WO2000075655A1 - Procede de criblage avec cd100 - Google Patents

Procede de criblage avec cd100 Download PDF

Info

Publication number
WO2000075655A1
WO2000075655A1 PCT/JP2000/003558 JP0003558W WO0075655A1 WO 2000075655 A1 WO2000075655 A1 WO 2000075655A1 JP 0003558 W JP0003558 W JP 0003558W WO 0075655 A1 WO0075655 A1 WO 0075655A1
Authority
WO
WIPO (PCT)
Prior art keywords
salt
gene
cells
compound
screening
Prior art date
Application number
PCT/JP2000/003558
Other languages
English (en)
Japanese (ja)
Inventor
Hitoshi Kikutani
Atsushi Kumanogoh
Akira Hori
Original Assignee
Takeda Chemical Industries, Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Takeda Chemical Industries, Ltd. filed Critical Takeda Chemical Industries, Ltd.
Priority to AU49526/00A priority Critical patent/AU4952600A/en
Publication of WO2000075655A1 publication Critical patent/WO2000075655A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A61P27/04—Artificial tears; Irrigation solutions
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/7056—Lectin superfamily, e.g. CD23, CD72
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/7056—Selectin superfamily, e.g. LAM-1, GlyCAM, ELAM-1, PADGEM
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention is based on the CD 100 (Proc Natl Acad Sci USA) 93, (1996) pp. 11780-11785, on CD 100 (Procedures of the National Academy) of Sciences of the U.S.A. Etc.) or its salt and its receptor, CD72 (J. Immunol, 149 (1992) pp. 880-886, etc.) to induce or induce abnormal antibody production.
  • the present invention relates to a method for screening a compound or a salt thereof useful as a therapeutic agent for preventing or treating a disease caused by the disease. Background art
  • B cells can give one of five types of antibodies: IgM, IgD, IgG, IgA, and IgE.
  • B cells first produce IgM due to their gene composition when they encounter the first antigen they encounter in vivo as they differentiate. However, the physiology of IgM is weaker than other types of antibodies. When stimulation with the same antigen continues, the gene changes and antibodies other than IgM are produced to exert strong physiological functions. The action or phenomenon that this immunoglobulin changes from IgM to another type is called class switch.
  • CD40 is a membrane glycoprotein expressed on B cells and reacts with, for example, CD40L expressed on activated T cells. It is known that mice without CD40 have no antibody production, class switch, or vaccine effect, and CD40 is an essential molecule for the antibody production function of B cells. When B cells are stimulated with CD40, B cell killing by anti-IgM antibodies is suppressed, and when B cells are stimulated with CD40, production of various classes of antibodies including IgM is induced. However, it is still unclear what drives these B cell responses.
  • abnormal antibodies can be specifically reduced for diseases caused by the production of abnormal antibodies, for example, atopic asthma, atopic dermatitis, chronic indirect rheumatism, allergic rhinitis, such It is an effective treatment for allergy and autoimmune diseases, but so far there is no such treatment. Disclosure of the invention
  • the present inventors isolated and obtained a gene induced by CD40 and elucidated that the molecule was CD100.
  • CD100 binds to CD72 on B cells stimulated with activators such as CD40, IL-4, or PS to form a complex
  • B-cells are stimulated by anti-IgM antibodies. It has been revealed that death can be avoided and that it plays a very important role in inducing the class switch.
  • CD100 binds and forms a complex with CD72 on B cells stimulated with activators such as CD40, IL-4, or LPS
  • the B cells trigger a class switch and are specific in vivo It has been elucidated that strong high-affinity antibodies are strongly induced.
  • CD100 itself is an effective treatment for rapidly increasing antibody titers after vaccination against epidemic diseases such as cold syndrome and influenza.
  • CD 100 has also been shown to be an immunostimulant for cancer and infectious diseases.
  • substances that inhibit the binding between CD72 and CD100 are diseases that are expected to inhibit only antibody production of activated B cells and are caused by abnormal antibody production, such as atopy. It has been shown to be an effective treatment for acute asthma, atopic dermatitis, chronic indirect rheumatism, and allergic rhinitis.
  • CD100 or its salt and CD72 or its salt A method for screening a compound or a salt thereof that alters the binding property between CD100 or a salt thereof and CD72 or a salt thereof,
  • CD100 or a salt thereof, or CD100 or a salt thereof and a test compound are added to CD72-expressing cells, and the change in the amount of antibody produced or secreted from the expressing cells is measured.
  • (11) a method for screening a compound or a salt thereof that alters the binding between CD100 or a salt thereof and a receptor thereof, which comprises using a non-human animal in which the CD100 gene has been knocked out;
  • a transgenic non-human animal having enhanced T cell reactivity characterized by having a DNA incorporating the exogenous CD100 gene or its mutant gene. Or its progeny having the DNA,
  • CD100 or a salt thereof and a receptor thereof using a transgenic non-human animal having a DNA into which the exogenous CD100 gene or its mutant gene has been incorporated, or a progeny thereof having the DNA. Screening method for a compound or a salt thereof, which changes the binding property to
  • FIG. 1 shows the binding between CD72-expressing CHO cells and mCD100_Fc in Example 1.
  • FIG. 2 shows the activity of CD100 in Example 2 for promoting the production of IgG1-specific antibodies.
  • FIG. 3 shows the activity of CD100 for inducing antibody production in vivo in Example 3.
  • Figure 4 shows the evening targeting vector used for the production of the CD100 knockout mouse in Example 4, the gene map of the CD100 gene expected in wild-type and knockout mice, and the CD in wild-type and knockout mice. The 100 gene structure and the expression level of CD100 protein in wild type mice and knockout mice are shown.
  • FIG. 5 shows the expression level of CD5 in the wild-type mouse and the CD100 knockout mouse in Example 5.
  • FIG. 6 shows antibody production against a TD (T cell-dependent) antigen in Example 6.
  • FIG. 7 shows the loss of T cell reactivity in CD100 knockout mice in Example 7.
  • Figure 8 shows the age-related soluble CD100 in MR LZ 1 pr mice in Example 9. And the increase in the amount of autoantibodies.
  • FIG. 9 shows the loss of dendritic cell reactivity in CD100 knockout mice in Example 10.
  • FIG. 10 shows T cell hyperreactivity in CD100 transgenic mice in Example 11. BEST MODE FOR CARRYING OUT THE INVENTION
  • CD 100 in the present invention specifically, a known CD 100 or a salt thereof [Procedures of the National Academy of Sciences-of-the-USA] (Proc Natl. Acad Sci USA) 93, (1996) 11780-11785; Journal of Biological Chemistry, Volume 271 (1996) 33376-33381] ,
  • CD72 in the present invention specifically, a known CD72 or a salt thereof [The 'Journal of Immunology', 144, 4870-4877 (1990); The Journal of Ibb unology, Volume 149, 880-886 (1992)], etc. Mouse CD72 is described in The Journal of Immunology, Volume 149, 880-886 (1992). And it has Lyb-2 al, Lyb-2 a 2, Lyb - 2 b, also includes Arotaipu such Lyb- 2 e. Furthermore, regarding CD 72,
  • CD72 a polypeptide characterized by containing the same or substantially the same amino acid sequence as that represented by SEQ ID NO: 5 or SEQ ID NO: 7 (hereinafter abbreviated as CD72) Or its salt, or
  • amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7 an amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7, in which 1 to 10 amino acids, preferably 1 to 5 amino acids have been added (or inserted), or SEQ ID NO: 5 or A protein comprising an amino acid sequence in which 1 to 10 amino acids, preferably 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 7 are substituted with other amino acids (19) CD72 or a salt thereof described in the above section.
  • the term “substantially the same” means that the activities of polypeptides and the like, for example, the binding activity of ligand (CD100) and receptor (CD72), physiological properties, etc. are substantially the same. I do. Amino acid substitutions, deletions, additions or insertions often do not significantly alter the physiological or chemical properties of the polypeptide, in which case the substitutions, deletions, additions or insertions are made.
  • the polypeptides (so-called CD100 variants, CD72 variants, etc.) will be substantially identical to those without such substitutions, deletions, additions or insertions.
  • Substantially identical substitutions of amino acids in the amino acid sequence can be selected, for example, from other amino acids of the class to which the amino acid belongs.
  • Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, purine, phenylalanine, tributofan, methionine and the like.
  • Examples of polar (neutral) amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • Amino acids having a positive charge (basic) include arginine, lysine, histidine and the like.
  • Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • the CD100 and CD72 used in the present invention include humans, warm-blooded animals (eg, guinea pigs, rats, mice, bushs, sheep, magpies, monkeys, etc.), and all tissues such as fishes.
  • warm-blooded animals eg, guinea pigs, rats, mice, bushs, sheep, magpies, monkeys, etc.
  • tissues such as fishes.
  • Any polypeptide may be used as long as it contains
  • the amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1, 3, 5, or 7 is preferably about 70% or more, preferably, the amino acid sequence represented by SEQ ID NO: 1, 3, 5, or 7. Is an amino acid sequence having a homology of about 80% or more, more preferably about 90% or more, and still more preferably about 95% or more.
  • CD72 includes, in addition to the polypeptide containing the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7, etc., the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7
  • examples thereof include polypeptides having an activity substantially the same as that of the contained polypeptide.
  • Substantially the same activity includes, for example, ligand binding activity, signal transduction activity, antibody-producing ability and the like.
  • the term “substantially the same” means that the ligand binding activity and the like are substantially the same. Therefore, the strengths such as the strength of the ligand binding activity and the quantitative factors such as the molecular weight of the polypeptide may be different.
  • CD100 includes, in addition to a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3 and the like, a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 3
  • polypeptides include polypeptides having substantially the same activity as polypeptides.
  • substantially equivalent activities include, for example, receptor binding activity, antibody production activity, and the like.
  • substantially the same quality means that the receptor binding activity and the like are the same in nature. Therefore, strength factors such as the strength of receptor binding activity, and quantitative factors such as the molecular weight of the polypeptide may be different.
  • CD72 and CD100 have N-terminal (amino terminal) at the left end and C-terminal (carboxyl terminal) at the right end according to the convention of peptide labeling.
  • the polypeptide containing the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 7, etc. is usually a C-terminal carboxylate group (-C00H) or carboxy.
  • the rate is (-C00_), but the C-terminal may be amide (_C0NH 2 ) or ester (-C00R).
  • R of the ester such as methyl, Echiru, n_ propyl, alkyl groups such as isopropyl, n- butyl, Shikurobe pentyl, ⁇ 3 _ 8 cycloalkyl group such as cyclohexyl, phenyl, shed - 2, such as naphthyl Le Ariru group, benzyl, phenethyl, phenylene Lou C ⁇ such as benzhydryl - 2 alkyl, or ⁇ - naphthylmethyl etc. ⁇ - naphthyl - 2 other C 7 _ 14 Ararukiru groups such as alkyl, commonly used as an ester for oral administration Viva yloxymethyl group and the like.
  • salts with physiologically acceptable bases eg, alkali metals and the like
  • acids organic acids and inorganic acids
  • Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, Salts such as co-octanoic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid and benzenesulfonic acid are used.
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid
  • Salts such as co-octanoic acid, tartaric acid, citric acid, malic acid, oxalic acid
  • CD72 and CD100 used in the present invention can be prepared by a known method [The Journal of Immunology, vol. 144, pp. 4870-4877 (1990); Proc Natl, The Journal of Immunology, 149, 880-886 (1992); Processing of the 'National' Academy 'of' Science ', of the' Proc Natl Acad Sci USA) 93, (1996) 11780-11785; Journal of Biological Chemistry, Volume 271 (1996) 33376-33381], That is, the polypeptide can be produced by a method of purifying a polypeptide from a tissue or a cell of a human warm-blooded animal, or can be produced according to a polypeptide synthesis method described later. Alternatively, it can be produced by culturing a transformant containing a DNA encoding the polypeptide described below.
  • CD72 and CD100 used in the present invention are produced according to a known method for synthesizing a polypeptide, or by cleaving a polypeptide containing a polypeptide with an appropriate peptidase. can do.
  • a method for synthesizing the peptide for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid that can constitute the polypeptide with the remaining portion, and if the product has a protecting group, removing the protecting group. Examples of the known condensation method and elimination of the protecting group include the methods described in the following 1 to 1.
  • the polypeptide (CD72, CD100) can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. .
  • the polypeptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method, and conversely, when the polypeptide is obtained as a salt, it can be converted to a free form by a known method. can do.
  • a commercially available resin for peptide synthesis suitable for amide formation can be used.
  • resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-Benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphene) (2-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin and the like.
  • an amino acid having an ⁇ -amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target peptide according to various known condensation methods.
  • the peptide is cleaved from the resin, and at the same time, various protecting groups are removed.
  • an intramolecular disulfide bond formation reaction is carried out in a highly diluted solution to obtain a desired polypeptide.
  • Caprolidimides include DC (;, N, ⁇ '-diisopropylcarbodiimide, ⁇ -ethyl- ⁇ '-(3-dimethylaminopropyl) carbodiimide, etc.
  • the activation by these agents requires a racemization inhibitor.
  • the protected amino acid (e.g., ⁇ 0 ⁇ ) can be added directly to the resin, or can be added to the resin after activating the previously protected amino acid as a symmetric acid anhydride or ⁇ 0 ⁇ ester
  • the solvent used for the activation of the protected amino acid or the condensation with the resin can be appropriately selected from solvents known to be usable for the peptide condensation reaction, for example, ⁇ , ⁇ -dimethylformamide, ⁇ Acid amides such as, ⁇ -dimethylacetamide and ⁇ -methylpyrrolidone; halogens such as methylene chloride and chloroform Hydrocarbons, alcohols such as trifluorophenol, sulfoxides such as dimethyl sulfoxide, tertiary amines such as pyridine, ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, and methyl acetate And an ester such as ethyl a
  • the reaction temperature is appropriately selected from the range known to be usable for peptide bond formation reactions, and is usually about 120 ° C .
  • the selected amino acid derivative is appropriately selected from the range of 50 ° C.
  • the activated amino acid derivative is usually used in a 1.5 to 4-fold excess, and as a result of a test using the ninhydrin reaction, if the condensation is insufficient. Can be sufficiently condensed by repeating the condensation reaction without removing the protecting group. Repetitive When sufficient condensation cannot be obtained even after repetition, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.
  • Examples of the protecting group for the amino acid of the starting amino acid include Z, Boc, pentyloxycarbonyl, isopolnyloxycarbonyl, 4-methoxybenzyloxycarbonyl, U-Z, Br-Z, and adamantyl.
  • Is a protecting group of carboxyl group for example the above as R ( ⁇ _ 6 alkyl group, C 3 _ 8 cycloalkyl group, other C 7 _ 1 4 Ararukiru group, 2-Adamanchiru, 4 twelve Torobenjiru, 4 — Methoxybenzyl, 4-cyclohexyl benzyl, phenacyl group and benzyloxycarbonyl hydrazide, tertiary butoxycarbonyl hydrazide, trityl hydrazide and the like.
  • the hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification.
  • Suitable groups for this esterification include, for example, lower alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbon such as benzyloxycarbonyl group and ethoxycarbonyl group.
  • groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a butyl group.
  • the protecting group of the phenolic hydroxyl group of tyrosine include Bz l, C l 2 -Bz l , 2 twelve Torobenjiru, Br @ - Z, and the like evening over tert-butyl.
  • Examples of the protecting group for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Tr and Fmoc.
  • Activated carboxyl groups of the raw materials include, for example, corresponding acid anhydrides, azides, and activated esters [alcohols (eg, phenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol) Esters with phenol, cyanomethyl alcohol, paranitrophenol, H0NB, N-hydroxysuccinimide, N-hydroxyfurimide, H0BT) and the like.
  • Activation of amino group of raw material Examples include the corresponding phosphoric amide.
  • Methods for removing (eliminating) the protecting group include catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd black or Pd carbon, or anhydrous hydrogen fluoride, methanesulfonate, or trifluoromethanesulfonate.
  • a catalyst such as Pd black or Pd carbon, or anhydrous hydrogen fluoride, methanesulfonate, or trifluoromethanesulfonate.
  • Acid treatment with trifluoroacetic acid or a mixture thereof base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc .; and reduction with sodium in liquid ammonia.
  • the elimination reaction by the above-mentioned acid treatment is generally carried out at a temperature of 120 to 40, but in the acid treatment, anisol, phenol, thioanisole, methacrylol, paracresol, dimethyl sulfide, 1,4 -Addition of a cation scavenger such as butanedithiol or 1,2-ethanedithiol is effective.
  • a cation scavenger such as butanedithiol or 1,2-ethanedithiol
  • the 2,4-dinitrophenyl group used as an imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group of tributofan is replaced with 1,2-ethanedithiol and 1,4-butane described above.
  • alkali treatment with dilute sodium hydroxide, dilute ammonia, etc.
