WO2004022761A1 - Retroviral vector and stable packaging cell lines - Google Patents

Retroviral vector and stable packaging cell lines Download PDF

Info

Publication number
WO2004022761A1
WO2004022761A1 PCT/GB2003/003791 GB0303791W WO2004022761A1 WO 2004022761 A1 WO2004022761 A1 WO 2004022761A1 GB 0303791 W GB0303791 W GB 0303791W WO 2004022761 A1 WO2004022761 A1 WO 2004022761A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
retroviral
cells
cell
retroviral vector
Prior art date
Application number
PCT/GB2003/003791
Other languages
English (en)
French (fr)
Inventor
Kyriacos Mitrophanous
Mary Collins
Yosuhiro Takeuchi
Yasuhiro Ikeda
Original Assignee
Oxford Biomedica (Uk) Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB0220467.5A external-priority patent/GB0220467D0/en
Application filed by Oxford Biomedica (Uk) Limited filed Critical Oxford Biomedica (Uk) Limited
Priority to JP2004533613A priority Critical patent/JP4992032B2/ja
Priority to EP03793864.4A priority patent/EP1534847B1/en
Priority to AU2003260769A priority patent/AU2003260769A1/en
Publication of WO2004022761A1 publication Critical patent/WO2004022761A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/02—Drugs for disorders of the nervous system for peripheral neuropathies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/06—Antimigraine agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16—Anti-Parkinson drugs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13051—Methods of production or purification of viral material
    • C12N2740/13052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16051—Methods of production or purification of viral material
    • C12N2740/16052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • the present invention relates to a retroviral vector, and particularly, but not exclusively, to a novel system for engineering cells to produce recombinant RNAs or proteins which are potentially harmful to the cells.
  • the present invention also relates to a retroviral vector which is itself capable of expressing a retroviral particle that is capable of delivering a nucleotide sequence of interest (hereinafter abbreviated to "NOI") - or even a plurality of NOIs - to a site of interest. More particularly, the present invention relates to vectors, stable cell lines and methods useful in gene therapy.
  • NOI nucleotide sequence of interest
  • Gene therapy includes any one or more of: the addition, the replacement, the deletion, the supplementation, the manipulation etc. of one or more nucleotide sequences in, for example, one or more targeted sites - such as targeted cells. If the targeted sites are targeted cells, then the cells may be part of a tissue or an organ. General teachings on gene therapy may be found in Molecular Biology (Ed Robert Meyers, Pub VCH, such as pages 556-558).
  • gene therapy also provides a means by which any one or more of: a nucleotide sequence, such as a gene, can be applied to replace or supplement a defective gene; a pathogenic gene or gene product can be eliminated; a new gene can be added in order, for example, to create a more favourable phenotype; cells can be manipulated at the molecular level to treat cancer (Schmidt- Wolf and Schmidt- Wolf, 1994, Annals of Hematology 69;273-279) or other conditions - such as immune, cardiovascular, neurological, inflammatory or infectious disorders; antigens can be manipulated and/or introduced to elicit an immune response - such as genetic vaccination.
  • a nucleotide sequence such as a gene
  • a pathogenic gene or gene product can be eliminated
  • a new gene can be added in order, for example, to create a more favourable phenotype
  • cells can be manipulated at the molecular level to treat cancer (Schmidt- Wolf and Schmidt- Wolf, 1994, Annals of Hematology
  • retroviruses have been proposed for use in gene therapy.
  • retroviruses are RNA viruses with a life cycle different to that of lytic viruses.
  • a retrovirus infects a cell, its genome is converted to a DNA form.
  • a retrovirus is an infectious entity that replicates through a DNA intermediate. More details on retroviral infection etc., are presented later on.
  • retroviruses have been proposed as a delivery system (otherwise known as a delivery vehicle or delivery vector) for inter alia the transfer of a NOI, or a plurality of NOIs, to one or more sites of interest.
  • the transfer can occur in vitro, ex vivo, in vivo, or combinations thereof.
  • the retroviruses are typically called retroviral vectors or recombinant retroviral vectors.
  • Retroviral vectors have even been exploited to study various aspects of the retrovirus life cycle, including receptor usage, reverse transcription and RNA packaging (reviewed by Miller, 1992 Curr Top Microbiol Immunol 158:1-24).
  • At least part of one or more of the gag, pol and env protein coding regions may be removed from the virus. This makes the retroviral vector replication-defective. The removed portions may even be replaced by a NOI in order to generate a virus capable of integrating its genome into a host genome, but wherein the modified viral genome is unable to propagate itself due to a lack of structural proteins. When integrated in the host genome, expression of the NOI occurs - resulting in, for example, a therapeutic effect.
  • the transfer of a NOI into a site of interest is typically achieved by: integrating the NOI into the recombinant viral vector; packaging the modified viral vector into a virion coat; and allowing transduction of a site of interest - such as a targeted cell or a targeted cell population.
  • retroviral vectors e.g. to prepare suitable titres of the retroviral vector
  • transduction of, for example, a site of interest by using a combination of a packaging or helper cell line and a recombinant vector.
  • propagation and isolation may entail isolation of the retroviral gag, pol and env genes and their separate introduction into a host cell to produce a "packaging cell line".
  • the packaging cell line produces the proteins required for packaging retroviral RNA.
  • the helper proteins can package the /....-positive recombinant vector to produce the recombinant virus stock. This is commonly known as a "producer cell” .
  • the vector can be used to infect cells to introduce the NOI into the genome of the cells.
  • the recombinant virus whose genome lacks all genes required to make viral proteins can infect only once and cannot propagate.
  • packaging cells have been developed in which the gag/pol and env viral coding regions and the viral vector are carried on separate expression plasmids that are independently transfected into a packaging cell line so that three recombinant events are required for wild type viral production.
  • Transient transfection can be used to make vectors.
  • transient transfection has been used if the vector or retroviral packaging components are toxic to cells.
  • Components typically used to generate retroviral vectors include a plasmid encoding the Gag/Pol proteins, a plasmid encoding the Env protein and a plasmid containing a NOI.
  • Vector production involves transient transfection of one or more of these components into cells containing the other required components. If the vector encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apoptosis, it has proved difficult to generate stable vector-producing cell lines, thus transient transfection can be used to produce the vector before the cells die.
  • the aforementioned technique can be problematic in the sense that the titre levels are not always satisfactory, it is difficult to make large batches of virus, and safety tests must be performed on each small batch.
  • HIN vectors are usually made by transient transfection of vector and helper virus.
  • Some workers have even replaced the HIN Env protein with that of vesicular stomatis virus (NSV).
  • NSV-G protein is quite toxic to cells.
  • retroviral vectors are used extensively in biomedical research and for gene therapy.
  • Current methods for the production of retroviral vectors make use of the fact that the two roles of the wild-type retrovirus genome, that is protein encoding and as a template for new genome copies, can be de-coupled (e.g. Soneoka et al 1995 ⁇ ucl. Acids Res. 23, 628 and references therein).
  • Protein that is required for the assembly of new virus particles and for enzyme and regulatory functions can be produced by non-genome sequences in, for example, a mammalian packaging cell line (e.g. Miller 1990 Hum. Gene Therapy 1, 5).
  • a genome sequence lacking the protein encoding functions is provided, so that the resulting retroviral vector particles are capable of infecting but not of replicating in a target cell.
  • the genome sequence can also be designed for delivery and integration of a therapeutic gene (Nile and Russel 1995 Brit. Med. Bull 51, 12).
  • Standard methods for producing murine leukaemia virus (MLN)-based vectors include use of stably engineered cell lines expressing the gag-pol and env genes (the packaging components) of MLN. These will package a compatible retroviral vector genome introduced by transfection with an appropriate plasmid.
  • An alternative method for producing HIV based vectors involves simultaneous transient transfection of gag-pol, env, and vector genome plasmids into suitable cells.
  • Retroviral vector particles are generally harvested by removing supernatant from a culture of particle-producing cells. The resulting suspension may be concentrated with respect to the vector particles, using physical methods, but only to a limited degree as problems such as aggregation and damage tend to arise. Thus, it may only be possible to concentrate a suspension of vector particles by up to 100-fold.
  • HIV-1 based vectors offer a means for the delivery of therapeutic trans genes into a wide variety of cell types, both dividing and non- dividing. HIV-1 based vectors have commonly been produced either transiently 20 or using packaging cell lines in which vector production is induced . Until recently no stable packaging cells to continuously produce high titre HIN-1 vectors were available, because it had been difficult to stably express large amounts of HIV-1 Gag-Pol.
  • VSV-G rhabdovirus vesicular stomatitis virus G protein
  • the present invention seeks to provide an improved system for preparing viral particles that may be of subsequent use in medicine.
  • the present invention seeks to provide an improved system for preparing a continuous supply of recombinant proteins and/or viral particles that may be of subsequent use in medicine.
  • the present invention also seeks to provide an improved system for preparing a high titre of recombinant proteins and/or viral particles that may be of subsequent use in medicine.
  • retroviral infection can result in stable HIV Gag-Pol expression. More generally, we have found that the concept of retroviral gene delivery may be used to stably express other somewhat cytotoxic proteins.
  • composition in the form of a retroviral vector comprising, and capable of expressing, a nucleotide of interest (NOI), wherein the NOI encodes an RNA or protein which is potentially harmful to a cell.
  • NOI nucleotide of interest
  • the retroviral vector will be capable of infecting a cell.
  • a protein that is capable of altering the metabolic processes or possessing a destructive action on cells i.e. is potentially cytotoxic. Protein toxicity can manifest itself on different levels, e.g. some proteins inhibit cell growth, whereas other proteins also kill them. Some proteins interfere with replication of the host cell, such as inhibitors of the cell cycle or proteins that induce apoptosis.
  • the present invention is particularly useful in the production of proteins which show some degree of detrimental effect to the cell, i.e. inhibit the cell function at sublethal levels. Whether a protein is harmful to a cell is normally assessed by expressing the protein in a cell using a constitutive promoter and determining whether there is any harmful effect on the cell compared to a control.
  • the NOI is capable of expressing an HIV protein, such as HIV protease.
  • the NOI is useful in medicine, e.g. cancer therapy.
  • the NOI will be present in the retroviral vector within a transcription unit
  • the NOI may form part of a second retroviral genome, which may itself contain a second NOI.
  • This second NOI is preferably useful in medicine e.g. gene therapy.
  • This second NOI may or may not be harmful to a cell.
  • a particular advantage of the present invention is that it allows the production of a packaging cell line that produces retroviral particles, including pseudotyped particles, at a higher titre than conventional packaging cell lines, and produces such retroviral particles for a longer period.
  • This advantage is achieved through stable integration of at least one component of the retroviral particle, which component is capable of being integrated, into the cell's genome through infection by a first retroviral vector. In this situation the NOI can be seen as encoding at least one component of a second retroviral particle.
  • a composition in the form of a retroviral expression system comprising a first retroviral vector which comprises a second retroviral component, wherein the first retroviral vector is capable of infecting a cell and the second retroviral component encodes at least one component of a second retroviral vector.
  • a retroviral expression system comprising a first retroviral vector which is capable of infecting a cell and which first retroviral vector encodes at least one component of a second retroviral vector, i.e. the second retroviral component is incorporated within the first retroviral vector.
  • cells may be transduced with a first retroviral component which comprises a polynucleotide sequence coding for a gene, such as gag- pol of the second retroviral component.
  • Regulatory proteins e.g. from the second retroviral particle, such as Tat and Rev, may be introduced for efficient vector genome production, along with Env and the vector genome of the second retroviral component, resulting in the production of the second retroviral particle.
  • the first retroviral component is capable of integrating itself into the genome of a cell.
  • the cell may be, or be used to form, a packaging or producer cell for production of the retroviral particle.
  • a packaging or producer cell for production of the retroviral particle.
  • the host cell we may refer to the cell infected by the first retroviral vector as the "host cell”.
  • the second retroviral component may comprise the retroviral gag-pol gene, or env. Contrary to the prejudice in the art we have found that the toxicity of e.g. Gag-Pol and Env is reduced when stably expressed following integration using a retroviral vector.
  • the first retroviral component is derivable from a different retrovirus to the second retroviral component.
  • the first retroviral component is derived from MLV.
  • the second retroviral vector component is derived from HIV or EIAV, more preferably HIV, even more preferably HIV- 1.
  • HIV or EIAV more preferably HIV, even more preferably HIV- 1.
  • a retroviral vector according to the present invention in the form of an integrated provirus in the form of an integrated provirus.
  • a retroviral production system for producing the retroviral vector of the present invention comprising a nucleic acid sequence encoding for the first viral vector component and a nucleic acid sequence encoding for the second viral vector component.
