial peptide thereof or a salt thereof, comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5.

17. The G protein-coupled receptor protein or a salt thereof according to claim 16, comprising the amino acid sequence represented by SEQ ID NO: 5.

18. A polynucleotide comprising a polynucleotide encoding the G protein-coupled receptor protein according to claim 16 or a partial peptide thereof.

19. The polynucleotide according to claim 18, which is a DNA.

20. DNA comprising the base sequence represented by SEQ ID NO: 6.

21. A recombinant vector containing the polynucleotide according to claim 18.

22. A transformant transformed with the recombinant vector according to claim 21.

23. The G protein conjugate according to claim 16, wherein the transformant according to claim 22 is cultured to produce the G protein-coupled receptor protein according to claim 16 or a partial peptide thereof. A method for producing a receptor protein, its partial peptide or a salt thereof.

24. A G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or An agent for preventing and treating wound or spinal cord injury or a regenerative agent comprising the salt.

25. A G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or An agent for preventing and / or treating wound or spinal cord injury, or an agent for regenerating kidney, comprising a polynucleotide containing a polynucleotide encoding the partial peptide.

26. A G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A diagnostic agent for wound, spinal cord injury, cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising a polynucleotide containing a polynucleotide encoding the partial peptide.

27. An antibody against the G protein-coupled receptor protein according to claim 16, a partial peptide thereof or a salt thereof.

28. The antibody according to claim 27, which is a neutralizing antibody that inactivates signal transduction of the G protein-coupled receptor protein according to claim 16.

29. A G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, A preventive and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antibody against the partial peptide or a salt thereof.

30. a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, A diagnostic agent for wound, spinal cord injury, cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antibody against the partial peptide or a salt thereof.

31. A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide according to claim 18 or a part thereof.

32. A G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A cancer, a renal disorder, a cataract, a dermatitis, which contains a polynucleotide comprising a nucleotide sequence complementary to a polynucleotide containing a polynucleotide encoding the partial peptide or a part thereof, An agent for preventing and / or treating chronic pain or hyperalgesia.

33. A G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, An agent for preventing and / or treating wound or spinal cord injury or a regenerative agent comprising a ligand or agonist against the partial peptide or a salt thereof.

34. G protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. An agent for preventing and / or treating cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising an antagonist against a protein-coupled receptor protein, a partial peptide thereof or a salt thereof.

35. A G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or A preventive and / or therapeutic agent for wound or spinal cord injury, or a regenerative agent, which comprises a substance that increases the expression level of the partial peptide.

36. A G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or An agent for preventing and / or treating cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia comprising a substance that reduces the expression level of the partial peptide.

37. To a mammal, (i) an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A G protein-coupled receptor protein, a partial peptide or a salt thereof, (ii) identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A polynucleotide containing a polynucleotide encoding a G protein-coupled receptor protein or a partial peptide thereof containing the same amino acid sequence, (iii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or a sequence A G protein-coupled receptor protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by No. 7; A ligand or agonist for the peptide or its salt, or (iv) an amino acid identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A method for preventing and / or treating wound or spinal cord injury, which comprises administering an effective amount of a substance that increases the expression level of a G protein-coupled receptor protein having a sequence, a partial peptide or a salt thereof, or Kidney regeneration method.

38. For mammals: (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or Or a G protein-coupled receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 7, an antibody against a partial peptide or a salt thereof, (ii) SEQ ID NO: 1, a G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, or a polypeptide encoding a partial peptide thereof A polynucleotide comprising a nucleotide sequence complementary to a polynucleotide containing a nucleotide or a part thereof; (iii) an amino acid represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A G protein-coupled receptor protein having an amino acid sequence identical or substantially identical to the sequence, (Iv) the same as or substantially the same as the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7; Cancer, renal disorder, cataract, dermatitis, chronic disease characterized by administering an effective amount of a substance that reduces the expression level of a G protein-coupled receptor protein containing the amino acid sequence of, or a partial peptide or a salt thereof. Prevention and / or treatment of pain or hyperalgesia.

39. (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 for producing a prophylactic and / or therapeutic agent for wound or spinal cord injury or a regenerative agent A G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence to be used, a partial peptide or a salt thereof, (ii) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or A polynucleotide containing a polynucleotide encoding a G protein-coupled receptor protein or a partial peptide thereof having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, (iii) SEQ ID NO: 1, an amino acid identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7 A ligand or agonist for the G protein-coupled receptor protein containing the sequence, its partial peptide or its salt, or (iv) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7. G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence shown, its partial peptide or its salt expression level The use of substances that increase.

40. (i) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 for producing a prophylactic and / or therapeutic agent for cancer, renal disorder, cataract, dermatitis, chronic pain or hyperalgesia G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 7, an antibody against a partial peptide thereof or a salt thereof, (ii) SEQ ID NO: 1, SEQ ID NO: 3 A G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7, or a polynucleotide encoding a partial peptide thereof. A polynucleotide comprising a nucleotide sequence complementary to the polynucleotide or a part thereof, (iii) SEQ ID NO: 1, SEQ ID NO: 3. G protein-coupled receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7, an antagosto against a partial peptide or a salt thereof Or (iv) a G protein-coupled receptor protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, Use of substances that reduce the expression of partial peptides or their salts.