  • Protection and protection of functional groups that should not be involved in the reaction of the raw materials, elimination of the protective groups, activation of the functional groups involved in the reaction, and the like can be appropriately selected from known groups or known means.
  • a peptide chain is added to the amino group to the desired length. After the elongation, a peptide (or amino acid) from which only the protecting group for the ⁇ -amino group at the N-terminus of the peptide chain is removed and a peptide (or amino acid) from which only the protecting group for the carboxyl group at the C-terminal is removed, These two peptides are condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above.
  • an ester of the desired polypeptide can be obtained in the same manner as the amide of the polypeptide.
  • the DNA encoding CD72 used in the present invention includes a receptor protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 5 or SEQ ID NO: 7.
  • the DNA containing the amino acid sequence represented by SEQ ID NO: 1 or the amino acid sequence identical to or substantially identical to the amino acid sequence represented by SEQ ID NO: 3 is used as the DNA encoding the CD100 used in the present invention.
  • Any DNA may be used as long as it contains a DNA encoding a ligand protein. Further, it may be any of genomic DNA, genomic DNA library, the above-described cDNA derived from tissues and cells, the above-described cDNA library derived from tissues and cells, and synthetic DNA.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. Alternatively, it can also be directly amplified by Reverse Transcriptase Polymerase Chain Reaction (hereinafter abbreviated as RT-PCR method) using an RNA fraction prepared from the above-described tissue / cell.
  • RT-PCR method Reverse Transcriptase Polymerase Chain Reaction
  • Hybridization can be performed according to a method known per se or a method analogous thereto.
  • the DNA encoding CD72 or CD100 used in the present invention can also be produced by the following genetic engineering techniques.
  • the DNA library was synthesized by a PCR method known per se using a synthetic DNA primer having a partial nucleotide sequence of a polypeptide. It is possible to amplify the desired DNA from the first place, or to combine DNA incorporated in an appropriate vector with, for example, a DNA fragment having a partial or entire region of a polypeptide or labeled with a synthetic DNA. Sorting can be performed by hybridization. The hybridization method is performed according to, for example, the method described in Molecular Cloning (2nd ed .; J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). When using a commercially available library, follow the method described in the attached instruction manual.
  • the cloned DNA encoding CD72 or CD100 used in the present invention can be used as it is, or digested with a restriction enzyme or added with a linker, if desired, if desired.
  • the DNA may have ATG as a translation initiation codon on the 5 'end, and may have TAA, TGA or TAG as a translation termination codon on the 3' end. These translation initiation codon and translation termination codon can also be added using an appropriate synthetic DNA adapter.
  • the expression vector for CD72 or CD100 used in the present invention can be prepared, for example, by (a) cutting out a DNA fragment of interest from DNA encoding CD72 or CD100 used in the present invention;
  • the DNA fragment can be produced by ligating the DNA fragment downstream of the promoter in an appropriate expression vector.
  • the vector examples include a plasmid derived from E. coli (eg, pBR322, pBR325, pUC12, pUC13), a plasmid derived from Bacillus subtilis (eg, pUB110, TP5, pC194), a plasmid derived from yeast ( For example, bacteriophages such as pSH19, pSH15) and ⁇ phage, and animal viruses such as retrovirus, vaccinia virus, and baculovirus are used.
  • the promoter used may be any promoter that is appropriate for the host used for gene expression.
  • the promoter derived from SV40, the promoter of the retrovirus, the metamouth thionine promoter, the heat shock promoter, the cytomegalovirus promoter, SR Hi promoters can be used.
  • the host is a genus Escherichia, Trp promoter, T7 promoter, lac promoter, recA promoter, ⁇ PL promoter, 1 pp promoter, etc.
  • the host are Bacillus
  • a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH1 promoter, a GAL promoter, and the like are preferable.
  • a polyhedrin promoter, a P10 promoter and the like are preferable.
  • the expression vector may further contain an enhancer, a splicing signal, a polyA addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like, if desired.
  • SV40 ori an SV40 replication origin
  • the selectable marker include a dihydrofolate reductase (hereinafter sometimes abbreviated as dh fr) gene [methodrexate (MTX) resistance] and an ampicillin resistance gene (hereinafter abbreviated as Amp).
  • MTX methodrexate
  • Amp ampicillin resistance gene
  • Neo neomycin resistance gene
  • the DHF R gene is used as a selectable marker using CH ⁇ (dh fr ⁇ ) cells. If used, selection can also be made with thymidine-free media.
  • a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide.
  • the host is a genus Escherichia, the phoA-signal sequence, immediately A signal sequence, etc.
  • the host is a Bacillus genus, the human amylase signal sequence, subtilisin signal sequence, etc.
  • insulin signal sequence, ⁇ -interferon ⁇ signal sequence , Antibody molecule, signal sequence, etc. can be used.
  • a transformant can be produced using the vector having the transformant.
  • Escherichia bacteria for example, Escherichia bacteria, Bacillus bacteria, yeast, insects or insect cells, animal cells, and the like are used.
  • Escherichia examples include Escherichia coli K12. DH1 [Procedures of the National Academy of Sciences of the Proc. Natl. Acad. Sci. USA), 60, 160 (1968)], JM103 [Nucleic Acids Research, (Nucleic Acids Research), 9, 309 (1981)], JA221 [Journal ' Journal of Molecular Biology], 120, 5 17 (1 978)), ⁇ 10 1 [Journal of Bio Molecular Biology, 41, 459 (Journal of Molecular Biology)] 1969)], C600 [Genetics, 39, 440 (1954)], E. coli DH10 B cells [Focus 12, p19 (1990) Law, D, etc.] Used.
  • Bacillus genus examples include Bacillus subtilis (BacUlus subtilis) M11114 [Gene, 24, 255 (1983)], 207-21 (Journal of Biochemistry, 95) , 87 (198 4)].
  • yeast for example, Saccharomyces cerevisiae AH22, AH22R-1, NA87-11A, DKD-5D, 20B112 are used.
  • insects for example, silkworm larvae are used [Maeda et al., Nature, 315, 592 (1985)].
  • insect cells for example, when the virus is Ac NPV, a cell line derived from a larva of night roth moth (Spodoptera frugiperda cell; Sf cell), MG1 cell derived from the midgut of Trichoplus ia ni, egg of Trichoplusia ni For example, High Five TM cells, Mamestra brassicae-derived cells, Estigmena acrea-derived cells and the like are used.
  • Sf cell a cell line derived from silkworm (Bombyxmori N; BmN cell) is used.
  • Sf cell include Sf9 cell (ATCC CRL1711), Sf21 cell [Vaughn, LL et al., In Vitro, Vol. 13-217 (1977)].
  • animal cells examples include monkey COS-7 cells, Vero cells, Chinese hamster cells CH ⁇ , DHFR gene-deficient Chinese hamster cells CHO (dhfr-CHO cells), mouse L cells, mouse 3T3 cells, mouse myeloma cells, Human ⁇ 293 cells, human FL cells, 293 cells, C127 cells, BALB 3 ⁇ 3 cells, Sp_2 / ⁇ cells, mouse B cell line WEH I 231 cells, P 3U1 plasma site and the like are used.
  • Transformation of yeast can be performed, for example, using Proc. Natl. Acad. Sci. USA, Proc. Natl. Acad. Sci. USA, 75, 1929 (Proc. 1978). Transformation of insect cells or insects is performed, for example, according to the method described in Bio / Technology, Vol. 6, pages 47-55 (1988).
  • Transformation of animal cells is performed, for example, according to the method described in Virology, 52, 456 (1973).
  • Examples of a method for introducing an expression vector into cells include the lipofection method.
  • the above-described expression vector introduced into the animal cells and a cell in which the expression vector is incorporated into a chromosome are clone-selected.
  • a transformant is selected using the above-mentioned selection marker as an index.
  • a stable animal cell line having high expression ability of polypeptides or the like can be obtained.
  • the MTX concentration is gradually increased, culture is performed, and by selecting a resistant strain, DNA encoding the polypeptide or its partial peptide, etc., together with the dhfr gene can be transferred to cells. It can also be amplified in E. coli to obtain more highly expressed animal cell lines.
  • the above transformant is cultured under conditions under which DNA encoding the polypeptide etc. (CD72, CD100) can be expressed, and the polypeptide etc. can be produced and accumulated by producing and accumulating the polypeptide etc. .
  • a liquid medium is suitable as a medium used for the cultivation, and a carbon source necessary for the growth of the transformant is contained therein.
  • carbon sources include glucose, dextrin, soluble starch, and sucrose.
  • nitrogen sources include ammonium salts, nitrates, corn chip liquor, peptone, potato zein, meat extract, soybean meal, and potato extract.
  • the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride.
  • yeast extract, vitamins, growth promoting factors and the like may be added.
  • the pH of the medium is preferably about 5-8.
  • Examples of a medium for culturing the genus Escherichia include, for example, an M9 medium containing glucose and casamino acid (Miller, Journal of Experiments in Molecular Genetics). 431-433, Cold Spring Harbor Laboratory, New York. 19 72] is preferred. If necessary, a drug such as 33-indolylacrylic acid can be added to make the promotion work efficiently.
  • the cultivation is usually performed at about 15 to 43 ° C for about 3 to 24 hours, and if necessary, aeration and stirring may be added.
  • cultivation is usually performed at about 30 to 40 ° C for about 6 to 24 hours.
  • the culture medium When culturing a transformant in which the host is yeast, the culture medium may be, for example, Burkholder's minimal medium [Bostian, KL, et al., “Procedures * of the National Academy of Sciences”. Natl. Acad. Sci. USA, 77 vol.'4505 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA et al. Seasings-of-the-National-Academy-of-the-Sciences-of-the-Your-Sue (Pro atl. Acad. Sci. USA), 81, 5330 (1 984)]
  • the ⁇ is preferably adjusted to about 5 to 8. Culture is usually performed at about 2 Ot: ⁇ 35 for about 24 to 72 hours, and aeration and stirring are added as necessary.
  • the culture medium When culturing a transformant whose host is an insect cell, the culture medium was immobilized in Grace's Insect Medium (Grace, TCC, Nature, 195, 788 (1962)). Those to which additives such as serum are appropriately added are used.
  • the pH of the medium is preferably adjusted to about 6.2 to 6.4. Culture is usually performed at about 27 ° C for about 3 to 5 days, and aeration and / or agitation are added as necessary.
  • a MEM medium containing about 5 to 20% fetal bovine serum [Seience, 122, 501 (1952)] , DMEM medium (Virology, 8, 396 (1959)), RPMI 1640 medium (Journal of the American Medical Association, The Jounal of The American Medical Association, 199, 5 1 9 (1967)], 199 medium [Proceeding of the Society for The Biological Medicine], 73, 1 (1 950)] are used.
  • the pH is about 6-8.
  • Culture is usually about 30 ° (: about 15-60 at ⁇ 40 ° C) Perform for a while, and add aeration and stirring as needed.
  • CHO (dhfr ) cells and the dhfr gene as selection markers, it is preferable to use a DMEM medium containing dialyzed fetal serum containing almost no thymidine.
  • the CD72 or CD100 used in the present invention can be separated and purified from the above culture by, for example, the following method.
  • CD72 or CD100 used in the present invention is extracted from cultured cells or cells
  • the cells or cells are collected by a known method after culturing, and the cells or cells are suspended in an appropriate buffer. After disrupting cells or cells by ultrasonication, lysozyme, Z or freeze-thawing, a method of obtaining a crude extract of the polypeptide by centrifugation or filtration may be used as appropriate. Even if the buffer contains a protein denaturing agent such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 (registered trademark, sometimes abbreviated as TM). Good.
  • TM Triton X-100
  • CD72 or CD100 used in the present invention is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. .
  • Purification of the CD72 or CD100 used in the present invention contained in the culture supernatant or the extract obtained in this manner is carried out by appropriately combining known separation and purification methods.
  • known separation and purification methods mainly include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis.
  • Method using difference in molecular weight Method using charge difference such as ion exchange chromatography, Method using specific affinity such as affinity chromatography, Hydrophobic such as reversed phase high performance liquid chromatography
  • a method utilizing the difference in gender, a method utilizing the difference in isoelectric points such as isoelectric focusing, and chromatofocusing are used.
  • CD72 or CD100 used in the present invention when CD72 or CD100 used in the present invention thus obtained is obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, it can be obtained in a salt form. In the case where it is obtained, it can be converted into a free form or another salt by a method known per se or a method analogous thereto.
  • CD72 or CD100 used in the present invention produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed before or after purification by the action of an appropriate protein-modifying enzyme. You can also.
  • the protein modifying enzyme for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used.
  • the presence of the polypeptide of the present invention thus produced can be measured by enzyme immunoassay using a specific antibody or the like.
  • CD72 or a salt thereof as a receptor, or construct a recombinant CD72 expression system, and use the expression system to bind CD100 or a salt thereof to a ligand-based receptor system (Ligand Receptor Aichi-Atsui).
  • the compound eg, peptide, protein, non-peptidic compound, synthetic compound, fermentation product, etc.
  • its salt that changes the binding between CD100 or its salt and CD72 or its salt by using Can be screened.
  • Such compounds include CD72-mediated immune response-promoting activity [eg, the production of antibodies such as antigen-specific IgG; the production of antibodies to TD (T cell-dependent) antigens; the proliferation of T cells; (I.e., T cell reactivity such as production of interferon gamma, activity to promote or suppress dendritic cell reactivity such as production of IL-12, etc.) (ie, CD72 agonist) and the promotion of the immune response.
  • CD72-mediated immune response-promoting activity eg, the production of antibodies such as antigen-specific IgG; the production of antibodies to TD (T cell-dependent) antigens; the proliferation of T cells; (I.e., T cell reactivity such as production of interferon gamma, activity to promote or suppress dendritic cell reactivity such as production of IL-12, etc.) (ie, CD72 agonist) and the promotion of the immune response.
  • Compounds having no activity ie, CD72 antagonist
  • Changing the binding between CD100 or its salt and its receptor means that CD100 or its salt and its receptor (eg, CD72 or its salt) This includes both the case of inhibiting the binding of and the case of promoting the binding to the ligand.
  • the present invention relates to (i) a case where CD100 or a salt thereof is brought into contact with CD100 or a salt thereof, and (ii) a case where the above-mentioned CD72 or a salt thereof is brought into contact with CD100 or a salt thereof and a test compound. And a method for screening a compound or a salt thereof that alters the binding property between CD100 or a salt thereof and CD72 or a salt thereof, wherein the method is characterized by comparing with CD100 or a salt thereof.
  • a compound that activates CD72 or a salt thereof is contacted with a cell containing CD72 or a salt thereof, and a compound or test that activates CD72 or a salt thereof.
  • CD72 or its salt-mediated immune response-promoting activity when a compound is contacted with cells containing CD72 or a salt thereof [eg, production of an antibody such as an antigen-specific IgG; TD (T cell-dependent ) T cell reactivity such as antibody production against antigen, T cell proliferation, IL-14 production, interferon gamma production, etc .; activity to promote or suppress ⁇ dendritic cell reactivity such as IL-12 production, etc.
  • a compound that activates CD72 or a salt thereof and a test compound are expressed on a cell membrane by culturing a transformant containing DNA encoding CD72.
  • CD72 or its salt-mediated immune response promoting activity when exposed to 72 or a salt thereof for example, production of an antibody such as an antigen-specific IgG; production of an antibody against a TD (T cell-dependent) antigen; T cell proliferation, T cell reactivity such as IL-14 production, interferon gamma production; activity to promote or suppress dendritic cell reactivity such as IL-12 production, etc.
  • any CD72 may be used as long as it contains the above-mentioned CD72, but the membrane fraction of organs such as humans, warm-blooded animals, and fish may be used. Is preferred. However, since it is extremely difficult to obtain human-derived organs in particular, CD72 or a salt thereof expressed in a large amount using a recombinant is suitable for screening.
  • CD72 or a salt thereof, the above-described methods and the like are used.
  • the cells When cells containing CD72 or a salt thereof are used, the cells may be immobilized with datalaldehyde, formalin, or the like.
  • the immobilization method can be performed according to a method known per se.
  • the cell containing CD72 or a salt thereof refers to a host cell expressing CD72 or a salt thereof.
  • the host cell include the aforementioned Escherichia coli, Bacillus subtilis, yeast, insect cells, animal cells, and the like. Can be
  • the membrane fraction refers to a fraction containing a large amount of cell membrane obtained by a method known per se after cell disruption.
  • the cells can be crushed by crushing the cells with a Potter-Elvehjem homogenizer, crushing with a Waring Blender ⁇ Polytron (Kinematica), crushing with ultrasonic waves, or squirting the cells from a narrow nozzle while applying pressure with a French press. Crushing and the like.
  • centrifugal fractionation methods such as differential centrifugation and density gradient centrifugation are mainly used.
  • the cell lysate is centrifuged at a low speed (500 rpm to 3000 rpm) for a short time (typically about 1 minute to 10 minutes), and the supernatant is further centrifuged at a higher speed (1500 rpm to 30000 rpm). Centrifuge for 1 minute to 2 hours, and use the resulting precipitate as the membrane fraction.