  • a retroviral vector produced by the production system of the present invention is A retroviral vector produced by the production system of the present invention.
  • a retroviral particle obtained from the retroviral vector or production system of the present invention is a retroviral particle obtained from the retroviral vector or production system of the present invention.
  • a retroviral vector, a retroviral particle, or a cell of the present invention for use in medicine.
  • retroviral vector Use of a retroviral vector, a retroviral particle, or a cell of the present invention to produce a protein which is harmful to a cell.
  • retroviral vector for the preparation of a medicament to deliver an NOI to a patient in need of same.
  • a method of producing a stable cell line comprising infecting a cell with a retroviral vector or a retroviral particle of the present invention.
  • a method of producing a protein which is harmful to a cell comprising infecting the cell with a retroviral vector or a retroviral particle of the present invention.
  • the present invention allows expression of recombinant proteins which may be harmful to a cell line, and have therefore proved difficult to produce using conventional approaches.
  • the present invention allows expression which is: Stable Long-term High Level
  • the present invention thus allows the production of cell lines which continuously produce vectors, such as HIV-l based vectors, and proteins of interest, and allows the reproducibly generation of large batches of these products for pre-clinical and clinical use.
  • the retroviral vector of the present invention can be seen as being in the form of a hybrid viral vector system which comprises primary viral vectors which encode a second or secondary viral vector, the first or primary vector being capable of infecting a host cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a further target cell.
  • a genetic vector of the invention consists of a primary vector manufactured in vitro which encodes the genes necessary to produce a secondary vector in vitro or in vivo.
  • the secondary vector carries one or more selected genes for insertion into the target cell.
  • the selected genes may be one or more marker genes and/or therapeutic genes.
  • the primary and secondary viral vector may be a variety of different retroviral vectors, such as lentiviral, or in the case of multiple primary viral vectors, they may be a mixture of vectors of different viral origin. In whichever case, the secondary viral vectors are preferably defective in that they are incapable of independent replication. Thus, they are capable of entering a target cell and delivering the secondary vector sequences, but not of replicating so as to go on to infect further target cells.
  • the hybrid viral vector system comprises more than one primary vector to encode the secondary vector
  • all of the primary vectors will be used to infect a primary target cell population, usually simultaneously.
  • the preferred single or multiple primary viral vectors are MLV vectors.
  • the secondary viral vector is preferably a lentiviral vector.
  • the second viral vector is derived from HIN.
  • the construction of a retro-lentiviral system is described in the Examples.
  • the secondary vector is produced by expression of essential genes for assembly and packaging of a defective viral vector particle, within the host cell. It is defective in that it is incapable of independent replication. Thus, once the secondary retroviral vector has transduced a target cell, it is incapable of spreading by replication to any further target cells.
  • the secondary vector may be produced from expression of essential genes for retroviral vector production encoded in the D ⁇ A of the primary vector.
  • genes may include a gag-pol gene from a retrovirus, an envelope gene from an enveloped virus, or any other protein, sugar, lipid or complex of these, capable of mediating cell entry and a defective retroviral genome containing one or more therapeutic genes.
  • the retroviral genome contains in general terms sequences to enable reverse transcription, at least part of a 5' long terminal repeat (LTR), at least part of a 3'LTR and a packaging signal.
  • LTR 5' long terminal repeat
  • HIN-1 packaging system herein referred to as "STAR".
  • This system rapidly and reproducibly generates large batches of high titre vectors, which allows extensive safety control tests, an important aspect for the clinical use.
  • high level expression of HIN-1 Gag-Pol was achieved by transducing cells, preferably 293T cells, with a murine leukaemia virus (MLN) vector coding for codon-optimised gag-pol gene 11 .
  • MNN murine leukaemia virus
  • the HIV-1 regulatory proteins, Tat and Rev for efficient vector genome production and gammaretrovirus envelopes (Env) were introduced, resulting in packaging cell lines producing empty vector particles.
  • Env gammaretrovirus envelopes
  • the secondary vector is also safe for in vivo use in that incorporated into it are one or more safety features which eliminate the possibility of recombination to produce an infectious virus capable of independent replication.
  • the secondary vector may be encoded by a plurality of transcription units, which may be located in a single or in two or more primary vectors.
  • a transcription unit encoding the secondary vector genome there may be a transcription unit encoding gag-pol and a transcription unit encoding env.
  • two or more of these may be combined.
  • nucleic acid sequences encoding gag-pol and env, or env and the genome may be combined in a single transcription unit. Ways of achieving this are known in the art.
  • Transcription units as described herein are regions of nucleic acid containing coding sequences and the signals for achieving expression of those coding sequences independently of any other coding sequences.
  • each transcription unit generally comprises at least a promoter, an enhancer and a polyadenylation signal.
  • the promoter and enhancer of the transcription units encoding the secondary vector are preferably strongly active, or capable of being strongly induced, in the target cells under conditions for production of the secondary viral vector.
  • the promoter and/or enhancer may be constitutively efficient, or may be tissue or temporally restricted in their activity.
  • Safety features which may be incorporated into the hybrid viral vector system are described below. One or more such features may be present.
  • sequence homology between the sequences encoding the components of the secondary vector may be avoided by deletion of regions of homology. Regions of homology allow genetic recombination to occur.
  • three transcription units are used to construct a secondary retroviral vector.
  • a first transcription unit contains a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer.
  • a second transcription unit contains a retroviral env gene under the control of a non-retroviral promoter and enhancer.
  • a third transcription unit comprises a defective retroviral genome under the control of a non-retroviral promoter and enhancer.
  • the packaging signal is located such that part of the gag sequence is required for proper functioning. Normally when retroviral vector systems are constructed therefore, the packaging signal, including part of the gag gene, remains in the vector genome. In the present case however, a synthetic gag sequence may be used which lacks homology with the vector.
  • the retroviral vector is constructed from the following three components.
  • the first transcription unit contains a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer.
  • the second transcription unit contains the env gene from the alternative enveloped virus, under the control of a non-retroviral promoter and enhancer.
  • the third transcription unit comprises a defective retroviral genome under the control of a non-retroviral promoter and enhancer. It is also envisaged that the primary viral vector may be pseudotyped. Pseudotyping is described below in more detail.
  • the possibility of replication competent retroviruses can be eliminated by using two transcription units constructed in a particular way.
  • the first transcription unit contains a gag-pol coding region under the control of a promoter-enhancer active in the primary target cell such as a hCMN promoter-enhancer or a tissue restricted promoter- enhancer.
  • the second transcription unit encodes a retroviral genome R ⁇ A capable of being packaged into a retroviral particle.
  • the second transcription unit contains retroviral sequences necessary for packaging, integration and reverse transcription and also contains sequences coding for an env protein of an enveloped virus and the coding sequence of one or more therapeutic genes.
  • the primary retroviral vectors may be replication competent vectors but are more preferably defective retroviral vectors.
  • Embodiments of the invention described solve one of the major problems associated with production of some viral vectors used in gene therapy, namely that production is transient.
  • retroviral vector as the secondary vector is also advantageous because it permits the stable expression of therapeutic genes in the target tissue, including stable expression in proliferating target cells.
  • the secondary viral vector preferentially infects a certain cell type or cell types. More preferably, the secondary vector is a targeted vector, that is it has a tissue tropism which is altered compared to the native virus, so that the vector is targeted to particular cells.
  • the term “targeted vector” is not necessarily linked to the term “target cell”.
  • “Target cell” simply refers to a cell which the second vector, whether native or targeted, is capable of infecting or transducing.
  • the envelope protein of the retroviral secondary vector needs to be a non-toxic envelope or an envelope which may be produced in non-toxic amounts within the primary target cell, such as for example a MLN ampho tropic envelope or a modified amphotropic envelope.
  • Target cells for the secondary vector according to the invention include but are not limited to haematopoietic cells (including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these); endothelial cells; tumour cells; stromal cells; astr ocytes or glial cells; muscle cells; epithelial cells; and adult or foetal stem cells.
  • haematopoietic cells including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these
  • endothelial cells including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these
  • endothelial cells including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these
  • endothelial cells including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these
  • this second transcription unit is under the control of a promoter-enhancer which is preferentially active in a diseased location within the body such as an ischaemic site or the micro-environment of a solid tumour.
  • the second transcription unit is constructed such that on insertion of the genome into the target cell, an intron is generated which serves to reduce expression of the viral env gene and permit efficient expression of a therapeutic gene.
  • the host cell population may be the same as the target cell population.
  • delivery of a primary vector of the invention to tumour cells leads to replication and generation of further vector particles which can transduce further tumour cells.
  • the target cell population may be different from the host cell population.
  • the host cells serve as an endogenous factory within the body of the treated individual and produce additional vector particles which can infect the target cell population.
  • the host cell population may be haematopoietic cells transduced by the primary vector in vivo or ex vivo.
  • the target cells are then delivered to or migrate to a site within the body such as a tumour and produce the secondary vector particles, which are capable of transducing for example tumour cells within a solid tumour.
  • the invention permits the localised production of high titres of defective retroviral vector particles in vivo at or near the site at which action of a therapeutic protein or proteins is required with consequent efficient transduction of target cells.
  • the primary vector will also be replication defective.
  • the invention also permits the production of retroviral vectors such as MLN-based vectors in non-dividing and slowly-dividing cells in vivo. It had previously been possible to produce MLN-based retroviral vectors only in rapidly dividing cells such as tissue culture-adapted cells proliferating in vitro or rapidly dividing tumour cells in vivo. Extending the range of cell types capable of producing retroviral vectors is advantageous for delivery of genes to the cells of solid tumours, many of which are dividing slowly, and for the use of non-dividing cells such as endothelial cells and cells of various haematopoietic lineages as endogenous factories for the production of therapeutic protein products.
  • retrovirus includes: murine leukemia virus (MLV), human immunodeficiency virus (HIN), equine infectious anaemia virus (ELAN), mouse mammary tumour virus (MMTN), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo- MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis virus (AEV) and all other retroviridiae including spurnaviruses and lenti viruses.
  • MMV murine leukemia virus
  • HIN human immunodeficiency virus
  • ELAN mouse mammary tumour virus
  • RSV Rous sarcoma virus
  • Fujinami sarcoma virus FuSV
  • the secondary retroviral vector at least is derivable from a lentivirus.
  • Lentiviruses also belong to the retrovirus family, but they can infect both dividing and non-dividing cells (Lewis et al (1992) EMBO J. 3053-3058).
  • the lentivirus group can be split into “primate” and "non-primate”.
  • primate lentiviruses include the human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIN).
  • the non-primate lentiviral group includes the prototype "slow virus” visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIN) and bovine immunodeficiency virus (BIN).
  • HIN encompasses all designations assigned to those viruses implicated as causative agents of acquired immunodeficiency syndrome (ALDS) and AIDS-related complex (ARC), such as HIV, e.g. HIV-1 and fflV-2, and HTLV, e.g. HTLV-HI.
  • ADS acquired immunodeficiency syndrome
  • ARC AIDS-related complex
  • HIV HIV
  • fflV-2 fflV-2
  • HTLV e.g. HTLV-HI
  • HJN-1 the predominant species around the world.
  • M two major groups of HIN-1 exist, "M” and "O”.
  • the virus that causes the great majority of HIN-1 infections are in the M group.
  • the O group isolates are genetically quite distant from the M group.
  • HIN-1 subtypes of the M group include subtypes A-J.
  • HIN and ELAN may be found from the ⁇ CBI Genbank database (i.e. Genome Accession ⁇ os. AF033819 and AF033820 respectively). Details of HIN variants may also be found at http://hiv-web.lanl.gov. Details of ELAN variants may be found through http://www.ncbi.nlm.nih. gov.
  • a retrovirus initially attaches to a specific cell surface receptor.
  • the refroviral R ⁇ A genome is then copied to D ⁇ A by the virally encoded reverse transcriptase which is carried inside the parent virus.
  • This D ⁇ A is transported to the host cell nucleus where it subsequently integrates into the host genome.