  • the membrane fraction is rich in the expressed CD72 or a salt thereof and membrane components such as cell-derived phospholipids and membrane proteins.
  • the amount of CD72 or a salt thereof in a cell or a membrane fraction containing the CD72 or a salt thereof is preferably 10 3 to 10 8 molecules per cell, and more preferably 10 5 to 10 7 molecules per cell. It is suitable.
  • an appropriate CD72 fraction and a labeled ligand (CD100) Is used.
  • the CD72 fraction a natural CD72 fraction or a recombinant CD72 fraction having an activity equivalent thereto is desirable.
  • the equivalent activity means equivalent ligand binding activity and the like.
  • the labeled ligand a labeled ligand (CD 100), a labeled ligand (CD 100) analog compound, or the like is used.
  • [3 H], [125 1], [14 C] it is the child utilizing such a ligand which is labeled with a [35 S] (CD 100).
  • a labeled form of CD100 or a CD100 derivative prepared by a known method using Bolton-Han-Yuichi reagent can also be used.
  • the cells containing the CD72 or a salt thereof or a membrane fraction of the cell are subjected to screening.
  • a buffer suitable for screening may be any buffer such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer which does not inhibit the binding between the ligand and the receptor.
  • surfactants such as CHAPS, Tween-80 TM (Kao-Atlas), digitonin, and dexcholate can be added to the buffer to reduce non-specific binding.
  • a protease inhibitor such as PMSF, leptin, E-64 (manufactured by Peptide Research Institute), or peptidyltin can be added in order to suppress the degradation of CD72 and CD100 by the protease.
  • PMSF Propeptide Research Institute
  • peptidyltin a protease inhibitor
  • the reaction solution is filtered through a glass fiber filter, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured by liquid scintillation. Measure in the evening of the race county or the evening of the county count.
  • the specific binding amount (B—NSB) is For example, a test compound having 50% or less can be selected as a candidate substance having a competitive inhibitory ability.
  • BI Acore manufactured by Amersham Pharmacia Biotech
  • CD100 or a salt thereof or a derivative thereof is immobilized on a sensor chip by an amino coupling method according to a protocol attached to the device, and a cell containing CD72 or a salt thereof or a DN encoding CD72.
  • CD72 or a salt thereof purified from a transformant containing A or a membrane fraction containing CD72 or a salt thereof, or a purified CD72 or a membrane fraction containing a salt thereof or CD72 or a salt thereof and a test compound Pass a buffer solution such as phosphate buffer or Tris buffer solution containing at a flow rate of 2-20 ⁇ per minute over the sensor chip.
  • CD72 or its salt and CD Compounds that alter the binding to 100 or a salt thereof can be screened.
  • CD72 or a salt thereof is immobilized on a sensor chip, and a buffer solution such as a phosphate buffer or a Tris buffer containing CD100 or a salt thereof, or CD100 or a salt thereof and a test compound is sensed.
  • a buffer solution such as a phosphate buffer or a Tris buffer containing CD100 or a salt thereof, or CD100 or a salt thereof and a test compound is sensed.
  • the same measurement can be performed by using a method of passing through one chip.
  • Examples of the test compound include the same compounds as described above.
  • the activity of promoting an immune reaction through CD72 or a salt thereof [for example, production of antibodies such as antigen-specific IgG; production of antibodies to TD (T cell-dependent) antigen; proliferation of T cells; production of IL-14; reactivity of T cells such as production of interferon gamma; production of IL_12 Activity for promoting or suppressing dendritic cell reactivity, etc.] can be measured using known methods or commercially available measurement kits. Specifically, first, cells containing CD72 or a salt thereof are cultured in a multiwell plate or the like.
  • the assay may be performed by adding an inhibitor to the enzyme.
  • cells expressing the appropriate CD72 or a salt thereof are used.
  • cells expressing CD72 or a salt thereof B cells and the above-mentioned recombinant CD72-expressing cell line are preferable.
  • the transformant-expressing CD72-expressing cell may be a stable expression strain or a transient expression strain. The same kind of animal cells as described above are used.
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.
  • the above-mentioned ligand system is used as follows.
  • a receptor-expressing cell When a receptor-expressing cell is stimulated by a receptor agonist, the production and secretion of intracellular class switches and any of IgG, IgA, IgD, and IgE other than IgM are promoted. Occurs.
  • the amount of antibody produced and secreted can be measured by the ELISA method by using a directly or indirectly labeled anti-Ig antibody to promote the antibody production of the receptor agonist. Using this reaction, the activity of CD100 to promote the production of antibodies against CD72-expressing cells can be measured. Specifically, this is carried out according to Example 2 described later and a method analogous thereto.
  • CD100 or a salt thereof, or CD100 or a salt thereof and a test compound were added, and the change in the activity of promoting antibody production was observed as compared with the case where CD100 or a salt thereof was administered alone.
  • Wear At this time, a compound exhibiting an activity of suppressing the activity of promoting the production of antibodies against CD72-expressing cells by CD100 can be selected as a candidate substance having a competitive inhibitory ability.
  • agonists can be screened by administering the test compound alone and observing the activity of promoting antibody production on CD72-expressing cells.
  • the culture medium or control IgM and IgG were diluted with 0.1 M carbonate buffer (pH 9.6), and each well of EIA 96-well Immunobrate (Maxisorp: Nunc) was diluted. 100 1 each, and leave it for about 4 hours. Wash each well with buffer A (0.02 M phosphate buffer, pH 7.0 containing 0.15 M NaCl), then add buffer B (0.1% BSA, 0.15 M NaCl). Solution containing enzyme-labeled anti-IgM, IgG, IgA, IgD, and IgE antibody diluted with 0.02M phosphate buffer (pH 7.0). Let react for 2 hours.
  • buffer A 0.02 M phosphate buffer, pH 7.0 containing 0.15 M NaCl
  • buffer B 0.15 M NaCl
  • alkaline phosphatase substrate solution (lmg / m1 phosphatase substrate (Sigma), 10 OmM Tris (pH 9.5), 100 mM NaC1, Add 100 mM 1 of 5 mM MgC12) and react at 25 ° C for 30 minutes. Measure absorbance at 405 nm using an automatic colorimeter for microplates. Assuming that the absorbance of the experimental group to which only CD 100 or its salt was added was 100% and that of the experimental group to which CD 100 or its salt was not added was 0%, the effect of the test compound on the antibody production promoting activity by CD 100 or its salt Is calculated. A test compound having an antibody production-promoting activity of, for example, 50% or less can be selected as a candidate substance capable of competitive inhibition.
  • a kit for screening a compound or a salt thereof that alters the binding between CD100 or a salt thereof and CD72 or a salt thereof includes CD72 or a salt thereof, a cell containing the CD72 or a salt thereof, or CD72 or a salt thereof. Of cells containing salt It contains a membrane fraction and CD100 or a salt thereof.
  • Examples of the screening kit of the present invention include the following.
  • CD100 or a salt thereof labeled with [ 3 H], [ 125 I], [ 14 C], [ 35 S] or the like.
  • CD100 or a salt thereof in PBS containing 0.1% ⁇ serum albumin (manufactured by Sigma) so as to become ImM, and store at -20 :.
  • a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is a compound that changes the binding (inhibits or promotes the binding) between CD100 or a salt thereof and CD72 or a salt thereof.
  • a compound having an immune response promoting activity such as antibody production via CD72 or a salt thereof, or a salt thereof (so-called CD72 agonist), or a compound having no immune response promoting activity (so-called CD72) 72 anniversary gonist).
  • the compound include peptides, proteins, non-peptidic compounds, synthetic compounds, and fermentation products. These compounds may be novel compounds or known compounds.
  • test compound is brought into contact with cells containing CD72 or a salt thereof, and the activity of promoting immune response such as antibody production via CD72 or a salt thereof is measured.
  • the compound having an immune response promoting activity or a salt thereof is CD72 agonist.
  • a compound that activates CD72 or a salt thereof eg, CD100 or CD 72 agonist
  • a compound that activates CD72 or a salt thereof and a test compound to a cell containing CD72 or a salt thereof.
  • the activity of promoting immune response such as antibody production via CD72 or a salt thereof is measured and compared.
  • a compound or a salt thereof that can reduce the immune response promoting activity by a compound that activates CD72 or a salt thereof is a CD72 antagonist.
  • the CD72 agonist Since the CD72 agonist has the same activity as CD100 or a salt thereof on CD72 or a salt thereof, the CD72 agonist is safe and low in the same manner as the CD100 or a salt thereof. Useful as a toxic drug.
  • the CD72 antagonist is capable of suppressing the physiological activity of CD100 or a salt thereof against CD72 or a salt thereof, it is safe and low toxic to suppress the receptor activity. Useful as a medicine.
  • CD72 or a salt thereof can suppress the physiological activity of CD100 or a salt thereof, like the CD72 antagonist, and is therefore useful as a safe and low-toxic drug.
  • CD72 agonist is a viral infection or disease (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, chickenpox, limbs Mouth disease, shingles, erythema contaminated, rash, rubella, idiopathic rash, viral conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola blood fever, Marlbladder fever, Congo haemorrhagic fever, Yellow fever, dengue, rabies, adult T-cell leukemia (ATL), oral virus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, Hansen
  • a pharmaceutically acceptable salt or the like is used as a salt of the compound obtained by using the above-described screening method or screening kit.
  • examples include salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids, and the like.
  • the salt with an inorganic base include an alkali metal salt such as a sodium salt and a potassium salt, an alkaline earth metal salt such as a calcium salt and a magnesium salt, and an aluminum salt and an ammonium salt.
  • salts with organic bases include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, genoaluminamine, triethanolamine, cyclohexylamine, dicyclohexane. Salts with xylamine, N, N'-dibenzylethylenediamine and the like.
  • salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and the like.
  • Suitable examples of salts with organic acids include, for example, formic acid, acetic acid, propionic acid, fumaric acid Salts with acids, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, benzoic acid, and the like.
  • salts with a basic amino acid include, for example, salts with arginine, lysine, or oltinine
  • salts with the acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. can give.
  • a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as a medicament, it can be carried out in a conventional manner.
  • sterile solution orally as tablets, capsules, elixirs, microcapsules, etc. coated with sugar coating or enteric coating as needed, or with water or other pharmaceutically acceptable liquids
  • the compound or a salt thereof may be combined with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder, etc., in a generally accepted unit dosage required for pharmaceutical practice. It can be manufactured by mixing in the form. The amount of the active ingredient in these preparations is adjusted so that an appropriate dose in the specified range can be obtained.
  • Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth gum, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc.
  • binders such as gelatin, corn starch, tragacanth gum, gum arabic
  • excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc.
  • a leavening agent such as magnesium stearate
  • a sweetener such as sucrose, lactose or saccharin
  • a flavoring agent such as peppermint, cocoa oil or cellulose
  • a liquid carrier such as an oil or fat can be further contained in the above-mentioned type of material.
  • Sterile compositions for injection can be formulated according to standard pharmaceutical practice, such as dissolving or suspending the active substance in a vehicle such as water for injection, or naturally occurring vegetable oils such as sesame oil
  • Aqueous solutions for injection include, for example, saline, isotonic solutions containing dextrose and other auxiliaries (eg, D-Sorbi! ⁇ -I, D_mannitol, sodium chloride, etc.), and the like.
  • Suitable solubilizers such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol) ), Nonionic surfactants (eg, polysorbate 80 (TM), HCO-50) and the like.
  • the oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol.
  • buffers eg, phosphate buffer, sodium acetate buffer
  • soothing agents eg, benzalkonium chloride, proforce hydrochloride, etc.
  • stabilizers eg, human serum albumin, polyethylene glycol, etc.
  • preservatives eg, benzyl alcohol, phenol, etc.
  • the preparations obtained in this way are safe and low toxic, and can be used, for example, in humans and mammals (for example, mice, rats, guinea pigs, egrets, sheep, higgs, bushus, dogs, cats, dogs, monkeys, chimpanzees, etc.). ) Can be administered.
  • the dose of a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention varies depending on the symptoms and the like.
  • the single dose varies depending on the administration target, target organ, symptoms, administration method, etc. It is convenient to administer about 0.01 to 3 Omg per day, preferably about 0.1 to 2 Omg, more preferably about 0.1 to 10 mg by intravenous injection.
  • the amount converted per 60 kg can be administered.
  • CD72 or a salt thereof When CD72 or a salt thereof is used as a medicament, a compound or a salt thereof obtained using the above-described screening method or screening kit of the present invention or a salt thereof is formulated and carried out in the same manner as when a medicament is used. be able to.
  • a non-human animal in which the CD100 gene has been knocked out (hereinafter sometimes referred to as a CD100 gene-deficient non-human animal) can be produced using non-human animal ES cells having an inactivated CD100 gene sequence.
  • the non-human animal ES cells having the inactivated CD100 gene sequence are artificially mutating the CD100 gene of the non-human animal ES cells to suppress the gene expression ability, or By substantially losing the activity of CD100 encoded by the gene, the gene was substantially inactivated without the ability to express CD100 (hereinafter, may be referred to as a knockout gene).
  • ES cells of non-human animals are artificially mutating the CD100 gene of the non-human animal ES cells to suppress the gene expression ability, or By substantially losing the activity of CD100 encoded by the gene, the gene was substantially inactivated without the ability to express CD100 (hereinafter, may be referred to as a knockout gene).
  • the non-human animal may be any animal other than a human having the CD100 gene, but a non-human mammal is preferred.
  • a non-human mammal for example, red sea lions, bushes, higgies, goats, blue herons, dogs, cats, guinea pigs, hams, mice, rats and the like are used.
  • the ontogenesis and biological cycle are relatively short in terms of the creation of the diseased animal model system, and rodents, especially those that are easy to breed, especially mice (for example, the C57BLZ6 strain as a pure strain,
  • rodents especially those that are easy to breed, especially mice (for example, the C57BLZ6 strain as a pure strain
  • a cross line such as two DBA lines, one B 6 C 3 F line, one BDF line, one B 6D2 F line, BALBZc line, ICR line, or rat (eg, Wistar, SD, etc.) is particularly preferable.
  • the CD100 gene may be a CD100 gene derived from a genome isolated and extracted from an animal, or may be a CD100 cDNA cloned using a genetic engineering technique.
  • the gene for the mouse-derived CD100 protein having the amino acid sequence represented by SEQ ID NO: 1 for example, a gene having the base sequence represented by SEQ ID NO: 2 is used.
  • a gene having the base sequence represented by SEQ ID NO: 4 or the like is used as the gene for the human-derived CD100 protein having the amino acid sequence represented.
  • a method for artificially mutating the CD100 gene for example, it can be carried out by deleting a part or all of the gene sequence and inserting or substituting another gene by a genetic engineering technique.
  • a knockout gene of CD100 can be prepared by shifting the codon reading frame or disrupting the function of the promoter or exon.
  • CD100 gene inactivated ES cells or knockout ES cells include, for example, drug resistance genes (eg, , Neomycin resistance gene, hygromycin resistance gene, etc., preferably omycin resistance gene, etc., or repo overnight gene (eg, lacZ (] 3_galactosidase gene), cat (chloramphenicol acetyltyl transferase gene) Or preferably, lac Z, etc.) to destroy the exon function, or insert a DNA sequence (eg, polyA addition signal) into the intron between the exons to terminate gene transcription.
  • drug resistance genes eg, Neomycin resistance gene, hygromycin resistance gene, etc., preferably omycin resistance gene, etc.
  • repo overnight gene eg, lacZ (] 3_galactosidase gene
  • cat chloramphenicol acetyltyl transferase gene
  • lac Z lac Z
  • RNA strand (hereinafter, evening abbreviated as one Getting vectors) which have a DNA sequence which was constructed Kowasuru so making.
  • the reporter gene is preferably inserted so as to be expressed under the control of the CD100 promoter.
  • a DNA strand having a DNA sequence constructed so as to disrupt the gene is introduced into the chromosome of the animal by, for example, homologous recombination, and the resulting ES cell is subjected to a DNA sequence on or near the CD100 gene
  • the DNA sequence on the targeting vector and the DNA sequence on the targeting vector and the DNA sequence of the nearby region other than the CD100 gene used for the preparation of the targeting vector were analyzed by PCR using primers as primers. It can be obtained by sorting.
  • ES cells from which the CD100 gene is inactivated by the homologous recombination method or the like for example, those already established as described above may be used, or a new ES cell may be used according to the method of Evans and Kaufma. It may be established. For example, in the case of mouse ES cells, currently, 129 ES cells are generally used. However, since the immunological background is not clear, a pure line which is an alternative to immunological genetically For the purpose of obtaining ES cells with a clear background, for example, BDF1 mice (C57BLZ6 and C57BLZ6 Those established using F1) with DBAZ2 can also be used successfully.