  • the provirus is typically referred to as the provirus.
  • the provirus is stable in the host chromosome during cell division and is transcribed like other cellular genes.
  • the provirus encodes the proteins and other factors required to make more virus, which can leave the cell by a process sometimes called "budding".
  • Each retroviral genome comprises genes called gag, pol and env which code for virion proteins and enzymes. These genes are flanked at both ends by regions called long terminal repeats (LTRs).
  • LTRs are responsible for proviral integration, and transcription. They also serve as enhancer-promoter sequences. In other words, the LTRs can control the expression of the viral genes. Encapsidation of the retroviral R As occurs by virtue of apsi sequence located at the 5' end of the viral genome.
  • the LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5.
  • U3 is derived from the sequence unique to the 3' end of the R ⁇ A.
  • R is derived from a sequence repeated at both ends of the R ⁇ A and
  • U5 is derived from the sequence unique to the 5 'end of the RNA.
  • the sizes of the three elements can vary considerably among different retroviruses.
  • the site of transcription initiation is at the boundary between U3 and R in one LTR and the site of poly (A) addition (termination) is at the boundary between R and U5 in the other LTR.
  • U3 contains most of the transcriptional control elements of the provirus, which include the promoter and multiple enhancer sequences responsive to cellular and in some cases, viral transcriptional activator proteins.
  • Some retroviruses have any one or more of the following genes that code for proteins that are involved in the regulation of gene expression: tat, rev, tax and rex.
  • gag encodes the internal structural protein of the virus.
  • Gag protein is proteolytically processed into the mature proteins MA (matrix), CA (capsid) and NC (nucleocapsid).
  • the pol gene encodes the reverse transcriptase (RT), which contains DNA polymerase, associated RNase H and integrase (IN), which mediate replication of the genome.
  • the env gene encodes the surface (SU) glycoprotein and the transmembrane (TM) protein of the virion, which form a complex that interacts specifically with cellular receptor proteins. This interaction leads ultimately to infection by fusion of the viral membrane with the cell membrane.
  • Retroviruses may also contain "additional" genes which code for proteins other than gag, pol and env.
  • additional genes include in HLV, one or more of vif, vpr, vpx, vpu, tat, rev and nef.
  • EIAV has (amongst others) the additional gene S2.
  • Proteins encoded by additional genes serve various functions, some of which may be duplicative of a function provided by a cellular protein.
  • EIAV for example, tat acts as a transcriptional activator of the viral LTR. It binds to a stable, stem-loop RNA secondary structure referred to as TAR. Rev regulates and co-ordinates the expression of viral genes through rev-response elements (RRE). The mechanisms of action of these two proteins are thought to be broadly similar to the analogous mechanisms in the primate viruses. The function of S2 is unknown.
  • an EIAV protein, Ttm has been identified that is encoded by the first exon of tat spliced to the env coding sequence at the start of the transmembrane protein.
  • Retroviral vector systems such as lentiviral vector systems have been proposed as a delivery system for inter alia the transfer of a NOI to one or more sites of interest. The transfer can occur in vitro, ex vivo, in vivo, or combinations thereof. Retroviral vector systems have even been exploited to study various aspects of the retrovirus life cycle, including receptor usage, reverse transcription and RNA packaging (reviewed by Miller, 1992 Curr Top Microbiol Immunol 158:1-24).
  • vector system means a vector particle capable of transducing a recipient cell with an NOI.
  • a vector particle includes the following components: a vector genome, which may contain one or more NOIs, a nucleocapsid encapsidating the nucleic acid, and a membrane surrounding the nucleocapsid.
  • nucleocapsid refers to at least the group specific viral core proteins (gag) and the viral polymerase (pol) of a retrovirus genome. These proteins encapsidate the packagable sequences and are themselves further surrounded by a membrane containing an envelope glycoprotein.
  • RNA genome from a retroviral vector particle is reverse transcribed into DNA and integrated into the DNA of the recipient cell.
  • vector genome refers to both to the RNA construct present in the retroviral vector particle and the integrated DNA construct.
  • the term also embraces a separate or isolated DNA construct capable of encoding such an RNA genome.
  • a retroviral or lentiviral genome should comprise at least one component part derivable from a retrovirus or a lentivirus.
  • the term “derivable” is used in its normal sense as meaning a nucleotide sequence or a part thereof which need not necessarily be obtained from a retrovirus such as a lentivirus but instead could be derived therefrom.
  • the sequence may be prepared synthetically or by use of recombinant DNA techniques.
  • the genome comprises a psi region (or an analogous component which is capable of causing encapsidation).
  • the primary retroviral vector is a self-inactivating (SIN) vector system.
  • SI self-inactivating
  • the primary retroviral vector contains an internal promoter to drive the expression of the NOI of interest.
  • the primary retroviral vector contains a split intron sequence (J Virol 2000 Mar; 74(5):2365-71. Split-intron retroviral vectors; enhanced expression with improved safety. Ismail SI, Kingsman SM, Kingsman AJ, Uden M.).
  • the primary refroviral vector contains a split polyA sequence (J Virol 2001 Jan; 75(l):199-204. Use of intron-disrapted polyadenylation sites to enhance expression and safety of refroviral vectors. Ismail SI, Rohll JB, Kingsman SM, Kingsman AJ, Uden M.).
  • the secondary refroviral vector is a self-inactivating (SIN) vector system.
  • SI self-inactivating
  • self-inactivating retroviral vector systems have been constructed by deleting the transcriptional enhancers or the enhancers and promoter in the U3 region of the 3' LTR. After a round of vector reverse transcription and integration, these changes are copied into both the 5' and the 3' LTRs producing a franscriptionally inactive provirus. However, any ⁇ romoter(s) internal to the LTRs in such vectors will still be franscriptionally active.
  • This strategy has been employed to eliminate effects of the enhancers and promoters in the viral LTRs on transcription from internally placed genes. Such effects include increased transcription or suppression of transcription.
  • This strategy can also be used to eliminate downstream transcription from the 3' LTR into genomic DNA. This is of particular concern in human gene therapy where it may be important to prevent the adventitious activation of an endogenous oncogene.
  • a recombinase assisted mechanism is used which facilitates the production of high titre regulated retroviral vectors from the producer cells of the present invention.
  • recombmase assisted system includes but is not limited to a system using the Cre recombinase / loxP recognition sites of bacteriophage PI or the site- specific FLP recombinase of S. cerevisiae which catalyses recombination events between 34 bp FLP recognition targets (FRTs).
  • the site-specific FLP recombinase of S. cerevisiae which catalyses recombination events between 34 bp FLP recognition targets (FRTs) has been configured into DNA constructs in order to generate high level producer cell lines using recombinase-assisted recombination events (Karreman et al (1996) NAR 24:1616-1624).
  • a similar system has been developed using the Cre recombinase / loxP recognition sites of bacteriophage PI (see PCT/ GB00/03837; Vanin et al (1997) J. Virol 71:7820-7826). This was configured into a lentiviral genome such that high titre lentiviral producer cell lines were generated.
  • producer/packaging cell lines of the present invention it is possible to propagate and isolate quantities of viral vector particles (e.g. to prepare suitable titres of the viral vector particles) for subsequent transduction of, for example, a site of interest (such as adult brain tissue).
  • Producer cell lines are usually better for large scale production or vector particles.
  • Producer cells/packaging cells can be of any suitable cell type.
  • Producer cells are generally mammalian cells but can be, for example, insect cells.
  • the term "producer cell” or “vector producing cell” refers to a cell which contains all the elements necessary for production of retroviral vector particles.
  • the producer cell is obtainable from a derived stable cell line.
  • derived stable producer cell line is a transduced producer cell line which has been screened and selected for high expression of a marker gene. Such cell lines support high level expression from the viral genome.
  • derived producer cell line is used interchangeably with the term “derived stable producer cell line” and the term “stable producer cell line”.
  • the derived producer cell line is an HIV or EIAV producer cell line.
  • envelope protein sequences, and nucleocapsid sequences are all stably integrated in the producer and/or packaging cell.
  • one or more of these sequences could also exist in episomal form and gene expression could occur from the episome.
  • packaging cell refers to a cell which contains those elements necessary for production of infectious recombinant virus which are lacking in the RNA genome.
  • packaging cells typically contain one or more producer plasmids which are capable of expressing viral structural proteins (such as gag-pol and env, which may be codon optimised) but they do not contain a packaging signal.
  • packetaging signal which is referred to interchangeably as “packaging sequence” or “p si” is used in reference to the non-coding, c_s-acting sequence required for encapsidation of retroviral RNA strands during viral particle formation.
  • this sequence has been mapped to loci extending from upstream of the major splice donor site (SD) to at least the gag start codon.
  • Packaging cell lines may be readily prepared (see also WO 92/05266), and utilised to create producer cell lines for the production of retroviral vector particles. As already mentioned above, a summary of the available packaging lines is presented in "Retroviruses”.
  • the packaging cell lines are useful for providing the gene products necessary to encapsidate and provide a membrane protein for a high titre vector particle production.
  • the packaging cell may be a cell cultured in vitro such as a tissue culture cell line. Suitable cell lines include but are not limited to mammalian cells such as murine fibroblast derived cell lines or human cell lines. Preferably the packaging cell line is a human cell line. Examples of suitable cell lines include: HEK293, 293-T, TE671, HT1080 or HeLa, more preferably 293T or HT1080, even more preferably 293T.
  • the packaging cell may be a cell derived from the individual to be treated such as a monocyte, macrophage, blood cell or fibroblast.
  • the cell may be isolated from an individual and the packaging and vector components administered ex vivo followed by re-administration of the autologous packaging cells.
  • high titre means an effective amount of a viral vector or particle which is capable of transducing a target site.
  • the term "effective amount” means an amount of a regulated retroviral vector particle which is sufficient to induce expression of the NOIs at a target site.
  • a high-titre viral preparation for a producer/packaging cell is usually of the order of 10 5 to 10 t.u. per ml.
  • the titer is expressed in transducing units per ml (t.u./ml) as titred on a standard cell line, such as 293T or D17).
  • a standard cell line such as 293T or D17.
  • the viral preparation is concentrated by ultracentrifugation, low-speed centrifugation or cross-slow filtration.
  • the expression products encoded by the NOIs may be proteins which are secreted from the cell. Alternatively the NOI expression products are not secreted and are active within the cell.
  • the NOI expression product it is preferred for the NOI expression product to demonstrate a bystander effect or a distant bystander effect; that is the production of the expression product in one cell leading to the modulation of additional, related cells, either neighbouring or distant (e.g. metastatic), which possess a common phenotype.
  • cPPT central polypurine tract
  • This c_s-acting element is located, for example, in the EIAV polymerase coding region element.
  • the genome of the vector system used in the present invention comprises a cPPT sequence.
  • the viral genome may comprise a post- translational regulatory element and/or a translational enhancer.
  • the NOIs may be operatively linked to one or more promoter/enhancer elements. Transcription of one or more NOI may be under the control of viral LTRs or alternatively promoter-enhancer elements can be engineered in with the transgene.
  • the promoter is a strong promoter such as CMV.
  • the promoter may be a regulated promoter.
  • the promoter may be tissue-specific.
  • a primate lentivirus minimal system can be constructed which requires none of the HJV/SIV additional genes vif, vpr, vpx, vpu, tat, rev and nef for either vector production or for transduction of dividing and non-dividing cells. It has also been demonsfrated that an EIAV minimal vector system can be constructed which does not require S2 for either vector production or for transduction of dividing and non-dividing cells.
  • the deletion of additional genes is highly advantageous. Firstly, it permits vectors to be produced without the genes associated with disease in lentiviral (e.g. HIN) infections. In particular, tat is associated with disease.
  • genes whose function is unknown, such as S2 may be omitted, thus reducing the risk of causing undesired effects. Examples of minimal lentiviral vectors are disclosed in WO-A- 99/32646 and in WO-A-98/17815.
  • the retroviral vector used in the invention is devoid of at least tat and S2 (if it is an EIAV vector system), and possibly also vif, vpr, vpx, vpu and nef. More preferably, the systems of the present invention are also devoid of rev.
  • Rev was previously thought to be essential in some retroviral genomes for efficient virus production. For example, in the case of HIV, it was thought that rev and RRE sequence should be included. However, it has been found that the requirement for rev and RRE can be reduced or eliminated by codon optimisation (see below) or by replacement with other functional equivalent systems such as the MPMV system.
  • codon optimised gag-pol is REV independent, RRE can be removed from the gag-pol expression cassette, thus removing any potential for recombination with any RRE contained on the vector genome.
  • the viral genome of the first aspect of the invention lacks the Rev response element (RRE).
  • RRE Rev response element
  • system used in the present invention is based on a so-called “minimal" system in which some or all of the additional genes have be removed.
  • Codon optimisation has previously been described in WO99/41397 and WO01/79518. Different cells differ in their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence so that they are tailored to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. By the same token, it is possible to decrease expression by deliberately choosing codons for which the corrsponding tRNAs are known to be rare in the particular cell type. Thus, an additional degree of translational control is available.
  • viruses including HIV and other lentiviruses
  • Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms.
  • Codon optimisation has a number of other advantages.
  • the nucleotide sequences encoding the packaging components of the viral particles required for assembly of viral particles in the producer cells/packaging cells have RNA instability sequences (INS) eliminated from them.
  • INS RNA instability sequences
  • the amino acid sequence coding sequence for the packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the packaging components is not compromised.
  • Codon optimisation also overcomes the Rev/RRE requirement for export, rendering optimised sequences Rev independent. Codon optimisation also reduces homologous recombination between different constructs within the vector system (for example between the regions of overlap in the gag-pol and env open reading frames). The overall effect of codon optimisation is therefore a notable increase in viral titre and improved safety.
  • codons relating to INS are codon optimised.
  • sequences are codon optimised in their entirety, with the exception of the sequence encompassing the frameshift site.
  • the gag-pol gene comprises two overlapping reading frames encoding the gag-pol proteins.
  • the expression of both proteins depends on a frameshift during translation. This frameshift occurs as a result of ribosome "slippage" during franslation. This slippage is thought to be caused at least in part by ribosome-stalling RNA secondary structures.
  • Such secondary structures exist downstream of the frameshift site in the gag- ol gene.
  • the region of overlap extends from nucleotide 1222 downstream of the beginning of gag (wherein nucleotide 1 is the A of the gag ATG) to the end of gag (nt 1503). Consequently, a 281 bp fragment spanning the frameshift site and the overlapping region of the two reading frames is preferably not codon optimised. Retaining this fragment will enable more efficient expression of the gag-pol proteins.
  • nt 1262 where nucleotide 1 is the A of the gag ATG.
  • the end of the overlap is at 1461 bp.
  • the wild type sequence has been retained from nt 1156 to 1465.
  • Derivations from optimal codon usage may be made, for example, in order to accommodate convenient restriction sites, and conservative amino acid changes may be introduced into the gag-pol proteins.
  • codon optimisation was based on lightly expressed mammalian genes.
  • the third and sometimes the second and third base may be changed.
  • gag-pol sequences can be achieved by a skilled worker.
  • retroviral variants described which can be used as a starting point for generating a codon optimised gag-pol sequence.
  • Lentiviral genomes can be quite variable. For example there are many quasi-species of HIN-1 which are still functional. This is also the case for ELAN. These variants may be used to enhance particular parts of the transduction process. Examples of HIN-1 variants may be found at http ://hiv-web.lanl. gov. Details of ELAN clones may be found at the ⁇ CBI database: http :/ / www.ncbi .nlm.nih. ov.
  • the strategy for codon optimised gag-pol sequences can be used in relation to any retrovirus. This would apply to all lentiviruses, including EIAN, FIN, BIN, CAEN,
  • VMR VMR
  • SIN HIN-1
  • HLV-2 HSV
  • HSRV human endogenous retroviruses
  • MLV MLV
  • other retroviruses HERV
  • Codon optimisation can render gag-pol expression Rev independent.
  • the genome also needs to be modified. This is achieved by optimising vector genome components.
  • these modifications also lead to the production of a safer system absent of all additional proteins both in the producer and in the transduced cell.
  • the packaging components for a retroviral vector include expression products of gag, pol and env genes.
  • efficient packaging depends on a short sequence of 4 stem loops followed by a partial sequence from gag and env (the "packaging signal").
  • packaging signal the partial sequence from gag and env
  • inclusion of a deleted gag sequence in the retroviral vector genome will optimise vector titre.
  • efficient packaging has been reported to require from 255 to 360 nucleotides of gag in vectors that still retain env sequences, or about 40 nucleotides of gag in a particular combination of splice donor mutation, gag and env deletions.
  • the refroviral vector genome includes a gag sequence which comprises one or more deletions, more preferably the gag sequence comprises about 360 nucleotides derivable from the N-terminus.
  • the primary and/or secondary viral vector is pseudotyped.
  • pseudotyping means incorporating in at least a part of, or substituting a part of, or replacing all of, an env gene of a viral genome with a heterologous env gene, for example an env gene from another virus.
  • Pseudotyping is not a new phenomenon and examples may be found in WO 99/61639, WO-A-98/05759, WO-A-98/ 05754, WO-A- 97/17457, WO-A-96/ 09400, WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841- 847.
  • LCMV lymphocytic choriomeningitis virus
  • the vector system may be pseudotyped with LMCV env protein.
  • the vector system may be pseudotyped with an envelope proteins from the Ebola virus.
  • the vector system may be pseudotyped with an envelope proteins from an alphavirus.
  • Env derived from gammaretrovirus strains such as amphotropic MLV (MLV- A), gibbon ape leukaemia virus (GALV) and the feline
  • MLV vectors bearing these Env have been used for the transduction of several clinically relevant cell types such as lymphocytes and CD34 + progenitor cells both in vitro 24"26 and ex vivo 21' 0 .
  • the mature gammaretrovirus Env consists of a trimer of heterodimers. Each dimer is composed of the extra- viral surface subunit (SU) and the membrane spanning subunit (TM). In the mature protein SU and TM are connected via several non-covalent interactions 31 and a labile disulphide bond 32 .
  • High titre vectors such as HIN-1 vectors, produced from cells according to the present invention and pseudotyped with gammarefroviral Env may be advantageous in many clinical and experimental settings compared to other systems, including transiently produced HIN- l(NSN-G).
  • the present invention may also make use of a mutant, variant, homologue or fragment of a gammarefroviral Env.
  • the cytoplasmic tail of RD114 may be replaced by that of the MLN envelope or the RD114 Env may be modified by replacing the R peptide cleavage site sequence with that of a matrix-capsid cleavage site in HIN-1 Gag to create RDpro.
  • the viral vector system may be pseudotyped with at least a part of a rabies G protein or a mutant, variant, homologue or fragment thereof, or at least a part of a VS V G protein or a mutant, variant, homologue or fragment thereof, or at least a part of a cocal virus glycoprotein (GenBank AF045556) or a mutant, variant, homologue or fragment thereof, or at least a part of a chandipura virus glycoprotein (GenBank J04350) or a mutant, variant, homologue or fragment thereof.
  • a cocal virus glycoprotein GenBank AF045556
  • a mutant, variant, homologue or fragment thereof or at least a part of a chandipura virus glycoprotein (GenBank J04350) or a mutant, variant, homologue or fragment thereof.
  • a viral vector comprising a heterologous env region, wherein the heterologous env region comprises at least a part of a rabies G protein or a mutant, variant, homologue or fragment thereof, or at least a part of a VS V G protein or a mutant, variant, homologue or fragment thereof, at least a part of a cocal glycoprotein or a mutant, variant, homologue or fragment thereof, or at least a part of a chandipura glycoprotein or a mutant, variant, homologue or fragment thereof to transduce a target adipose tissue site.
  • the heterologous env region may be encoded by a gene which is present on a producer plasmid.
  • the producer plasmid may be present as part of a kit for the production of viral vector particles suitable for use in the first aspect of the invention.
  • the vector may be pseudotyped with at least a part of a rabies G protein or a mutant, variant, homologue or fragment thereof.
  • rabies G protein is also described in EP-A-0445625.
  • the use of rabies G protein provides vectors which, in vivo, preferentially transduce targeted cells which rabies virus preferentially infects. This includes adipose tissue target cells in vivo.
  • rabies G from a pathogenic strain of rabies such as ERA may be particularly effective.
  • rabies G protein confers a wider target cell range in vitro including nearly all mammalian and avian cell types tested (Seganti et al, 1990 Arch Virol. 34,155-163; Fields et al, 1996 Fields Virology, Third Edition, vol.2, Lippincott-Raven Publishers, Philadelphia, New York).
  • the tropism of the pseudotyped vector particles may be modified by the use of a mutant rabies G which is modified in the extracellular domain.
  • Rabies G protein has the advantage of being mutatable to restrict target cell range.
  • the uptake of rabies virus by target cells in vivo is thought to be mediated by the acetylcholine receptor (AchR) but there may be other receptors to which it binds in vivo (Hanham et al, 1993 J. Virol.,67, 530-542; Tuffereau et a/.,1998 J. Virol., 72, 1085-1091). It is thought that multiple receptors are used in the nervous system for viral entry, including NCAM (Thoulouze et al (1998) J. Virol 72(9):7181-90) and p75 Neurofrophin receptor (Tuffereau C et al (1998) Embo J 17(24) 7250-9).
  • arginine at amino acid 333 in the mature protein to glutamine can be used to restrict viral entry to olfactory and peripheral neurons in vivo while reducing propagation to the central nervous system.
  • These viruses were able to penetrate motor neurons and sensory neurons as efficiently as the wild type virus, yet transneuronal transfer did not occur (Coulon et al, 1989, J. Virol. 63, 3550-3554).
  • Viruses in which amino acid 330 has been mutated are further attenuated, being unable to infect either motor neurons or sensory neurons after infra-muscular injection (Coulon et «/.,1998 J. Virol., 72, 273-278).
  • rabies G proteins from laboratory passaged strains of rabies may be used. These can be screened for alterations in tropism. Such sfrains include the following:
  • the ERA strain is a pathogenic strain of rabies and the rabies G protein from this strain can be used for transduction of neuronal cells.
  • the sequence of rabies G from the ERA strains is in the GenBank database (accession number J02293). This protein has a signal peptide of 19 amino acids and the mature protein begins at the lysine residue 20 amino acids from the franslation initiation methionine.
  • the HEP-Flury strain contains the mutation from arginine to glutamine at amino acid position 333 in the mature protein which correlates with reduced pathogenicity and which can be used to restrict the tropism of the viral envelope.
  • WO 99/61639 discloses the nucleic and amino acid sequences for a rabies virus strain ERA (Genbank locus RAVGPLS, accession M38452).
  • the envelope glycoprotein (G) of Vesicular stomatitis virus (VSV), a rhabdovirus, is another envelope protein that has been shown to be capable of pseudotyping certain retroviruses. Its ability to pseudotype MoMLV-based refroviral vectors in the absence of any retroviral envelope proteins was first shown by Emi et al (1991 Journal of Virology 65:1202-1207). WO94/294440 teaches that retroviral vectors may be successfully pseudotyped with VSV-G. These pseudotyped VSV-G vectors may be used to transduce a wide range of mammalian cells. Even more recently, Abe et al (J Virol 1998 72(8) 6356-6361) teach that non-infectious retroviral particles can be made infectious by the addition of VSV-G.
  • VSV-G pseudotyped vectors have been shown to infect not only mammalian cells, but also cell lines derived from fish, reptiles and insects (Burns et al 1993 ibid). They have also been shown to be more efficient than traditional amphotropic envelopes for a variety of cell lines (Yee et al, 1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568, Lin, Emi et al, 1991 Journal of Virology 65:1202-1207). VSV-G protein can be used to pseudotype certain retroviruses because its cytoplasmic tail is capable of interacting with the retroviral cores.
  • VSV-G protein The provision of a non-retroviral pseudotyping envelope such as VSV-G protein gives the advantage that vector particles can be concentrated to a high titre without loss of infectivity (Akkina et al, 1996 J. Virol. 70: 2581-5). Retrovirus envelope proteins are apparently unable to withstand the shearing forces during ultracentrifugation, probably because they consist of two non-covalently linked subunits. The interaction between the subunits may be disrupted by the centrifugation. In comparison the VSV glycoprotein is composed of a single unit. VSV-G protein pseudotyping can therefore offer potential advantages.
  • WO 00/52188 describes the generation of pseudotyped retroviral vectors, from stable producer cell lines, having vesicular stomatitis virus-G protein (VSV-G) as the membrane-associated viral envelope protein, and provides a gene sequence for the VSV- G protein.
  • VSV-G vesicular stomatitis virus-G protein
  • a potential advantage of using the rabies glycoprotein in comparison to the VSV glycoprotein is the detailed knowledge of its toxicity to man and other animals due to the extensive use of rabies vaccines.
  • phase 1 clinical trials have been reported on the use of rabies glycoprotein expressed from a canarypox recombinant virus as a human vaccine (Fries et al, 1996 Vaccine 14, 428-434), these studies concluded that the vaccine was safe for use in humans.
  • the retroviral vector system used in the present invention may be pseudotyped with a mutant, variant, homologue or fragment of an envelope protein.
  • wild type is used to mean a polypeptide having a primary amino acid sequence which is identical with the native protein (i.e., the viral protein).
  • mutant is used to mean a polypeptide having a primary amino acid sequence which differs from the wild type sequence by one or more amino acid additions, substitutions or deletions.
  • a mutant may arise naturally, or may be created artificially (for example by site-directed mutagenesis).
  • the mutant has at least 90% sequence identity with the wild type sequence.
  • the mutant has 20 mutations or less over the whole wild-type sequence. More preferably the mutant has 10 mutations or less, most preferably 5 mutations or less over the whole wild-type sequence.
  • variant is used to mean a naturally occurring polypeptide which differs from a wild-type sequence.
  • a variant may be found within the same viral strain (i.e. if there is more than one isoform of the protein) or may be found within a different strains.
  • the variant has at least 90% sequence identity with the wild type sequence.
  • the variant has 20 mutations or less over the whole wild-type sequence. More preferably the variant has 10 mutations or less, most preferably 5 mutations or less over the whole wild-type sequence.
  • homologue means an entity having a certain homology with the wild type amino acid sequence and the wild type nucleotide sequence.
  • the term “homology” can be equated with "identity”.