  • BDF 1 mice have the advantage of high egg collection and robust eggs
  • C57BL / 6 mice are used as background
  • the ES cells obtained by using them can be used to cross-react with C57BLZ6 mice to create a genetic background for C57BLZ6 mice. It can be used advantageously because it can be replaced with a BL / 6 mouse.
  • blastocysts 3.5 days after fertilization are generally used.However, it is more efficient to collect embryos at the 8-cell stage and culture them up to blastocysts. Many early embryos can be obtained.
  • male ES cells are generally more convenient for producing a germline chimera. It is also desirable to discriminate between males and females as soon as possible in order to reduce the complexity of culturing.
  • sex identification methods of ES cells for example, amplifying the gene in the sex-determining region on the Y chromosome by PCR process and detected, be mentioned as its example is
  • the use of Degiru t this method conventional , for example G-banding method, it requires about 10 6 cells for karyotype analysis, since requires the number of ES cells approximately 1 colony (about 50), the first ES cells in culture Initial Subsequent selection can be carried out by gender discrimination, and the early selection of male cells can greatly reduce the labor required for the initial culture.
  • Embryonic stem cell lines obtained in this way usually have very good growth potential, but must be carefully subcultured because they tend to lose their ability to generate individuals.
  • a suitable feeder cell such as STO fibroblasts
  • CO 2 incubator preferably 5% CO 2, 95% air or Incubate the cells at about 37 ° C in 5% oxygen, 5% carbon dioxide, 90% air, etc.
  • trypsin ZEDTA solution usually 0.001-0.5% trypsin / 0%
  • 1-5 mM EDTA preferably about 0.1% trypsin Z1
  • a single cell is prepared by treatment with mM EDTA) and seeded on a newly prepared feeder cell.
  • Such subculture is usually performed every 1 to 3 days. At this time, cells are observed, and if morphologically abnormal cells are found, it is desirable to discard the cultured cells.
  • ES cells can be transformed into various types of cells, such as parietal, visceral, and cardiac muscle, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions.
  • MJ Evans and MH Kaufman Nature, 292, 154, 1981; GR Martin Proceedings of the National Academy of Sciences (SA). Proc. Natl. Acad. Sci. USA) 78, 7634, 1981; TC Doetschman et al., Journal of Obembliology and Experimental Morphology, 87, 27, 1985.
  • CD100 gene expression deficient cells obtained by differentiating ES cells are useful in the cell biology of CD100 in the in vivo mouth.
  • a transgenic non-human animal having an inactivated CD100 gene sequence (hereinafter sometimes referred to as a non-human gene-deficient non-human animal) is, for example, a non-human animal embryo having the inactivated CD100 gene sequence. It is created by genetic engineering using stem cell-derived cells, and is, for example, a non-human animal in which the inactivated CD100 gene sequence has been introduced into germ cells and somatic cells at an early stage of embryogenesis.
  • the above-mentioned evening-targeting vector is introduced into mouse embryonic stem cells or mouse egg cells, and the inactivated CD100 gene sequence of the evening-targeting vector is homologously recombined by gene homologous recombination. This can be achieved by replacing the CD100 gene on the chromosome of mouse embryonic stem cells or mouse egg cells.
  • non-human animal embryonic stem cells When non-human animal embryonic stem cells are used, a cell line in which the CD100 gene has been inactivated by homologous recombination is cloned, and the cells are cloned at an appropriate time in the early stage of embryogenesis, for example, The 8-cell stage non-human animal embryo or blastocyst is injected, and the prepared chimeric embryo is transplanted into the uterus of the pseudo-pregnant non-human animal.
  • the produced animal is a chimeric animal composed of both cells having a normal CD100 locus and cells having an artificially mutated CD100 locus.
  • all tissues are artificially obtained from the population obtained by crossing such a chimeric individual with a normal individual. It can be obtained by selecting individuals composed of cells having the CD100 locus with mutation added thereto, for example, by judging coat color or the like.
  • the individuals obtained in this way are usually CD100 heterozygously deficient individuals, and crossbreeding individuals with CD100 heterozygously deficient expression, and CD100 homozygous expression defects from their offspring. Individuals can be obtained.
  • a transgenic non-human animal having a chromosome into which a gettering vector has been introduced can be obtained by injecting a gene solution into a nucleus of an egg cell by a microinjection method. Compared to non-human genic animals, they can be obtained by selecting those with a mutation at the CD100 locus by genetic homologous recombination.
  • a non-human animal deficient in CD100 gene expression can be distinguished from a normal animal by measuring the mRNA level of the animal using a known method and indirectly comparing the expression level. .
  • the animals obtained by crossing should also be confirmed to have the gene knocked out and be subcultured in a normal breeding environment. Can be.
  • the germline can be obtained and maintained according to a conventional method. That is, by mating male and female animals having the inactivated gene sequence, a homozygous animal having the inactivated gene sequence on both homologous chromosomes can be obtained. The obtained homozygous animal was compared to the mother animal by 1 normal individual It can be obtained efficiently by breeding in a state where there are multiple mosaigots. By mating male and female heterozygous animals, homozygous and heterozygous animals having the inactivated gene sequence can be bred and subcultured. The progeny of the animal having the inactivated gene sequence thus obtained is also included in the non-human animal deficient in CD100 gene expression.
  • Such non-human animal embryonic stem cells in which the CD100 gene has been inactivated are extremely useful for producing a nonhuman animal deficient in expression of the CD100 gene.
  • the non-human animal deficient in CD100 gene expression produced as described above has (1) a reduced ability to produce antibodies to the TD (T cell-dependent) antigen (Example 6 described later), (2) Loss of T cell reactivity such as IL-4 producing ability and INF-fer producing ability (Example 7 described later) (3) Loss of dendritic cell reactivity such as IL-11 producing ability (Example 1 described later) 0) a non-human animal that has a CD100 deficiency, such as a disease caused by a CD100 deficiency, for example, an inactivity of the CD100 biological activity based on the loss of various biological activities that can be induced by the CD100.
  • Diseases caused by metamorphosis such as viral infections or diseases (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, varicella, hand, foot and mouth disease, shingles, erythema contagis, rubella, sudden rash , Viral conjunctivitis, viral meningitis, viral pneumonia, viral brain , Lassa fever, Ebola hemorrhagic fever, Marbleda disease, Congo haemorrhagic fever, yellow fever, dengue fever, rabies, adult T-cell leukemia (ATL), oral tauvirus, polio, mumps), bacterial or fungal infection or Diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid fever, cholera, paratyphoid, plague, tetanus, tularemia, brucellosis, anthrax, sepsis, bacterial pneumonia, dermatomycosis,
  • the non-animals deficient in CD100 gene expression can be used for screening for a preventive / therapeutic agent for the disease.
  • Examples of the non-human animal deficient in CD100 gene expression used in the screening method of the present invention include the same animals as described above.
  • Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, etc., and these compounds are novel compounds. Or a known compound.
  • non-human animals deficient in CD100 gene expression are treated with a test compound, compared with untreated control animals, and tested using changes in the organs, tissues, disease symptoms, etc. of the animals as indices. Compounds can be tested for their prophylactic and therapeutic effects.
  • test compound for example, oral administration, intravenous injection and the like are used, and it can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like.
  • the dose of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.
  • a non-human animal lacking the expression of the CD100 gene is administered, for example, mocyanine to a keyhole limpet, and then the test substance is administered to the abdominal cavity, subcutaneously, intravenously, etc.
  • screening can be performed by measuring the amount of interferon gamma or IL-12 in the blood.
  • screening can be performed by implanting the tumor into the abdominal cavity, subcutaneously, or intravenously, administering the test substance to the peritoneal cavity, subcutaneously, intravenously, etc. over time, and measuring the tumor volume and survival time.
  • the prophylactic / therapeutic agent of the present invention obtained by the screening method using a non-human animal in which the CD100 gene has been knocked out is a compound selected from the test compounds described above, It is effective as a safe and low-toxic treatment for diseases caused by CD100 deficiency because it has preventive and therapeutic effects on diseases caused by it.
  • a compound derived from the compound can also be used.
  • the compound obtained by the screening method may form a salt, and the salt of the compound is preferably a physiologically acceptable acid addition salt.
  • Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid), Alternatively, salts with organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used. .
  • inorganic acids eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid,
  • the screening method of the present invention using a non-human animal in which the CD100 gene is knocked out is performed by the above-described method for screening a compound or a salt thereof that alters the binding property between CD100 and CD72 (ligand ⁇ It may be implemented in combination with Reception (Atsui system). That is, the present invention uses a non-human animal in which the CD100 gene has been knocked out, and comprises a compound that alters the binding between CD100 or a salt thereof and its receptor (particularly, CD1 A compound that promotes the binding between CD100 and CD72 or a compound that binds to CD72 in place of CD100) or a salt thereof.
  • the compound that alters the binding property between CD100 and CD72 was selected as a candidate compound using the ligand-receptor-Atsui system as a primary screening, and then the non-human CD100 knocked-out non-human compound was selected.
  • the prophylactic / therapeutic effect of the candidate compound may be tested in a secondary screening system using animals, or a screening system using a non-human animal in which the CD100 gene is knocked out may be used as the primary screening for the candidate compound.
  • the ligand ′ is subjected to secondary screening of Receptu Atsushi system, and the obtained compound that alters the binding property between CD100 and CD72 is used as the preventive agent of the present invention. It may be selected as a candidate compound.
  • the compound or a salt thereof obtained by the screening method using a non-human animal in which the CD100 gene of the present invention has been knocked out is used as the above-mentioned therapeutic or prophylactic agent, it can be carried out according to conventional means.
  • orally coated as tablets, capsules, elixirs, microcapsules, etc. coated with sugar, aseptic solution or suspension with water or other pharmaceutically acceptable liquids It can be used parenterally in the form of injections.
  • the compound or a salt thereof is mixed with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder and the like in a unit dosage form required for generally accepted pharmaceutical practice. Can be manufactured.
  • Additives that can be incorporated into tablets, capsules, etc. include, for example, binders such as gelatin, corn starch, tragacanth, gum arabic, excipients such as crystalline cellulose, corn starch, gelatin, alginic acid, etc. Swelling agents such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, and flavoring agents such as peppermint, cocoa oil or cherry.
  • a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material.
  • Sterile compositions for injection can be formulated according to standard pharmaceutical practice, such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil and coconut oil. it can.
  • Aqueous injection solutions include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.).
  • glucose and other adjuvants eg, D-sorbitol, D-mannitol, sodium chloride, etc.
  • alcohols for example, ethanol
  • polyalcohols for example, propylene glycol, polyethylene glycol, etc.
  • nonionic surfactants for example, polysorbate 80TM, HCO-50, etc.
  • buffers eg, phosphate buffer, sodium acetate buffer, etc.
  • soothing agents eg, benzalkonium chloride, proactive hydrochloride, etc.
  • stabilizers eg, human serum albumin, polyethylene glycol, etc.
  • Preservatives eg, benzyl alcohol, phenol, etc.
  • antioxidants eg, antioxidants and the like.
  • the prepared injection solution is usually filled into a suitable ampoule.
  • the preparations obtained in this way are safe and low toxic and can be used, for example, in humans or in warm-blooded animals (eg mice, rats, puppies, sheep, bush, pussi, puma, birds, cats, dogs, Monkeys, chimpanzees, etc.).
  • warm-blooded animals eg mice, rats, puppies, sheep, bush, pussi, puma, birds, cats, dogs, Monkeys, chimpanzees, etc.
  • the dose of the compound or a salt thereof varies depending on the symptoms and the like. However, in the case of oral administration, in general, for an adult (assuming a body weight of 60 kg), about 0.1 to 100 mg per day, Preferably, it is about 1.0 to 50 mg, more preferably about 1.0 to 20 mg.
  • the single dose depends on the subject, target organ, and disease. For example, in the form of an injection, usually about 0.01 to 30 mg, preferably about 0.1 to 2 Omg per day for an adult (60 kg) in the form of an injection More preferably, about 0.1 to 1 Omg is administered by intravenous injection. For other animals, the equivalent dose per 60 kg can be administered.
  • the present invention provides a test compound administered to a non-human animal deficient in CD100 gene expression, and detects or suppresses the expression of a reporter gene, thereby promoting or inhibiting CD100 promoter activity.
  • a method for screening a compound or a salt thereof is provided.
  • the non-human animals deficient in CD100 gene expression described above are inactivated by introducing a reporter gene.
  • the CD100 gene sequence is used, and the reporter gene can be expressed under the control of the CD100 promoter.
  • test compound examples include the same compounds as described above.
  • reporter gene the same one as described above is used, and the) 3-galactosidase gene (lacZ) is more preferably used.
  • the expression of the substance encoded by the reporter gene is traced because the reporter gene is under the control of the CD100 promoter.
  • the activity of the CD100 promoter can be detected.
  • a tissue that expresses CD100 originally should I3_galactosidase is expressed instead of 100. Therefore, for example, by staining with a reagent that serves as a substrate for 3-galactosidase, such as 5-promo 4-cyclo-3-3-indolyl_] 3-galactopyranoside (X-gal), it is easy to perform staining. Thus, the expression state of CD100 in an animal body can be observed.
  • a reagent that serves as a substrate for 3-galactosidase such as 5-promo 4-cyclo-3-3-indolyl_] 3-galactopyranoside (X-gal)
  • a CD100-deficient mouse or a tissue section thereof is fixed with Daltar aldehyde or the like, washed with Dulbecco's phosphate buffered saline (PBS), and then X- After reacting with the staining solution containing gal at room temperature or around 7 ° C for about 30 minutes to 1 hour, the ⁇ -galactosidase reaction was stopped by washing the tissue specimen with ImM.EDTAZPBS solution. Observe the color.
  • mRNA encoding 1 ac Z may be detected according to a conventional method.
  • non-human animals deficient in CD100 gene expression are extremely useful in screening for compounds or salts thereof that promote or inhibit CD100 promoter activity, and that are caused by CD100 deficiency. It can greatly contribute to investigating the causes of various diseases or developing preventive and therapeutic drugs.
  • the compound or a salt thereof obtained by using the above-mentioned screening method is a compound selected from the above-mentioned test compounds and is a compound that promotes or inhibits CD100 promoter activity.
  • CD100 promoter activity can promote the expression of CD100 and enhance the function of CD100.
  • infections or diseases caused by virus cold syndrome, influenza, AIDS, etc.
  • compounds or salts thereof that inhibit CD100 promoter activity can inhibit the expression of CD100 and inhibit the function of CD100, for example, resulting from abnormal or excessive antibody production.
  • Diseases eg, atopic Asthma, allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiskott—A 1 drich syndrome, thymic hypoplasia, Hodkin disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes mellitus, systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, B asedow disease, pernicious anemia, Ad dison disease, male infertility, multiple sclerosis, Good pasture syndrome, pemphigus, pemph
  • CD100 transgenic animals having DNA incorporating the exogenous CD100 gene or its mutant gene
  • CD100 transgenic animals include unfertilized eggs, fertilized eggs, spermatozoa and their progenitor cells For germ cells, etc., preferably at the early stage of embryogenesis in non-human animal development (more preferably at the stage of monocytic or fertilized egg cells and generally before the 8-cell stage), calcium phosphate It can be produced by transferring the target CD100 gene by the pulse method, lipofection method, agglutination method, microinjection method, particle gun method, DEAE-dextran method, or the like.
  • the exogenous CD100 gene of interest can be transferred to somatic cells, organs of living organisms, tissue cells, and the like by the CD100 gene transfer method, and can be used for cell culture, tissue culture, and the like.
  • the CD100 gene-transferred animal can also be produced by fusing these cells with the above-mentioned germ cells by a cell fusion method known per se.
  • An exogenous CD100 gene is a CD100 gene found in the body of a non-human animal. Instead of using genes, CD100 genes once isolated and extracted from animals, or CD100 cDNA cloned using genetic engineering techniques are used.
  • mutant CD100 gene a gene in which a mutation (for example, mutation) has occurred in the base sequence of the original CD100 gene, specifically, The CD100 gene in which additions, deletions, substitutions with other bases and the like have occurred is used, and also includes an abnormal gene of the CD100 gene (hereinafter, abbreviated as abnormal CD100 gene).
  • the abnormal CD100 gene means a CD100 gene that expresses abnormal CD100.
  • a CD100 gene that expresses CD100 that suppresses normal CD100 function and the like are used.
  • the exogenous CD100 gene may be derived from an animal of the same or different species as the animal of interest.
  • Any DNA incorporating the exogenous CD100 gene or its mutant gene may be used as long as it contains the exogenous CD100 gene or its mutant gene.
  • the CD100 gene in transferring the CD100 gene to a target animal, it is generally advantageous to use the CD100 gene as a DNA construct linked downstream of a promoter capable of expressing in animal cells.
  • a DNA construct eg, a vector, etc. linked to the human CD100 gene is microinjected into a fertilized egg of a target animal, such as a mouse fertilized egg, by microinjecting the CD100. It is possible to create a CD100 transgenic animal that highly expresses the gene.
  • CD100 expression vectors include plasmids derived from E. coli, plasmids derived from Bacillus subtilis, plasmids derived from yeast, bacteriophages such as Retroviruses such as Ronny leukemia virus, animal viruses such as vaccinia virus or baculovirus are used. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast are preferably used.
  • promoters derived from viruses include promoters derived from viruses (eg, Simian virus, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus, poliovirus, etc.).
  • viruses eg, Simian virus, cytomegalovirus, Moroni leukemia virus, JC virus, breast cancer virus, poliovirus, etc.
  • Various animals humans, egrets, dogs, cats, guinea pigs, hamsters, rats, mice, etc.
  • birds chicken, etc.
  • Endothelin Endothelin
  • muscle creatine kinase glial fibrillary acidic protein
  • daltathione S-transferase platelet-derived growth factor 3
  • keratin Kl, K10 and K14 collagen type I and type II
  • collagen type I and type II cyclic AMP-dependent protein
  • Cukkinaze i3 I subunit Dystrophin Tartrate-Resistant
  • the vector preferably has a sequence that terminates the transcription of the messenger RNA of interest in a CD100 transgenic animal (generally referred to as Yuichi Minei Yuichi).
  • the sequences of the respective CD100 genes derived from various mammals and birds can be used, and preferably, the simian virus SV40 / Mine / Yuichi is used.
  • a gene splicing signal a gene enhancer region such as an immunoglobulin gene, a part of an intron of a eukaryotic cell gene, etc., 5 ′ upstream of the promoter region, for the purpose of further expressing the target CD100 gene, It is also possible to link between the promoter region and the translation region or 3 ′ downstream of the translation region depending on the purpose.
  • the normal CD100 translation region includes DNAs derived from liver, kidney, thyroid cells, fibroblasts, and the like from various animals (eg, egrets, dogs, cats, guinea pigs, hamsters, rats, mice, humans, etc.). All or part of the genomic genes from various commercially available genomic libraries, or the complementary CD100 gene prepared by known methods from liver, kidney, thyroid cells, or fibroblast-derived RNA, as a raw material Can be obtained.
  • the exogenous abnormal CD100 gene can be prepared by mutating the translation region of normal CD100 obtained from the above cells or tissues by point mutagenesis.
  • the translation region can be prepared as a DNA construct that can be expressed in a transgenic animal by a conventional genetic engineering technique in which it is ligated downstream of the above promoter and, if desired, upstream of the transcription termination site.
  • CD100 gene at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the subject animal.
  • Production after CD100 gene transfer The presence of the CD100 gene in the germ cells of the animal means that all progeny of the produced animal retain the CD100 gene in all of its germ cells and somatic cells Means this. Progeny of this type of animal that has inherited the CD100 gene have the CD100 gene in all of its germ cells and somatic cells.
  • the non-human animal to which the exogenous normal CD 100 gene was transferred was confirmed to stably maintain the CD 100 gene by mating, and as a CD 100 gene-carrying animal, It can be reared in a normal breeding environment. Transfer of the CD100 gene at the fertilized egg cell stage is ensured to be present in excess in all germ and somatic cells of the subject animal. Excess of the CD100 gene in the germ cells of the produced animal after the CD100 gene transfer means that all offspring of the produced animal have an excess of the CD100 gene in all of their germ cells and somatic cells. . The offspring of this type of animal that has inherited the CD100 gene have an excess of the CD100 gene in all of their germ and somatic cells.
  • the transgenic non-human animal having the DNA incorporating the exogenous CD100 gene or its mutant gene obtained in this way has an increased T cell interferon gamma production ability and proliferative property, and has an enhanced T cell reactivity.
  • This is a non-human animal (Example 11 described later).
  • Non-human animals that have the normal CD100 gene have high expression of the normal CD100 gene, and ultimately develop CD100 hyperactivity by promoting the function of the endogenous normal CD100 gene. And can be used as a disease model animal.
  • CD100 hyperactivity and CD100-related diseases such as diseases caused by abnormal or excessive antibody production (eg, atopic asthma, allergic rhinitis, atopy) Dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease, Kimura's disease, high IgE syndrome, Wiskott-Aldrich syndrome, thymic dysplasia, Hodkin's disease, liver cirrhosis, acute hepatitis, chronic joint Rheumatism, inulin-dependent diabetes mellitus, systemic lupus erythematosus, scleroderma, infertility, endometriosis, autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, Based
  • the animal in which the exogenous normal CD100 gene has been transferred has an increased symptom of free CD100, it can be used for a screening test for a therapeutic agent for the above-mentioned CD100-related disease.
  • the above mice are inoculated with a foreign antigen such as dinitrophenylovalbumin, and on the other hand, the test substance is administered as appropriate to determine whether the antibody titer against the foreign antigen decreases, thereby determining the inhibitory activity of the inhibitor. Screening is possible. More specifically, it can also be measured by measuring the amount of blood cytokines such as interferon gamma, which is considered to increase in autoimmune diseases and the like.
  • a non-human animal having an exogenous abnormal CD 100 gene can be subcultured in a normal breeding environment as an animal having the CD 100 gene after confirming that the CD 100 gene is stably maintained by mating.
  • the target CD100 gene can be inserted into the above-mentioned plasmid and used as a source substance.
  • the DNA construct with the promoter can be prepared by a conventional CD100 genetic engineering technique.
  • Transfer of the abnormal CD100 gene at the fertilized egg cell stage is ensured to be present in all germ and somatic cells of the subject animal.
  • the presence of the abnormal CD100 gene in the germ cells of the animal after the CD100 gene transfer means that all offspring of the animal produce the abnormal CD100 gene in all of its germ cells and somatic cells.
  • the offspring of such animals that have inherited the CD100 gene have an abnormal CD100 gene in all of their germ and somatic cells.
  • Non-human animals that have an abnormal CD100 gene have high expression of the abnormal CD100 gene, and may eventually become refractory to CD100 by inhibiting the function of the endogenous normal CD100 gene. Yes, it can be used as a model animal of the disease state. It is possible to elucidate the pathophysiology of dysfunction and to examine treatment methods for this disease.
  • animals with abnormally high CD100 gene expression can inhibit normal CD100 function (dominant negative effect) by abnormal CD100 in CD100 refractory disease.
  • a model to elucidate since the function of normal CD100 is impaired in animals transfected with the foreign CD100 gene, infection or disease caused by virus (cold syndrome, influenza, AIDS, hepatitis, virus, etc.) , Measles, chickenpox, hand-foot-and-mouth disease, shingles, erythema contaminated, rubella, idiopathic rash, virulent conjunctivitis, viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic disease, Marbleda disease, Congo hemorrhage Fever, yellow fever, dengue, rabies, adult T cell leukemia (ATL), rotavirus infection, polio, mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea
  • the screening method using a transgenic non-human animal having a DNA into which the exogenous CD100 gene or its mutant gene has been incorporated according to the present invention provides a compound that alters the binding property between CD100 and CD72 described above.
  • it may be carried out in combination with a method for screening a salt thereof (ligand / receptor atsei system). That is, the present invention is characterized by using a transgenic non-human animal having a DNA into which an exogenous CD100 gene or its mutant gene has been incorporated, wherein the binding between CD100 or a salt thereof and its receptor is performed.
  • a method for screening a compound that alters the sex particularly, a compound that inhibits the binding between CD100 and CD72 or a salt thereof.
  • DNA incorporating the exogenous CD100 gene or its mutant gene was selected.
  • the prophylactic / therapeutic effect of the candidate compound may be tested in a secondary screening system using a transgenic non-human animal having a transgenic non-human animal.
  • the screening system using human animals is used as a primary screen to select candidate compounds, and then subjected to a secondary screening of ligand, receptor, and Yuichi Atsushi system to change the binding between the obtained CD100 and CD72.
  • the compound may be selected as a candidate compound for the prophylactic or therapeutic agent of the present invention.
  • CD100 transgenic animals include, for example,
  • CD 100 gene or RNA in the tissues of CD 100 transgenic animals can be analyzed directly, or by analyzing tissues with high expression of CD 100 gene.
  • Cells of the tissue having the CD100 gene are cultured by standard tissue culture techniques, and these are used to study the function of cells from tissues that are generally difficult to culture.
  • CD100 transgenic animals can be used to examine the clinical symptoms of CD100-related diseases, including CD100 dysfunction, and to provide more detailed pathological findings in each organ of the CD100-related disease model. Thus, it can contribute to the development of new treatment methods and the research and treatment of secondary diseases caused by the diseases.
  • each organ is removed from the CD100 transgenic animal, cut into small pieces, and CD100 transgenic cells are obtained using a proteolytic enzyme such as tribcine, and cultured.
  • a proteolytic enzyme such as tribcine
  • a virus vector such as a retrovirus vector, an adenovirus vector, an AAV vector, a herpes virus vector, or a membrane fusion ribosome method is used.
  • DNA Deoxyribonucleic acid
  • Y thymine or cytosine
  • N Thymine, cytosine, adenine or guanine
  • R adenine or guanine
  • H is or H histidine
  • Trt Trityl
  • BSA Serum albumin
  • CHAPS 3 — [(3-colamidopropyl) dimethylammonio] 1-1—propanesulfonate
  • DNP-OVA dinitrophenylovalbumin
  • DNP-BSA Dinitrophenyl serum albumin
  • PBS phosphate buffered salen
  • LPS Lipopolysaccharide
  • SEQ ID Nos in the present specification indicate the following sequences.
  • Reference Example 1 Isolation of CD100 whose expression is enhanced by CD40 stimulation
  • MCD100-Fc described in Examples 1 and 3 below is a protein obtained by fusing a soluble human IgGI Fc portion to mouse CD100.
  • a primer gctgtcgactgtgtgcccgttgctgaaggcct
  • S a1 I site 3 ⁇ 4r in the sense direction [SEQ ID NO: 9]
  • a primer containing a BamHI site in the antisense direction gacggatcctacttactttgctt tgcttgct tgagatacaccgtcttctctga
  • Secretory mouse CD100 cDNA was prepared from mouse CD100 cDNA extracted from WE HI 231 cells stimulated with the same method.
  • the resulting Sa1I-BamHI fragment was inserted into the SaII-BamHI fragment DNA fragment of the pEFBos human IgGlFc cassette, and the gene that expresses the mCD100-Fc protein was inserted.
  • Produced The gene was introduced into P3U1 plasmacytoma by electroporation (using a Bio-Rad Gene Pulser at 0.25 kV and 960 micro FD) to produce transformed cells.
  • the 50 g pEFBo s one mCD 1 00- F c plasmid DNA and pMC 1 neo vector cleaved with B amH I 10 7 cells which were digested with H i ndlll of transformed. After culturing for 10 days in RPMI medium containing 10% fetal calf serum and 0.3 mg / ml G418, colonies resistant to G418 were isolated and cloned.
  • the mCD100-Fc protein was purified from the culture broth by Protein A Sepharose (Amersham Sharmpharmacia).
  • the biotinylated mCDIOO-Fc described in Example 1 described below is obtained by binding biotin to mCD100-Fc using a biotinylated kit (Boehringer Mannheim).
  • the CHO cell expressing CD100 described in Example 2 is a transformed cell in which the CD100 gene has been introduced into the CHO cell, and expresses the CD100 protein.
  • the full-length CD100 cDNA was incorporated into pEFBOS Vector, and introduced into CHO cells together with the pMC1neo vector using ribofectamine minplus (Life Technology). After 10 days in the presence of 0.3 mg / m 1 of G418, cells resistant to G418 were selected.
  • Reference Example 2 Isolation of CD72, a molecule that binds to CD100
  • mice 2 B 4 cells were cultured with RPM I 16 40 culture medium containing 10% fetal bovine serum, 1 X 10 6 eel 1 s Zm 1 of 2 B 4 cells 2 ng / / 1111 (: 0) Stimulation for 18 hours at 8.
  • Total RNA was isolated from the cells by guanidine isothionate density gradient centrifugation, and mRNA was analyzed from the total RNA using o1igo (dT) -bound magnetic beads (Promega).
  • O Double-stranded cDNA containing 1 igo (d T) was synthesized using Superscript II cDNA synthesis kit (Life Technology) and Bst XI adapter was added to the cDNA.
  • the DNA was fractionated by 1% agarose gel electrophoresis, and the cDNA of 1.0 kb or more was recovered and inserted into pME18S vector cut with BstXI.
  • E. DH 10B cells using Bio-Rad Gene Pulser at 2.5 kV, 25 FD) by electroporation (A) Lee off Technology -..) was transformed with 2 X 10 7 independent by using the plasmid obtained from E.
  • Extrachromosomal plasmid DNA was extracted using Hir (Proceeding of National Academy of Sciences of USA 84, 3365-3369 (1987)).
  • the plasmid DNA was inserted into Escherichia coli DH10 B cells by electroporation (performed at 2.5 kV, 25 FD using a Bio-Rad Gene Pulser), and the second, third, and fourth transformations were performed by protoplast fusion. Was done.
  • the above magnetic extraction was repeated four times. As a result, a clear band of 1.4 kb was observed.
  • As a result of analyzing the nucleotide sequence of this 1.4 kb cDNA clone it was found to be the full-length mouse CD72 cDNA [SEQ ID NO: 6].
  • the CD72 gene is a transformed cell introduced into the CHO cell, and expresses the CD72 protein.
  • the pME18S vector incorporating CD72 was introduced into CHO cells together with pMC1neo vector using Ribofectmin Plus (Life Technology 1). After 10 days in the presence of 0.38 mg / m 1 of G418, G418-resistant cells were selected.
  • mCD100-Fc was biotinylated using a biotinylation kit.
  • staining buffer 2% bovine containing 10 6 control CHO cells and CD 72 CHO transformed cells originating current to the 5 gZm 1 F c block (Pharmingen)
  • the cells were reacted with biotinylated mCD100_Fc (40 ⁇ gZml) in ice for 1 hour in fetal serum, PBS containing 0.02% sodium azide, 2 mM calcium chloride, and ImM magnesium chloride.
  • cells were stained with FITC-labeled streptavidin (Becton Dickinson) for 20 minutes. After washing the cells with the staining buffer, the cells to which FITC-labeled streptavidin was bound were analyzed using a flow cytometer.
  • Figure 1 shows the results.
  • the diagram on the left shows the results for control CHO cells, and the diagram on the right shows the results for CHO cells expressing CD72.
  • the dotted line shows the result when mCD100-Fc was not added, and the solid line shows the result when mCD100-Fc was added.
  • the horizontal axis shows the fluorescence intensity per cell, and the vertical axis shows the cell number relatively.
  • the fluorescence intensity did not change even when the biotinylated mCD100-Fc was added. This indicates that the CHO cells do not bind to the biotinylated mCD100-Fc.
  • the culture solution or control IgM or IgG was diluted with 0.1 M carbonate buffer (pH 9.6), and added to each well of an EIA 96-well immunoplate (Maxisorp: Nunc). The mixture was injected one at a time, and the mixture was allowed to stand for about 4: 4. After washing each well with buffer A (0.02 M phosphate buffer at pH 7.0 containing 0.15 M NaC1, buffer B (0.1% BSA, 0.15 M NaC1) The solution was added with an enzyme-labeled anti-IgM / IgG1 antibody solution (100 ⁇ 1) diluted with 0.02M phosphate buffer (pH 7.0) containing l and reacted at 25 for about 2 hours.
  • buffer A 0.02 M phosphate buffer at pH 7.0 containing 0.15 M NaC1
  • buffer B (0.1% BSA, 0.15 M NaC1
  • the solution was added with an enzyme-labeled anti-IgM / IgG1 antibody solution (100 ⁇ 1) diluted with 0.02M
  • the experiments were performed under the following conditions: (1) When only culture medium (Medium) was added in the absence of CHO cells expressing no CD100, (2) When only culture medium (Medium) was added in the presence of CHO cells expressing CD100 (3) Anti-CD40 in the absence of CD100-expressing CHO cells (A CD40), when IL-14 was added, and (4) IgM amount when the anti-CD40 antibody (a CD40) and IL-4 were added in the presence of CD100-expressing CHO cells. The amount of IgG1 was compared.
  • Figure 2 shows the results. The horizontal axis shows the results of (1), (2), (3), and (4), respectively, from the left, and the vertical axis shows the antibody amount (unit: ng / ml) quantified from the absorbance.
  • both IgM and IgG1 do not affect antibody production as compared to the control group without additives (1).
  • both IgM and IgG1 induce antibody production compared to the control group without additives (1).
  • IgM production was slightly reduced compared to when stimulated with anti-CD40 antibody and IL-14.
  • IgGl production increased more strongly than in (3). This indicates that the phenomenon in which the class of antibodies produced and secreted from B cells is switched from IgG to IgG1 is called a class switch.
  • Example 3 CD100 enhances in vivo antibody production
  • DNP-OVA Dnitronitrophenol