  • an homologous sequence is taken to include an amino acid sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence.
  • the homologues will comprise the same active sites etc. as the subject amino acid sequence.
  • homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
  • an homologous sequence is taken to include a nucleotide sequence which may be at least 75, 85 or 90% identical, preferably at least 95 or 98% identical to the subject sequence.
  • the homologues will comprise the same sequences that code for the active sites etc. as the subject sequence.
  • homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
  • Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
  • % homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues. Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.
  • BLAST and FASTA are available for offline and online searching (see Ausubel et al, 1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program.
  • a new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247- 50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov).
  • a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance.
  • An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs.
  • GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
  • % homology preferably % sequence identity.
  • the software typically does this as part of the sequence comparison and generates a numerical result.
  • sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance.
  • Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues as long as the secondary binding activity of the substance is retained.
  • negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.
  • the present invention also encompasses homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Non-homologous substitution may also occur i.e.
  • Z ornithine
  • B diaminobutyric acid ornithine
  • O norleucine ornithine
  • pyriylalanine thienylalanine
  • naphthylalanine phenylglycine
  • Replacements may also be made by unnatural amino acids include; alpha* and alpha- disubstituted* amino acids, N-alkyl amino acids*, lactic acid*, halide derivatives of natural amino acids such as trifluorotyrosine*, p-Cl-phenylalanine*, p-Br- phenylalanine*, p-I-phenylalanine*, L-allyl-glycine*, ⁇ -alanine*, L- ⁇ -amino butyric acid*, L- ⁇ -amino butyric acid*, L- ⁇ -amino isobutyric acid*, L- ⁇ -amino caproic acid , 7- amino heptanoic acid*, L-methionine sulfone* * , L-norleucine*, L-norvaline*, p-nitro-L- phenylalanine*, L-hydroxyproline , L-tl ioproline*, methyl
  • Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or ⁇ - alanine residues.
  • alkyl groups such as methyl, ethyl or propyl groups
  • amino acid spacers such as glycine or ⁇ - alanine residues.
  • a further form of variation involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art.
  • the peptoid form is used to refer to variant amino acid residues wherein the ⁇ -carbon substituent group is on the residue's nitrogen atom rather than the ⁇ -carbon.
  • fragment indicates that the polypeptide comprises a fraction of the wild-type amino acid sequence. It may comprise one or more large contiguous sections of sequence or a plurality of small sections.
  • the polypeptide may also comprise other elements of sequence, for example, it may be a fusion protein with another protein.
  • the polypeptide comprises at least 50%, more preferably at least 65%, most preferably at least 80% of the wild-type sequence.
  • mutant, variant, homologue or fragment should be capable of transducing a cell when used to pseudotype an appropriate vector.
  • the retroviral vector used in the present invention may comprise nucleotide sequences that can hybridise to the nucleotide sequence presented herein (including complementary sequences of those presented herein).
  • the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention under stringent conditions (e.g. 65°C and 0.1 SSC) to the nucleotide sequence presented herein (including complementary sequences of those presented herein) .
  • stringent conditions e.g. 65°C and 0.1 SSC
  • one or more NOIs may be delivered to a target cell in vivo or in vitro.
  • heterologous refers to a nucleic acid or protein sequence linked to a nucleic acid or protein sequence to which it is not naturally linked.
  • the term NOI includes any suitable nucleotide sequence, which need not necessarily be a complete naturally occurring DNA or RNA sequence.
  • the NOI can be, for example, a synthetic RNA/DNA sequence, a recombinant RNA/DNA sequence (i.e. prepared by use of recombinant DNA techniques), a cDNA sequence or a partial genomic DNA sequence, including combinations thereof.
  • the sequence need not be a coding region. If it is a coding region, it need not be an entire coding region.
  • the RNA/DNA sequence can be in a sense orientation or in an anti-sense orientation. Preferably, it is in a sense orientation.
  • the sequence is, comprises, or is transcribed from cDNA.
  • a retroviral vector genome may generally comprise LTRs at the 5' and 3' ends, suitable insertion sites for inserting one or more NOI(s), and/or a packaging signal to enable the genome to be packaged into a vector particle in a producer cell.
  • the lentiviral vector particle has a reverse transcription system (compatible reverse transcription and primer binding sites) and an integration system (compatible integrase and integration sites).
  • the NOI may encode a protein of interest ("POI").
  • POI protein of interest
  • a refroviral delivery system could be used to examine the effect of expression of a foreign gene a target cell.
  • a retroviral delivery system could be used to screen a cDNA library for a particular effect on a target site.
  • the NOI may be capable of blocking or inhibiting the expression of a gene in the target site.
  • the NOI may be an antisense sequence or interfering RNA sequence.
  • the inhibition of gene expression using antisense technology is well known.
  • the NOI or a sequence derived therefrom may be capable of "knocking out” the expression of a particular gene in a target site.
  • the NOI may be capable of integrating in the genome of the cells of the target site so as to disrupt expression of the particular gene.
  • the NOI may disrupt expression by, for example, introducing a premature stop codon, by rendering the downstream coding sequence out of frame, or by affecting the capacity of the encoded protein to fold (thereby affecting its function).
  • the NOI may be capable of enhancing or inducing ectopic expression of a gene in the target site.
  • the NOI or a sequence derived therefrom may be capable of "knocking in” the expression of a particular gene.
  • Transduced cells which express a particular gene, or which lack the expression of a particular gene have applications in drug discovery and target validation.
  • the expression system could be used to determine which genes have a desirable effect on target tissue cells.
  • An NOI delivered by the viral delivery system of the present invention may be a selection gene, or a marker gene. Many different selectable markers have been used successfully in retroviral vectors.
  • An NOI delivered by a retroviral vector of the present invention may be a therapeutic gene - in the sense that the gene itself may be capable of eliciting a therapeutic effect or it may code for a product that is capable of eliciting a therapeutic effect.
  • suitable NOIs include those that are of therapeutic and/or diagnostic application such as, but not limited to: sequences encoding cytokines, chemokines, hormones, antibodies, anti-oxidant molecules, engineered immunoglobulin-like molecules, a single chain antibody, fusion proteins, enzymes, immune co-stimulatory molecules, immunomodulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a tumour suppresser protein and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives thereof (such as with an associated reporter group).
  • the NOIs may also encode pro-drug activating enzymes.
  • antibody includes a whole immunoglobulin molecule or a part thereof or a bioisostere or a mimetic thereof or a derivative thereof or a combination thereof.
  • a part thereof include: Fab, F(ab)' 2j and Fv.
  • a bioisostere include single chain Fv (ScFv) fragments, chimeric antibodies, bifunctional antibodies.
  • mimetic relates to any chemical which may be a peptide, polypeptide, antibody or other organic chemical which has the same binding specificity as the antibody.
  • derivative as used herein includes chemical modification of an antibody. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group.
  • the present invention also relates to a screening method and modulating factors isolatable by such methods, and uses for such factors.
  • the present invention provides method for screening for modulating factors for cells, which comprises the following steps: (i) providing a target cell;
  • the cDNA library may be a ribozyme library constructed in a lentiviral vector.
  • the ribozyme library can include but is not limited to a hammerhead ribozyme, an EGS or a group II intron ribozyme.
  • the ribozyme library may be used to transduce cell types of interest in vitro and in vivo. These cells can then be screened for the phenotype of interest.
  • the gene or genes affected by the ribozyme can be elucidated by PCR analysis of the ribozyme. For general teachings on ribozymes, see WO 99/41397.
  • the retroviral vector is a lentiviral vector.
  • the advantage of doing this with a lentiviral vector is that it allows the transduction of primary (non-dividing) cells.
  • the present invention also provides the use of a retroviral vector of the invention in the manufacture of a pharmaceutical composition.
  • the pharmaceutical composition may be used to deliver a NOI to a target cell in need of same.
  • the pharmaceutical composition may be used for treating an individual by gene therapy, wherein the composition comprises or is capable of producing a therapeutically effective amount of a retroviral vector system according to the present invention.
  • the method and pharmaceutical composition of the invention may be used to treat a human or animal subject.
  • the subject is a mammalian subject. More preferably the subject is a human.
  • a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular patient.
  • the composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target tissue site (such as for example a lipid delivery system).
  • the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
  • compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution iso tonic with blood.
  • a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution iso tonic with blood.
  • the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
  • the vector system used in the present invention may conveniently be administered by direct injection into the patient. DISEASES
  • the delivery of one or more therapeutic genes by a vector system according to the present invention may be used alone or in combination with other treatments or components of the treatment.
  • the retroviral vector of the present invention may be used to deliver one or more NOI(s) useful in the treatment of the disorders listed in WO-A-98/05635.
  • cancer inflammation or inflammatory disease
  • dermatological disorders fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, HIV infection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion injury, meningitis, migraine and aspirin-dependent anti-thrombosis
  • cerebral ischaemia ischaemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis;
  • the retroviral vector of the present invention may be used to deliver one or more NOI(s) useful in the treatment of disorders listed in WO-A- 98/07859.
  • cytokine and cell proliferation differentiation activity e.g. for treating immune deficiency, including infection with human immune deficiency virus; regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity
  • regulation of haematopoiesis e.g. treatment of myeloid or lymphoid diseases
  • promoting growth of bone, cartilage, tendon, ligament and nerve tissue e.g.
  • follicle-stimulating hormone for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration; inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g. for treating haemophilia and stroke); antiinflammatory activity (for treating e.g. septic shock or Crohn's disease); as antimicrobials; modulators of e.g. metabolism or behaviour; as analgesics; treating specific deficiency disorders; in treatment of e.g. psoriasis, in human or veterinary medicine.
  • the retroviral vector of the present invention may be used to deliver one or more NOI(s) useful in the treatment of disorders listed in WO-A- 98/09985.
  • NOI(s) useful in the treatment of disorders listed in WO-A- 98/09985.
  • macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity i.e.
  • inhibitory effects against a cellular and/or humoral immune response including a response not associated with inflammation; inhibit the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectm, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction and inflammation including arthritis, including rheumatoid arthritis, inflammation associated with hyper sensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomer ulonephritis or other renal and urologic diseases, otitis or other oto-rhin
  • retinitis or cystoid macular oedema retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g.
  • monocyte or leukocyte proliferative diseases e.g. leukaemia
  • monocytes or lymphocytes for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
  • the present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the retroviral vector of the present invention comprising one or more deliverable therapeutic and/or diagnostic NOI(s) or a viral particle produced by or obtained from same.
  • the pharmaceutical composition may be for human or animal usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual.
  • the composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as - or in addition to - the carrier, excipient or diluent any suitable binder (s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
  • the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously.
  • compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • compositions may be adniinistered in the form of tablets or lozenges which can be formulated in a conventional manner.
  • the delivery of one or more therapeutic genes by a vector system according to the invention may be used alone or in combination with other treatments or components of the treatment.
  • Diseases which may be treated include, but are not limited to: cancer, neurological diseases, inherited diseases, heart disease, stroke, arthritis, viral infections and diseases of the immune system.
  • Suitable therapeutic genes include those coding for tumour suppressor proteins, enzymes, pro-drug activating enzymes, immunomodulatory molecules, antibodies, engineered immimoglobulin-like molecules, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, cytokines, chemokines, anti-viral proteins, antisense RNA and ribozymes.
  • a gene encoding a pro-drug activating enzyme is delivered to a tumour using the vector system of the invention and the individual is subsequently treated with an appropriate pro-drug.
  • pro-drugs include etoposide phosphate (used with alkaline phosphatase Senter et al., 1988 Proc. Natl. Acad. Sci. 85: 4842-4846); 5-fluorocytosine (with Cytosine deaminase Mullen et al. 1994 Cancer Res.