  • human IgGl myeloma protein or mCD100-Fc was administered at 200 g / day for 10 days.
  • Serum was collected 6 days and 10 days after DNP-OVA administration.
  • the antibody titer of the antibody specific to DNP was measured by ELISA using DNP-BSA.
  • the serum of the mouse after immunization was diluted with 0.1 M carbonate buffer (pH 9.6) and coated with a DNP-BSA-coated 96-well EIA plate for EIA (Maxisorp: Nunc).
  • Figure 3 shows the results.
  • the figure on the left shows the antibody titer to DNP contained in the serum 6 days after administration of DNP-OVA, and the figure on the right shows the antibody titer after 10 days.
  • the abscissa indicates the antibody titer when the human IgG 1 myeloma protein was administered, and ⁇ indicates the antibody titer when mCD100-Fc was administered.
  • the vertical axis Anti-DNP indicates the antibody titer to DNP.
  • One thousandth of the amount of the antibody against DNP contained in the serum of the mice of the control group 12 days after the administration was defined as lunit.
  • CD100 mCD100-Fc
  • the antibody titer on day 6 exceeded the antibody titer on day 6 when the control human IgGl myeloma protein was administered by at least three times.
  • the antibody titer was higher than the antibody titer on day 10 when the control human IgGI myeloma protein was administered. This indicates that CD100 plays an important role in the ability to induce antigen-specific antibody production.
  • a phage clone containing a CD100 genomic DNA fragment of about 12 kb was isolated from a 129ZS vJ mouse liver-derived genomic library (Strategene) using 0 bp).
  • the 1.6 Kb portion including the part of the first exon where the initiation codon is present was replaced with a neomycin resistance gene (distributed from the Maternal and Child Health Center) (Cell (Cel 1), 51 (1987) Year) 503-512).
  • a thymidine kinase gene (HSV-TK) derived from the herpes simplex virus was inserted downstream of the CD100 genomic gene for negative selection (Neichia-(Nature) 336 (1988) 348-352). Evening A plasmid DNA was constructed. 50 g of this evening gettering plasmid DNA was transduced into 1 ⁇ 10 6 E14-1 embryonic stem cells by electroporation. Embryonic stem cells into which the gene was introduced were double-selected with G418 (0.4 mg / m 1; Life Technology) and ganciclovir (2 M; Syntex). The homologous recombination on the CD100 gene was selected from the 1000 resistant colonies by Southern blotting. Two clones of embryonic stem cells were identified.
  • Embryonic stem cells derived from CD100 mutant clones were inoculated into blastocysts of C57BLZ6 mice (Shizuoka Experimental Animals Association, 6-8 weeks old), and then ICR foster parents (Shizuoka Experimental Animals Association, 6-8 weeks) Aged).
  • the chimerism of offspring was determined based on the degree of fur coat color, and a knockout mouse was produced in which the male chimera was further bred to C57BLZ6 female mice.
  • the offspring were analyzed by Southern blot to determine whether the CD100 gene had been knocked out. Genomic DNA was isolated from the tail of the mouse, digested with BamHI, and then subjected to agarose gel electrophoresis.
  • the electrophoresed DNA was transferred to a nylon filter (Amersham Pharmacia), and then hybridized with a radiolabeled probe (CD 100 Promoter, 0.2 Kb).
  • the filter was washed for 1 hour with 65 in 0.1 ⁇ SSC, 0.1% SDS, and then subjected to autoradiography.
  • Figure 4 shows the results.
  • A shows a CD100 wild-type gene, a CD100 gene targeting vector gene map, and a CD100 gene map when expected recombination has occurred, respectively, from the top. Exons in the 5 'untranslated region are shown in gray boxes, and exons in the translated region are shown in black boxes.
  • B indicates a position to be cleaved by BamHI restriction enzyme, and E indicates a position to be cleaved by EcoRI restriction enzyme.
  • Neo indicates the neomycin resistance gene
  • HSV-TK indicates the thymidine kinase gene derived from herpes simplex virus
  • the arrow indicates the transcription direction of these genes.
  • Probe indicates the position of the probe used in the Southern blot. When Southern blotting with BamHI digestion is performed, the length of the gene binding to the probe is expected to be 2.6 Kb for the wild-type gene and 1.2 Kb for the recombinant.
  • CD100-positive cells were observed in wild-type mice, whereas no CD100-positive cells were observed in knockout mice. Therefore, it was confirmed that the CD100 molecule was not expressed on the cells in the knockout mouse.
  • Example 5 Analysis of CD5 surface antigen of knockout mouse and wild type mouse lymphocytes
  • Peritoneal cells were collected by washing the peritoneal cavity with a phosphate buffer containing 2% FCS and 10 UZm1 heparin. The results of double staining of a cell suspension prepared from the abdominal cavity or spleen with a FTC-labeled anti-B220 antibody and a phycoerythrin-labeled anti-CD5 antibody (Pharmingen) are shown.
  • B220 is a cell surface marker for mouse B cells.
  • CD5 is known as a marker for autoantibody production (Autoimmunity, 30 (1999) 63-69).
  • Fig. 5 shows the results.
  • ++ indicates a wild type mouse
  • 1/1 indicates a CD100 knockout mouse.
  • the horizontal axis and the vertical axis respectively show the production amounts of B220 and CD5 molecules on the cell surface in logarithmic representation as the fluorescence intensity per cell.
  • the cell fraction positive for both cell markers is shown in the frame in the figure.
  • the ratio of both B220 and CD5 positive cells was 14.6% in wild-type mice, but decreased to 7.49% in knockout mice.
  • spleen cells the ratio of both B220 and CD5 positive cells was 1.5% in wild-type mice and 0.93% in knockout mice, which also decreased.
  • CD5 which is considered to be upregulated in autoimmune diseases. It is presumed that it may be useful for treating autoimmune diseases.
  • Example 6 Antibody production against TD (T cell-dependent) antigen
  • Fig. 6 shows the results.
  • A represents a time course of NP 12 labeled ⁇ shea serum albumin binding of I gG amount.
  • B shows the time course of NP 2 labeled ⁇ shea serum albumin binding of I gG amount.
  • C over time shows the ratio of NP 2 labeled ⁇ shea serum albumin binding of I gG amount and NP 12 labeled ⁇ shea serum albumin binding of I gG amount.
  • the vertical axis indicates the amount of antibody in A and B. In C, the ratio is shown.
  • the horizontal axis shows the number of days elapsed after immunization with the first immunization day as 0 day.
  • ⁇ shows the results when CD100 knockout mice were used, and ⁇ shows the results when wild-type mice were used.
  • NP 2 / NP j 2 ratio is increased in wild-type mice as shown in Figure 6 C. It shows a process that mature B cell populations that produce higher affinity antibodies over time, the increase in NP 2 ZNP 12 ratio was Roh Kkuautomausu is moderate as compared to wild type mice, high The mechanism of maturation to affinity antibody production was shown to be impaired.
  • KLH keyhole limpet hemocyanin
  • CD4-positive T cells were prepared from spleen or regional lymph nodes using CD4-labeled magnetic beads (Magnetic Cell Sorting, Milteny Biotech).
  • the 1 X 10 5 cells, radiation treatment (3 000 rad) and wildtype mouse spleen cells (5 x 10 5) presence were stimulated 3 days with various concentrations of KLH.
  • 2Ci of tritiated thymidine was added for 12 hours, and intracellular radioactivity was measured.
  • the amounts of IL-4 (interleukin 4) and IFN- ⁇ (interferon gamma) in the cell culture supernatant for 3 days were measured using an ELISA kit (R & D system).
  • Fig. 7 shows the results.
  • A shows the comparison between CD4 positive T cells derived from spleen and KLH-stimulated proliferating wild type mice and CD100 knockout mice.
  • B shows a comparison of proliferating wild-type mice and CD100 knockout mice proliferating by KLH stimulation of CD4 positive T cells derived from the associated lymph node.
  • ⁇ indicates the results of wild-type mice, and ⁇ indicates the results of CD100 knockout mice.
  • the vertical axis represents intracellular radioactivity as an index of proliferation.
  • the horizontal axis shows the amount of KLH added.
  • C Proliferation of CD4-positive T cells derived from regional lymph nodes by KLH stimulation, IL-4 and IFN-producing wild type mice and CD1
  • the following shows a comparison between 00 knockout mice and the effect of adding CD100.
  • mCD100-Fc was administered intravenously at 50 us / mouse for 6 consecutive days from the day after immunization. The result when 4 gZm1 of KLH is used is shown.
  • the horizontal axis + _ / +, -Z- indicates wild type mice and knockout mice.
  • CD 100—Fc indicates the case where 10 was added, and the case where — was not added.
  • the vertical axis is proliferative from the left, IL-14 amount,
  • FIG. 7A the reactivity of spleen-derived T cells to KLH was reduced in knockout mice compared to wild type mice.
  • FIG. 7B further reduction in reactivity was observed in lymph node-derived T cells in knockout mice, and no reactivity was observed even when the amount of KLH was increased.
  • FIG. 7C in the knockout mice, the production ability of IL-4 and INF- ⁇ of the 04-positive cells was significantly reduced as compared with the wild-type mice, and it was confirmed that both factors were hardly produced. Was called. Furthermore, the addition of soluble CD100 restored the decrease in reactivity, confirming that these abnormalities in knockout mice were mediated by CD100.
  • C57BL-6, Ba1 / c, MRLZn, MRLZ1pr mice were purchased from SLC (Shizuoka Experimental Animal Cooperative). Blood was collected from the fundus of 16-week-old mice.
  • a mouse fusion protein of soluble CD100 and F1ag was prepared by PCR from CD100 cDNA prepared from WEH1-231 cells stimulated with anti-CD40 antibody.
  • the primer 1 contains the S a 1 I site as the 5′-end sequence.
  • ttgctt tgct tgct tgagatacac cgtctctctga [SEQ ID NO: 10] was used.
  • the Sa1I-BamHI fragment generated by PCR was incorporated into the SalI—BamHI portion of the pEFBos human IgG1Fc cassette.
  • the transfected cells were selected in RPMI 1640 medium containing 10% fetal calf serum and 0.3 mg / ml G418.
  • the CD100-F1ag protein was purified using anti-F1ag antibody-labeled agarose (Sigma).
  • the sandwich ELISA method for detecting soluble CD100 was performed as follows.
  • a 96-well microplate (Nunc) was coated with rat anti-mouse CD100 antibody (Clone BMA-12, 5 g / m 1) with ⁇ -4.
  • 200 1 hole in blocking solution (5 OmM T ris- HC 1 ( pH8. 1), lm M MgC l 2, 0. 15M NaC l, 1% BSA, 0. 05% Twe en 20) was added, It was left at room temperature for 1 hour.
  • a 100-well sample and standard sample (mouse fusion protein of soluble CD100 and F1ag) diluted with a blocking solution were allowed to stand at room temperature for 1.5 hours.
  • the double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain single-stranded DNA.
  • 5 g / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse IgG antibody (Southern Biotechnology) was added.
  • the monoclonal antibodies BMA-8 and BMA-12 were prepared as follows. 100 g of CD100-Fc was subcutaneously administered once a week for a total of four times and immunized.
  • the adjuvant used for immunization was Freund's complete adjuvant for the first time, and Freund's incomplete adjuvant for the second and subsequent times.
  • B cells were prepared from rat spleen and fused with myeloma cells. Clones BMA-8 and BMA-12 producing antibodies to CD100 were selected from the fused cells. The clone was transplanted into a rat intraperitoneal cavity, and the antibody was purified from ascites.
  • the RL / 1pr mouse is an autoimmune disease model mouse selected from MRL / n mice.
  • Serum soluble CD100 in serum was C57BLZ6, Ba1b / c, MR.LZn normal mice were below the detection limit (12 ngZml), but MR showing autoimmune disease-like symptoms. It was extremely elevated in mice with LZ 1 pr autoimmune disease (166 ng / m 1).
  • the amount of anti-single-chain DNA antibody which is an indicator of the amount of autoantibodies associated with autoimmune diseases, is much higher in MRLZ1r mice than in MRL / n mice, and MRLZ1pr mice It was also evident from the amount of anti-single-chain DNA antibody.
  • the amount of soluble CD100 (A) and the amount of anti-single-chain DNA antibody (B) were measured using 8-20 week old mice. Blood was collected from the fundus. A sandwich ELISA for detecting soluble CD100 was performed as follows. A 96-well microplate (nucleated) was coated with rat anti-mouse CD100 antibody (BMA-12, 5 ⁇ g / m1) with- ⁇ 4. After washing, 200 1 Z well blocking solution (5 OmM Tris—HC1 (pH 8.1), 1 mM MgCl 2 , 0.15 M NaCl, l% BSA, 0.05% Tween 20) was added and left at room temperature for 1 hour.
  • a sandwich ELISA for detecting soluble CD100 was performed as follows. A 96-well microplate (nucleated) was coated with rat anti-mouse CD100 antibody (BMA-12, 5 ⁇ g / m1) with- ⁇ 4. After washing, 200 1 Z well blocking solution (5 OmM Tris—HC1 (pH
  • the specimen and standard sample (mouse fusion protein of soluble CD100 and FLAG sequence) in the 1001 Z well diluted with the blocking solution were allowed to stand at room temperature for 1.5 hours. After washing three times with PBS containing 0.05% Tween 20, 2 g Zm1 of a biotinylated rat anti-mouse CD100 antibody (BMA-8) was added. One hour later, alkaline phosphatase-labeled streptavidin (Sigma) was added. After washing, a phosphatase substrate (Sigma) was added, and soluble CD100 molecules were detected at an absorbance of 405 nm.
  • BMA-8 biotinylated rat anti-mouse CD100 antibody
  • Anti-single-stranded DNA was prepared as follows. ⁇ The thymus DNA (Sigma) was treated with S1 nuclease (Sigma) to obtain double-stranded DNA. The double-stranded DNA was boiled for 15 minutes and then cooled on ice to obtain a single-stranded DNA. 5 g / ml single-stranded DNA was attached to a 96-well microplate, mouse serum was added, and alkaline phosphatase-labeled anti-mouse IgG antibody (Southern Biotechnology) was added.
  • Fig. 8 shows the results.
  • A shows the amount of soluble CD100 in serum
  • B shows the amount of anti-single-chain DNA antibody in serum.
  • the horizontal axis represents the age of mice.
  • the vertical axis of B represents the amount of the antibody. 22
  • the numerical value obtained from the serum of the 2-week-old mouse was set to 1, and the numerical value of each sample was indicated by the magnification.
  • the amount of soluble CD100 in the serum was below the detection sensitivity in 8-week-old MRL / 1pr mice, but increased with the age of the week and reached 116 ⁇ 89 ngZm1 at the age of 16 weeks. Similarly, it is an indicator of the progression of an autoimmune disease
  • the amount of anti-single-chain DNA antibody also increased with age.
  • Fig. 9 shows the results.
  • the results for wild-type mice are shown in white, and the results for knockout trout are shown as hatched lines.
  • the vertical axis represents IL-12.
  • dendritic cells derived from wild-type mice were stimulated with an anti-CD40 antibody or LPS, the production of IL-112 increased and the dendritic cells were activated.
  • dendritic cells derived from knockout mice were used, the production of IL-112 decreased, and the activation of dendritic cells was impaired. It has been reported that the release of IL-12, which activates antigen-presenting cells, induces the activation of antitumor T cells and produces antitumor immunity (Nature, 393: (19) 1998) 413-414).
  • Example 11 1 Hyperactivity of T cells in CD100 transgenic mice
  • An integrated construct was created.
  • Transgenic mice were prepared by introducing this gene fragment into fertilized eggs of C57BLZ6 mice.
  • CD4-positive T cells were prepared from the regional lymph nodes using CD4-labeled magnetic beads (Magnetic Cell Sorting, Milten Biotech). 1 ⁇ 10 5 cells were stimulated with various concentrations of KLH for 3 days in the presence of irradiated (3000 rad) wild-type mouse spleen cells (5 ⁇ 10 5 ). When examining cell proliferation, 2 Ci of thymidine thymidine was added for 12 hours, and intracellular radioactivity was measured. The amount of IFN-r (interferon gamma) in the cell culture supernatant for 3 days was measured using an ELISA kit (R & D system).
  • FIG. 1 The results are shown in FIG.
  • the left figure shows the amount of I NF- ⁇ production, and the right figure shows the proliferation.
  • ⁇ shows the results of wild-type mice
  • Hata shows the results of CD100 transgenic mice.
  • the horizontal axis shows the added KLH amount. Proliferation is represented by intracellular radioactivity as an index.
  • transgenic mice As shown in FIG. 10, in transgenic mice, the amount of I NF- ⁇ production and proliferation of CD4-positive T cells increased as compared to wild-type mice. This indicates that T cells specific for KLH were activated. It has been reported that the activation of antigen-presenting cells induces the activation of antitumor T cells, thereby generating antitumor immunity (Nachiya, 393: (1998) pp. 413-414). . At that time, an increase in proliferation and an increase in the ability to produce INF-a are observed in the antitumor T cells. From the results of this example, transgenic mice also showed an increase in INF- ⁇ production and an index of proliferative activity for antigen-specific T cell activation.
  • CD100 is deeply involved in the activation of antitumor T cells.
  • CD72 a receptor for CD100, is expressed on antigen presenting cells or activated T cells (Anyual Solar Surgery, Vol. 61: (199 6 years) 25 2—2 58 pages). Therefore, it is presumed that CD100 acts directly on these cells to activate T cells and exert antitumor activity.
  • this transgenic model mouse is considered to be in an immune reaction hypersensitivity state due to enhanced CD100 production. Therefore, it is considered to be a model for diseases such as putative immunodeficiency caused by enhanced CD100.
  • Screening methods include viral infections or diseases (cold syndrome, influenza, AIDS, hepatitis, herpes, measles, varicella, hand-foot-and-mouth disease, shingles, erythema flu, rubella, sudden rash, viral conjunctivitis , Viral meningitis, viral pneumonia, viral encephalitis, Lassa fever, Ebola hemorrhagic fever, Mar Burda disease, Congo hemorrhagic fever, yellow fever, dengue fever, rabies, adult T cell leukemia (ATL), rotavirus infection, polio , Mumps, etc., bacterial or fungal infections or diseases (bacterial food poisoning, bacterial diarrhea, tuberculosis, leprosy, dysentery, typhoid fever
  • atopic asthma, allergic rhinitis, atopic dermatitis, allergic bronchitis, pulmonary aspergillosis, parasitic disease Kimura's disease, high IgE syndrome, Wisk ott-A 1 drich syndrome, thymic dysplasia, Hodkin's disease, cirrhosis, acute hepatitis, rheumatoid arthritis, insulin-dependent diabetes mellitus, systemic lupus tomatoes, scleroderma, infertility, endometriosis, Autoimmune thyroid disease myasthenia gravis, Hashimoto's disease, Basedow's disease, pernicious anemia, Addison's disease, male infertility, multiple sclerosis Syndrome, Good pasture syndrome, pemphigus, pemphigoid, myasthenia gravis, lens ophthalmitis, sympathetic ophthalmitis, autoimmune hemolytic anemia, idi

Abstract

Cette invention concerne un procédé de criblage d'un composé ou de son sel, capable de modifier l'avidité de CD100 ou de son sel, caractérisé en ce qu'il fait intervenir le CD100 ou son sel, ou bien le CD72 ou son sel. Ce procédé est utile pour le criblage d'un agoniste de CD72 qui convient bien pour le traitement préventif et curatif notamment des infections et maladies virales, des infections et maladies bactériennes ou fongiques, du cancer, etc. ou un antagoniste de CD72 qui convient bien pour le traitement préventif ou curatif notamment de pathologies dues à une production d'anticorps anormale ou excessive et analogues.
PCT/JP2000/003558 1999-06-03 2000-06-01 Procede de criblage avec cd100 WO2000075655A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU49526/00A AU4952600A (en) 1999-06-03 2000-06-01 Screening method with the use of cd100

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP11/157111 1999-06-03
JP15711199 1999-06-03

Publications (1)

Publication Number Publication Date
WO2000075655A1 true WO2000075655A1 (fr) 2000-12-14

Family

ID=15642478

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/003558 WO2000075655A1 (fr) 1999-06-03 2000-06-01 Procede de criblage avec cd100

Country Status (2)

Country Link
AU (1) AU4952600A (fr)
WO (1) WO2000075655A1 (fr)

Cited By (68)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
WO2011031870A1 (fr) 2009-09-09 2011-03-17 Centrose, Llc Conjugués médicamenteux ciblés à visée extracellulaire
WO2011056983A1 (fr) 2009-11-05 2011-05-12 Genentech, Inc. Conjugués d'anticorps modifiés par cystéine, radiomarqués par le zirconium
WO2011130598A1 (fr) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazépines et conjugués de celles-ci
WO2011156328A1 (fr) 2010-06-08 2011-12-15 Genentech, Inc. Anticorps et conjugués modifiés par la cystéine
WO2012074757A1 (fr) 2010-11-17 2012-06-07 Genentech, Inc. Conjugués d'anticorps alaninyl-maytansinol
WO2012155019A1 (fr) 2011-05-12 2012-11-15 Genentech, Inc. Procédé lc-ms/ms de surveillance de réactions multiples pour détecter des anticorps thérapeutiques dans des échantillons animaux à l'aide de peptides de signature d'infrastructure
WO2013130093A1 (fr) 2012-03-02 2013-09-06 Genentech, Inc. Biomarqueurs pour un traitement à base de composés chimiothérapeutiques anti-tubuline
WO2014057074A1 (fr) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014140174A1 (fr) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014140862A2 (fr) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2014159981A2 (fr) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2015023355A1 (fr) 2013-08-12 2015-02-19 Genentech, Inc. Conjugués anticorps-médicament dimérique 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
WO2015095227A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2015095212A1 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés conjugués anticorps-médicament dimérique à base de 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
WO2015095223A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2016040825A1 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Intermédiaires disulfure d'anthracycline, conjugué anticorps-médicaments et procédés
WO2016040856A2 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Anticorps et conjugués modifiés génétiquement avec de la cystéine
WO2016037644A1 (fr) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazépines et leurs conjugués
WO2016090050A1 (fr) 2014-12-03 2016-06-09 Genentech, Inc. Composés d'amine quaternaire et conjugués anticorps-médicament de ceux-ci
EP3088004A1 (fr) 2004-09-23 2016-11-02 Genentech, Inc. Anticorps et conjugués modifiés au niveau des cystéines
US9562049B2 (en) 2012-12-21 2017-02-07 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9567340B2 (en) 2012-12-21 2017-02-14 Medimmune Limited Unsymmetrical pyrrolobenzodiazepines-dimers for use in the treatment of proliferative and autoimmune diseases
WO2017059289A1 (fr) 2015-10-02 2017-04-06 Genentech, Inc. Conjugués anticorps-médicaments de pyrrolobenzodiazépine et méthodes d'utilisation
WO2017064675A1 (fr) 2015-10-16 2017-04-20 Genentech, Inc. Conjugués médicamenteux à pont disulfure encombré
WO2017068511A1 (fr) 2015-10-20 2017-04-27 Genentech, Inc. Conjugués calichéamicine-anticorps-médicament et procédés d'utilisation
WO2017165734A1 (fr) 2016-03-25 2017-09-28 Genentech, Inc. Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
EP3235820A1 (fr) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazépines et conjugués à base de disulfure d'anticorps associés
WO2017201449A1 (fr) 2016-05-20 2017-11-23 Genentech, Inc. Conjugués anticorps-protac et procédés d'utilisation
WO2017205741A1 (fr) 2016-05-27 2017-11-30 Genentech, Inc. Procédé bioanalytique pour la caractérisation de conjugués anticorps-médicament spécifiques d'un site
WO2017214024A1 (fr) 2016-06-06 2017-12-14 Genentech, Inc. Médicaments conjugués d'anticorps silvestrol et procédés d'utilisation
WO2018031662A1 (fr) 2016-08-11 2018-02-15 Genentech, Inc. Promédicaments de pyrrolobenzodiazépine et conjugués d'anticorps de ceux-ci
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2018065501A1 (fr) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Procédés de préparation de conjugués anticorps-médicament
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2019060398A1 (fr) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. Analogues de thailanstatine
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
WO2020049286A1 (fr) 2018-09-03 2020-03-12 Femtogenix Limited Amides polycycliques servant d'agents cytotoxiques
WO2020086858A1 (fr) 2018-10-24 2020-04-30 Genentech, Inc. Inducteurs chimiques conjugués de dégradation et méthodes d'utilisation
WO2020123275A1 (fr) 2018-12-10 2020-06-18 Genentech, Inc. Peptides de photoréticulation pour conjugaison spécifique de site à des protéines contenant fc
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2020157491A1 (fr) 2019-01-29 2020-08-06 Femtogenix Limited Agents cytotoxiques de réticulation g-a
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2022023735A1 (fr) 2020-07-28 2022-02-03 Femtogenix Limited Agents cytotoxiques
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
KATHARYN T. HALL ET AL.: "Human CD100 a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation", PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11780 - 11785, XP002932673 *
WILLIAM H. ROBINSON ET AL.: "Extensive polymorphism in the extra cellular domain of the mouse B cell differentiation antigen Lyb-2 CD72", THE JOURNAL OF IMMUNOLOGY, vol. 149, no. 3, 1992, pages 880 - 886, XP002932674 *