  • Doxorubicin-N-p- hydroxyphenoxyacetamide with Penicillin- V-Amidase (Kerr et al. 1990 Cancer Immunol. Immimother. 31 : 202-206); Para-N-bis(2-chloroe thyl) aminobenzoyl glutamate (with Carboxypeptidase G2); Cephalosporin nitrogen mustard carbamates (with b- lactamase); SR4233 (with P450 Reducase); Ganciclovir (with HSV thymidine kinase, Borrelli et al. 1988 Proc . Natl. Acad. Sci.
  • Figure 1 shows representations of MLV-based vector constructs. HIV gag-pol sequences were introduced into the cloning sites of pCNC-MCS to construct pCNC-GPRT, pCNC- SYNGP, and pCNC-GP.
  • Figure 1A illustrates pCNC-MCS.
  • Figure IB illustrates pCNC-GPRT.
  • Figure 1C illustrates pCNC-SYNGP.
  • Figure ID illustrates pCNC-GP.
  • Figure 2 is a table showing a comparison between transfection and retroviral transduction. G418-resistant clones were isolated 2 to 3 weeks after transfection or retroviral transduction, or 293T clones were isolated by limiting dilution after transduction, then screened for HIN p24 CA antigen expression by immxinostaining.
  • Figure 3 shows the results of an immimofluoresence assay for p24 expression in the HeLa clones. All twelve positive clones generated by C ⁇ C- GPRT transduction (designated HeLa C ⁇ C-GPRT clones) showed brighter fluorescence than the rare positive clones generated by transfection of pC ⁇ C-GPRT (designated HeLa TF clones).
  • Figure 4 is a graph illustrating the ability of the cells to package an HIN-1 vector. The ability was assessed by transient transfection of pSI ⁇ -CSGW and pMDG with a weight ratio of 3:1. In the case of the GP+R cells and the SY ⁇ GP cells, Tat and Rev-expressing plasmids were also transfected with a weight ratio of 3:1:1:1 of vector to NSN-G to Tat to Rev plasmids. Titres were determined on 293T cells.
  • Figure 5 shows the results of p24 i munoblot of lysates and supernatants from HeLa, 293T and HT1080 clones. Total protein from 5 x 10 4 cells was used as cells lysates. 2ml culture supernatants were ultracentrifuged and the resulting pellet was used as supernatants.
  • Figure 6 is a graph showing the level of p24 antigen in the culture supernatants from HIV-1 Gag-stable clones. Detection of p24 antigen in the supernatants of Gag-stable clones was performed on serially diluted samples of culture supernatants by p24 ELISA.
  • Figure 7 illustrates HLV-based vector constructs used for the establishment of stable HLV- 1 producer cell lines.
  • Figure 7A illustrates the pH7G vector which expresses Rev.
  • Figure 7B illustrates pHRSLN-CSGW.
  • Figure 7C illustrates pHV.
  • Figure 8 is a table illustrating vector production from retroviral envelope-stable packaging cell lines.
  • the packaging cells were infected with the H7G of HV vector or selected with puromycin after co-transfection of the vector and puromycin-resistance plasmids. Titres were determined on 293T cells.
  • Figure 9 is a table illustrating the level of viral production by STAR cells after prolonged culture.
  • Figure 10 is a table illustrating the level of gag/pol functional transfer, measured by ability to rescue virus from VAT-7 cells which contain pH7G, Tat and ampho envelope. The numbers shown represent titre of rescued virus on 293T cells.
  • Figure 11 shows level of gag sequence transfer to 293T cells measured by nested PCR.
  • Figure 12 shows a gel illustrating incorporation of gammaretrovirus envelopes in HIN-1 vectors. Eight millilitre of supernatants were concentrated by ultracentrifugation and the pellet resuspended in 30 ⁇ l of loading buffer. 15 ⁇ l of each sample was run on 10% (3 upper panels) or 14%) (bottom panel) polyacrylamide gels.
  • Figure 13 is a graph showing titration of HIV-1 vectors on a range of cell lines.
  • HIN-1 vectors pseudotyped with gammaretrovirus envelopes (MLV- A, GALV+, RD+ and RDpro) were harvested in OptiMEM from STAR cells or, in the case of HIV-1 (VSV-G) harvested in OptiMEM during transient virus production.
  • Each pseudotype was titrated onto the human cell lines 293T, TE671, HeLa and HT1080 or the murine cell line ⁇ IH 3T3 in the presence of polybrene (8 ⁇ g/ml).
  • Titre was assayed by FACS 48 hours post infection. Detection limit of 4 X 10 4 iu/ml is indicated by arrows.
  • Figure 14 is a graph showing stability of HIN-1 vectors at 37°C.
  • Vectors were harvested in either OptiMEM or DMEM + 10% FCS.
  • Vector stocks were incubated at 37°C and titrated at different time points.
  • eGFP titre on 293T cells in the presence of 8 ⁇ g/ml polybrene is presented as a percentage of the viral titre before incubation. Values shown are the mean of two experiments and the error bars show the actual data points.
  • Figure 15 shows graphs illustrating resistance of HIV-1 vectors to freeze/thaw cycling. Pseudotyped HIV vectors were frozen and thawed at -80°C and 37°C, respectively, up to three times. Relative eGFP titre to the control tifre before initiating the first cycle on
  • Figure 16 is a graph showing resistance of HIV-1 vectors to human sera.
  • Pseudotyped HIN vectors harvested in either OptiMEM or DMEM + 10% FCS were exposed to human sera.
  • Titre on 293T cells in the presence of 8 ⁇ g/ml polybrene is represented as a percentage of the viral titre after incubation with fresh frozen serum in relation to incubation with corresponding heat inactivated serum. Values shown are the mean of two experiments. In the two experiments viral titre did not vary by greater than 2 fold. Values below 6% of the control titre could not be detected by FACS.
  • Figure 17 is a graph showing the effect of polybrene and spinoculation on HIV-1 vector infection.
  • HLV-l vectors were harvested in OptiMEM.
  • Each pseudotype was tifrated on 293T cells and spun down at 1200g for 2 hours at 25°C or tifrated on 293T in the presence of polybrene (8 ⁇ g/ml) or both. Values of relative titre to control titre in the absence of polybrene and without spinoculation are shown.
  • FIG 18 shows graphs illustrating titration of concentrated HLV-l vectors.
  • HLV-1(MLV- A) Panel A
  • HIV-1 HIV-1
  • OptiMEM OptiMEM
  • OptiMEM concentrated 40 fold by a range of methods; ultracentrifugation at 100,000g and 10,000g, low-speed centrifugation at 3,000g and centrifugal filtration using Centricon-20 filters (lOOkDa filter).
  • Each concentrated stock was diluted in a 2-fold series and titrated onto 293T cells in the presence of 8 ⁇ g/ml polybrene.
  • eGFP transduced cells were counted by FACS .
  • FIG 19 shows graphs illustrating gel filtration analysis of HLV(MLV-A) preparation by centrifugal filtration.
  • HLV-l(MLV-A) pseudotypes were harvested in OptiMEM and subjected to concentration by centrifugal filtration. The resulting concentrated stock was fractionated by Sepharose gel filtration. Aliquots of each fraction were analysed for eGFP transduction (Panel A) and the presence of HLV-l CA and MLV- A Env by Western blot using antibodies against CA and Env gp70 (Panel B).
  • HIV-1 human immunodeficient virus type 1
  • attempts to make stable HIV-1 based vector packaging cells by transfection of plasmids encoding HLV-l gag-pol have resulted in cells which secrete only low levels of p24 antigen (20-80ng/ ml) (2-4) compared to the lOOOng/ml secreted by some HLV-l infected cells lines (5). It has been speculated that this might be due to the cytotoxicity of HLV-l protease (6) and has led to the construction of packaging cell lines in which HIN-1 Gag-Pol expression can be induced (7-10).
  • HIN-1 Gag-Pol expression cassettes using a retroviral vector based on murine leukaemia virus (MLN) allowed stable, long-term, high level (up to 850ng/ ml) expression of HIN-1 Gag.
  • HT1080 or 293T-based packaging cells were constructed expressing codon optimised HIN-1 Gag-Pol (11), HIN-1 Tat and Rev and envelope proteins of C-type retroviruses.
  • Introduction of an HIN-1 vector resulted in producer cells that could make up to 10 7 293T infectious units/ml (20 293T infectious units/ cell/day) for 3 months in culture.
  • HeLa ATCC CCL-2
  • 293T ATCC 293T
  • HT1080 ATCC, CCl-121
  • FCS fetal calf serum
  • Plasmids The HIV packaging ( ⁇ CMVR8.91) and VSV-G (pMDG) plasmids are described in (12).
  • pC ⁇ C-MCS was constructed by replacing the SacII- ⁇ otI short fragment of pC ⁇ CG (13) with a SacII-Xhol- ⁇ otI linker.
  • SacII-Xhol fragment of pCMVR8.9 which contains HIN-1 gag, pol, rev, tat genes and RRE, was introduced into the SacII-Xhol site of pC ⁇ C-MCS to make pC ⁇ C-GPRT.
  • pC ⁇ C-SY ⁇ GP was constructed by introducing the SacII- ⁇ otI fragment of pSY ⁇ GP (11), containing a codon- optimised gag-pol sequence, into the SacII- ⁇ otI site of pC ⁇ C-MCS.
  • an HIN RRE sequence was amplified by PCR using pCMNR8.91 as a template and introduced into the Xhol-Notl site of pCNC-MCS, followed by the introduction of the SacIL- Sail fragment of pCMV8.91 into its SacII-Xhol site.
  • pCNC- TAT and pCNC-REV were constructed by introducing Tat and Rev cDNA from pCMVR8.91 into the SacII-Xhol site of pCNC-MCS.
  • pHRSIN-CSGW is described in (15). Its non-self-inactivating derivative pHV was constructed by introducing the Nrul- Xhol fragment of pHRSIN-CSGW into the Nrul-Sall site of pH7G (11). Retroviral envelope vectors pALF and pG+F were reported (1 ,18).
  • pRDproLF was constructed by replacing the BcII-Apal fragment of pRDLF (16) with the BcII-Apal fragment phCMVRDpro.
  • Transfection and selection Transfection was performed using Lipofectamine (Invitrogen).
  • the pCNC-GPRT and pCNC-SYNGP transfected cells were selected with G418 (lmg/ml) and G418-residant clones were isolated 2 to 3 weeks later.
  • Cells transfected with the envelope plasmids were selected with phleomycin: 30 ⁇ g/ml for pALF, and pRDproLF-fransfected cells and 7 ⁇ g/ml for pG+F-transfected cells. Phleomycin-resistant colonies were isolated after 3 weeks.
  • the vector plasmids were co- transfected with pPUR (Clontech) at a ratio of 20:1. After the selection with 3 ⁇ g/ml of puromycin for 3 weeks, 15 puromycin-stable colonies were isolated and the other resistant colonies (>500) were harvested as bulk populations.
  • the infectious CNC-GPRT, CNC-SYNGP, CNC-GP, CNC-REN and C ⁇ C-TAT MLN virions were produced by transient transfection of 293T cells with a weight ratio of 3:2:1 of vector of packaging of VSV-G plasmids using Lipofectamine (13). Cell supernatants were concentrated by ultracentrifugation (10,000xg, 1.5 hr) and used for transduction of HeLa, HT1080, 293T cells. To establish GPRT or SY ⁇ GP clones, cells were infected with the C ⁇ C-GPRT vector at multiplicity of infection (MOI) of 4 three times, or with the C ⁇ C-SY ⁇ GP vector of MOI of 2 once.
  • MOI multiplicity of infection
  • HeLa or HT1080 cells were selected with lmg/ml G418 for 3 weeks, 293T cells were cloned by limiting dilution, and clones screened for p24 expression.
  • HeLa-GP+R clones HeLa cells were transduced with the C ⁇ C-GP vector at MOI of 4 twice and then selected in G418 for 2 weeks.
  • the G418-resistant cells were further transduced with the CNC-REV vector at MOI of 20 then cloned by limiting dilution.
  • HT- STAR clone (1 in 28) and STAR clone (1 in 34) were selected after the screening for Tat- and Rev-expression by fransfection of pHRSLN-CSGW and pMDG.
  • the VSV-G pseudotyped H7G and HV vectors were produced by transient fransfection of 293T cells with a weight ratio of 3:2:1 of vector to pCMVR8.91 to pMDG plasmids using Lipofectamine.
  • the vector were harvested, passed through a 0.45- ⁇ m filter, and concentrated by ultracentrifugation. The vectors were used to transduce the packaging cell lines to establish HLV vector-producing cell lines.
  • Vector rescue from Gag-Pol-stable clones To assess the ability of the GPRT, GPRT1+ Rl cells to package an HLV-l vector, vector rescue experiments were performed by transient tranfec tion of pSLN-CSGW and pMDG with a weight ratio of 3 : 1. In the case of the GP+R cells and the SYNGP cells, Tat and Rev-expressing plasmids, pCNC-REV and pCNC-TAT were also transfected with a weight ratio of 3:1:1:1 of vector to VSV-G to Tat to Rev plasmids.
  • Virus titration To determine the titres, a total of 2 x 10 5 239T cells per well in 24 well plates were inoculated with serial dilutions of the virus supernatants in the presence of 8u_g/ml polybrene for 6 hours. Numbers of infected cells were determined by measurements of eGFP expression by fluorescence-activated cell sorting (FACS) using a FACScan and CELL QUEST software (Becton Dickinson) at least 48 hours later. Titres for each producer cell line were calculated from the data points where 5-20% of the cell population was eGFP-positive. P24 Immunostaining.
  • FACS fluorescence-activated cell sorting
  • Cells were washed twice in phosphate-buffered saline (PBS), spread on multi-well glass slides and air dried. After fixation with acetone for 20min, the cells were incubated with anti- p24 mouse monoclonal antibody 38:96K (AIDS Reagent MRC Program. 1:200) for 30 min at 37°C, and rinsed twice with PBS before incubating with the secondary antibody, FITC-conjugated goat anti-mouse immunoglobulin, for 30 min at 37°C. Cells were then washed twice with PBS, and observed by confocal microscopy (MRC 1024 [Bio-Rad] equipped with a krypton-argon laser).
  • MRC 1024 [Bio-Rad] equipped with a krypton-argon laser
  • P24 ELISA 1 x 10 6 cells were cultured in a 6 well plate with 2ml OptiMEM (Gibco) for24hr and the serially diluted samples were analyzed for detection of p24 by ELISA using Anti-p24 antibody D7320 (Aalto bioreagents, Dublin), EH12EI-AP (MRC ADP reagents, ADP452) and ⁇ 24 standard (MRC ADP reagents, ADP620).
  • Anti-p24 antibody D7320 Alto bioreagents, Dublin
  • EH12EI-AP MRC ADP reagents, ADP452
  • ⁇ 24 standard MRC ADP reagents, ADP620
  • SynF2 ACGGGGCTCAGACATCGCCGGAACGAC
  • SynR2 AAAGTTGCCGCGCTGCATCATGATGG l ⁇ g cellular DNA was used as approximately 10 5 cell equivalents. 1/20 of the first PCR reaction was used as template for the second round of the nested PCR. Serial dilutions of plasmids pCMVR8.91 and pSYNGP were used to determine sensitivity.
  • the vectors pCNC-GPRT (as shown in Figure IB) and pCNC-SYNGP) as shown in Figure IC) were constructed by inserting HLV-l sequences from pCMVR8.91 (12) or pSYNGP (11), respectively, into the MLV vector - pCNC-MCS, which is shown in Figure 1A.
  • pCNC-GPRT and pCNC-SYNGP were either (a) tranfected directly into HeLa or HT1080 cells, or (b) first packaged into MLV virions using a fransient MLN packaging system (13), which were then used to infect HeLa, HT1080 or 293T cells.
  • Transfected or infected HeLa and HT1080 were selected in G418 for the presence of the neo gene.
  • Infected 293T cells were cloned by limiting dilution as the cells are already G418 resistant. Each clone was then analysed by immunofluorescence for the presence of the HIN-1 p24.
  • Figure 2 shows that infection, rather than transfection, of HeLa cells with either virus generated a higher frequency of clones that expressed HIN-1 p24.
  • Figure 3 shows that results of the imm iinofliirescence assay are given in Figure 3, which show that the level of p24 expression in the two rare positive clones generated by fransfection of HeLa cells was relatively low.
  • the ability of cells to package an HIN-1 vector was assessed by transient transfection of the vector pSI ⁇ -CSGW (15) (shown in Figure 7B) and a vesicular stomatitis virus (NSN)-G protein expression plasmid (12).
  • NSN vesicular stomatitis virus
  • the Tat and Rev-expressing plasmids, pC ⁇ C-REN and pC ⁇ C-TAT were also co- transfected to allow vector expression.
  • Supernatants from the transiently transfected cells were used to infect 293T cells and GFP expression was monitored.
  • Figure 4 shows that additional Rev enhanced vector production and that the GPRT1+R1 293T clone produced the highest titre in this assay of over 10 6 i.uJml. Among the cells expressing SY ⁇ GP, the 293T clones gave the highest titre as shown in Figure 4.
  • Figure 5 shows an immixno blot of lysates and supernatants from the HeLa cells transfected with CNC-GPRT and the HeLa cells infected with CNC-GPRT and CNC- SYNGP. Consistent with vector production, increased Rev expression improved the level of HLV-l Gag expression and secretion by CNC-GPRT.
  • the ratio of Gag in supernatant to that in lysate was lower in HeLa producer cells and that the ratio of precursor Gag to mature p24 is higher in supernatants from HeLa than HT1080 or 293T. These results suggest that HeLa cells are less efficient in virus release and maturation than other cell lines.
  • Figure 6 shows p24 levels in cell supernatants; a number of SYNGP 293T and HT1080 clones produce more than HeLa cells.
  • envelope proteins of MLV and other C-type retroviruses as they are not cytotoxic, can produce relatively high titre pseudotypes of HIN-1 and have been widely used in clinical gene therapy applications.
  • Cells were transfected with the vectors pALF, pRDproLF or pG+F, expressing the envelopes of MLN 4070A (designated Ampho (16)), the feline endogenous virus RD114 with an HIV protease site introduced at the R peptide cleavage site (designated Rdpro), or gibbon ape leukaemia virus (GALV) with an MLV cytoplasmic tail (designated GALV+ (18)).
  • transfected cells were selected in phleomycin and a clone expressing a high level of envelope was chosen (1 clone from 12).
  • Figure 8 shows that the STAR-Ampho cells produced the highest titre of virus, over 10 7 i.u./ml from a bulk population after introduction of the vector genome by infection. The presence of Rev in the vector did not affect titre in the STAR cells, suggesting that the level of Rev in the packaging cell was sufficient (Figure 8).
  • the level of viral production by STAR cells was stable after prolonged culture ( Figure 9) and virus could be concentrated by centrifugation to produce stocks with titres up to 5 x 10 9 i.u.. ml.
  • FIG. 10 shows the result of infecting VAT-7 cells with 2x10 7 iu of transiently or stably produced vectors. Supernatant from the infected VAT-7 cells was taken on the day shown, concentrated and used to infect fresh 293T cells, which were screened for GFP expression.
  • Vector produced transiently with the wild-type HLV Gag-Pol construct pCMNR8.91 showed significant levels of transfer of Gag-Pol function.
  • Vector produced stably by its derivative pC ⁇ C-GPRT expressed in 293GPRT+R1 cells showed a lower level.
  • vector produced transiently by pSYNGP, or stably by its derivative pC ⁇ C-SY ⁇ GP in STAR cells showed only sporadic Gag-Pol function transfer.
  • Gag-Pol sequence transfer after vector infection of 293T cells was also detected by nested PCR ( Figure 11); again wild-type Gag-Pol showed a higher level of transfer and stable producer cell lines showed a lower level.
  • RD+ Env sequence from pRD+ plasmid 17 was introduced into RDL plasmid 16 , resulting RD+L plasmid.
  • STAR RD+ cells were generated by transfecting RD+L plasmid into STAR cells and used to produce an eGFP encoding HLV-l vector, HLV-1(RD+) as previously described.
  • STAR Ampho, STAR RDpro and STAR GALN+ cells producing eGFP encoding HIN-1 vectors, HIN- 1 (MLV- A), HLV- 1 (RDpro) and HIN- 1 (GALN+), respectively were previously described.
  • Viral vector preparation Viruses were harvested from 10cm plates. For virus harvest from STAR cells, 4 x 10 6 cells were plated 24 hours before the start of virus harvest. Virus was harvested in 8ml of either DMEM + 10% FCS, plus penicillin and streptomycin or OptiMEM (GibCoBRL) for 48 hours at 37°C. Viral supernatant was then passed through a 0.45- ⁇ m-pore-size filter.
  • HLV-1(VSV-G) virus was generated by transient transfection of 293T cells with a weight ratio of 3:2:1 of vector (pHV) to packaging (pCMN ⁇ R8.91 12 ) to envelope (pMD-G 20 ) plasmids using Lipofectamine (GibcoBRL) as per the manufacturer's instructions. After washing with OptiMEM, virus was harvested for 48 hours at 37°C in 8ml of either DMEM + 10% FCS, plus penicillin and streptomycin or OptiMEM. Viral supernatant was then passed through a 0.45- ⁇ m- pore-size filter.
  • Viral titre determination 2 x 10 5 cells were inoculated with serial dilutions of viral supernatant. 48 hours after infection, eGFP titres (iu/ ml) were determined by using a fluorescence-activated cell scanner (FACS). Where indicated, titrations were carried out in the presence of 8 ⁇ g/ml polybrene (hexadimethrine bromide (Sigma)) or with spinoculation (l,200g, 2 hours, 25°C) or both.
  • polybrene hexadimethrine bromide (Sigma)
  • spinoculation l,200g, 2 hours, 25°C
  • Virus in 8ml of supernatant was pelleted for analysis by ulfracentrifugation in an SW41 Beckman Rotor (30,000 rpm, 1 h, 4 °C). Pellets were resuspended in 30 ⁇ l of 6x loading buffer diluted in OptiMEM. Samples were boiled for 5 min and frozen at -20°C until ftrrther analysis. Samples were run on 10 or 14% polyacrylamide (SDS) gels. Protein was then transferred onto Hybond ECL nitrocellulose filters (Amersham) using semi-dry transfer apparatus and transfer buffer (39mM glycine, 48mM Tris base, 20% methanol).
  • MLV-A SU was detected with goat polyclonal anti-Rauscher leukemia virus gp70 (Quality Biotech Inc., Camden, ⁇ .J.), diluted 1/1000.
  • RD114 SU was detected with goat polyclonal anti-RD114 gp70 (Quality Biotech Inc., Camden, N.J.), diluted 1/5000.
  • HLV-l CA was detected with a 1:1 mixture of the murine monoclonal antibodies ADP365 and ADP366 (MRCARD) both diluted 1/200.
  • MLV capsid was detected with goat polyclonal anti-Rauscher leukemia virus gp70 (Quality Biotech Inc., Camden, N.J.), diluted 1/1000. Blots were developed with horseradish peroxidase-conjugated anti-immunoglobulin (DAKO), diluted 1/1000, and an enhanced chemiluminescence (ECL) kit (Amersham Life Science). Preparation of human sera. Human peripheral blood was clotted on ice overnight at 4°C. Serum was separated from the clot and aliquoted and frozen at -80°C (fresh serum preparation) until required or heat inactivated at 56°C for 45 minutes and then frozen at - 80°C (heat-inactivated serum preparation).
  • DAKO horseradish peroxidase-conjugated anti-immunoglobulin
  • ECL enhanced chemiluminescence
  • HIN-1 VSV-G
  • gammaretrovirus pseudotypes were harvested in OptiMEM. 10ml of each supernatant was concentrated at 10 5 g using a Beckman L7 ultracentrifuge (SW41 rotor, 35,000 rpm, 1.5 hrs, 4°C) and the pellet resuspended in 250 ⁇ l of OptiMEM. A Beckman L7 ultracentrifuge was also used to concentrate virus at 10 4 g (SW41 rotor, 15,000 rpm, 3 hrs, 4°C). Again the pellet was resuspended in 250 ⁇ l of OptiMEM.
  • the envelope expression plasmids for MLN- A, GALN+, RD+ and RDpro were transfected into STAR cells and clonal cell lines for envelope expression were obtained. These clones were infected with HIN-1 (NSN-G) carrying the vector HN, encoding eGFP. The envelope clones producing highest titre virus were selected. Culture supernatant was harvested and analysed for Env incorporation and infectivity on several cell lines.
  • Figure 12 shows western blotting of pellets from the ultrafugation of STAR cell supernatants. The presence of vector particles was demonstrated for all STAR cell lines, but not for parental 293T cells, by the blot probed with anti-HIN-1 p24.
  • Antibodies raised against the RDl 14 SU recognised the RDl 14 gp70 in the supernatant from STAR cells expressing RD+ or RDpro envelopes ( Figure 1, lanes 5 and 6), although the two cannot be differentiated.
  • the same membrane was probed with polyclonal antibodies raised against an MLN envelope SU. It has been shown that these antibodies strongly recognise the MLN-A SU but show only weak cross-reaction with the GALN SU 36 .
  • HLV-l vectors bearing gammaretrovirus Env had titres in the range of 10 6 -10 7 iu/ml on all human cell lines tested; MLN-A the highest and GALN+ lowest. These tifres were similar to or slightly lower than those of HIN-1 (NSN-G). It should be noted that all supernatants of STAR cell lines had p24 at the range of 450-650 ng/ml (data not shown). This compares to about 100 ng/ml for transiently produced HIN- 1 (VSV-G), indicating less infectivity per vector particles for gammarefroviral pseudotypes than HLV-l (VSV-G).
  • HLV-l did not infect TE671 cells chronically infected with replication competent MLN-A
  • HIN-1(GALN+) did not infect TE671 cells chronically infected with GALV
  • HLV-1(RD+) did not infect TE671 chronically infected with RDl 14 (data not shown). No cross interference was observed.
  • HIN-1 vectors bearing gammaretrovirus Env were examined for stability at 37°C, sensitivity to freeze/thaw cycles and inactivation by human sera.
  • vectors were harvested in either OptiMEM or DMEM + 10% FCS as the absence of FCS in the vector preparation is desirable in many gene therapy applications.
  • HLV-1(MLV-A) and HIN- 1 (RDpro) appeared to be least stable with a half life less than 2 hours, while HIN-1 bearing either the GALN+ or RD+ appeared to be slightly more stable over 2 hours incubation (half life between 2 and 6 hours).
  • HLV-l (VSV-G) virus meanwhile, had lost only up to 40%) of its original titre after 6 hours incubation at 37°C.
  • Virus titration after 24 hours incubation at 37°C showed that HLV-l (VSV-G) tifre has fallen by 90% (data not shown).
  • the half-life of this virus at 37°C was therefore shorter than 24 hours.
  • virus harvested in OptiMEM lost up to 65%> of its original titre, while virus titre in DMEM + 10% FCS appeared to be stable. Moreover, after three cycles virus in OptiMEM lost 90% of its original titre while that in DMEM + 10% FCS lost less than 10%. Thus the condition for freezing HIN- 1 (VSV-G) may need careful optimisation.
  • HIN-l(NSN-G) virus in contrast, appeared to be sensitive to inactivation by fresh human sera. There was no substantial difference in serum sensitivity between vectors with different gammaretrovirus Env in this study. In contrast, we previously reported that replication competent MLN-A was more sensitive than RDl 14 or GALN when produced by galactosyl( ⁇ l-3)galactosyl ( ⁇ Gal) negative human cells 37 . HIN- 1 (VSV-G) was more sensitive to inactivation in fresh human serum than HLV- 1 vectors pseudotyped with gammarefroviral Env.
  • Vector concentration before transduction or modification of the in vitro or ex vivo transduction procedure to augment virus binding is commonly performed to enhance titres of retro/ lentivirus vector harvests.
  • polybrene The enhancement effect of polybrene on different cell lines (the human cell lines 293T, TE671, HeLa and HT1080 and the murine cell line ⁇ LH 3T3) was also investigated (data not shown). Polybrene did not raise HIN-1 (NSN-G) titre by greater than 2x on any cell line tested. The effect of polybrene on gammarefrovirus pseudotype tifre was most notable on 293T or TE671 cells (8x-16x), while its effect is less dramatic on HeLa or HT1080 cells (2x-4x). The infection enhancement of polybrene on ⁇ LH 3T3 cells was negligible.
  • Vectors bearing MLV-A, GALV+ and RDpro Env as well as VSV- G were harvested in OptiMEM and concentrated 40-fold in volume by four conditions - centrifugal filtration using a filter with a cut-off of lOOkDa or centrifugation at three different speeds: 100,000g for 1.5 h; 10,000g for 1.5 h; 3,000g for 7 h.
  • % eGFP transduced cells was measured in 2-fold serial dilutions on 293T cells in the presence of polybrene.
  • Figure 18 shows examples of the titration curves for HLV-1(MLV-A) and HLV-1(VSV-G).
  • eGFP titre and % recovery of each vector preparation after the concentration procedure was estimated using % transduction data for dilutions in linear range of titration and shown in Table 1.
  • Virus produced was concentrated by concentrated 40 fold by centrifugation at 100,000g, 10,000g and 3,000 g and centrifugal filtration with lOOkDa cutoff (a). Virus was titrated on 293T cells with 8 ⁇ g/ml polybrene and eGFP expression assayed by FACS. b, titre is expressed as 10 7 iu/ml; c, % recovery (100 X tifre after concentration) / (40 X unconcentrated titre) shown in parentheses.
  • HIN-1(VSV-G) may be more stable than HIN-1 vectors with gammaretrovirus Env when concentrated at higher ultracentrifugation speeds or by centrifugal filtration. Also, in an extension of this study, it was noted that greater concentration, up to 100-fold, could be achieved with high yield by one step centrifugation at either 10,000g or 3,000g, resulting in the titre of 2.0 X 10 8 - 1.5 XI 0 9 iu/ml (data not shown).
  • HIN-1 NNSN-G
  • gammaretroviral pseudotypes could achieve 100% infection on 293T cells only when viral supernatant was subjected to milder conditions of centrifugation (Fig. 18Aa for HIV-1 (MLV-A), data not shown for HLV-1(GALV+) and HLV-l (RDpro)).
  • Fig. 18Aa for HIV-1 (MLV-A)
  • RDpro HLV-l
  • infection of gammaretrovirus pseudotypes was inhibited when virus particles were concentrated by either ultracentrifugation at a speed of 100,000g or centrifugal filtration. It has been previously reported that an MLV vector packaging cell line, FLYA13 16 , expels large quantities of MLV-A Env free from vector particles into the culture media.
  • fractions 9-22 were plated on 293T cells together with a fixed dose of HIN- 1(MLN-A) and HIN-l(RDpro) (Fig 19C). Without inhibition these vector doses resulted in 40-50 % > eGFP transduction. Substantial reduction of eGFP fransduction by HIN- 1 (MLV-A), but not HLV-l (RDpro), was observed for fractions 10-13, which contain most MLV-A Env. This indicates that the non-virion associated envelope present in fractions 10-13 specifically inhibited HLV-l (MLV-A) infection, presumably competing out vector particles for cellular receptors.
  • HIN vectors produced from STAR cells and pseudotyped with gammaretroviral Env can infect certain types of human cells as efficiently as NSN-G pseudotyped HIN-1 vectors. They are more stable in fresh human serum and can be more effectively used with polybrene and spinoculation in ex vivo application than HIN- 1 (VSV-G). They are resistant to freeze/thaw but their decay rate at 37 °C is faster than that of HLV-l (VSV-G). This is potentially advantageous where local gene transfer without unwanted vector spread is required. Soluble Env in vector preparation is preferably carried out using vector centrifugation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Virology (AREA)
  • Pulmonology (AREA)
  • Communicable Diseases (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Oncology (AREA)
  • Cardiology (AREA)
  • Biotechnology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pain & Pain Management (AREA)
  • Diabetes (AREA)
  • Molecular Biology (AREA)
  • Dermatology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
PCT/GB2003/003791 2002-09-03 2003-09-02 Retroviral vector and stable packaging cell lines WO2004022761A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2004533613A JP4992032B2 (ja) 2002-09-03 2003-09-02 レトロウイルスベクター
EP03793864.4A EP1534847B1 (en) 2002-09-03 2003-09-02 Retroviral vector and stable packaging cell lines
AU2003260769A AU2003260769A1 (en) 2002-09-03 2003-09-02 Retroviral vector and stable packaging cell lines

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0220467.5 2002-09-03
GBGB0220467.5A GB0220467D0 (en) 2002-09-03 2002-09-03 Composition
US41767302P 2002-10-09 2002-10-09
US60/417,673 2002-10-09

Publications (1)

Publication Number Publication Date
WO2004022761A1 true WO2004022761A1 (en) 2004-03-18

Family

ID=31980010

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2003/003791 WO2004022761A1 (en) 2002-09-03 2003-09-02 Retroviral vector and stable packaging cell lines

Country Status (4)

Country Link
EP (1) EP1534847B1 (pt-PT)
JP (1) JP4992032B2 (pt-PT)
AU (1) AU2003260769A1 (pt-PT)
WO (1) WO2004022761A1 (pt-PT)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9273288B2 (en) 2006-02-27 2016-03-01 The Board Of Regents Of The University Of Texas System Pseudoinfectious flavivirus and uses thereof
WO2016189326A1 (en) * 2015-05-27 2016-12-01 Oxford Genetics Ltd Cell lines
WO2017091786A1 (en) 2015-11-23 2017-06-01 Novartis Ag Optimized lentiviral transfer vectors and uses thereof
EP3192874A1 (en) 2008-06-18 2017-07-19 Oxford BioMedica (UK) Limited Virus purification
US9796987B2 (en) 2007-12-11 2017-10-24 The University Of North Carolina At Chapel Hill Polypurine tract modified retroviral vectors
CN109804089A (zh) * 2016-07-29 2019-05-24 朱诺治疗学股份有限公司 用于评估复制型病毒存在或不存在的方法
EP3502260A1 (en) 2017-12-22 2019-06-26 Oxford BioMedica (UK) Limited Retroviral vector
WO2019229109A1 (en) 2018-05-30 2019-12-05 Glycostem Therapeutics B.V. Car nk cells
WO2021160993A1 (en) 2020-02-13 2021-08-19 Oxford Biomedica (Uk) Limited Production of lentiviral vectors
WO2021181108A1 (en) 2020-03-13 2021-09-16 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2021222222A1 (en) 2020-04-27 2021-11-04 Mccray Jr Paul B Compositions and methods for the treatment of cystic fibrosis
WO2021229242A1 (en) 2020-05-15 2021-11-18 Oxford Biomedica (Uk) Limited Viral vector production
GB202114532D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral Vectors
GB202114530D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Retroviral vectors
GB202114529D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral vectors
WO2022101617A1 (en) 2020-11-10 2022-05-19 Oxford Biomedica (Uk) Limited Preparation of a solution of polymer/nucleic acid complexes
WO2023062363A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023062359A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Novel viral regulatory elements
WO2023105235A1 (en) 2021-12-09 2023-06-15 Oxford Biomedica (Uk) Limited Purification method of viral vectors
WO2024038266A1 (en) 2022-08-16 2024-02-22 Oxford Biomedica (Uk) Limited Envelope proteins
WO2024259299A1 (en) 2023-06-14 2024-12-19 The Broad Institute, Inc. Compositions and methods for identification of vhh antibodies that bind a target antigen
US12264371B2 (en) 2018-01-31 2025-04-01 Juno Therapeutics, Inc. Methods and reagents for assessing the presence or absence of replication competent virus

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010045002A2 (en) * 2008-09-26 2010-04-22 Tocagen Inc. Gene therapy vectors and cytosine deaminases
JP6419706B2 (ja) 2012-10-25 2018-11-07 トカジェン インコーポレーテッド ミニプロモーターカセットを含むレトロウイルスベクター

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032646A1 (en) * 1997-12-22 1999-07-01 Oxford Biomedica (Uk) Limited Equine infectious anaemia virus (eiav) based

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5716826A (en) * 1988-03-21 1998-02-10 Chiron Viagene, Inc. Recombinant retroviruses
DK0975783T3 (da) * 1997-02-27 2002-01-28 Bundesrepublik Deutschland Let Retrovirusvektorer, fremgangsmåde til fremstilling heraf samt deres anvendelse til genoverføring til CD4-positive celler
US20020123471A1 (en) * 1997-03-06 2002-09-05 Klaus Uberla Lentivirus based vector and vector system
DE19752855C2 (de) * 1997-11-28 2003-04-03 Bundesrepublik Deutschland Let Retrovirale Pseudotyp-Vektoren mit modifizierten Oberflächen-Hüllproteinen und Verpackungszelle zu ihrer Herstellung für den selektiven Gentransfer
AU6149099A (en) * 1998-09-22 2000-04-10 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Replication deficient retroviral vector system and methods of using

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032646A1 (en) * 1997-12-22 1999-07-01 Oxford Biomedica (Uk) Limited Equine infectious anaemia virus (eiav) based

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DEMAISON CHRISTOPHE ET AL: "High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter", HUMAN GENE THERAPY, vol. 13, no. 7, 1 May 2002 (2002-05-01), pages 803 - 813, XP002263326, ISSN: 1043-0342 *
FARSON DEBORAH ET AL: "A new-generation stable inducible packaging cell line for lentiviral vectors", HUMAN GENE THERAPY, vol. 12, no. 8, 20 May 2001 (2001-05-20), pages 981 - 997, XP002263325, ISSN: 1043-0342 *
IKEDA YASUHIRO ET AL: "Continuous high-titer HIV-1 vector production.", NATURE BIOTECHNOLOGY, vol. 21, no. 5, May 2003 (2003-05-01), pages 569 - 572, XP002263324, ISSN: 1087-0156 (ISSN print) *
KUNG SAM K P ET AL: "A murine leukemia virus (MuLV) long terminal repeat derived from rhesus macaques in the context of a lentivirus vector and MuLV gag sequence results in high-level gene expression in human T lymphocytes", JOURNAL OF VIROLOGY, vol. 74, no. 8, April 2000 (2000-04-01), pages 3668 - 3681, XP002263327, ISSN: 0022-538X *
OLSEN J C: "EIAV, CAEV AND OTHER LENTIVIRUS VECTOR SYSTEMS", SOMATIC CELL AND MOLECULAR GENETICS, NEW YORK, NY, US, vol. 26, no. 1-6, November 2001 (2001-11-01), pages 131 - 145, XP009009363 *

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9273288B2 (en) 2006-02-27 2016-03-01 The Board Of Regents Of The University Of Texas System Pseudoinfectious flavivirus and uses thereof
US9796987B2 (en) 2007-12-11 2017-10-24 The University Of North Carolina At Chapel Hill Polypurine tract modified retroviral vectors
US10017785B2 (en) 2007-12-11 2018-07-10 The University Of North Carolina At Chapel Hill Polypurine tract modified retroviral vectors
EP3192874A1 (en) 2008-06-18 2017-07-19 Oxford BioMedica (UK) Limited Virus purification
WO2016189326A1 (en) * 2015-05-27 2016-12-01 Oxford Genetics Ltd Cell lines
GB2554316A (en) * 2015-05-27 2018-03-28 Oxford Genetics Ltd Cell Lines
WO2017091786A1 (en) 2015-11-23 2017-06-01 Novartis Ag Optimized lentiviral transfer vectors and uses thereof
EP4458957A2 (en) 2015-11-23 2024-11-06 Novartis AG Optimized lentiviral transfer vectors and uses thereof
CN109804089A (zh) * 2016-07-29 2019-05-24 朱诺治疗学股份有限公司 用于评估复制型病毒存在或不存在的方法
EP3633040A1 (en) 2017-12-22 2020-04-08 Oxford BioMedica (UK) Limited Retroviral vector
EP3696272A1 (en) 2017-12-22 2020-08-19 Oxford BioMedica (UK) Limited Retroviral vector
EP3502260A1 (en) 2017-12-22 2019-06-26 Oxford BioMedica (UK) Limited Retroviral vector
US12264371B2 (en) 2018-01-31 2025-04-01 Juno Therapeutics, Inc. Methods and reagents for assessing the presence or absence of replication competent virus
WO2019229109A1 (en) 2018-05-30 2019-12-05 Glycostem Therapeutics B.V. Car nk cells
WO2021160993A1 (en) 2020-02-13 2021-08-19 Oxford Biomedica (Uk) Limited Production of lentiviral vectors
WO2021181108A1 (en) 2020-03-13 2021-09-16 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2021222222A1 (en) 2020-04-27 2021-11-04 Mccray Jr Paul B Compositions and methods for the treatment of cystic fibrosis
WO2021229242A1 (en) 2020-05-15 2021-11-18 Oxford Biomedica (Uk) Limited Viral vector production
EP4335458A2 (en) 2020-11-10 2024-03-13 Oxford BioMedica (UK) Limited Preparation of a solution of polymer/nucleic acid complexes
WO2022101617A1 (en) 2020-11-10 2022-05-19 Oxford Biomedica (Uk) Limited Preparation of a solution of polymer/nucleic acid complexes
EP4335457A2 (en) 2020-11-10 2024-03-13 Oxford BioMedica (UK) Limited Preparation of a solution of polymer/nucleic acid complexes
GB202114532D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral Vectors
WO2023062366A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Retroviral vectors
WO2023062367A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023062359A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Novel viral regulatory elements
WO2023062363A1 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
WO2023062365A2 (en) 2021-10-12 2023-04-20 Oxford Biomedica (Uk) Limited Lentiviral vectors
GB202114529D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Lentiviral vectors
GB202114530D0 (en) 2021-10-12 2021-11-24 Oxford Biomedica Ltd Retroviral vectors
EP4530355A2 (en) 2021-10-12 2025-04-02 Oxford BioMedica (UK) Limited Lentiviral vectors
WO2023105235A1 (en) 2021-12-09 2023-06-15 Oxford Biomedica (Uk) Limited Purification method of viral vectors
WO2024038266A1 (en) 2022-08-16 2024-02-22 Oxford Biomedica (Uk) Limited Envelope proteins
WO2024259299A1 (en) 2023-06-14 2024-12-19 The Broad Institute, Inc. Compositions and methods for identification of vhh antibodies that bind a target antigen

Also Published As

Publication number Publication date
EP1534847B1 (en) 2015-10-28
EP1534847A1 (en) 2005-06-01
JP2005537021A (ja) 2005-12-08
JP4992032B2 (ja) 2012-08-08
AU2003260769A1 (en) 2004-03-29

Similar Documents

Publication Publication Date Title
US7585676B2 (en) Retroviral vector
EP1534847B1 (en) Retroviral vector and stable packaging cell lines
US7419829B2 (en) Vector system
US20060281180A1 (en) Vectors
EP1080216B1 (en) Retroviral delivery system
US6818209B1 (en) Retroviral delivery system
AU1395400A (en) Vector
US9932597B2 (en) Vectors for transgene expression
EP1478759B1 (en) Retroviral vectors pseudotyped with influenza virus hemagglutinin and influenza m2 potein for gene delivery
JP2002539797A (ja) 機能的および非機能的なスプライス供与部位ならびにスプライス受容部位を含むレトロウイルスベクター
US20030143205A1 (en) Alphavirus expression systems
AU2001248619B2 (en) Method
GB2337520A (en) Retroviral delivery system
GB2356200A (en) Hybrid viral vectors
HK1056576B (en) Pseudotype retroviral vectors containing membrane proteins having hemagglutinin activity
HK1056576A1 (zh) 含有血凝素活性膜蛋白質的假型逆轉錄病毒載體

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003793864

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2004533613

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2003793864

Country of ref document: EP