Cited By (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3434275A1 (fr) 2003-11-06 2019-01-30 Seattle Genetics, Inc. Méthode de dépistage de cellules cancéreuses basé sur l'utilisation de conjugués d'auristatin avec anticorps
EP2260858A2 (fr) 2003-11-06 2010-12-15 Seattle Genetics, Inc. Composés de monométhylvaline capable de conjugaison aux lignads.
EP2486933A1 (fr) 2003-11-06 2012-08-15 Seattle Genetics, Inc. Composés de monométhylvaline conjugués avec des anticorps
EP2489364A1 (fr) 2003-11-06 2012-08-22 Seattle Genetics, Inc. Composés de monométhylvaline conjuguös avec des anticorps
EP3858387A1 (fr) 2003-11-06 2021-08-04 Seagen Inc. Composés de monométhylvaline capables de conjugaison aux ligands
EP3120861A1 (fr) 2003-11-06 2017-01-25 Seattle Genetics, Inc. Composés intermédiaires pour la préparation de conjugués d'auristatin avec des éléments de liaison
EP2478912A1 (fr) 2003-11-06 2012-07-25 Seattle Genetics, Inc. Conjugués d'auristatin avec des anticorps dirigés contre le HER2 ou le CD22 et leur usage thérapeutique
EP2286844A2 (fr) 2004-06-01 2011-02-23 Genentech, Inc. Conjugués anticorps-médicament et procédés
EP3088004A1 (fr) 2004-09-23 2016-11-02 Genentech, Inc. Anticorps et conjugués modifiés au niveau des cystéines
WO2011031870A1 (fr) 2009-09-09 2011-03-17 Centrose, Llc Conjugués médicamenteux ciblés à visée extracellulaire
WO2011056983A1 (fr) 2009-11-05 2011-05-12 Genentech, Inc. Conjugués d'anticorps modifiés par cystéine, radiomarqués par le zirconium
WO2011130598A1 (fr) 2010-04-15 2011-10-20 Spirogen Limited Pyrrolobenzodiazépines et conjugués de celles-ci
WO2011156328A1 (fr) 2010-06-08 2011-12-15 Genentech, Inc. Anticorps et conjugués modifiés par la cystéine
WO2012074757A1 (fr) 2010-11-17 2012-06-07 Genentech, Inc. Conjugués d'anticorps alaninyl-maytansinol
WO2012155019A1 (fr) 2011-05-12 2012-11-15 Genentech, Inc. Procédé lc-ms/ms de surveillance de réactions multiples pour détecter des anticorps thérapeutiques dans des échantillons animaux à l'aide de peptides de signature d'infrastructure
US11135303B2 (en) 2011-10-14 2021-10-05 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2013130093A1 (fr) 2012-03-02 2013-09-06 Genentech, Inc. Biomarqueurs pour un traitement à base de composés chimiothérapeutiques anti-tubuline
US11701430B2 (en) 2012-10-12 2023-07-18 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10780181B2 (en) 2012-10-12 2020-09-22 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11771775B2 (en) 2012-10-12 2023-10-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
EP2839860A1 (fr) 2012-10-12 2015-02-25 Spirogen Sàrl Pyrrolobenzodiazépines et ses conjugués
US11690918B2 (en) 2012-10-12 2023-07-04 Medimmune Limited Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US9931414B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US9931415B2 (en) 2012-10-12 2018-04-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10994023B2 (en) 2012-10-12 2021-05-04 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9919056B2 (en) 2012-10-12 2018-03-20 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
WO2014057074A1 (fr) 2012-10-12 2014-04-17 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
US9889207B2 (en) 2012-10-12 2018-02-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10335497B2 (en) 2012-10-12 2019-07-02 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US10799596B2 (en) 2012-10-12 2020-10-13 Adc Therapeutics S.A. Pyrrolobenzodiazepine-antibody conjugates
US11779650B2 (en) 2012-10-12 2023-10-10 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10751346B2 (en) 2012-10-12 2020-08-25 Medimmune Limited Pyrrolobenzodiazepine—anti-PSMA antibody conjugates
US10736903B2 (en) 2012-10-12 2020-08-11 Medimmune Limited Pyrrolobenzodiazepine-anti-PSMA antibody conjugates
US10722594B2 (en) 2012-10-12 2020-07-28 Adc Therapeutics S.A. Pyrrolobenzodiazepine-anti-CD22 antibody conjugates
US10695433B2 (en) 2012-10-12 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10646584B2 (en) 2012-10-12 2020-05-12 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9567340B2 (en) 2012-12-21 2017-02-14 Medimmune Limited Unsymmetrical pyrrolobenzodiazepines-dimers for use in the treatment of proliferative and autoimmune diseases
US9562049B2 (en) 2012-12-21 2017-02-07 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2014140174A1 (fr) 2013-03-13 2014-09-18 Spirogen Sàrl Pyrrolobenzodiazépines et leurs conjugués
WO2014140862A2 (fr) 2013-03-13 2014-09-18 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2014159981A2 (fr) 2013-03-13 2014-10-02 Spirogen Sarl Pyrrolobenzodiazépines et leurs conjugués
WO2015023355A1 (fr) 2013-08-12 2015-02-19 Genentech, Inc. Conjugués anticorps-médicament dimérique 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
US9956299B2 (en) 2013-10-11 2018-05-01 Medimmune Limited Pyrrolobenzodiazepine—antibody conjugates
US10010624B2 (en) 2013-10-11 2018-07-03 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US10029018B2 (en) 2013-10-11 2018-07-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
US9950078B2 (en) 2013-10-11 2018-04-24 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
WO2015095223A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2015095227A2 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés peptidomimétiques et conjugués anticorps-médicament de ceux-ci
WO2015095212A1 (fr) 2013-12-16 2015-06-25 Genentech, Inc. Composés conjugués anticorps-médicament dimérique à base de 1-(chlorométhyl)-2,3-dihydro-1 h-benzo [e]indole, et méthodes d'utilisation et de traitement
US10188746B2 (en) 2014-09-10 2019-01-29 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016037644A1 (fr) 2014-09-10 2016-03-17 Medimmune Limited Pyrrolobenzodiazépines et leurs conjugués
WO2016040856A2 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Anticorps et conjugués modifiés génétiquement avec de la cystéine
US10420777B2 (en) 2014-09-12 2019-09-24 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof
WO2016040825A1 (fr) 2014-09-12 2016-03-17 Genentech, Inc. Intermédiaires disulfure d'anthracycline, conjugué anticorps-médicaments et procédés
EP3235820A1 (fr) 2014-09-17 2017-10-25 Genentech, Inc. Pyrrolobenzodiazépines et conjugués à base de disulfure d'anticorps associés
US10780096B2 (en) 2014-11-25 2020-09-22 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
WO2016090050A1 (fr) 2014-12-03 2016-06-09 Genentech, Inc. Composés d'amine quaternaire et conjugués anticorps-médicament de ceux-ci
US11059893B2 (en) 2015-04-15 2021-07-13 Bergenbio Asa Humanized anti-AXL antibodies
US11702473B2 (en) 2015-04-15 2023-07-18 Medimmune Limited Site-specific antibody-drug conjugates
WO2017059289A1 (fr) 2015-10-02 2017-04-06 Genentech, Inc. Conjugués anticorps-médicaments de pyrrolobenzodiazépine et méthodes d'utilisation
WO2017064675A1 (fr) 2015-10-16 2017-04-20 Genentech, Inc. Conjugués médicamenteux à pont disulfure encombré
WO2017068511A1 (fr) 2015-10-20 2017-04-27 Genentech, Inc. Conjugués calichéamicine-anticorps-médicament et procédés d'utilisation
US10392393B2 (en) 2016-01-26 2019-08-27 Medimmune Limited Pyrrolobenzodiazepines
US10695439B2 (en) 2016-02-10 2020-06-30 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11517626B2 (en) 2016-02-10 2022-12-06 Medimmune Limited Pyrrolobenzodiazepine antibody conjugates
WO2017165734A1 (fr) 2016-03-25 2017-09-28 Genentech, Inc. Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
EP4273551A2 (fr) 2016-03-25 2023-11-08 F. Hoffmann-La Roche AG Dosage multiplexé pour la quantification d'anticorps totaux et de médicaments conjugués à des anticorps
US10543279B2 (en) 2016-04-29 2020-01-28 Medimmune Limited Pyrrolobenzodiazepine conjugates and their use for the treatment of cancer
WO2017201449A1 (fr) 2016-05-20 2017-11-23 Genentech, Inc. Conjugués anticorps-protac et procédés d'utilisation
WO2017205741A1 (fr) 2016-05-27 2017-11-30 Genentech, Inc. Procédé bioanalytique pour la caractérisation de conjugués anticorps-médicament spécifiques d'un site
WO2017214024A1 (fr) 2016-06-06 2017-12-14 Genentech, Inc. Médicaments conjugués d'anticorps silvestrol et procédés d'utilisation
WO2018031662A1 (fr) 2016-08-11 2018-02-15 Genentech, Inc. Promédicaments de pyrrolobenzodiazépine et conjugués d'anticorps de ceux-ci
WO2018065501A1 (fr) 2016-10-05 2018-04-12 F. Hoffmann-La Roche Ag Procédés de préparation de conjugués anticorps-médicament
US10799595B2 (en) 2016-10-14 2020-10-13 Medimmune Limited Pyrrolobenzodiazepine conjugates
US11813335B2 (en) 2017-02-08 2023-11-14 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11160872B2 (en) 2017-02-08 2021-11-02 Adc Therapeutics Sa Pyrrolobenzodiazepine-antibody conjugates
US11612665B2 (en) 2017-02-08 2023-03-28 Medimmune Limited Pyrrolobenzodiazepine-antibody conjugates
US11370801B2 (en) 2017-04-18 2022-06-28 Medimmune Limited Pyrrolobenzodiazepine conjugates
US10544223B2 (en) 2017-04-20 2020-01-28 Adc Therapeutics Sa Combination therapy with an anti-axl antibody-drug conjugate
US11318211B2 (en) 2017-06-14 2022-05-03 Adc Therapeutics Sa Dosage regimes for the administration of an anti-CD19 ADC
US11938192B2 (en) 2017-06-14 2024-03-26 Medimmune Limited Dosage regimes for the administration of an anti-CD19 ADC
US11649250B2 (en) 2017-08-18 2023-05-16 Medimmune Limited Pyrrolobenzodiazepine conjugates
WO2019060398A1 (fr) 2017-09-20 2019-03-28 Ph Pharma Co., Ltd. Analogues de thailanstatine
US11352324B2 (en) 2018-03-01 2022-06-07 Medimmune Limited Methods
US11524969B2 (en) 2018-04-12 2022-12-13 Medimmune Limited Pyrrolobenzodiazepines and conjugates thereof as antitumour agents
WO2020049286A1 (fr) 2018-09-03 2020-03-12 Femtogenix Limited Amides polycycliques servant d'agents cytotoxiques
WO2020086858A1 (fr) 2018-10-24 2020-04-30 Genentech, Inc. Inducteurs chimiques conjugués de dégradation et méthodes d'utilisation
WO2020123275A1 (fr) 2018-12-10 2020-06-18 Genentech, Inc. Peptides de photoréticulation pour conjugaison spécifique de site à des protéines contenant fc
WO2020157491A1 (fr) 2019-01-29 2020-08-06 Femtogenix Limited Agents cytotoxiques de réticulation g-a
WO2022023735A1 (fr) 2020-07-28 2022-02-03 Femtogenix Limited Agents cytotoxiques

Also Published As

Publication number Publication date
AU4952600A (en) 2000-12-28

Similar Documents

Publication Publication Date Title
WO2000075655A1 (fr) Procede de criblage avec cd100
US11576356B2 (en) Genetically modified non-human animals and methods of use thereof
JP2004533811A (ja) ２型サイトカインレセプターおよび２型サイトカインレセプターをコードする核酸
US20080039416A1 (en) Methods for Treating Disease by Modulating an Osmotic Stress Pathway
WO2002006482A1 (fr) Protéine réceptrice reconnaissant spécifiquement un adn bactérien
WO2001044475A1 (fr) Nouveau polypeptide et son adn
WO2001002564A1 (fr) Nouveau polypeptide et adn de ce polypeptide
WO2004048565A1 (fr) Proteine associee a l'apoptose et son utilisation
WO2001046415A1 (fr) Polypeptides de type tachykinine et utilisation associee
WO2000071581A1 (fr) Nouveau polypeptide
WO2001000799A1 (fr) Nouvelle proteine et son adn
WO2004041850A1 (fr) Nouveaux ligands fprl1 et utilisations de ceux-ci
JP4090092B2 (ja) 新規Ｆａｓリガンド様タンパク質およびそのＤＮＡ
JP2001050951A (ja) Ｃｄ１００を用いるスクリーニング方法
KR102658190B1 (ko) 인간화된 sirpa-il15 녹인 마우스 및 이의 이용 방법
JP2001048803A (ja) 医 薬
JP4320355B2 (ja) 新規Ｆａｓリガンド様タンパク質およびそのＤＮＡ
JP2001029090A (ja) 新規ポリペプチド
JP2004075569A (ja) Ｉｌ２０受容体およびｉｌ２０の新規用途
JP2001299364A (ja) 新規タンパク質およびそのｄｎａ
WO2004095023A1 (fr) Nouvelle technique de criblage
JP2002348299A (ja) Ｉｒａｐ結合タンパク質
JP2001149083A (ja) 新規ポリペプチドおよびそのｄｎａ
WO2004041301A1 (fr) Antidiuretiques
WO2004080485A1 (fr) Substance preventive/therapeutique pour les maladies de l'appareil digestif superieur

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AU AZ BA BB BG BR BY CA CN CR CU CZ DM DZ EE GD GE HR HU ID IL IN IS JP KG KR KZ LC LK LR LT LV MA MD MG MK MN MX MZ NO NZ PL RO RU SG SI SK TJ TM TR TT UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP