WO2003082200A2 - Potent oncolytic herpes simplex virus for cancer therapy - Google Patents

Potent oncolytic herpes simplex virus for cancer therapy Download PDF

Info

Publication number
WO2003082200A2
WO2003082200A2 PCT/US2003/009287 US0309287W WO03082200A2 WO 2003082200 A2 WO2003082200 A2 WO 2003082200A2 US 0309287 W US0309287 W US 0309287W WO 03082200 A2 WO03082200 A2 WO 03082200A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
vector
cells
cell membrane
membrane fusion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/009287
Other languages
English (en)
French (fr)
Other versions
WO2003082200A3 (en
Inventor
Xiaoliu Zhang
Xinping Fu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Baylor College of Medicine
Original Assignee
Baylor College of Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Baylor College of Medicine filed Critical Baylor College of Medicine
Priority to AU2003258060A priority Critical patent/AU2003258060B2/en
Priority to CA002479763A priority patent/CA2479763A1/en
Priority to JP2003579743A priority patent/JP2005521398A/ja
Priority to EP03745618A priority patent/EP1494613A4/en
Publication of WO2003082200A2 publication Critical patent/WO2003082200A2/en
Anticipated expiration legal-status Critical
Publication of WO2003082200A3 publication Critical patent/WO2003082200A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/76Viruses; Subviral particles; Bacteriophages
    • A61K35/763Herpes virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16632Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/16011Herpesviridae
    • C12N2710/16611Simplexvirus, e.g. human herpesvirus 1, 2
    • C12N2710/16641Use of virus, viral particle or viral elements as a vector
    • C12N2710/16643Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/10022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/20Pseudochromosomes, minichrosomosomes
    • C12N2800/204Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/30Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/60Vector systems having a special element relevant for transcription from viruses

Definitions

  • the present invention is directed to the fields of virology, cancer biology, and medicine. Specifically, the present invention regards compositions and methods directed to an oncolytic vector utilizing viral infection and cell membrane fusion mechanisms. More specifically, a Herpes Simplex Virus (HSV) vector comprising multiple fusogenic mechanisms is utilized, and, in some embodiments, further comprises a strict late viral promoter.
  • HSV Herpes Simplex Virus
  • HSV Oncolytic herpes simplex virus
  • FMGs envelop fusogenic membrane glycoproteins
  • GLV.fus gibbon ape leukemia virus envelope glycoprotein
  • This truncated form of FMG lacks the 16 amino acid R-peptide of the wild-type protein, which normally serves to restrict fusion of the envelope until it is cleaved during viral infection (Januszeski et al, 1997).
  • CMN enhancer sequences can substantially increase the promoter activity (Latham et al, 2000). However, this action also causes the original promoters to lose their tissue-specificity. Another potential concern for these tissue-specific promoters is that they also intend to lose their tissue specificity once they are cloned into viral vectors (Babiss et al, 1987).
  • HSN-1 Like many D ⁇ A viruses, the transcriptional program of HSN-1 is a regulated cascade in which early and late phases of gene expression are separated by viral D ⁇ A synthesis (Wagner et al, 1995). The early genes are transcribed prior to viral D ⁇ A replication, while late genes are expressed at high levels only after viral D ⁇ A replication has taken place. Late transcripts can be further categorized as either leaky-late, which are readily detectable prior to the onset of viral genome replication, or strict late that are only reliably detectable after the onset of viral D ⁇ A replication (Holland et al, 1980; Johnson and Everett, 1986; Flanagan et al, 1991).
  • the present invention in some embodiments uses a strict late viral promoter (e.g., the promoter of the UL38 gene of HSV) to selectively express a therapeutic nucleic acid sequence (e.g., GALV.fus) in tumor tissues.
  • a strict late viral promoter e.g., the promoter of the UL38 gene of HSV
  • a therapeutic nucleic acid sequence e.g., GALV.fus
  • WO 01/45737 is directed to a mutant human herpes simplex virus lacking a functionally active wild-type glycoprotein C polypeptide encoding UL44 and preferably oncolytic to a neoplasm. J-n preferred embodiments, the virus is deficient in the viral particle attachment to a cell susceptible to its effects or in attachment to the cell surface through a receptor.
  • WO 98/40492 addresses a nucleic acid vector for therapy of a malignant disease wherein the vector directs expression of a syncytium-inducing polypeptide on a eukaryotic cell surface.
  • the syncytium-inducing polypeptide is a viral membrane glycoprotein
  • the nucleic acid vector is a defective HSV.
  • the present invention addresses a deficiency in the art by providing a conditionally replicating (oncolytic) HSV containing different membrane fusion mechanisms. These include selection of fusogenic oncolytic HSV through random mutagenesis of the virus and insertion of fusogenic glycoproteins into the oncolytic virus.
  • the antitumor activity from the present invention comes from two completely different but complementary mechanisms (direct viral oncolysis from a conditionally replicating viral vector and cell membrane fusion), wherein, preferably, the vector is non-defective.
  • Such a combined approach can provide many advantages over the embodiments in WO 98/40492 at treating malignant diseases.
  • the combination of membrane fusion activity with a conditionally replicating viral vector generates a syngeneic antitumor effect, as the syncytia formation from membrane fusion can facilitate the spread of oncolytic virus in the tumor tissues. This should also reduce the occurrence of virus- resistant tumor cells, because those cells that become resistant to one mechanism (e.g.
  • oncolytic virus infection/replication may be indirectly destroyed by the other tumor-destroying mechanism (e.g. syncytial formation). More importantly, having two or more mechanisms to provide cell membrane fusion capacity will render the composition effective for different populations of cells, such as, for example, those having different types of viral attachment receptors. Finally, the present invention also provides a way for selective expression of the fusion protein in tumor cells, therefore directly increasing the clinical safety of the therapeutic approach. Uncontrolled expression of the fusion peptide, as embodied in WO 98/40492, would potentially cause widespread damage to normal tissues in patients.
  • the present invention addresses a long-felt need in the art by providing a potent oncolytic HSV for therapy of undesirable cells, such as malignant cells, h preferred embodiments, the conditionally replicating HSV comprises at least two mechanisms for generating cell membrane fusion to rid a culture, tissue or organism of at least some undesirable cells, to inhibit proliferation of at least some undesirable cells, to prevent proliferation of at least some desirable cells, or a combination thereof.
  • the vector is generated by one of the following procedures: 1) screening for syncytial phenotype from any vector, such as a well-established oncolytic HSV, following random mutagenesis (as described, for example, for the creation of Fu-10 (Fu and Zhang, 2002)); 2) insertion of a nucleic acid sequence encoding a gene product comprising fusogenic properties into the vector, such as the nucleic acid sequence encoding the hyperfusogenic membrane glycoprotein of gibbon ape leukemia virus (GALV.fus) into the genome of an oncolytic HSV (such as, for the creation of Synco-2 (Fu et al., 2002)); and 3) incorporation of both of these two membrane fusion mechanisms into a single oncolytic HSV (such as, for example, for the generation of Synco-2D).
  • the fusogenic oncolytic HSVs showed a dramatically enhanced antitumor activity when compared with the non- fusogenic virus.
  • an HSV is rendered fusogenic by generating mutations or other manipulations of the virus to attain that function.
  • it is engineered to comprise a nucleic acid sequence encoding a fusogenic polypeptide, such as GALV.fus, and/or to engineer a characteristic, such as a mutation that confers fusogenic properties.
  • expression of a nucleic acid sequence, such as a GALV.fus, in a tumor-specific manner is useful.
  • the tumor-specific expression is tlirough a strictly late viral promoter whose activity is dependent on the ability of the oncolytic virus to replicate in tumor cells.
  • any nucleic acid sequence of the present invention may be regulated by a strictly late viral promoter.
  • the construction of such oncolytic HSVs through an enforced ligation strategy is obtained, and in vitro characterization and in vivo evaluation of these viruses in xenografted human tumor is described.
  • the transcriptional regulatory elements of strict late genes is useful as strong and tumor-specific promoters when utilized with an oncolytic HSV.
  • a strict late viral promoter is extremely active in the tumor tissue where the oncolytic virus can fully replicate but is silent in non-dividing or post-mitotic normal cells since viral replication would be limited.
  • an oncolytic HSV that contains the secreted form of alkaline phosphatase gene (SEAP) driven by the promoter of UL38, a well-characterized strict late gene of HSV (Goodart et al, 1992; Guzowski and Wagner, 1993; Guzowski et al, 1994).
  • SEAP alkaline phosphatase gene
  • This promoter has very low activity in non-dividing cells.
  • its activity is dramatically increased to a level equivalent to that of the CMV-P.
  • In vivo administration of an oncolytic HSV containing this promoter cassette also demonstrated strong tumor-selective expression property.
  • a strict late viral promoter in an oncolytic HSV can function as a strong tumor-selective promoter.
  • a strict late viral promoter is used in the context of an oncolytic virus as a tumor-specific promoter.
  • the virus could be any kind of virus that can be developed for oncolysis, including retrovirus, adenovirus, or adeno-associated virus.
  • composition comprising a cell membrane fusion-generating Herpes Simplex Virus vector comprising at least one additional cell membrane fusion-generating mechanism.
  • the HSV vector is conditionally replicating.
  • the conditionally replicating is defined as the vector comprising a strict late viral promoter.
  • the cell membrane fusion-generating vector is generated by mutagenesis of a non-cell membrane fusion- generating vector.
  • the additional cell membrane fusion mechanism comprises a nucleic acid sequence in the HSV vector that encodes a fusogenic polypeptide.
  • the fusogenic polypeptide is further defined as a membrane glycoprotein.
  • the membrane glycoprotein is paramyxovirus F protein, HIV gpl60 protein, SIN gpl60 protein, retroviral Env protein, Ebola virus Gp, or the influenza virus haemagglutinin.
  • the glycoprotein is a membrane glycoprotein from gibbon ape leukemia virus (GALV).
  • the glycoprotein is a C-terminally truncated form of the gibbon ape leukemia virus envelope glycoprotein (GALV.fus).
  • the expression of the nucleic acid sequence is controlled by a strict late viral promoter.
  • the strict late viral promoter is the promoter of UL38 or Us 11 of HSV.
  • a method of generating fusion between a first cell and a second cell comprising the step of introducing' to the first cell a cell membrane fusion-generating Herpes Simplex Virus vector comprising at least one additional cell membrane fusion-generating mechanism, wherem following the introduction step the cell membrane of the first cell fuses with the cell membrane of the second cell.
  • the first cell, second cell, or both first and second cells are malignant cells
  • the step is repeated with a plurality of cells
  • the HSV vector is conditionally replicating
  • the additional cell membrane fusion mechanism comprises a nucleic acid sequence encoding a fusogenic polypeptide.
  • the expression of the nucleic acid sequence is regulated by a strict late viral promoter.
  • the strict late viral promoter is the promoter of UL38 or Us 11 of HSV.
  • a method of destroying a malignant cell comprising the step of introducing to the cell a cell membrane fusion-generating Herpes Simplex Virus vector comprising at least one additional cell membrane fusion-generating mechanism, wherein following said introduction the membrane of the malignant cell fuses with another cell membrane.
  • the malignant cell is of human origin, h a specific embodiment, the introduction step is further defmed as administering the vector to a human at about 1 x 10 9 plaque forming units (pfu).
  • the method further comprises administrating an additional cancer therapy to the human.
  • the additional cancer therapy is chemotherapy, radiation, surgery, immunotherapy, gene therapy, or a combination thereof.
  • composition comprising an oncolytic virus, wherem the virus comprises a strict late viral promoter.
  • virus is further defined as being tumor-specific.
  • compositions comprising a cell membrane fusion-generating He ⁇ es Simplex Virus vector, said vector including at least one additional cell membrane fusion-generating component.
  • the HSV vector is conditionally replicating, such as when the vector comprises a strict late viral promoter.
  • the cell membrane fusion-generating vector may be a non-cell membrane fusion-generating vector that further comprises a mutation.
  • the additional cell membrane fusion component comprises a nucleic acid sequence in the HSV vector that encodes a fusogenic polypeptide, which, in some embodiments, is further defined as a membrane glycoprotein.
  • the membrane glycoprotein may be paramyxo virus F protein, HIV gpl60 protein, SW gpl ⁇ O protein, retroviral Env protein, Ebola virus Gp, or the influenza virus haemagglutinin.
  • the glycoprotein is a membrane glycoprotein from gibbon ape leukemia virus (GALV) or is a C- terminally truncated form of the gibbon ape leukemia virus envelope glycoprotein (GALV.fus).
  • the expression of the nucleic acid sequence may be controlled by a strict late viral promoter, such as the promoter of UL38 or Us 11 of HSV.
  • compositions described herein further comprise a pharmaceutically acceptable excipient.
  • a method of generating fusion between a first cell and a second cell comprising the step of fusing the second cell membrane with the first cell membrane by introducing to the first cell a cell membrane fusion-generating Herpes Simplex Virus vector comprising at least one additional cell membrane fusion-generating component.
  • the first cell, second cell, or both first and second cells are malignant cells, such as liver cancer malignant cells, breast cancer malignant cells, ovarian cancer malignant cell, prostate cancer malignant cells, and/or lung cancer malignant cells, h specific embodiments, a step of the method is repeated with a plurality of cells.
  • the HSV vector may be conditionally replicating.
  • the additional cell membrane fusion mechanism may comprise a nucleic acid sequence encoding a fusogenic polypeptide.
  • the expression of the nucleic acid sequence is regulated by a strict late viral promoter, such as the promoter of UL38 or Us 11 of HSV.
  • a method of destroying a malignant cell comprising the step of introducing to the cell a cell membrane fusion-generating Herpes Simplex Virus vector comprising at least one additional cell membrane fusion-generating mechanism, wherein following said introduction the membrane of the malignant cell fuses with another cell membrane.
  • the malignant cell is of human origin.
  • the introduction step may be further defined as administering the vector to a human at about 1 x 10 9 plaque forming units (pfu), and in some embodiments the method further comprises administrating an additional cancer therapy to the human, wherem the additional cancer therapy is chemotherapy, radiation, surgery, immunotherapy, gene therapy, or a combination thereof.
  • there is a composition comprising an oncolytic virus, wherein the virus comprises a strict late viral promoter.
  • the virus may be further defined as being tumor-specific.
  • a method of generating a cell membrane fusion-generating Herpes Simplex Virus vector comprising the steps of introducing a mutation to a non-cell membrane fusion-generating Herpes Simplex Virus vector; and incorporating into the vector a nucleic acid sequence encoding a cell membrane fusion-generating polypeptide.
  • composition comprising a Herpes Simplex Virus vector comprising a mutation that renders the vector a cell membrane fusion-generating vector; and a nucleic acid sequence encoding GALV.fus.
  • a method of destroying a malignant cell comprising introducing to said cell a composition comprising an oncolytic virus, wherein the virus comprises a strict late viral promoter.
  • compositions comprising a vector comprising a first cell membrane fusion-generating activity; and a second cell membrane fusion-generating activity.
  • the vector may be a Herpes Simplex Virus vector, and it may be conditionally replicating, such as being further defined as the vector comprising a strict late viral promoter.
  • the first cell membrane fusion-generating activity, the second cell membrane fusion-generating activity, or both comprise a mutation, said mutation conferring said cell membrane fusion-generating activity to the vector or a gene product encoded thereby.
  • the first cell membrane fusion-generating activity, the second cell membrane fusion-generating activity, or both comprise a nucleic acid sequence that encodes a fusogenic polypeptide, such as one that is further defmed as a membrane glycoprotein, such as paramyxovirus F protein, HIV gpl60 protein, STV gpl60 protein, retroviral Env protein, Ebola virus Gp, or the influenza virus haemagglutinin.
  • the glycoprotein may be a membrane glycoprotein from gibbon ape leukemia virus (GALV) or a C-terminally truncated form of the gibbon ape leukemia virus envelope glycoprotein (GALV.fus).
  • the expression of the nucleic acid sequence is controlled by a strict late viral promoter, in some embodiments, such as the strict late viral promoter is the promoter of UL38 or Us 11 of HSV.
  • the composition further comprises a pharmaceutically acceptable excipient.
  • a method of generating fusion between a first cell and a second cell comprising the step of fusing the second cell membrane with the first cell membrane by introducing to the first cell a vector comprising a first cell membrane fusion-generating activity and a second cell membrane fusion-generating activity.
  • the first cell, second cell, or both first and second cells may be malignant cells, such as in a solid tumor and/or such as in a human.
  • the introducing step may be further defined as delivering the vector to the human, such as systemically delivering the vector to the human, such as intravenously delivering the vector to the human.
  • the step may be repeated with a plurality of cells.
  • the vector may be a conditionally replicating Herpes Simplex Virus vector.
  • the first cell membrane fusion-generating activity, the second cell membrane fusion-generating activity, or both comprise a mutation, said mutation conferring said cell membrane fusion-generating activity to the vector or a gene product encoded thereby.
  • the first cell membrane fusion-generating activity, the second cell membrane fusion-generating activity, or both comprise a nucleic acid sequence that encodes a fusogenic polypeptide.
  • the expression of the nucleic acid sequence may be regulated by a strict late viral promoter, such as the promoter of UL38 or Usl 1 of HSV.
  • the method further comprises the step of providing enhanced tumor antigen presentation compared to in the absence of said vector, and the enhanced tumor antigen presentation provides an improved antitumor immunity compared to in the absence of said enhanced tumor antigen presentation.
  • a method of destroying a malignant cell comprising the step of introducing to the cell a vector comprising a first cell membrane fusion-generating activity; and a second cell membrane fusion-generating activity, wherein following said introduction the membrane of the malignant cell fuses with another cell membrane.
  • the malignant cell is in a human and/or the introduction step is further defined as administering at least about 1 x 10 9 plaque forming units (pfu) of the vector to the human.
  • the method may further comprise administering an additional cancer therapy to the human, such as chemotherapy, radiation, surgery, immunotherapy, gene therapy, or a combination thereof.
  • the method may further comprise the step of providing enhanced tumor antigen presentation compared to in the absence of said vector, such as wherein the enhanced tumor antigen presentation provides an improved antitumor immunity compared to in the absence of said enhanced tumor antigen presentation.
  • composition comprising an oncolytic virus, wherein the virus comprises a strict late viral promoter, and the virus may be further defmed as being tumor-specific.
  • a method of generating a cell membrane fusion-generating He ⁇ es Simplex Virus vector comprising the steps of introducing a mutation to a non-cell membrane fusion-generating He ⁇ es Simplex Virus vector, said mutation conferring cell-membrane fusion-generating activity to the vector or a gene product encoded thereby; and inco ⁇ orating into said vector a nucleic acid sequence encoding a cell membrane fusion-generating polypeptide.
  • composition comprising a He ⁇ es Simplex Virus vector comprising a mutation that confers to the vector or a gene product encoded thereby a cell membrane fusion-generating activity; and a nucleic acid sequence encoding GALV.fus.
  • a method of destroying a malignant cell comprising introducing to said cell a composition comprising an oncolytic virus, wherein the virus comprises a strict late viral promoter.
  • a vector comprising a first cell membrane fusion-generating activity and a second cell membrane fusion- generating activity
  • said vector is obtainable by a method comprising at least one of the following steps generating a mutation in a nucleic acid sequence of the vector, wherein the mutation confers to the vector or a gene product encoded thereby the cell membrane fusion- generating activity; inco ⁇ orating into the vector a nucleic acid sequence encoding a gene product comprising cell membrane fusion-generating activity; or both.
  • the inco ⁇ orating step may be further defined as providing a first polynucleotide comprising a He ⁇ es Simplex Virus genome, said He ⁇ es Simplex Virus being non-infectious; providing a second polynucleotide comprising the nucleic acid sequence encoding at least one gene product comprising cell membrane fusion-generating activity; and at least one nucleic acid sequence encoding a gene product comprising a functional packaging signal; and inco ⁇ orating the nucleic acid sequence encoding a gene product comprising cell membrane fusion-generating activity and the nucleic acid sequence encoding a gene product comprising a functional packaging signal into the first polynucleotide, wherein said inco ⁇ orating step generates an infectious He ⁇ es Simplex Virus.
  • the inco ⁇ orating the nucleic acid sequence encoding a gene product comprising cell membrane fusion-generating activity and the nucleic acid sequence encoding a gene product comprising a functional packaging signal into the first polynucleotide step may be further defined as mixing the first and second polynucleotides together to form a mixture; introducing the mixture to a cell; and assaying for lysis of said cell.
  • the first polynucleotide may be provided on a bacterial artificial chromosome.
  • the He ⁇ es Simplex Virus of the first polynucleotide may comprise a deletion of j34.5; a deletion of one or more copies of pac; or a combination thereof.
  • the infectious He ⁇ es Simplex Virus may be replication selective.
  • the second polynucleotide may be provided on a plasmid.
  • the expression of the nucleic acid sequence encoding at least one gene product comprising cell membrane fusion-generating activity may be regulated by CMV immediate early promoter.
  • a method of generating a vector comprising a first cell membrane fusion-generating activity and a second cell membrane fusion-generating activity comprising at least one of the following steps generating a mutation in a nucleic acid sequence of the vector, wherein the mutation confers to the vector or a gene product encoded thereby the cell membrane fusion-generating activity; inco ⁇ orating into the vector a nucleic acid sequence encoding a gene product comprising cell membrane fusion- generating activity; or both.
  • the inco ⁇ orating step may further be defined as providing a first polynucleotide comprising a He ⁇ es Simplex Virus genome, said He ⁇ es Simplex Virus being non-infectious; providing a second polynucleotide comprising the nucleic acid sequence encoding at least one gene product comprising cell membrane fusion-generating activity; and at least one nucleic acid sequence encoding a gene product comprising a functional packaging signal; and inco ⁇ orating the nucleic acid sequence encoding a gene product comprising cell membrane fusion-generating activity and the nucleic acid sequence encoding a gene product comprising a functional packaging signal into the first polynucleotide, wherein said inco ⁇ orating step generates an infectious He ⁇ es Simplex Virus.
  • a method of increasing tumor antigen presentation in an individual comprising a malignant cell, comprising the step of providing to the individual a vector comprising a first cell membrane fusion-generating activity and a second cell membrane fusion-generating activity.
  • the increased tumor antigen presentation provides an improved antitumor immunity in the individual compared to in the absence of said increased tumor antigen presentation, in some embodiments.
  • a method of destroying a malignant cell comprising introducing to said cell a composition comprising an oncolytic virus, wherein the virus comprises a strict late viral promoter.
  • FIG. 1 provides a schematic illustration of the enforced strategy for the insertion of GALV.fus gene into oncolytic HSV.
  • the mutated HSV DNA sequence is represented by dotted gray bars and the BAC sequence is represented by black bars in fHSV- delta-pac.
  • the pac and the gene cassette from shuttle plasmids are labeled.
  • the gene insertion is done in vitro before the ligation mixture was transfected into Vero cells for the generation of infectious viruses.
  • FIG. 2 shows phenotypic characterization of Synco-1 on tumor cells.
  • the top panel shows the tumor cells infected with Baco-1. Each photo contains a single infection focus.
  • the bottom panel shows the cells infected with Synco-1. Each photo shows a single syncytium (original magnification, x200).
  • FIGS. 3A and 3B illustrate increased tumor cell killing ability from Synco-1 infection.
  • the percentage of cell survival was calculated by dividing the live cells from the infected wells with the total number of cells in the well that was not infected. Statistical comparison was made between the cells infected with Baco-1 or Synco-1 at each of the virus doses and the time points of harvest. * P ⁇ 0.001.
  • FIG. 4 demonstrates enhanced oncolytic potency of Synco-1 in nude mouse - human tumor xenografts.
  • Treatment groups include Synco-1, Baco-1 or PBS.
  • FIGS. 5A-5L provide phenotypic characterization of Synco-2 and selective GALV.fus expression from the virus.
  • FIGS. 5A-5C show different tumor cells (FIG. 5A, U87 MG; FIG. 5B, DU 145; and FIG. 5C, Hep 3B) infected with Synco-2.
  • FIG. 5D and 5E show Hep 3B cells infected with Synco-1 (FIG. 5D) and Synco-2 (FIG. 5E) in the presence of ACV in the medium.
  • FIG. 5F shows uninfected human embryonic fibroblasts HF 333.
  • FIG. 5G - 51 shows different status of HF333.We infected with Synco-1 (FIG.
  • FIG. 5G shows cell maintained in growth medium
  • FIG. 5H shows cells serum-starved for 24 h
  • FIG. 51 shows serum-starved cells for 24 h plus incubation with lovastatin
  • FIG. 5J - 5L show different status of HF 333.
  • FIG. 5J shows cells maintained in growth medium
  • FIG. 5K shows cells serum-starved for 48h
  • FIG. 5L shows cells serum-starved plus incubation with lovastatin) infected with Synco-2, (Original magnification, x200).
  • FIGS. 6A-6B show a comparison of anti-tumor potency between Synco-1 and Synco-2 and demonstration of their in vivo syncytial formation.
  • FIG. 6A is a comparison of oncolytic potency on xenografted human tumors. Treatment groups include Baco-1, Synco-1, Synco-2 and PBS.
  • FIG. 6B shows microscopic examination of tumor tissues after viral or PBS injection. The syncytial formation in Synco-1 or Synco-2 infected tumor tissues are indicated by arrow heads.
  • FIG. 7 is a schematic exemplary illustration of an enforced ligation strategy for the construction of oncolytic HSV containing AP gene.
  • the plasmid DNA sequence is represented by filled area
  • the HSV DNA sequence in the fHSV-delta-pac is represented by the hatched area.
  • the BAC sequence, the HSV packaging signal (pac), the two different promoter elements, and the AP gene are each individually labeled (not proportional to their actual sizes).
  • the locations of the restriction enzyme P d site on each construct are also indicated.
  • the gene cassettes containing AP gene were cut out with Pad and ligated into fHSV- delta-pac that has also been linearized with Pad.
  • the ligation mixture was directly transfected into Vero cells for the generation of infectious viruses.
  • FIG. 8 illustrates in vitro characterization of UL38p cloned in a plasmid.
  • Both pLox-AP and pBVIJ-pac-AP were transfected into Vero cells, which were then infected with 0.1 pfu/cell of an oncolytic HSV (Baco-1) or mock infected (with medium only).
  • the medium was collected 24 h after viral infection (i.e., 48 h after DNA transfection) and quantified for the AP secretion. The results represent the average of three independent experiments.
  • FIG. 9 shows in vitro characterization of UL38p in the context of oncolytic HSV.
  • Human embryonic fibroblasts HF 333. We
  • HF 333 Human embryonic fibroblasts
  • One set of cells was treated with 20 ⁇ M lovastatin in serum-free medium for 30 h.
  • Both untreated (in complete medium) and the lovastatin-arrested cells were then infected with either Baco-APl or Baco-AP2 at 0.1 pfu/cell.
  • the supematants were collected 24 h after infection and the AP in the medium was quantified.
  • the figures represent the average of two independent experiments.
  • FIG. 10 demonstrates in vivo characterization of UL38p in the context of oncolytic HSV.
  • Mice with established liver tumor on the right-hand side flank were intratumorally injected (i.t.) with 5X10 6 pfu of either Baco-AP-1 or Baco-AP2.
  • Mice without tumor were injected with the same amount of virus either intramuscularly (i.m.) or intravenously (i.v.). Blood was collected at the indicated day after virus inoculation and the AP secreted into the blood was quantified. Data are expressed as the mean ⁇ SE (n-5).
  • FIG. 11 provides a summary of the strategy for fusogenic oncolytic HSV.
  • the large circle area represents the HSV DNA sequence including the BAC sequence represented by black circle in the fHSV-delta-pac.
  • the pac and the gene cassette from shuttle plasmids are labeled.
  • the gene cassettes were ligated into the BAC-HSV construct in vitro before the ligation mixture was transfected into Vero cells for the generation of infectious viruses. After that, to generate the enhanced fusogenic potent HSVs, random mutagenesis was performed.
  • FIGS. 12A-12F show in vitro phenotypic characterization of Synco-2D in ovarian cancer cell lines.
  • Hey or SKOV3 ovarian cancer cells were infected with either Baco-1 or Synco-2D. Photos were taken at 48 h after initial viral infection (original magnification, x200). Black arrows indicate a single syncytia formation (FIG. 12E, FIG. 12F).
  • FIGS. 13A and 13B provide a comparison of the in vitro cytotoxicity of Baco-1 and Synco-2D on ovarian cancer cells.
  • Hey or SKOV3 ovarian cancer cells were seeded into 24-well plates and infected with Baco-1 or Synco-2D, or left uninfected (not shown in this figure).
  • Cells collected 24 h or 48 h after infection, and viable cells were counted after trypan blue staining. The percentage of cell viability was determined by dividing the number of viable infected cells by the number of uninfected cells. Data are expressed as mean ⁇ standard deviation of the mean.
  • FIG. 13A shows 0.01 pfu/cell
  • FIG. 13B shows 0.1 pfu/cell.
  • FIGS. 14A-14C demonstrate a therapeutic effect of the fusogenic oncolytic HSV for an orthotopic ovarian cancer model.
  • mice received intraperitoneal administration of oncolytic HSV at a dose of 2xl0 7 pfu/200 ⁇ l from a different site of tumor injected.
  • the treated group was as follows; (FIG. 14A): PBS as control; (FIG. 14B): Baco-1; (FIG. 14C): Synco-2D.
  • FIG. 14A PBS as control
  • FIG. 14B Baco-1
  • FIG. 14C Synco-2D.
  • Forty-two days after the orthotopic tumor inoculation the live mice were euthanized and examined whether they developed tumors and had peritoneal dissemination. Black arrows indicate the formation of peritoneal thickness or dissemination.
  • FIG. 15 demonstrates survival of mice treated with oncolytic HSV for advanced ovarian cancer (Kaplan-Meier plots).
  • FIG. 16 provides phenotypic characterization of fusogenic oncolytic HSV in prostate cancer cell line PC-3M-Pro4.
  • PC-3M-Pro4 cells were infected with either non- fusogenic (Baco-1) or fusogenic (Synco-2 or Synco-2D) oncolytic HSVs. Each photo was taken at 24 h or 48h after initial viral infection (original magnification, x200). Black arrows indicate the boundary of the syncytium.
  • FIGS. 17A and 17B show comparison of the in vitro cytotoxicity of Baco-1, Synco-2 and Synco-2D on prostate cancer cells.
  • PC-3M-Pro4 prostate cancer cells were seeded into 24-well plates and infected with Baco-1, Synco-2 or Synco-2D at 0.01 pfu/cell (FIG. 17A) or 0.1 pfu/cell (FIG. 17B), or left uninfected.
  • Cells were collected 24 h, 48 h or 72 h after infection, and viable cells were counted after trypan blue staining. The percentage of cell viability was determined by dividing the number of viable cells from the infected wells by the number of cells in the uninfected well. Data are expressed as mean ⁇ standard deviation of the mean. ⁇ , P ⁇ 0.05 as compared with Baco-1; , PO.01 as compared with Synco-2.
  • FIGS. 18A and 18B show a therapeutic effect of the fusogenic oncolytic HSVs on the orthotopic prostate tumor.
  • Human prostate cancer xenografts were established in the primary site through orthotopic inoculation of PC-3M-Pro4 cells.
  • Eight and 15 days after tumor cell inoculation mice received intravenous administration of oncolytic HSV at a dose of 2xl0 7 pfu at a volume of 100 ⁇ l through tail vein.
  • mice that were still alive were euthanized and examined for the presence of tumor mass in the original injection site and lymph node metastases.
  • FIG. 18A provides photos that were taken from one mouse from each group that shows an average tumor and local lymph node metastasis (PBS treated group only).
  • the orthotopic tumors are indicated with dashed triangles and the lymph node metastasis is indicated with filled arrows.
  • FIG. 18B shows orthotopic tumors that were explanted and weighed. The plotted figures represent the average weight ⁇ standard deviation.
  • FIGS. 19A tlirough 19C demonstrate that an enhanced oncolytic effect of Synco-2D on 4T1 tumor is accompanied by elevated tumor-specific CTL activities
  • FIG. 19 A antitumor activity of oncolytic HSVs on local tumor is shown.
  • the tumor volume was determined by the formula (L x W2)/2, where the L is the tumor length and W the width.
  • FIG. 19B a therapeutic effect of oncolytic HSVs on lung metastases is shown.
  • the figure demonstrates the gross pathological findings in a representative mouse from each group.
  • FIG. 19C tumor-specific CTL activity after tumor destruction by oncolytic HSVs is provided.
  • cell membrane fusion refers to fusion of an outer membrane of at least two cells, such as two adjacent cells.
  • conditionally replicating refers to the property that a virus can only replicate in, for example, dividing cells (such as tumor cells) but not in, for example, postmitotic or non-dividing cells such as normal hepatocytes or neurons.
  • the terms "enhanced tumor antigen presentation” or “increased tumor antigen presentation” as used herein refers to an enhancement, increase, intensification, augmentation, amplification, proliferation, multiplication, or combination thereof of the presentation of tumor antigens to the immune system, h a specific embodiment, the presentation comprises the release of tumor antigens, hi a specific embodiment, the enhanced tumor antigen presentation is particularly useful for solid tumors, non-solid tumors, and/or metastasized cancer.
  • some exemplary tumor antigens include gplOO and carcinoembryonic antigen (CEA).
  • improved antitumor immunity refers to the generation of a better antitumor immunity in the presence of membrane fusion, (wherein the fusion leads to syncytia formation and enhanced tumor antigen presentation) compared to in the absence of the membrane fusion.
  • the improved antitumor immunity is directed to cell-mediated antitumor immunity.
  • the term "oncolytic” as used herein refers to an agent that can destroy malignant cells.
  • the destruction comprises fusion of the malignant cell membrane to another membrane.
  • the destruction comprises lysis of the cell, and in some embodiments the destruction comprises both membrane fusion and lysis.
  • replication selective or “replication conditional” as used herein refers to the ability of an oncolytic virus to selectively grow in certain tissues (e.g., tumors).
  • the present invention regards a conditionally replicating (oncolytic) HSV vector having greater than one cell membrane fusion-generating mechanism, in contrast to those in the related art.
  • a fusogenic oncolytic HSV such as created by methods described herein, for example random mutagenesis, further comprises a nucleic acid encoding a cell membrane fusion-generating polypeptide, such as GALV.fus.
  • the GALV.fus sequence is SEQ ID NO:5.
  • Oncolytic viruses have shown great promise as anti-tumor agents for solid tumors. However, their anti-tumor potency must be further improved before a clear clinical benefit can be obtained from their administration.
  • the present invention utilizes, in specific embodiments, a gene encoding a truncated form of gibbon ape leukemia virus envelope fusogenic membrane glycoprotein (GALV.fus) into an oncolytic he ⁇ es simplex virus through an enforced ligation procedure. In vivo studies show that expression of GALV.fus in the context of an oncolytic virus significantly enhances the anti-tumoral effect of the virus.
  • GALV.fus gibbon ape leukemia virus envelope fusogenic membrane glycoprotein
  • the confinement of transgene expression to tumor cells is particularly desirable for gene therapy of malignant diseases.
  • Current approaches for transcriptional targeting to tumors mainly use tissue-specific promoters to control gene expression.
  • these promoters generally have much lower activity than the constitutive viral promoters and may also lose their tissue specificity once cloned into viral vectors.
  • the present invention in some embodiments, utilizes a strict late viral promoter (UL38p), whose activity depends on the onset of viral DNA replication.
  • the promoter was introduced into an oncolytic he ⁇ es simplex virus (HSV).
  • a recombinant nucleic acid vector for treatment of a malignant disease in a mammalian patient wherein the vector comprises a sequence directing the expression on a eukaryotic cell surface of a cell membrane fusion-inducing polypeptide.
  • the UL38p is utilized to direct expression of the cell membrane fusion-inducing polypeptide.
  • the HSV comprises a mutation that provides to the vector cell fusogenic properties.
  • the mutation may be generated randomly, and a pool of potential candidates for having cell fusogenic properties is then assayed for the function by means described herein and/or known in the art.
  • a HSV comprising a mutation may also be obtained from nature, and the corresponding HSV isolated.
  • a mutation(s) that renders a HSV as having cell fusogenic and/or syncytial-forming properties is located at or near the glycoprotein B (gB), the gK gene region, or both.
  • the mutation may be a point mutation, a frameshift, an inversion, a deletion, a splicing error mutation, a post- transcriptional processing mutation, a combination thereof, and so forth.
  • the mutation may be identified by sequencing the particular oncolytic HSV, such as Synco-2D, and comparing it to a known wild type sequence.
  • the methods and compositions of the present invention are useful for the treatment of malignant cells, such as, for example, to inhibit their spread, decrease or inhibit their replication, to eradicate them, to prevent their generation or proliferation, or a combination thereof.
  • the malignant cells may be from any form of cancer, and they may be from a solid tumor, although other forms are treatable with methods and compositions herein.
  • the methods and compositions are utilized to treat lung, liver, prostate, ovarian, breast, brain, pancreatic, testicular, colon, head and neck, melanoma, and other types of malignant cells.
  • the invention is useful for treating malignant cells at any stage of a cancer disease, however, in a particular embodiment the invention is utilized upon metastatic stages of the disease.
  • the invention may be utilized in conjunction with another means of therapy for an individual comprising malignant cells.
  • conventional radiation therapy and surgery are both potentially curative treatment modalities for organ-confined cancer, such as prostate cancer, there is little effective treatment for metastatic disease, for example, particularly after androgen deprivation therapy fails in prostate cancer.
  • the replication-conditional (oncolytic) viruses of the present invention comprising more than one cell membrane fusion capabilities are useful for the treatment of solid tumors, such as prostate cancer, and the present invention demonstrates that inco ⁇ oration of cell membrane fusion capability into an oncolytic HSV significantly increases the antitumor potency of the virus.
  • fusogenic oncolytic HSVs may be constructed by any means, so long as greater than one cell membrane fusion capability is present on the vector, in particular embodiments the capability for the fusogenic oncolytic HSVs was generated by one of three different strategies: 1) screening for syncytial phenotype from a vector, such as a well- established oncolytic HSV after random mutagenesis (such as for the generation of Fu-10); 2) insertion of the gene encoding a fusogenic gene product, such as a hyperfusogenic membrane glycoprotein of gibbon ape leukemia virus (GALV.fus), into the genome of an oncolytic HSV (such as for the generation of Synco-2); and 3) inco ⁇ oration of both of these two membrane fusion mechanisms into a single oncolytic HSV (such as for the generation of Synco-2D).
  • a vector such as a well- established oncolytic HSV after random mutagenesis (such as for the generation of Fu-10)
  • the present invention in some embodiments comprises at least a fusogenic portion of a cell membrane fusion-inducing polypeptide, such as a viral FMG. h some embodiments the FMG or functional fragment thereof is present on the HSV composition as a nucleic acid encoding an FMG or functional fragment polypeptide.
  • the polypeptide is preferably capable of inducing cell membrane fusion at substantially neutral pH (such as about pH 6-8).
  • the FMG comprises at least a fusogenic domain from a C-type retrovirus envelope protein, such as MLV (as an example, SEQ J-D NO: 7) or GALV (as an example, SEQ ID NO:5).
  • a retroviral envelope protein having a deletion of some, most, or all of the cytoplasmic domain is useful, because such manipulation results in hyperfusogenic activity for human cells.
  • Particular modifications are introduced, in some embodiments, into viral membrane glycoproteins to enhance their function to induce cell membrane fusion.
  • truncation of the cytoplasmic domains of a number of retroviral and he ⁇ esvirus glycoproteins has been shown to increase their fusion activity, sometimes with a simultaneous reduction in the efficiency with which they are inco ⁇ orated into virions (Rein et al, 1994; Brody et al,. 1994; Mulligan et al, 1992; Pique et al, 1993; Baghian et al, 1993; Gage et al, 1993).
  • a skilled artisan recognizes that in some embodiments it is desirable to introduce functions into a FMG polypeptide, such as novel binding specificities or protease- dependencies, and thereby target their fusogenic activities to specific cell types that express the targeted receptors.
  • cell membrane fusing polypeptides include measles virus fusion protein (SEQ TD NO:8), the HLV gpl60 (SEQ LD NO:9) and SIV gpl60 (SEQ ID NO: 10) proteins, the retroviral Env protein (SEQ ID NO: 11), the Ebola virus Gp (SEQ ID NO: 12), and the influenza virus haemagglutinin (SEQ ID NO: 13).
  • the present invention is directed to an HSV vector comprising greater than one fusogenic mechanism.
  • the vector comprises some or all of the following components.
  • vector refers to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated.
  • a nucleic acid sequence can be "exogenous,” which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found.
  • Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs).
  • expression vector refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes.
  • Expression vectors can contain a variety of "control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell, h addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.
  • a “promoter” is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription a nucleic acid sequence.
  • the phrases "operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
  • a strict late viral promoter which directs expression only in replicating cells, such as tumor cells.
  • strict late viral promoters include UL38 (SEQ ID NO:3) and Usll (SEQ ID NO:4).
  • SEQ ID NO:3 is GTGGGTTGCGGACTTTCTGCGGGGCGGCCCAAATGGCCCTTTAAACGTGT GTATACGGACGCGCCGGGCCAGTCGGCCAACACAACCCACCGGAGCGGTAGCCGCG TTTGGCTGTGGGGTGGGTGGTTCCGCCTTGCGT.
  • SEQ ID NO:4 is
  • a promoter generally comprises a sequence that functions to position the start site for RNA synthesis.
  • the best-known example of this is the TATA box, but in some promoters lacking a TATA box, such as, for example, the promoter for the mammalian terminal deoxynucleotidyl transferase gene and the promoter for the SV40 late genes, a discrete element overlying the start site itself helps to fix the place of initiation. Additional promoter elements regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
  • a coding sequence "under the control of a promoter, one positions the 5' end of the transcription initiation site of the transcriptional reading frame "downstream" of (i.e., 3' of) the chosen promoter.
  • the "upstream” promoter stimulates transcription of the DNA and promotes expression of the encoded RNA.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another.
  • the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
  • individual elements can function either cooperatively or independently to activate transcription.
  • a promoter may or may not be used in conjunction with an "enhancer,” which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.
  • a promoter may be one naturally associated with a nucleic acid sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous.”
  • an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.
  • certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment.
  • a recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment.
  • Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus, or prokaryotic or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
  • promoters that are most commonly used in recombinant DNA construction include the ⁇ -lactamase (penicillinase), lactose and tryptophan (t ⁇ ) promoter systems, hi addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (see U.S. Patent Nos. 4,683,202 and 5,928,906, each inco ⁇ orated herein by reference).
  • control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
  • promoter and/or enhancer that effectively directs the expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression.
  • Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, (see, for example Sambrook et al. 1989, inco ⁇ orated herein by reference).
  • the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
  • the promoter may be heterologous or endogenous.
  • any promoter/enhancer combination (as per, for example, the Eukaryotic Promoter Data Base EPDB, http://www.epd.isb-sib.ch/) could also be used to drive expression.
  • Use of a T3, T7 or SP6 cytoplasmic expression system is another possible embodiment.
  • Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
  • Tables 1 and 2 list non-limiting examples of elements/promoters that may be employed, in the context of the present invention, to regulate the expression of a RNA.
  • Table 2 provides non-limiting examples of inducible elements, which are regions of a nucleic acid sequence that can be activated in response to a specific stimulus.
  • tissue-specific promoters or elements as well as assays to characterize their activity, is well l ⁇ iown to those of skill in the art.
  • Nonlimiting examples of such regions include the human LEVIK2 gene (Nomoto et al.
  • the somatostatin receptor 2 gene (Kraus et al, 1998), murine epididymal retinoic acid-binding gene (Lareyre et al, 1999), human CD4 (Zhao-Emonet et al, 1998), mouse alpha2 (XI) collagen (Tsumaki, et al, 1998), D1A dopamine receptor gene (Lee, et al, 1997), insulin-like growth factor TT (Wu et al, 1997), and human platelet endothelial cell adhesion molecule-1 (Almendro et al, 1996).
  • a specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
  • IRES internal ribosome entry sites
  • J ES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988).
  • IRES elements from two members of the picomavirus family polio and encephalomyocarditis have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991).
  • IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages.
  • each open reading frame is accessible to ribosomes for efficient translation.
  • Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent Nos. 5,925,565 and 5,935,819, each herein inco ⁇ orated by reference).
  • Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector (see, for example, Carbonelli et al, 1999, Levenson et al, 1998, and Cocea, 1997, inco ⁇ orated herein by reference.)
  • MCS multiple cloning site
  • Restriction enzyme digestion refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art.
  • a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector.
  • "Ligation” refers to the process of fo ⁇ riing phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.
  • RNA molecules will undergo RNA splicing to remove introns from the primary transcripts.
  • Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression (see, for example, Chandler et al, 1997, herein inco ⁇ orated by reference.)
  • the vectors or constructs of the present invention will generally comprise at least one termination signal.
  • a “termination signal” or “terminator” is comprised of the DNA sequences involved in specific termination of an RNA transcript by an RNA polymerase.
  • a temiination signal that ends the production of an RNA transcript is contemplated.
  • a terminator may be necessary in vivo to achieve desirable message levels.
  • the terminator region may also comprise specific DNA sequences that permit site-specific cleavage of the new transcript so as to expose a polyadenylation site. This signals a specialized endogenous polymerase to add a stretch of about 200 A residues (poly A) to the 3' end of the transcript. RNA molecules modified with this polyA tail appear to more stable and are translated more efficiently.
  • that terminator comprises a signal for the cleavage of the RNA, and it is more preferred that the terminator signal promotes polyadenylation of the message.
  • the terminator and/or polyadenylation site elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
  • Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator.
  • the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.
  • polyadenylation signal In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript.
  • the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and any such sequence may be employed.
  • Preferred embodiments include the SV40 polyadenylation signal or the bovine growth hormone polyadenylation signal, convenient and known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.
  • a vector in a host cell may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated.
  • ori origins of replication sites
  • ARS autonomously replicating sequence
  • cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector.
  • markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector.
  • a selectable marker is one that confers a property that allows for selection.
  • a positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection.
  • An example of a positive selectable marker is a drug resistance marker.
  • a drug selection marker aids in the cloning and identification of transformants
  • genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers.
  • markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated.
  • screenable enzymes such as he ⁇ es simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized.
  • a vector is propagated from the initially infected cell to surrounding cells.
  • the vector is introduced to the initially infected cell by suitable methods.
  • Such methods for nucleic acid delivery for transformation of an organelle, a cell, a tissue or an organism for use with the current invention are believed to include virtually any method by which a nucleic acid (e.g., HSV vector) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be l ⁇ iown to one of ordinary skill in the art.
  • Such methods include, but are not limited to, direct delivery of DNA such as by ex vivo transfection (Wilson et al, 1989, Nabel et al, 1989), by injection (U.S. Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each inco ⁇ orated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Patent No. 5,789,215, inco ⁇ orated herein by reference); by electroporation (U.S. Patent No.
  • organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
  • the composition may also be delivered to a cell by administering it systemically, such as intravenously, in a pharmaceutically acceptable excipient to a mammal comprising the cell.
  • a nucleic acid may be delivered to an organelle, a cell, a tissue or an organism via one or more injections (i.e., a needle injection), such as, for example, subcutaneously, intradermally, intramuscularly, intervenously, intraperitoneally, etc.
  • injections i.e., a needle injection
  • Methods of injection of vaccines are well l ⁇ iown to those of ordinary skill in the art (e.g., injection of a composition comprising a saline solution).
  • Further embodiments of the present invention include the introduction of a nucleic acid by direct microinjection. Direct microinjection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985). The amount of cell membrane fusion-generating HSV used may vary upon the nature of the, cell, tissue or organism affected.
  • a nucleic acid is introduced into an organelle, a cell, a tissue or an organism via electroporation.
  • Electroporation involves the exposure of a suspension of cells and DNA to a high- voltage electric discharge.
  • certain cell wall-degrading enzymes such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells (U.S. Patent No. 5,384,253, inco ⁇ orated herein by reference).
  • recipient cells can be made more susceptible to transformation by mechanical wounding.
  • a nucleic acid is introduced to the cells using calcium phosphate precipitation.
  • Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique.
  • mouse L(A9), mouse C127, CHO, CV-1, BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990).
  • a nucleic acid is delivered into a cell using DEAE-dextran followed by polyethylene glycol.
  • reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).
  • Additional embodiments of the present invention include the introduction of a nucleic acid by direct sonic loading.
  • LTK fibroblasts have been transfected with the thymidine kinase gene by sonication loading (Fechheimer et al, 1987).
  • a nucleic acid such as an oncolytic HSV
  • a lipid complex such as, for example, a liposome.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).
  • Lipofectamine Gabco BRL
  • Superfect Qiagen
  • Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987).
  • the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells has also been demonstrated (Wong et al, 1980).
  • a liposome may be complexed with a hemagglutinatin virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
  • a liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991).
  • HMG-1 nuclear non-histone chromosomal proteins
  • a liposome may be complexed or employed in conjunction with both HVJ and HMG-1.
  • a delivery vehicle may comprise a ligand and a liposome.
  • a nucleic acid may be delivered to a target cell via receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in a target cell. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention.
  • Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a nucleic acid-binding agent. Others comprise a cell receptor-specific ligand to which the nucleic acid to be delivered has been operatively attached.
  • Several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987; Wagner et al, 1990; Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique.
  • Specific delivery in the context of another mammalian cell type has been described (Wu and Wu, 1993; inco ⁇ orated herein by reference), hi certain aspects of the present invention, a ligand will be chosen to correspond to a receptor specifically expressed on the target cell population.
  • a nucleic acid delivery vehicle component of a cell-specific nucleic acid targeting vehicle may comprise a specific binding ligand in combination with a liposome.
  • the nucleic acid(s) to be delivered are housed within the liposome and the specific binding ligand is functionally inco ⁇ orated into the liposome membrane.
  • the liposome will thus specifically bind to the receptor(s) of a target cell and deliver the contents to a cell.
  • Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.
  • EGF epidermal growth factor
  • the nucleic acid delivery vehicle component of a targeted delivery vehicle may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding.
  • lipids or glycoproteins that direct cell-specific binding.
  • lactosyl-ceramide, a galactose-terminal asialganglioside have been inco ⁇ orated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes (Nicolau et al, 1987). It is contemplated that the tissue-specific transforming constructs of the present invention can be specifically delivered into a target cell in a similar manner.
  • Microprojectile bombardment techniques can be used to introduce a nucleic acid into at least one, organelle, cell, tissue or organism (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Application WO 94/09699; each of which is inco ⁇ orated herein by reference).
  • This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).
  • microprojectile bombardment techniques There are a wide variety of microprojectile bombardment techniques l ⁇ iown in the art, many of which are applicable to the invention.
  • one or more particles may be coated with at least one nucleic acid and delivered into cells by a propelling force.
  • Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold particles or beads. Exemplary particles include those comprised of tungsten, platinum, and preferably, gold. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
  • cells in suspension are concentrated on filters or solid culture medium.
  • immature embryos or other target cells may be arranged on solid culture medium.
  • the cells to be bombarded are positioned at an appropriate distance below the macroprojectile stopping plate.
  • An illustrative embodiment of a method for delivering DNA into a cell (e.g., a plant cell) by acceleration is the Biolistics Particle Delivery System, which can be used to propel particles coated with DNA or cells through a screen, such as a stainless steel or Nytex screen, onto a filter surface covered with cells, such as for example, a monocot plant cells cultured in suspension.
  • the screen disperses the particles so that they are not delivered to the recipient cells in large aggregates. It is believed that a screen intervening between the projectile apparatus and the cells to be bombarded reduces the size of projectiles aggregate and may contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by projectiles that are too large.
  • the terms "cell,” “cell line,” and “cell culture” may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations.
  • "host cell” refers to a prokaryotic or eukaryotic cell, and it includes any transformable organism that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors.
  • a host cell may be "ttansfected” or “transformed,” which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a transformed cell includes the primary subject cell and its progeny.
  • the terms “engineered” and “recombinant” cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence, such as, for example, a vector, has been inttoduced. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly inttoduced nucleic acid.
  • RNAs or proteinaceous sequences may be co-expressed with other selected RNAs or proteinaceous sequences in the same host cell. Co-expression may be achieved by co-ttansfecting the host cell with two or more distinct recombinant vectors. Alternatively, a single recombinant vector may be constructed to include multiple distinct coding regions for RNAs, which could then be expressed in host cells transfected with the single vector.
  • a tissue may comprise a host cell or cells to be transformed with a cell membrane fusion-generatmg HSV.
  • the tissue may be part or separated from an organism.
  • a tissue may comprise, but is not limited to, adipocytes, alveolar, ameloblasts, axon, basal cells, blood (e.g., lymphocytes), blood vessel, bone, bone marrow, brain, breast, cartilage, cervix, colon, cornea, embryonic, endometrium, endothelial, epithelial, esophagus, facia, fibroblast, follicular, ganglion cells, glial cells, goblet cells, kidney, liver, lung, lymph node, muscle, neuron, ovaries, pancreas, peripheral blood, prostate, skin, skin, small intestine, spleen, stem cells, stomach, testes, and all cancers thereof.
  • the host cell or tissue may be comprised in at least one organism, hi certain embodiments, the organism may be, but is not limited to, a prokayote (e.g., a eubacteria, an archaea) or an eukaryote, as would be understood by one of ordinary skill in the art.
  • a prokayote e.g., a eubacteria, an archaea
  • an eukaryote as would be understood by one of ordinary skill in the art.
  • a plasmid or cosmid can be introduced into a prokaryote host cell for replication of many vectors.
  • Cell types available for vector replication and/or expression include, but are not limited to, bacteria, such as E. coli (e.g., E. coli strain RR1, E. coli L ⁇ 392, E. coli B, E. coli X 1776 (ATCC No. 31537) as well as E.
  • coli W3110 F-, lambda-, protottophic, ATCC No. 273325), DH5 ⁇ , JM109, and KC8, bacilli such as Bacillus subtilis; and other enterobacteriaceae such as Salmonella typhimurium, Serratia marcescens, various Pseudomonas specie, as well as a number of commercially available bacterial hosts such as SURE" Competent Cells and SOLOPACKTM Gold Cells (STRATAGENE ® , La Jolla).
  • bacterial cells such as E. coli LE392 are particularly contemplated as host cells for phage viruses.
  • Examples of eukaryotic host cells for replication and or expression of a vector include, but are not limited to, HeLa, NIH3T3, Jurkat, 293, Cos, CHO, Saos, and PC12. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector.
  • Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells.
  • control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells.
  • One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.
  • Expression systems may be utilized in the generation of compositions of the present invention. Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available.
  • the insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patent No. 5,871,986, 4,879,236, both herein inco ⁇ orated by reference, and which can be bought, for example, under the name MAXBAC ® 2.0 from INVITROGEN ® and BACPACKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH ® .
  • expression systems include STRATAGENE ® 'S COMPLETE CONTROLTM Inducible Mammalian Expression System, which involves a synthetic ecdysone- inducible receptor, or its pET Expression System, an E. coli expression system.
  • INVITROGEN ® Another example of an inducible expression system is available from INVITROGEN ® , which carries the T- REXTM (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter.
  • INVITROGEN ® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylottophic yeast Pichia methanolica.
  • a vector such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.
  • proteins, polypeptides or peptides produced by the methods of the invention may be "overexpressed", i.e., expressed in increased levels relative to its natural expression in cells.
  • overexpression may be assessed by a variety of methods, including radio-labeling and/or protein purification.
  • simple and direct methods are preferred, for example, those involving SDS/PAGE and protein staining or western blotting, followed by quantitative analyses, such as densitometric scanning of the resultant gel or blot.
  • a specific increase in the level of the recombinant protein, polypeptide or peptide in comparison to the level in natural cells is indicative of overexpression, as is a relative abundance of the specific protein, polypeptides or peptides in relation to the other proteins produced by the host cell and, e.g., visible on a gel.
  • the expressed proteinaceous sequence forms an inclusion body in the host cell
  • the host cells are lysed, for example, by disruption in a cell homogenizer, washed and/or centrifuged to separate the dense inclusion bodies and cell membranes from the soluble cell components.
  • This centrifugation can be performed under conditions whereby the dense inclusion bodies are selectively enriched by inco ⁇ oration of sugars, such as sucrose, into the buffer and centrifugation at a selective speed.
  • Inclusion bodies may be solubilized in solutions containing high concentrations of urea (e.g.
  • chaotropic agents such as guanidine hydrochloride
  • reducing agents such as ⁇ -mercaptoethanol or DTT (dithiothreitol)
  • refolded into a more desirable conformation as would be known to one of ordinary skill in the art.
  • a vector such as a non- fusogenic conditionally replicating oncolytic HSN, is mutagenized to generate a fusogenic HSV vector.
  • mutagenesis is accomplished by a variety of standard mutagenic procedures. Mutation is the process whereby changes occur in the quantity or structure of an organism. Mutation can involve modification of the nucleotide sequence of a single gene, blocks of genes or whole chromosome. Changes in single genes may be the consequence of point mutations that involve the removal, addition or substitution of a single nucleotide base within a DNA sequence, or they may be the consequence of changes involving the insertion or deletion of large numbers of nucleotides.
  • Mutations can arise spontaneously as a result of events such as errors in the fidelity of DNA replication or the movement of ttansposable genetic elements (transposons) within the genome. They also are induced following exposure to chemical or physical mutagens.
  • mutation-inducing agents include ionizing radiations, ultraviolet light and a diverse array of chemical such as alkylating agents and polycyclic aromatic hydrocarbons all of which are capable of interacting either directly or indirectly (generally following some metabolic biotransformations) with nucleic acids.
  • the DNA lesions induced by such environmental agents may lead to modifications of base sequence when the affected DNA is replicated or repaired and thus to a mutation. Mutation also can be site-directed through the use of particular targeting methods.
  • Insertional mutagenesis is based on the inactivation of a gene via insertion of a known DNA fragment. Because it involves the insertion of some type of DNA fragment, the mutations generated are generally loss-of-function, rather than gain-of-function mutations. However, there are several examples of insertions generating gain-of-function mutations (Oppenheimer et al. 1991). Insertion mutagenesis has been very successful in bacteria and Drosophila (Cooley et al. 1988) and recently has become a powerful tool in com (Schmidt et al. 1987); Arabidopsis; (Marks et al, 1991; Koncz et al. 1990); and Antirrhinum (Sommer et al. 1990).
  • Transposable genetic elements are DNA sequences that can move
  • Transposable elements in the genome are characterized by being flanked by direct repeats of a short sequence of DNA that has been duplicated during transposition and is called a target site duplication. Virtually all transposable elements whatever their type, and mechanism of transposition, make such duplications at the site of their insertion. In some cases the number of bases duplicated is constant , in other cases it may vary with each transposition event. Most transposable elements have inverted repeat sequences at their termini, these terminal inverted repeats may be anything from a few bases to a few hundred bases long and in many cases they are known to be necessary for transposition.
  • Prokaryotic transposable elements have been most studied in E. coli and Gram negative bacteria, but also are present in Gram positive bacteria. They are generally termed insertion sequences if they are less than about 2 kB long, or transposons if they are longer. Bacteriophages such as mu and D108, which replicate by transposition, make up a third type of transposable element, elements of each type encode at least one polypeptide a transposase, required for their own transposition. Transposons often further include genes coding for function unrelated to transposition, for example, antibiotic resistance genes.
  • Transposons can be divided into two classes according to their structure. First, compound or composite transposons have copies of an insertion sequence element at each end, usually in an inverted orientation. These transposons require transposases encoded by one of their terminal IS elements. The second class of ttansposon have terminal repeats of about 30 base pairs and do not contain sequences from IS elements.
  • Transposition usually is either conservative or replicative, although in some cases it can be both.
  • replicative transposition one copy of the transposing element remains at the donor site, and another is inserted at the target site, hi conservative transposition, the transposing element is excised from one site and inserted at another.
  • Eukaryotic elements also can be classified according to their structure and mechanism of transportation. The primary distinction is between elements that transpose via an RNA intermediate, and elements that transpose directly from DNA to DNA.
  • Retrotransposon Elements that transpose via an RNA intermediate often are referred to as rettotransposons, and their most characteristic feature is that they encode polypeptides that are believed to have reverse transcriptionase activity.
  • retrotransposon There are two types of retrotransposon. Some resemble the integrated proviral DNA of a rettovirus in that they have long direct repeat sequences, long terminal repeats (LTRs), at each end. The similarity between these retrottansposons and proviruses extends to their coding capacity. They contain sequences related to the gag and pol genes of a retrovirus, suggesting that they transpose by a mechanism related to a retroviral life cycle. Retrottansposons of the second type have no terminal repeats.
  • gag- and _po/-like polypeptides and transpose by reverse transcription of RNA intermediates, but do so by a mechanism that differs from that or retrovirus-like elements. Transposition by reverse transcription is a replicative process and does not require excision of an element from a donor site.
  • Transposable elements are an important source of spontaneous mutations, and have influenced the ways in which genes and genomes have evolved. They can inactivate genes by inserting within them, and can cause gross chromosomal rearrangements either directly, through the activity of their ttansposases, or indirectly, as a result of recombination between copies of an element scattered around the genome. Transposable elements that excise often do so imprecisely and may produce alleles coding for altered gene products if the number of bases added or deleted is a multiple of three.
  • Transposable elements themselves may evolve in unusual ways. If they were inherited like other DNA sequences, then copies of an element in one species would be more like copies in closely related species than copies in more distant species. This is not always the case, suggesting that ttansposable elements are occasionally transmitted horizontally from one species to another.
  • Chemical mutagenesis offers certain advantages, such as the ability to find a full range of mutant alleles with degrees of phenotypic severity, and is facile and inexpensive to perform.
  • the majority of chemical carcinogens produce mutations in DNA.
  • Benzo[a]pyrene, N- acetoxy-2-acetyl aminofluorene and aflotoxin Bl cause GC to TA transversions in bacteria and mammalian cells.
  • Benzo[a]pyrene also can produce base substitutions such as AT to TA.
  • N- nitroso compounds produce GC to AT transitions. Alkylation of the O4 position of thymine induced by exposure to n-nitrosoureas results in TA to CG transitions.
  • a high correlation between mutagenicity and carcinogenity is the underlying assumption behind the Ames test (McCann et al, 1975) which speedily assays for mutants in a bacterial system, together with an added rat liver homogenate, which contains the microsomal cytochrome P450, to provide the metabolic activation of the mutagens where needed.
  • N-nittoso-N-methyl urea induces mammary, prostate and other carcinomas in rats with the majority of the tumors showing a G to A transition at the second position in codon 12 of the Ha-ras oncogene.
  • Benzo[a]pyrene-induced skin tumors contain A to T transformation in the second codon of the Ha-ras gene.
  • Ionizing radiation causes DNA damage and cell killing, generally proportional to the dose rate. Ionizing radiation has been postulated to induce multiple biological effects by direct interaction with DNA, or through the formation of free radical species leading to DNA damage (Hall, 1988). These effects include gene mutations, malignant transformation, and cell killing. Although ionizing radiation has been demonstrated to induce expression of certain DNA repair genes in some prokaryotic and lower eukaryotic cells, little is known about the effects of ionizing radiation on the regulation of mammalian gene expression (Borek, 1985). Several studies have described changes in the pattern of protein synthesis observed after irradiation of mammalian cells.
  • ionizing radiation treatment of human malignant melanoma cells is associated with induction of several unidentified proteins (Boothman et al, 1989).
  • Synthesis of cyclin and co-regulated polypeptides is suppressed by ionizing radiation in rat REF52 cells, but not in oncogene-transformed REF52 cell lines (Lambert and Borek, 1988).
  • Other studies have demonstrated that certain growth factors or cytokines may be involved in x-ray-induced DNA damage.
  • platelet-derived growth factor is released from endothelial cells after irradiation (Witte, et al, 1989).
  • the term "ionizing radiation” means radiation comprising particles or photons that have sufficient energy or can produce sufficient energy via nuclear interactions to produce ionization (gain or loss of electrons).
  • An exemplary and preferred ionizing radiation is an x-radiation.
  • the amomit of ionizing radiation needed in a given cell generally depends upon the nature of that cell.
  • an effective expression-inducing dose is less than a dose of ionizing radiation that causes cell damage or death directly.
  • Means for determining an effective amount of radiation are well l ⁇ iown in the art.
  • an effective expression inducing amomit is from about 2 to about 30 Gray (Gy) administered at a rate of from about 0.5 to about 2 Gy/minute. Even more preferably, an effective expression inducing amount of ionizing radiation is from about 5 to about 15 Gy. In other embodiments, doses of 2-9 Gy are used in single doses. An effective dose of ionizing radiation may be from 10 to 100 Gy, with 15 to 75 Gy being preferred, and 20 to 50 Gy being more preferred.
  • any suitable means for delivering radiation to a tissue may be employed in the present invention in addition to external means.
  • radiation may be delivered by first providing a radiolabeled antibody that immunoreacts with an antigen of the tumor, followed by delivering an effective amount of the radiolabeled antibody to the tumor.
  • radioisotopes may be used to deliver ionizing radiation to a tissue or cell.
  • Random mutagenesis also may be introduced using error prone PCR (Cadwell and Joyce, 1992). The rate of mutagenesis may be increased by performing PCR in multiple tubes with dilutions of templates.
  • mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al, 1989).
  • techniques for estimating the equilibrium constant for ligand binding using minuscule amounts of protein have been developed (Blackburn et al, 1991; U.S. Patents 5,221,605 and 5,238,808). The ability to perform functional assays with small amounts of material can be exploited to develop highly efficient, in vitro methodologies for the saturation mutagenesis of antibodies.
  • the inventors bypassed cloning steps by combining PCR mutagenesis with coupled in vitro transcription translation for the high throughput generation of protein mutants.
  • the PCR products are used directly as the template for the in vitro transcription/translation of the mutant single chain antibodies. Because of the high efficiency with which all 19 amino acid substitutions can be generated and analyzed in this way, it is now possible to perform saturation mutagenesis on numerous residues of interest, a process that can be described as in vitro scanning saturation mutagenesis (Burks et al, 1997).
  • In vitro scanning saturation mutagenesis provides a rapid method for obtaining a large amount of structure-function information including: (i) identification of residues that modulate ligand binding specificity, (ii) a better understanding of ligand binding based on the identification of those amino acids that retain activity and those that abolish activity at a given location, (iii) an evaluation of the overall plasticity of an active site or protein subdomain, (iv) identification of amino acid substitutions that result in increased binding.
  • a method for generating libraries of displayed polypeptides is described in U.S. Patent 5,380,721.
  • the method comprises obtaining polynucleotide library members, pooling and fragmenting the polynucleotides, and reforming fragments therefrom, performing PCR amplification, thereby homologously recombining the fragments to form a shuffled pool of recombined polynucleotides.
  • Site-specific mutagenesis uses specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent, unmodified nucleotides. In this way, a primer sequence is provided with sufficient size and complexity to form a stable duplex on both sides of the deletion junction being traversed. A primer of about 17 to 25 nucleotides in length is preferred, with about 5 to 10 residues on both sides of the junction of the sequence being altered.
  • the technique typically employs a bacteriophage vector that exists in both a single-stranded and double-stranded form.
  • Vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well l ⁇ iown to those skilled in the art. Double-sttanded plasmids are also routinely employed in site-directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.
  • a single-stranded vector or melts two strands of a double-sttanded vector, which includes within its sequence a DNA sequence encoding the desired protein or genetic element.
  • An oligonucleotide primer bearing the desired mutated sequence, synthetically prepared, is then annealed with the single-stranded DNA preparation, taking into account the degree of mismatch when selecting hybridization conditions.
  • the hybridized product is subjected to DNA polymerizing enzymes such as E. coli polymerase I (Klenow fragment) in order to complete the synthesis of the mutation-bearing strand.
  • heteroduplex is formed, wherein one strand encodes the original non-mutated sequence, and the second strand bears the desired mutation.
  • This heteroduplex vector is then used to transform appropriate host cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.
  • an "anticancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.
  • these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell.
  • This process may involve contacting the cells with the expression construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the expression construct and the other includes the second agent(s).
  • HS-tK simplex-thymidine kinase
  • the gene therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks, hi embodiments where the other agent and expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and expression construct would still be able to exert an advantageously combined effect on the cell.
  • gene therapy is "A” and the secondary agent, such as radio- or chemotherapy, is "B":
  • Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments.
  • Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, 5 -fluorouracil, vincristin, vinblastin and methotrexate, or any analog or derivative variant of the foregoing.
  • CDDP cisplatin
  • carboplatin carboplatin
  • ⁇ -rays X-rays
  • X-rays X-rays
  • UV-irradiation UV-irradiation
  • Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens.
  • Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
  • contacted and “exposed,” when applied to a cell are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell.
  • both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
  • Immunotherapeutics generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
  • the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
  • the antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing.
  • the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
  • the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
  • Various effector cells include cytotoxic T cells and NK cells.
  • Immunotherapy thus, could be used as part of a combined therapy, in conjunction with the present invention.
  • the general approach for combined therapy is discussed below.
  • the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells.
  • Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase ( ⁇ 97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55.
  • the secondary treatment is a secondary gene therapy in which a second therapeutic polynucleotide is administered before, after, or at the same time a first therapeutic polynucleotide encoding all of part of a therapeutic polypeptide. Delivery of a vector encoding either a full length or truncated therapeutic polypeptide in conjuction with a second vector encoding one of the following gene products will have a combined anti- hype ⁇ roliferative effect on target tissues. Alternatively, a single vector encoding both genes may be used. A variety of proteins are encompassed within the invention, some of which are described below.
  • the proteins that induce cellular proliferation further fall into various categories dependent on function.
  • the commonality of all of these proteins is their ability to regulate cellular proliferation.
  • a form of PDGF the sis oncogene
  • Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor.
  • anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression of the inducer of cellular proliferation.
  • the proteins FMS, ErbA, ErbB and neu are growth factor receptors. Mutations to these receptors result in loss of regulatable function. For example, a point mutation affecting the transmembrane domain of the Neu receptor protein results in the neu oncogene.
  • the erbA oncogene is derived from the intracellular receptor for thyroid hormone. The modified oncogenic ErbA receptor is believed to compete with the endogenous thyroid hormone receptor, causing uncontrolled growth.
  • the largest class of oncogenes includes the signal transducing proteins (e.g., Src, Abl and Ras).
  • Src is a cytoplasmic protein-tyrosine kinase, and its transformation from proto-oncogene to oncogene in some cases, results via mutations at tyrosine residue 527.
  • transformation of GTPase protein ras from proto-oncogene to oncogene results from a valine to glycine mutation at amino acid 12 in the sequence, reducing ras GTPase activity.
  • the proteins Jun, Fos and Myc are proteins that directly exert their effects on nuclear functions as transcription factors.
  • the tumor suppressor oncogenes function to inhibit excessive cellular proliferation.
  • the inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation.
  • the tumor suppressors p53, pl6 and C-CAM are described below.
  • mutant p53 has been found in many cells transformed by chemical carcinogenesis, ultraviolet radiation, and several viruses.
  • the p53 gene is a frequent target of mutational inactivation in a wide variety of human tumors and is already documented to be the most frequently mutated gene in common human cancers. It is mutated in over 50% of human NSCLC (Hollstein et al, 1991) and in a wide spectrum of other tumors.
  • the p53 gene encodes a 393-amino acid phosphoprotein that can form complexes with host proteins such as large-T antigen and E1B.
  • the protein is found in normal tissues and cells, but at concentrations which are minute by comparison with transformed cells or tumor tissue
  • Wild-type p53 is recognized as an important growth regulator in many cell types. Missense mutations are common for the p53 gene and are essential for the transforming ability of the oncogene. A single genetic change prompted by point mutations can create carcinogenic p53. Unlike other oncogenes, however, p53 point mutations are known to occur in at least 30 distinct codons, often creating dominant alleles that produce shifts in cell phenotype without a reduction to homozygosity. Additionally, many of these dominant negative alleles appear to be tolerated in the organism and passed on in the germ line. Various mutant alleles appear to range from minimally dysfunctional to strongly penetrant, dominant negative alleles (Weinberg, 1991).
  • pl6 Another inhibitor of cellular proliferation is pl6.
  • the major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK's.
  • CDK cyclin-dependent kinase 4
  • the activity of this enzyme may be to phosphorylate Rb at late G].
  • the activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl ⁇ 1 ⁇ 4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al, 1993; Serrano et al, 1995).
  • .l6 m ⁇ i protein is a CDK4 inhibitor (Serrano, 1993)
  • deletion of this gene may increase the activity of CDK4, resulting in hype ⁇ hosphorylation of the Rb protein.
  • pl6 also is known to regulate the function of CDK6.
  • pl6 WKA belongs to a newly described class of CDK-inhibitory proteins that also includes pl6 B , pi 9, p21 WAF1 , and p27 KIP1 .
  • the pl ⁇ 1 ⁇ 4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the p g iNK4 g ene are f re q Uen ⁇ m human tumor cell lines. This evidence suggests that the pl ⁇ 1 ⁇ 4 gene is a tumor suppressor gene.
  • genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-H, zacl, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, r ⁇ s, myc, neu, r ⁇ fi erb, fins, trk, ret, gsp, hst, ⁇ bl, EIA, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC. 3.
  • Apoptosis or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al, 1972).
  • the Bcl-2 family of proteins and ICE-like proteases have been demonsttated to be important regulators and effectors of apoptosis in other systems.
  • the Bcl-2 protein plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al, 1985; Cleary and Sklar, 1985; Cleary et al, 1986; Tsujimoto et al, 1985; Tsujimoto and Croce, 1986).
  • the evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists.
  • Bcl-2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., BCI XL , Bclw, Bcls, Mcl-1, Al, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax, Bak, Bik, Bim, Bid, Bad, Harakiri).
  • ERBB/HER Avz ' n erythroblastosis Amplified, deleted EGF/TGF- ⁇ / virus; ALV promoter squamous cell amphiregulin/ insertion; amplified cancer; glioblastoma hetacellulin receptor human tumors Gene Source Human Disease Function
  • NGF nerve growth human colon cancer factor
  • RET Translocations and point Sporadic thyroid cancer Orphan receptor Tyr mutations familial medullary kinase thyroid cancer; multiple endocrine neoplasias 2A and 2B
  • LCK MuLV murine leukemia Src family; T cell virus promoter signaling; interacts
  • Virus Tyr kinase with signaling function activated by receptor kinases
  • E-cadherin Candidate tumor Breast cancer Extracellular homotypic Gene Source Human Disease Function
  • PTC/NBCCS Tumor suppressor and Nevoid basal cell cancer 12 transmembrane Drosophilia homology syndrome (Gorline domain; signals syndrome) through Gli homogue CI to antagonize hedgehog pathway
  • CRK CT1010 ASV Adapted SH2/SH3 interact Abl DPC4 Tumor suppressor Pancreatic cancer TGF- ⁇ -related signaling pathway MAS Transfection and Possible angiotensin Tumorigenicity receptor NCK Adaptor SH2/SH3
  • GLI Amplified glioma Glioma Zinc fmger; cubitus interruptus homologue is in hedgehog signaling pathway; inhibitory link PTC and hedgehog
  • VHL Heritable suppressor Von Hippel-Landau Negative regulator or syndrome elongin; transcriptional elongation complex
  • INK4/MTS1 Adjacent INK-4B at Candidate MTS 1 pi 6 CDK inhibitor
  • MDM-2 Amplified Sarcoma Negative regulator p53 Gene Source Human Disease Function p53 Association with SV40 Mutated >50% human Transcription factor; T antigen tumors, including checkpoint control; hereditary Li-Fraumeni apoptosis syndrome
  • an exemplary sequence includes p53 (M14695; SEQ ID NO: 6) for cancer treatment.
  • Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.
  • Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed.
  • Tumor resection refers to physical removal of at least part of a tumor, hi addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and miscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
  • a cavity may be formed in the body.
  • Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy.
  • Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months.
  • These treatments maybe of varying dosages as well.
  • agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment.
  • additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adehesion, or agents that increase the sensitivity of the hyperprohferative cells to apoptotic inducers.
  • Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL- 2 and other cytokines; F42K and other cytokine analogs; or MTP-1, MlP-lbeta, MCP-1, RANTES, and other chemokines.
  • cell surface receptors or their ligands such as Fas / Fas ligand, DR4 or DR5 / TRAIL would potentiate the apoptotic inducing abililties of the present invention by establishment of an autocrine or paracrine effect on hyperprohferative cells.
  • Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperprohferative cell population, hi other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyerproliferative efficacy of the treatments.
  • Inhibitors of cell adehesion are contemplated to improve the efficacy of the present invention.
  • cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperprohferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.
  • FAKs focal adhesion kinase
  • Lovastatin Lovastatin
  • Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described.
  • the use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.
  • compositions of the present invention will have an effective amount of a nucleotide sequence for therapeutic administration in combination and, in some embodiments, is combined with an effective amount of a compound (second agent) that is therapeutic for the respective appropriate disease or medical condition.
  • Such compositions will generally be dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
  • effective or “therapeutically effective” as used herein refers to inhibiting an exacerbation in symptoms, preventing onset of a disease, amelioration of at least one symptom, or a combination thereof, and so forth.
  • phrases "pharmaceutically or pharmacologically acceptable” refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or human, as appropriate.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients, its use in the therapeutic compositions is contemplated. Supplementary active ingredients, such as other anti-disease agents, can also be inco ⁇ orated into the compositions.
  • other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; time release capsules; and any other form currently used, including cremes, lotions, mouthwashes, inhalants and the like.
  • compositions of the present invention may include classic pharmaceutical preparations. Administration of these compositions according to the present invention will be via any common route so long as the target tissue is available via that route. This includes oral, nasal, buccal, rectal, vaginal or topical. Alternatively, administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Such compositions would normally be administered as pharmaceutically acceptable compositions, described supra.
  • compositions of the present invention may advantageously be administered in the form of injectable compositions either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection also may be prepared. These preparations also may be emulsified.
  • a typical composition for such purposes comprises a 50 mg or up to about 100 mg of human serum albumin per milliliter of phosphate buffered saline.
  • Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oil and injectable organic esters, such as theyloleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.
  • Intravenous vehicles include fluid and nutrient replenishers.
  • Preservatives include antimicrobial agents, antioxidants, chelating agents and inert gases. The pH and exact concentration of the various components in the pharmaceutical are adjusted according to well-known parameters.
  • Oral formulations include such typical excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like.
  • the compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
  • the route is topical, the form may be a cream, ointment, salve or spray.
  • unit dose refers to a physically discrete unit suitable for use in a subject, each unit containing a predetermined quantity of the therapeutic composition calculated to produce the desired response in association with its administration, i.e., the appropriate route and treatment regimen.
  • the quantity to be admimstered both according to number of treatments and unit dose, depends on the subject to be treated, the state of the subject and the protection desired. Precise amounts of the therapeutic composition also depend on the judgment of the practitioner and are peculiar to each individual.
  • kits All of the essential materials and reagents required for therapy may be assembled together in a kit.
  • the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • an agent may be formulated into a single or separate pharmaceutically acceptable syringeable composition.
  • the container means may itself be an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the body, such as the lungs, injected into an animal, or even applied to and mixed with the other components of the kit.
  • kits of the invention may also be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means.
  • the kits of the invention may also include an instruction sheet defining administration of the gene therapy and/or the chemotherapeutic drug.
  • kits of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow- molded plastic containers into which the desired vials are retained.
  • a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow- molded plastic containers into which the desired vials are retained.
  • the kits of the invention also may comprise, or be packaged with, an instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal.
  • an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle.
  • the active compounds of the present invention will often be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or even intraperitoneal routes.
  • parenteral administration e.g., formulated for injection via the intravenous, intramuscular, subcutaneous, or even intraperitoneal routes.
  • the preparation of an aqueous composition that contains a second agent(s) as active ingredients will be l ⁇ iown to those of skill in the art in light of the present disclosure.
  • such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
  • Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions, h all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the active compounds may be formulated into a composition in a neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • the carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial ad antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying abso ⁇ tion, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by inco ⁇ orating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by inco ⁇ orating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the therapeutic formulations of the invention could also be prepared in forms suitable for topical administration, such as in cremes and lotions. These forms may be used for treating skin-associated diseases, such as various sarcomas.
  • solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, with even drug release capsules and the like being employable.
  • aqueous solutions for parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage could be dissolved in 1 mL of isotonic NaCl solution and either added to 1000 mL of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • a composition of the present invention such as an AE-DNA with an appropriate homologous exchangeable piece may be complexed with liposomes and injected into patients with cancer; intravenous injection can be used to direct the gene to all cell.
  • Directly injecting the liposome complex into the proximity of a cancer can also provide for targeting of the complex with some forms of cancer.
  • cancers of the ovary can be targeted by injecting the liposome mixture directly into the peritoneal cavity of patients with ovarian cancer.
  • the potential for liposomes that are selectively taken up by a population of cancerous cells exists, and such liposomes will also be useful for targeting the gene.
  • the dosage may vary from between about lmg composition DNA/Kg body weight to about 5000 mg composition DNA/Kg body weight; or from about 5 mg/Kg body weight to about 4000 mg/Kg body weight or from about lOmg/Kg body weight to about 3000 mg/Kg body weight; or from about 50mg/Kg body weight to about 2000 mg/Kg body weight; or from about lOOmg/Kg body weight to about 1000 mg/Kg body weight; or from about 150 mg/Kg body weight to about 500 mg/Kg body weight.
  • this dose may be about 1, 5, 10, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2500, 3000, 3500, 4000, 4500, 5000 mg/Kg body weight, h other embodiments, it is envisaged that higher does may be used, such doses may be in the range of about 5 mg composition DNA/Kg body to about 20 mg composition DNA/ Kg body.
  • the doses may be about 8, 10, 12, 14, 16 or 18 mg/Kg body weight.
  • this dosage amount may be adjusted upward or downward, as is routinely done in such treatment protocols, depending on the results of the initial clinical trials and the needs of a particular patient.
  • Non-viral gene delivery vectors for the transfer of a polynucleotide(s) of the present invention into mammalian cells also are contemplated by the present invention. These include calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990) DEAE-dexttan (Gopal, 1985), electroporation (Tur-Kaspa et al, 1986; Potter et al, 1984), direct microinjection (Harland and Weintraub, 1985), DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et al, 1979) and lipofectamine-DNA complexes, cell sonication (Fechheimer et al, 1987), gene bombardment using high velocity microprojectiles (Yang et al, 1990), and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988).
  • the sequence of the AE-DNA homologous to the target DNA is positioned accordingly.
  • the polynucleotide may be stably integrated into the genome of the cell by methods described herein. How the polynucleotide is delivered to a cell and where in the cell the nucleic acid remains is dependent on a number of factors l ⁇ iown in the art.
  • the expression vector may simply consist of naked recombinant DNA or plasmids comprising the polynucleotide. Transfer of the construct may be performed by any of the methods mentioned above which physically or chemically permeabilize the cell membrane. This is particularly applicable for transfer in vitro, but it may be applied to in vivo use as well.
  • Dubensky et al. (1984) successfully injected polyomavirus DNA in the form of calcium phosphate precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (1986) also demonstrated that direct intraperitoneal injection of calcium phosphate- precipitated plasmids results in expression of the transfected genes. It is envisioned that DNA encoding a gene of interest may also be transferred in a similar manner in vivo and express the gene product.
  • transfer of a naked DNA into cells may involve particle bombardment.
  • This method depends on the ability to accelerate DNA- coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987).
  • Several devices for accelerating small particles have been developed.
  • One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al, 1990).
  • the microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.
  • a polynucleotide may be entrapped in a liposome, another non-viral gene delivery vector.
  • Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated are lipofectamine-DNA complexes.
  • the liposome may be complexed with a hemagglutinatin virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989).
  • the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991).
  • HMG-1 nuclear non-histone chromosomal proteins
  • the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. h that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase.
  • receptor-mediated delivery vehicles that can be employed to deliver a nucleic acid encoding a particular gene into cells. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993).
  • Receptor-mediated gene targeting vehicles generally consist of two components: a cell receptor-specific ligand and a DNA-binding agent.
  • ligands have been used for receptor-mediated gene transfer. The most extensively characterized ligands are asialoorosomucoid (ASOR) (Wu and Wu, 1987) and transferrin (Wagner et al, 1990).
  • ASOR asialoorosomucoid
  • transferrin Wang a synthetic neoglycoprotein, which recognizes the same receptor as ASOR, has been used as a gene delivery vehicle (Ferkol et al, 1993; Perales et al, 1994) and epidermal growth factor (EGF) has also been used to deliver genes to squamous carcinoma cells (Myers, EPO 0 273 085).
  • the delivery vehicle may comprise a ligand and a liposome.
  • a ligand and a liposome For example, Nicolau et al: (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, inco ⁇ orated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes.
  • a nucleic acid encoding a particular gene also may be specifically delivered into a cell type by any number of receptor-ligand systems with or without liposomes.
  • epidermal growth factor (EGF) may be used as the receptor for mediated delivery of a nucleic acid into cells that exhibit upregulation of EGF receptor.
  • Mannose can be used to target the mannose receptor on liver cells.
  • DNA transfer may more easily be performed under ex vivo conditions.
  • Ex vivo gene therapy refers to the isolation of cells from an animal, the delivery of a nucleic acid into the cells in vitro, and then the return of the modified cells back into an animal. This may involve the surgical removal of tissue/organs from an animal or the primary culture of cells and tissues.
  • African green monkey kidney (Vero) cells, human embryonic fibroblasts (HF 333.We), human tumor cell lines U-87 MG (glioblastoma), Hep 3B (hepatocellular carcinoma) and human prostate cancer line DU 145 were obtained from American Tissue Culture Collection (Rockville, MD). All the cells were cultured with DMEM containing 10% fetal bovine serum (FBS).
  • FBS fetal bovine serum
  • HSV-delta-pac a bacterial artificial chromosome (BAC) construct containing a mutant form of HSV-1 genome (with deletion of y34.5 genes and HSV packaging signals) (Saeki et al, 1998).
  • Infectious HSV were generated from fHSV-delta-pac by a 2-step procedure (FIG. 1).
  • gene cassettes including enhanced green fluorescent protein (EGFP) and GALV-fus were first cloned into pSZ-pac, which contains a copy of the HSV pac (an exemplary sequence being SEQ TD NO: 14) and a cytomegalovirus immediate early promoter.
  • EGFP enhanced green fluorescent protein
  • GALV-fus were first cloned into pSZ-pac, which contains a copy of the HSV pac (an exemplary sequence being SEQ TD NO: 14) and a cytomegalovirus immediate early promoter.
  • the EGFP gene cassette was cut out from pEGFP- Nl (Clontech) with Asel and Afllll and cloned into pSZ-pac, to create pSZ-EGFP.
  • the GALV.fus gene was cut out from pCR3.1-GALV with Nhel and Notl and cloned into pSZ-pac, to generate pSZ-GALV.
  • the promoter and the enhancer region (das) of UL38 have been well defined (Guzowski and Wagner, 1993).
  • the promoter was amplified (including the das sequence) from HSV-1 genome with this pair of oligos: forward primer 5' GTGGGTTGCGGACTTTCTGC 3' (SEQ ID NO:l), and reverse primer 5' ACACTCACGCAAGGCGGAAC 3' (SEQ ID NO:2).
  • the PCR product was cloned into pSZ- pac to replace the CMV promoter, to generate plox-UL38P.
  • the GALV.fus gene obtained from Nhel and Notl digestion was then cloned into plox-UL38P so that the gene is driven by the UL38 promoter, to generate pSZ-38P-GALV.
  • Infectious HSV was obtained from fHSV-delta-pac, the GALV.fus or EGFP, together with the HSV pac, by cutting out from pSZ-EGFP based plasmids (pSZ-EGFP, pSZ-GALV, pSZ-38P-GALV) and direct ligation into the unique Pad site of fHSV-delta-pac.
  • the DNA ligation mixture was transfected into Vero cells using Lipofectamine (Gibco-BRL) and incubated for 3-5 days for the infectious virus to be generated.
  • viruses designated Baco- 1 (containing the DNA fragment of EGFP and pac), Synco-1 (containing the DNA fragment of CMV-GALV.fus and pac) and Synco-2 (containing UL38P-GALV.fus and pac), were subsequently plaque purified.
  • Virus stocks were prepared by infecting Vero cells with the viruses at 0.01 plaque-forming units (pfu) per cell, and were harvested after 2 days and stored at -80°C.
  • Phenotypic Characterization of fusogenic oncolytic HSVs [0247] Cells were seeded into six-well plates and infected the following day with each virus at a dose ranging from 0.1 to 0.0001 pfu/cell. Cells were cultured in a maintenance medium (containing 1% FBS) and were left for up to two days to allow the fusion pattern and plaques to develop. To block HSV replication, acyclovir was added into the culture medium at a final concentration of 100 ⁇ M.
  • Lovastatin is a chemical that induces cell-cycle arrest but does not interfere with HSV replication (Schang et al, 1998).
  • Each of the three human tumor cell lines were seeded into 48-well plates and were infected with each virus at 0.1 and 0.01 pfu/cell, or were left uninfected. Cells were harvested 24 h and 48 h later through trypsinization. The number of surviving cells was counted on a hemocytometer following trypan blue staining. The percentage of cell survival was calculated by dividing the number of viable cells from the infected well by the number of cells from the well that was left uninfected. The experiments were done in triplicate, and the averaged numbers were used for the final calculation.
  • mice were sacrificed 5 days after virus or PBS injection. The tumors were removed, fixed and stained with hematoxylin and eosin. [0251] Statistical values are presented as mean ⁇ standard deviation of the mean; comparisons were made using student's t-test. Statistical significance was defined as p ⁇ 0.05.
  • fHSV-delta-pac is a bacterial artificial chromosome (BAC) based construct that contains a mutated HSV genome, in which the diploid gene encoding r34.5 was partly deleted, and both copies of HSV packaging signal (pac) were completely deleted (Saeki et al, 1998).
  • BAC bacterial artificial chromosome
  • infectious HSV can not be generated from the construct unless an intact HSV pac is provided in cis. Also, any virus eventually generated from this construct will be replication selective, due to the partial deletion of y 34.5 gene.
  • the GALV.fus gene cassette (driven by CMV immediate early promoter) was linked with an intact HSV pac in a plasmid. The GALV.fus-pac sequence was then ligated directly into the unique Pad site located in the BAC sequence of fHSV-delta-pac. The ligation mixture was directly transfected into Vero cells, and the virus grown from the cells was collected and plaque purified. One of the plaque-purified viruses was named Synco-1 and was used subsequently.
  • Synco-1 was phenotypically characterized. Human cancer cells of different tissue origins were infected with the virus at a low multiplicity of infection (MOI). At 36 h after infection, a clear syncytial phenotype was observed on all of the three tumor cells tested (FIG. 2, bottom panel). By average, each syncytium covers an area of around 1,000 cells, indicating that a large number of tumor cells were involved in each syncytium. On the other hand, no obvious syncytium was observed in the same tumor cells that were infected with Baco-1 (FIG. 2, top panel), which was also derived from fHSV-delta-pac but contains the EGFP gene instead of GALV.fus. The area covered by each individual plaque from Baco-1 was substantial smaller than the syncytia from Synco-1.
  • FMG-mediated syncytial formation in the context of oncolytic HSV was demonsttated to result in an increased tumor cell killing.
  • the cell viability was compared after the cells were infected with either Baco-1 or Synco-1 at a relatively low MOI (0.1 and 0.01 pfu/cell), so that both the inherent cytotoxicity of the input virus as well as the ability of the virus to replicate and spread in these cells could be assessed.
  • the cytotoxic effect of the virus infection on the tumor cells was quantified by calculating the percentage of cells that survived at different time points after the virus infection. In general, Synco-1 had a significantly stronger ability to kill these tumor cells than Baco-1 at both time points and with both viral doses (FIGS. 3A and 3B).
  • EXAMPLE 3 ENHANCED ANTI-TUMOR EFFECT OF SYNCO-1 IN XENOGRAFTED HUMAN CANCER [0255]
  • the syncytial phenotype and the enhanced tumor cell killing ability of Synco-1 converted to an enhanced anti-tumor effect in vivo.
  • the virus was injected directly into established xenografts of Hep 3B, with tumor diameters ranging from 5 mm to 8 mm.
  • a single intratumoral injection was given with a dose of 1X10 7 pfu. This is in contrast to literatures where multiple injections with substantially higher viral dose were usually given (Mineta et al, 1995; Pawlik et al., 2000).
  • the tumor size was measured weekly for 4 weeks.
  • some of the late transcripts can be catagorized as strict late, whose expression are strictly depending on the initiation of viral DNA replication. It was reasoned that directing GALV.fus expression with such a strictly late viral promoter, in the context of an oncolytic HSV, leads to a high level, selective GALV.fus gene expression in tumor tissues.
  • the UL38 promoter is a well-characterized strictly late viral gene and its promoter region has been well defined (Guzowski and Wagner, 1993).
  • the GALV.fus gene was linked with the UL38 promoter and subsequently inserted as the gene cassette into fHSV-delta- pac by the strategy described in FIG. 1, to create Synco-2.
  • Infection of different human tumor cells with Synco-2 showed that this virus also has a clear syncytial phenotype in these cells (FIG. 5 A, 5B, 5C) and the extent of the cell fusion is similar to that of Synco-1 (as shown in FIG. 2).
  • Syncytial fonnation is indeed part of the oncolytic process of Synco-1 and Synco-2 mediated anti-tumor therapy.
  • Established Hep 3B tumors were injected with oncolytic HSVs or PBS, and the tumors were excised 5 days later. Examination of stained tumor sections revealed that syncytia comprising a varying number of cell nucleus were frequently encountered across the tissue section of tumors injected with either Synco-1 or Synco-2 viruses (FIG. 6B). Such syncytia were not seen in tissue sections of tumors injected with either Baco-1 or PBS.
  • Vero African green monkey kidney fibroblasts
  • human embryonic fibroblasts HF 333.We
  • Hep 3B human liver cancer cells
  • the promoter and the enhancer region (das) of UL38 which has been well defmed (Guzowski and Wagner, 1993), was amplified from HSV-1 DNA with the following pair of primers: forward 5 -GTGGGTTGCGGACTTTCTGC-3 ' (SEQ ID NO:l) and reverse 5 - ACACTCACGCAAGGCGGAAC-3' (SEQ ID NO:2).
  • the amplified promoter sequence was cloned into the unique Ncol site of plox-3H, which lies next to a copy of the HSV packaging signal flanked by recognition sites for the restriction enzyme Pad, to generate plox-UL38p.
  • SEAP alkaline phosphatase
  • PIMJ-pac-AP was constructed by inserting the same AP gene (Hpal-Hindlll fragment of pSEAP-control) into the downstream of the CMV-P contained in pIMJ-pac, which lies next to a copy of HSV pac flanked by Pad recognition sites.
  • Pure plasmid DNA was obtained by alkaline lysis of bacterial culture and purified by QIAGEN-tip 500 column (QIAGEN, Valencia, CA).
  • fHSV-delta-pac is a bacterial artificial chromosome (BAC)-based HSV construct.
  • HSV packaging signal As the diploid gene encoding ⁇ 34.5 and both copies of HSV packaging signal (pac) have been deleted from the HSV sequence contained in fHSV-delta-pac (Saeki et al, 1998), infectious HSV cannot be generated from this construct unless an intact HSV pac is provided in cis, and the generated virus is replication-conditional due to the deletion of both copies of ⁇ 34.5 gene.
  • the ligation mixture was directly ttansfected into Vero cells using Lipofectamine (Gibco- BRL) and incubated for 3-5 days for the infectious virus to be generated.
  • the viruses designated Baco-APl (containing CMV-P-AP cassette) and Baco-AP2 (containing UL38p-AP cassette), were subsequently plaque purified.
  • AP gene in the viruses was confirmed by detection of AP expression.
  • Vero cells were infected with each of the virases at 0.01 plaque-forming unit (pfu) per cell. The viruses were harvested 2 days later and subjected to 3 cycles of freeze-thaw, which was followed by 1 cycle of sonication. Cell debris was removed by low-speed centrifugation (2,000 g at 4°C for 10 min), and the virus stocks were stored at -80°C.
  • Vero cells were seeded in 6-well plates one day earlier at 2X10 5 cells/well and incubated at 37°C in a 5% CO 2 atmosphere.
  • the plasmid DNA (2 ⁇ g) of pLox-AP or pIMJ-pac-AP was mixed with 5 ⁇ l of lipofectamine (GibcoBRL) according to the manufacturer's instruction.
  • the liposome-formulated DNA was added to 1 ml of DMEM without serum.
  • the cells (about 70% confluent) were exposed to the DNA-liposome complex for 3 h at 37°C, after which the transfection mixture was replaced with 2ml DMEM containing 10% FBS.
  • the cells were either infected with 0.1 pfu/cell of Baco-1, an oncolytic HSV constructed the same way as Baco-APl or Baco-AP2 but contains the EGFP gene cassette instead, or mock infected (with medium only). The medium was collected 24 h later for the measurement of AP release.
  • the embryonic fibroblasts were either kept in cycling phase by growing in medium containing 10% FBS, or were anested with 20 ⁇ M lovastatin for 30 h in serum-free medium.
  • Lovastatin is a chemical that induces cell-cycle anest but does not interfere with HSV replication (Schang et al, 1998).
  • the cells were then infected with either Baco-APl or Baco-AP2 at 0.1 pfu/cell and the medium was collected 24 h after infection for the quantification of AP release.
  • AP activity in culture medium or blood serum was quantified using a commercial detection kit from CLONTECH Laboratories, Inc. (Palo Alto, CA). The assay was performed according to the manufacturer's instructions. Briefly, 25 ⁇ l of sample was added to 75 ⁇ l of IX dilution buffer. After gentle mixing, the diluted samples were incubated at 65°C for 30 min. The samples were cooled to room temperature, and 100 ⁇ l of assay buffer was added to each sample, followed by incubation for 5 min. at room temperature. Finally, samples were mixed with the solution containing chemilummescent substrate C and enhancer at a ratio of 1 :20, and incubated for 30 min at room temperature. The chemilummescent emission was detected using a luminometer (Turner Designs Instruments; Sunnyvale, CA). Animal Studies
  • mice Six-week-old female Hsd athymic (nu/nu) mice were obtained from Harlan (Indianapolis, Indiana). For the establishment of liver cancer, Hep 3B cells were cultured in standard conditions and were harvested in log phase with 0.05% trypsin-EDTA. The cells were washed twice with serum-free medium before they were resuspended in PBS at a concentration of 5 x 10 7 cells/ml. A total of 5 x 10 6 cells (in a 100- ⁇ l suspension) were subcutaneously injected into the right flank of each mouse. For inttatumoral injection, when the tumors reached approximately 8 mm in diameter, they were injected with viruses (5 x 10 6 pfu in a 100 ⁇ l volume).
  • mice without established tumor were injected with the same amount of viruses. Blood was withdrawn from the mice at days 1, 2, 3, 4, 5 and 7 after virus inoculation for quantification of AP release.
  • the SEAP gene was linked with the UL38 promoter (UL38p).
  • the same SEAP gene was also linked to the CMV-P as a control.
  • an enforced ligation strategy was utilized, which is more reliable and efficient for cloning foreign genes into HSV genome than the traditional homologous recombination. As depicted in FIG.
  • fHSV-delta-pac is a bacterial artificial chromosome (BAC) based construct that contains a mutated HSV genome, in which the diploid gene encoding ⁇ 34.5 was partly deleted, and both copies of HSV packaging signal (pac) were completely deleted (Saeki et al, 1998). Therefore, infectious HSV can not be generated from this construct unless an intact HSV pac is provided in cis. Any virus generated from this construct will be replication selective, due to the partial deletion of both copies of the y34.5 gene.
  • BAC bacterial artificial chromosome
  • the SEAP gene cassettes were initially cloned into a middle plasmid to generate pEVIJ-pac-AP and pLox-AP in which the gene cassettes are flanked by the recognition sites of restriction endonuclease Pad.
  • the DNA fragments were then cut out with Pad and ligated into the unique Pad site located in the BAC sequence of fHSV-delta-pac.
  • the ligation mixture was directly ttansfected into Vero cells and the virus grown from the cells was collected and plaque purified, to generate Baco-APl (containing CMV-P-SEAP cassette) and Baco-AP2 (containing UL38p- SEAP cassette), respectively (FIG. 7).
  • the two virases (Baco-APl and Baco-AP2) were then directly compared for their growth property in vitro. Vero cells were infected with the virases at three different multiplicities of infection: 0.1, 1, and 5 plaque forming units (pfu) per cell. The virases were harvested 24 and 48 h after infection and titrated by a plaque assay. There was no significant difference in the replication of these two viruses (Table 4).
  • the activity of UL38p in an oncolytic HSV in vitro was characterized.
  • the promoter activity was compared in normal human cells in either a quiescent or a cycling state.
  • Primary human fibroblasts were plated in 12-well plates in duplicate.
  • One set was treated with 20 ⁇ M lovastatin, a drag that induces cell-cycle anest but does not interfere with HSV replication (Schang et al, 1998).
  • Both anested and un-treated (i.e. cycling) cells were then infected with either Baco-APl or Baco-AP2 at 0.1 pfu/cell.
  • the culture medium was collected 24 h after infection and the AP in the medium was quantified.
  • a human xenografted liver tumor (Hep 3B) was established subcutaneously on the right flank of athymic nude mice. Once the tumor size reached around 8 mm in diameter, the virases (Baco-APl or Baco-AP2) were injected mttatumorally at a dose of 5X10 6 pfu. At the same time, mice that did not receive tumor inoculation were injected with the same amount of the viruses either by intravenous (i.v.) or intramuscular (i.m.) injection. Blood was collected at different time points after virus injection and quantified for the AP release.
  • i.v. intravenous
  • i.m. intramuscular
  • the AP concentration in the mice injected mttatumorally with either of the virases started to increase by day 2 after virus administration, and reached their peak level by day 3.
  • the AP release started to decline afterwards, but was maintained at a relatively high level for the rest of the experiment (FIG. 10).
  • the AP release from Baco-APl was marginally higher than that of Baco-AP2 during the entire experiment except on the last time point (day 7) when the former was slightly lower than the later (P>0.05).
  • P>0.05 the AP release at day 2
  • African green kidney (Vero) cells were purchased from American Tissue Culture Collection (Rockville, MD). The human cell line HEY and SKOV3 were kindly gifted from Dr. Robert Bast (MD Anderson Cancer Center, Houston, Texas). Hey cell was established from a peritoneal deposit of a moderately differentiated papillary ovarian cystoadenocarcinoma, and it has been reported to be moderately resistant to chemotherapeutic agent (Selby et al., 1980; Buick et al., 1985). All cells were cultured with DMEM containing 10% fetal bovine seram (FBS) and antibiotics in a humidified 5% CO 2 atmosphere. Female Hsd athymic (nu/nu) mice (obtained from Harlan, Indianapolis, Indiana) were bred under specific pathogen-free conditions and used for experiments at age of 7 to 8 weeks.
  • FBS fetal bovine seram
  • the GALV.fus or EGFP gene cassette that was linked with the HSV pac was then cut from the plasmids and directly ligated into the unique Pad site of fHSV-delta-pac.
  • the ligation mixture was directly transfected into Vero cells using LipofectAMINE (Gibco-BRL) and incubated for 3- 5 days for infectious viras to be generated.
  • the virases were subsequently plaque purified were designated Baco-1 (containing the DNA fragment of EGFP and pac) and Synco-2 (containing UL38-GALV.fus and pac).
  • Membrane fusion capability was first introduced into a conventional oncolytic HSV, Baco-1 (2), through random mutagenesis of inco ⁇ oration of the thymidine analogue BrdU during viral replication in Vero cells (Fu and Zhang, 2002).
  • the viras was phenotypically identified and purified to homogeneity.
  • One of the plaque-purified virases, designated Synco-2D was chosen for further characterization.
  • Hey or SKOV3 ovarian cancer cells were seeded into 6-well plates, and then infected the following day with Baco-1 or Synco-2D at a dose of 0.01 pfu/cell.
  • Cells were cultured in a maintenance medium (containing 1% FBS) and were left for up to 2 days to allow the fusion pattern and plaques to develop.
  • a maintenance medium containing 1% FBS
  • the number of viable cells was counted on a hemocytometer after trypan blue staining.
  • the percentage of cell viability was calculated by dividing the number of viable cells from the infected well by the number of cells from the well that was left uninfected. The experiments were done in triplicate, and the averaged numbers were used for the final calculation.
  • Hey cells were harvested from subconfluent cultures by a brief exposure to 0.25% trypsin and 0.05% EDTA. Trypsinazation was stopped with medium containing 10%FBS, and cells were washed once in serum-free medium and resuspended in PBS. Only single cell suspensions with >95% viability were used for the in vivo injection. Briefly, on day 0, 3x10 5 viable Hey cells were inoculated into the peritoneal cavities of 8 weeks old female nude mice. On day 14 and 28 after tumor inoculation, intraperitoneal administration of HSV vector (2xl0 7 pfu/200 ⁇ l) was initiated at a different site from tumor cells inoculated.
  • mice were implanted with Hey tumor and randomized into three groups of eight animals. These groups included; (a) controls to which phosphate-buffer saline (PBS) was administered; (b) mice treated on day 14 and 28 with Baco-1; and (c) mice treated on day 14 and 28 with Synco-2D. On day 42 after tumor cell inoculation, mice were euthanized by CO 2 exposure and subjected to macroscopic (number of tumor nodule, tumor volume) analysis in a blinded fashion.
  • PBS phosphate-buffer saline
  • the inventors sought to overcome deficiencies in the art including reduced potency of virases in tumors due to deletions that confer viral replication selectivity and, unlike other therapeutic strategies (such as prodrug enzyme delivery), the antitumor activity of oncolytic HSV does not potentiate a significant bystander effect.
  • the bystander effect is considered to be crucial for effective antitumor therapy for advanced cancers, particularly ovarian, because it compensates for the limited efficiency of vector delivery and spread in, for example, the abdominal cavity. Therefore, it is likely that additional improvements on both the potency and killing ability of these oncolytic virases is a requisite to obtaining a clear clinical benefit for cancer treatment, particularly for ovarian cancer.
  • FMGs viral fusogenic membrane glycoproteins
  • the present inventors have modified the fusogenic potency of oncolytic HSV.
  • the present inventors have generated a new type of fusogenic HSV vector by combination of random mutagenesis and insertion of GALV.fus.
  • the extent of syncytial formation induced by HSV infection was examined in vitro.
  • the antitumor efficacy of the viras was evaluated in an orthotopic model of advanced ovarian cancer in athymic mice.
  • Synco-2 was subjected to random mutagenesis through inco ⁇ oration of the thymidine analogue BrdUrd during its replication in Vero cells.
  • the mutagenized virus stock was then screened for the ability to confer a syncytial phenotype on infection of Vero cells. Plaques that were predominantly formed from syncytial fonnation were collected, and one isolate, designated Synco-2D, consistently showed a strong syncytial phenotype after a few passages. After then, this viras purified to homogeneity tlirough multiple rounds of plaque purification from 100% of plaques displayed a syncytial phenotype.
  • Each plaque from Synco-2D infection covered an area equivalent to several hundred cells, in sha ⁇ contrast to those from Baco-1 infection in which substantially fewer cells were involved.
  • the infection foci from Baco-1 infection had gotten larger, but by 72 h the monolayer still had not reached 100%o CPE.
  • the cells infected by Synco-2D displayed a markedly different phenotype; by 48 h, the cells in the entire dish were fused together (and appeared like a "fishing net"), and by 72 h, the cells appeared contracted (resembling a "a big lake”).
  • the ability of Synco-2D to destroy tumor cells was further characterized.
  • the cells were infected with Baco-1 or Synco-2D at a relatively low multiplicity of infection (0.1 and 0.01 pfu/cell), which assesses both the inherent cytotoxicity of the input viras as well as the ability of the viras to replicate and spread in these cells.
  • the cytotoxic effect of the virus infection on the tumor cells was quantified by calculating the percentage of cells that survived after the viras infection. In Hey and SKOV3 cell lines, Synco-2D had a significantly stronger ability to kill these tumor cells than Baco-1 (p ⁇ 0.01).
  • Hey ovarian cancer cell (3xl0 5 ) were inoculated into the peritoneal cavity of nude mice. [0286] After 14 days of Hey cell inoculation, group of mice were treated with once per two weeks
  • African green monkey kidney (Vero) cells were purchased from American Tissue Culture Collection (Rockville, MD). Vero cells were cultured with DMEM containing 10%o fetal bovine serum (FBS) and antibiotics in a humidified 5% CO 2 atmosphere.
  • PC-3M-Pro4 cell is a highly metastatic prostate cancer cell line (Pettaway et al, 1996). This cell line was grown in RPMI 1640 supplemented with 10%o FBS. For in vivo inoculation, cells were harvested from culture flasks after a brief trypsinization. Only single-cell suspensions of >95% viability (trypan blue exclusion) were used for inoculation.
  • the oncolytic HSVs were derived from fHSV-delta-pac, a bacterial artificial chromosome (BAC)-based HSV construct, and the details for their construction has been described elsewhere (Fu et al, in press, Molecular Therapy; Nakamori et al, in press, Clinical Cancer Research). Briefly, to generate Baco-1 and Synco-2, the enhanced green fluorescent protein gene (EGFP, for Baco-1) or GALV.fus (for Synco-2), together with the HSV packaging signal sequence, were ligated into the unique Pad site in fHSV-delta-pac. The ligation mixture was subsequently transfected into Vero cells for viras production.
  • EGFP enhanced green fluorescent protein gene
  • GALV.fus for Synco-2
  • Baco-1 was initially subjected to random mutagenesis followed by screening for the syncytial phenotype as described (Fu and Zhang, 2002). After that, the circular form of viral DNA was obtained by extracting virion DNA from Vero cells shortly (1 h) after virus infection, through a method previously described (Zhang et al, 1994). The viral DNA was then transformed into competent E. coli cell DH-10B tlirough electroporation. The gene cassette encoding green fluorescent protein (GFP) in the Baco-1 viral genome was then cut out with Pad and replaced with GALV.
  • GFP green fluorescent protein
  • the ligation mixture was directly ttansformed into Vero cells using LipofectAMINE (GIBCO-BRL) and incubated for 3-5 days for infectious virus to be generated.
  • the viras was subsequently plaque purified.
  • Viral stocks were prepared by infecting Vero cells with the viruses at 0.01 plaque- forming units (pfu) per cell, harvested after 2 days and stored at -80°C. The viral titers were quantified by plaque assay and were represented as plaque forming units (pfu).
  • PC-3M-Pro4 cancer cells were seeded into 6-well plates. The cells were infected the following day with serially diluted virases (Baco-1, Synco-2, or Synco-2D) and were cultured in a maintenance DMEM medium (containing 1% FBS) for up to 3 days to allow the fusion pattern and plaques to develop.
  • a maintenance DMEM medium containing 1% FBS
  • PC-3M-Pro4 cells were plated at 5x10 4 cells/well in 12-well plate. Cells were infected by Baco-1, Synco-2 or Synco-2D at 0.01 and 0.1 pfu/cell, respectively.
  • Cells were harvested at 24 h intervals, and the cell viability was determined using trypan blue staining. The percentage of cell viability was calculated by dividing the number of viable cells from the infected well by the number of cells from the well that was left uninfected. The experiments were done in triplicate, and the averaged numbers were used for the final calculation.
  • mice (7-8 week old) were obtained from Harlan (Indianapolis, Indiana) and were kept in groups of four or fewer under specific pathogen- free conditions. All animal studies were approved Baylor College of Medicine Animal Care and Use Subcommittee and were performed in accordance with its policies. For surgical procedures, all of the mice were anesthetized with an intraperitoneal injection of mixture solution containing 2.5% 2,2,2-tribromoethanol and tert-amylalcohol (1:1). Orthotopic inoculation was performed according to a procedure described in the literature (Stephenson et al., 1992). Briefly, a transverse incision was made in the lower abdomen.
  • oncolytic HSVs such as, for example, Synco-2D
  • oncolytic HSVs is a potent therapeutic agent on this exemplary tumor model and that intravenous administration of this viras led to a significant shrinkage of the primary tumor and a dramatic reduction of tumor nodules in the lung.
  • the exemplary human prostate cancer cell line PC-3M-Pro4 was chosen for both in vitro and in vivo experiments. This cell line was selected from PC-3M tlirough repeated cycles of orthotopic inoculation harvest in athymic mice, and has been shown to efficiently establish lung metastases after intravenous injection into immune deficient mice (Pettaway et al., 1996). To phenotypically characterize Synco-2D on human prostate cancer line PC-3M-Pro4, the cells were infected with serially diluted viruses (Baco-1, Synco-2, or Synco-2D). At different times after infection, photos were taken from a typical plaque formed by virus infection. As shown in FIG.
  • PC-3M-Pro4 cells were infected with Baco-1, Synco-2, or Synco-2D at a relatively low multiplicity of infection (0.1 and 0.01 pfu/cell), which assesses both the inherent cytotoxicity of the input virus as well as the ability of the viras to replicate and spread in these cells.
  • the cytotoxic effect of the viras infection on the tumor cells was quantified by calculating the percentage of cells that survived after the virus infection against the cells in a well that received no virus infection.
  • mice were checked surgically and all of them were found to have primary tumor formation at sizes around 2 mm in diameter. At that time point, mice were given first intravenous injection (through tail vein) of either oncolytic viruses (Baco-1, Synco-2 or Synco-2D) at a dose of 2X10 7 or the same volume (00 ⁇ l) of PBS as a control. A repeated injection with the same dose of virus was given one week later.
  • oncolytic viruses Baco-1, Synco-2 or Synco-2D
  • Lung metastases were established through tail vein injection of PC-3M-Pro4 (1 x 10 5 /100 ⁇ l), which was given one day after orthotopic tumor inoculation.
  • the therapeutic scheme was the same as described in FIG. 18.
  • mice were euthanized by CO 2 inhalation and their lungs were resected, washed in saline, and placed in Bouin's fixative. After then, lung metastases were counted with the aid of a dissecting microscope 24 h later.
  • ND not detected; " p ⁇ 0.01 as compared with control; b pO.Ol as compared with Baco-1; c p ⁇ 0.05 as compared with Synco-2
  • mice that were given Baco-1 only had half of the metastatic nodules in their lung. The most dramatic result was obtained in the group where mice received Synco-2D administration. On average, only 1.l ⁇ I .6 tumor nodules per lung were found in the animals in this group, which is significantly less than the number of lung metastatic nodules (6.8 ⁇ 2.2) recorded in animals tteated with Synco-2 (p 0.0424). On the other hand, both Synco-2 and Synco-2D had a significantly better therapeutic effect on lung metastasis than Baco- 1 (p ⁇ 0.01).
  • Immunotherapy is potentially a very useful treatment modality for cancer, as it has the ability to eradicate residual tumors that are difficult to manage by conventional or other gene therapy approaches.
  • tumor-associated antigens that have been identified recently (Boon and van der Braggen, 1996)
  • clinical success using these antigens as vaccines has yet to be shown.
  • cancer vaccines derived from whole tumor cells which theoretically covers the entire repertoire of tumor antigens in a single vaccine preparation, have been extensively exploited (Dranoff et al., 1993; Whitney et al., 2000).
  • the success of this whole-cell vaccine approach either through ex vivo or in vivo manipulation, will largely depend on the development of simple and efficient strategies to stimulate tumor antigen presentation in vivo.
  • a fusogenic oncolytic HSV releases a large quantity of tumor antigens, and the unique mechanism of tumor destruction by syncytia fonnation facilitates the tumor antigen presentation, leading to the generation of a potent antitumor immunity.
  • the combined action of a fusogenic oncolytic HSV (whose direct oncolysis can debulk established breast cancer, for example) and the induced antitumor immunity that can clear the residual tumor, will lead to a complete eradication of established cancer, such as, for example, breast cancer.
  • Murine tumor cells are non-permissive to HSV infection.
  • murine tumor cell lines moderately permissive to oncolytic HSV infection are N18 (neuroblastoma), MC26 (colon carcinoma) and EJ-6-2-Bam-6a Ras-transformed fibroblasts (Chahlavi et al., 1999; Yoon et al., 2000; Lambright et al., 2000).
  • N18 neuroblastoma
  • MC26 colon carcinoma
  • EJ-6-2-Bam-6a Ras-transformed fibroblasts Choahlavi et al., 1999; Yoon et al., 2000; Lambright et al., 2000.
  • To identify murine mammary tumor cells suitable for establishing tumors in syngeneic immune competent mice a panel of murine mammary tumor cell lines were collected and screened.
  • 4T1 a 6- thioguanine-resistant cell line derived from a BALB/c spontaneous mammary carcinoma and kindly provided by Dr. Fred Miller (Michigan Cancer Foundation, Detroit, MI) (Aslakson et al., 1992), was found to be moderately sensitive to oncolytic HSV infection.
  • phenotypic characterization of fusogenic oncolytic HSVs in this cell line showed that only infection of the doubly fusogenic Synco-2D could induce syncytia formation.
  • 4T1 is non- immunogenic and highly malignant and metastatic in syngeneic BALB/c mice (Aslakson et al., 1992; Pulaski and Osttand-Rosenberg, 1998).
  • Cells (lxlO 5 4T1 cells) were orthotopically injected into mammary fat pat of immune competent BALB/c mice for the establishment of primary tumor, and the mice were left for 2 weeks for lung metastases to develop.
  • the results indicate that the unique mechanism of tumor destruction by the doubly fusogenic oncolytic HSV enhanced tumor antigen presentation, leading to a better antitumor immunity, which may have directly contributed to the enhanced antitumor activity, especially on the distant metastatic tumors.
  • a potent FMG such as a GALV
  • oncolytic HSV can dramatically increase its anti-tumor potency, hi specific embodiments, this is because, unlike other virases such as adenovirus, cell membrane fusion is a natural part of HSV infection process.
  • the virus infection cycle is therefore unaffected by the cloning of the GALV.fus gene into its genome. This allows the syncytial formation and viras replication to work synergistically to destroy tumor cells when the viras reaches tumor sites, hi addition, other synergies may also come from the combined actions of these two totally different anti-tumor mechanisms.
  • tumors unlike in vitro cultured tumor cells that are relatively homogenous, many tumors contain cells of different lineages, in which some may be resistant to HSV infection due to, for example, lack of viral receptors on the cell surface.
  • the combined anti-tumor action from two completely different mechanisms significantly reduces the occunence of virus-resistant tumor cells, because those cells that become resistant to oncolytic viras infection/replication may be indirectly desttoyed by syncytial fonnation.
  • GALV.fus is prefened rather than the FMG from human immunodeficiency viras type 1 (HIV-1), which has recently been cloned into an oncolytic adenovirus, also for the piupose of enhancing oncolytic potency of the virus (Li et al., 2001); FMG from HIN-1 can only induce syncytia in the presence of CD4 + target cells, while the GANL.fus receptor Pit-1 is widely distributed on human cell surface and GALV.fus therefore can target a much wider range of tumor cells.
  • oncolytic virases can rapidly spread in cultured tumor cells, viral spreading within a solid tumor mass is often limited (Heise et al, 1999). The large size of the viral particles may contribute to the inefficiency of viral spreading in vivo.
  • the cell membrane fusion mediated by GALV.fus may facilitate the spreading of the oncolytic HSV in the tumor mass so that a larger area of the tumor is affected.
  • the program of HSV gene expression during its lytic infection can be readily divided into early and late phases.
  • the early genes are transcribed prior to viral D ⁇ A replication while the late genes are expressed at high levels only after viral D ⁇ A replication has taken place.
  • a few genes in the late phase, including UL38, are classified as strictly late, which are only reliably detectable after the onset of viral D ⁇ A replication.
  • the initial characterization on a secreted form of alkaline phosphatase showed that without productive HSV replication, the UL38 promoter activity is extremely low. However, the UL38 promoter activity is almost equivalent to CMV IE promoter once the viras is undergoing lytic infection.
  • Oncolytic virases developed from HSV have shown great utility for treating solid tumors and are cunently in clinical trial for patients with brain tumors (Markert et al, 2000; Rampling et al, 2000); they are also suitable vectors for delivering therapeutic genes for cancer treatment.
  • conditionally-replicating vectors have several advantages. First, unlike the defective vectors that are merely functioning as a delivering vehicle, oncolytic HSVs themselves possess a very high therapeutic index against the tumor. Any anti-tumor effect from the delivered therapeutic gene should be additive and lead to a higher total therapeutic effect.
  • the oncolytic viruses have the ability to spread in the tumor tissues, they can deliver the therapeutic genes to a larger area of tumor mass than defective viral vectors. Thirdly, the ability of the viras to replicate in the tumor may lead to a longer period of gene expression. In support of this, the Examples showed that after intratumor delivery of oncolytic HSV, the AP expression was maintained at a relatively high level over one week, which is in contrast to gene expression from defective HSV vectors that usually lasts for only 24 to 48 h after intratumor injection (Todryk et al, 1999).
  • UL38p has very low basal activity that is maintained in non-dividing cells infected with an oncolytic HSV carrying the UL38p cassette. However, in cycling cells where the oncolytic viras can replicate, UL38p showed a similar level of activity as the CMV-P.
  • the cell-cycle dependent property of UL38p was also demonsttated in vivo, hitratumoral injection of both Baco-APl and Baco-AP2 produced high level AP expression. On the other hand, only a transient and low level of AP expression was detected during i.v.
  • Baco-PA2 which is in contrast to the abundant AP release from i.v. administration of Baco-APl.
  • the transient and low level of AP release after i.v. injection of Baco-AP2 was probably from certain dividing cells such as fibroblasts which might have gained access to the viras and were subsequently infected after systemic delivery of the virus.
  • the low level and transient AP expression implies that UL38p in the context of an oncolytic HSV has minimal activity in the nonnal hepatocytes.
  • a strict late viral promoter such as UL38p with an oncolytic HSV has additional advantages over the traditional usage of a tumor-specific promoter in a defective viral vector.
  • these late viral promoters may be applicable to a variety of tumors in which the viras can conditionally replicate. This is particularly useful for tumors in which tumor specific promoters have not yet been defined.
  • conditional activation of the UL38 promoter upon the initiation of lytic HSV infection in the tumor cells may provide a synchronized action between the oncolysis of the viras and the therapeutic effect of the delivered gene. Such a synchronized action may be particularly important under certain circumstance, e.g. in combination with immunotherapy, where the tumor antigen release from the viral oncolysis will be paralleled by the release of immune stimulating molecules from the genes inserted into the virus.
  • the combination of random mutagenesis and insertion of GALV.fus gene in a conventional HSV provides more oncolytic efficiency than conventional HSVs for cancer cells, such as, for example, ovarian or prostate cancer cells, hi some Examples provided herein, the oncolytic HSV is administered intraperitoneally after 14 days of tumor inoculation, when tumors had become well established in an animal model. Actually, the mice implanted with Hey tumors eventually were palpable tlirough the abdominal wall, and the tumor diameters approximated 3 mm. This tumor- bearing state mimics the advanced ovarian cancer state.
  • a strict-late viral promoter directs the expression of the GALV.fus gene in the virus, which provides strong tissue-selective expression of the gene.
  • the UL38 promoter appeared to have several advantages over the conventional tissue-specific promoter, such as HER-2/neu, that is over-expressed in approximately 10%) of ovarian cancers and may conelate with a poor prognosis. For example, this promoter is probably substantially stronger than most tissue-specific promoters.
  • activation of the UL38 promoter upon initiation of lytic HSV infection in the tumor cells provides a synchronized action between these two antitumor mechanisms, in specific embodiments.
  • Fusogenic oncolytic HSVs constructed from insertion of a hyperfusogenic glycoprotein into a conventional oncolytic HSV can also significantly increase the antitumor effect of that viras.
  • a newer version of fusogenic oncolytic HSV was constructed, in which both fusion mechanisms were inco ⁇ orated into a single viras (Synco- 2D). Evaluation of this viras through intraperitoneal administration on disseminated ovarian cancer led to 75%o of mice tumor free.
  • the therapeutic effect on the orthotopic tumor from Synco-2D is only marginally better than that of Synco-2 after systemic administered of the viruses.
  • the likely reasons for this differential effect on the tumor in primary site and the metastatic tumor are probably due to the discrepancy between the tumor size and amount of virus distribution after systemic delivery.
  • the orthotopic tumor volume was already bulky and was probably substantially bigger than the lung metastatic nodules.
  • systemic administration of oncolytic HSVs can only distribute a limited amount of virases to the tumor mass. Therefore, with only a limited amount of virases distributed to a bulky tumor, even a more effective viras may not produce a noticeably better therapeutic effect than Synco-2.
  • Syncytia formation mediated by fusogenic glycoproteins relies on the initial binding of fusogenic glycoproteins with their specific receptors on target cells, which induces ordered structural changes of the membrane lipid bilayers, leading in turn to lipid mixing and eventual membrane fusion either between viral and cellular membranes or among cellular membranes (Lentz et al, 2000).
  • the cellular receptor for GALV.fus has been identified as PiTl, a type III sodium-dependent phosphate transporter (Johann et al., 1993; Kavanaugh et al., 1994).
  • the membrane fusion induced by HSV is more complex, requiring the participation of multiple viral glycoproteins and at least two specific cellular receptors on the cell surface.
  • glycoproteins are encoded by late genes whose expression depends upon viral D ⁇ A replication, the cell membrane fusion mediated by this mechanism would only occur in tumor cells (where viras can undergo a full infection cycle) but not in nonnal nondividing cells (where virus replication is restricted and very low levels of glycoproteins are expressed).
  • an enhanced fusogenic HSV (1) facilitates cell-to-cell spread of viras particles; (2) supports the dispersion in a peritoneal cavity; and (3) is compatible with a replication-competent HSV system for the treatment of advanced cancer, such as ovarian cancer or prostate cancer.
  • Viral fusogenic membrane glycoproteins kill solid tumor cells by nonapoptotic mechanisms that promote cross presentation of tumor antigens by dendritic cells. Cancer Res. 62(22): 6566-78. Berlthout et al, Cell, 59:273, 1989. Bischoff, J. R., et al. (1996). An adenoviras mutant that replicates selectively in p53-deficient human tumor cells. Science. 274: 373-376. Blanar et al, EMBOJ., 8:1139, 1989. Blank, SN., Rubin, S.C., Coukos, G., Amin, K.M., Albelda, S.M. and Molnar-Kimber, K.L.
  • Multi-attenuated he ⁇ es simplex viras- 1 mutant G207 exerts cytotoxicity against epithelial ovarian cancer but not nonnal mesothelium and is suitable for intraperitoneal oncolytic therapy.
  • a lentiviral vector expressing a fusogenic glycoprotein for cancer gene therapy expressing a fusogenic glycoprotein for cancer gene therapy.
  • a lentiviral vector expressing a fusogenic glycoprotein for cancer gene therapy expressing a fusogenic glycoprotein for cancer gene therapy.
  • Viral fusogenic membrane glycoprotein expression causes syncytia formation with bioenergetic cell death: implications for gene therapy.
  • Cancer Res. 60: 6396-6402 Higuchi, H., S. F. Bronlc, A. Bateman, K. Hanington, R. G. Vile and G. J. Gores (2000).
  • Viral fusogenic membrane glycoprotein expression causes syncytia formation with bioenergetic cell death: implications for gene therapy. Cancer Res. 60(22): 6396-402. Hirasawa, K., Nishikawa, S. G., Norman, K. L., Alain, T., Kossakowska, A., and Lee P. W.
  • Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer construction and testing of a tissue-specific adenoviras vector. Cancer Res. 60: 334-341.
  • ICP34.5 mutant HSV-1716 in human non-small cell lung cancer.
  • Hum Gene Ther. HSV-1716

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2003/009287 2002-03-27 2003-03-26 Potent oncolytic herpes simplex virus for cancer therapy Ceased WO2003082200A2 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU2003258060A AU2003258060B2 (en) 2002-03-27 2003-03-26 Potent oncolytic herpes simplex virus for cancer therapy
CA002479763A CA2479763A1 (en) 2002-03-27 2003-03-26 Potent oncolytic herpes simplex virus for cancer therapy
JP2003579743A JP2005521398A (ja) 2002-03-27 2003-03-26 癌治療用の強力な腫瘍溶解性単純ヘルペスウイルス
EP03745618A EP1494613A4 (en) 2002-03-27 2003-03-26 EFFECTIVE ONCOLYTIC HERPES SIMPLEX VIRUS FOR CANCER THERAPY

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US36778802P 2002-03-27 2002-03-27
US60/367,788 2002-03-27
US41002402P 2002-09-11 2002-09-11
US60/410,024 2002-09-11

Publications (2)

Publication Number Publication Date
WO2003082200A2 true WO2003082200A2 (en) 2003-10-09
WO2003082200A3 WO2003082200A3 (en) 2004-09-30

Family

ID=28678199

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/009287 Ceased WO2003082200A2 (en) 2002-03-27 2003-03-26 Potent oncolytic herpes simplex virus for cancer therapy

Country Status (6)

Country Link
US (1) US20040009604A1 (https=)
EP (1) EP1494613A4 (https=)
JP (1) JP2005521398A (https=)
AU (1) AU2003258060B2 (https=)
CA (1) CA2479763A1 (https=)
WO (1) WO2003082200A2 (https=)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7361354B1 (en) 1999-11-25 2008-04-22 Viralytics Limited Methods for treating malignancies expressing ICAM-1 using coxsackie a group viruses
JP2008546801A (ja) * 2005-06-23 2008-12-25 ベイラー カレッジ オブ メディスン 癌の治療のための単純ヘルペスウイルス2型変異体の使用
US7485292B2 (en) 2002-12-18 2009-02-03 Viralytics Limited Method of treating a malignancy in a subject via direct picornaviral-mediated oncolysis
WO2016100364A1 (en) * 2014-12-18 2016-06-23 Amgen Inc. Stable frozen herpes simplex virus formulation
CN108070569A (zh) * 2018-02-05 2018-05-25 翁炳焕 一种产前基因芯片检测的改良方法
WO2020109389A1 (en) 2018-11-28 2020-06-04 Innovative Molecules Gmbh Helicase primase inhibitors for treating cancer in a combination therapy with oncolytic viruses
WO2021024207A1 (en) 2019-08-05 2021-02-11 Mesoblast International Sarl Cellular compositions comprising viral vectors and methods of treatment
WO2021087019A1 (en) * 2019-11-01 2021-05-06 University Of Houston System Oncolytic virotherapy with induced anti-tumor immunity
WO2022034506A1 (en) 2020-08-10 2022-02-17 Mesoblast International Sárl Cellular compositions and methods of treatment
US12364723B2 (en) 2018-12-27 2025-07-22 Amgen Inc. Thermostable compositions comprising live attenuated herpes simplex virus type 1
US12473547B2 (en) 2017-11-22 2025-11-18 Mesoblast International Sàrl Use of mesenchymal lineage precursor cells or stem cells (MLPSCs) for delivery of oligonucleotides in the treatment of cancer

Families Citing this family (56)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100086522A1 (en) * 2006-07-18 2010-04-08 Ottawa Health Research Institute Disparate suicide carrier cells for tumor targeting of promiscuous oncolytic viruses
US20090317456A1 (en) * 2006-10-13 2009-12-24 Medigene Ag Use of oncolytic viruses and antiangiogenic agents in the treatment of cancer
US8450106B2 (en) * 2007-10-17 2013-05-28 The Ohio State University Research Foundation Oncolytic virus
US8859256B2 (en) 2011-10-05 2014-10-14 Genelux Corporation Method for detecting replication or colonization of a biological therapeutic
WO2013138522A2 (en) 2012-03-16 2013-09-19 Genelux Corporation Methods for assessing effectiveness and monitoring oncolytic virus treatment
WO2013158265A1 (en) 2012-04-20 2013-10-24 Genelux Corporation Imaging methods for oncolytic virus therapy
US20140140959A1 (en) 2012-10-05 2014-05-22 Aladar A. Szalay Energy Absorbing-Based Diagnostic and Therapeutic Methods Employing Nucleic Acid Molecules Encoding Chromophore-Producing Enzymes
WO2015103438A2 (en) 2014-01-02 2015-07-09 Genelux Corporation Oncolytic virus adjunct therapy with agents that increase virus infectivity
ES2753391T3 (es) 2014-10-14 2020-04-08 Halozyme Inc Composiciones de adenosina desaminasa 2 (ADA2), variantes de la misma y métodos de uso de las mismas
GB201504251D0 (en) * 2015-03-13 2015-04-29 Virttu Biolog Ltd And University Of Sheffield The Oncolytic herpes simplex virus infected cells
AU2016246457B2 (en) * 2015-04-06 2020-10-15 Cytoimmune Therapeutics, Inc. EGFR-directed car therapy for glioblastoma
IL262365B2 (en) 2016-04-15 2024-11-01 Alpine Immune Sciences Inc Immunomodulatory proteins ICOS ligand variants and uses thereof
EP4706777A2 (en) 2016-04-15 2026-03-11 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
US11834490B2 (en) 2016-07-28 2023-12-05 Alpine Immune Sciences, Inc. CD112 variant immunomodulatory proteins and uses thereof
CN110088127A (zh) 2016-07-28 2019-08-02 高山免疫科学股份有限公司 Cd155变体免疫调节蛋白及其用途
US11471488B2 (en) 2016-07-28 2022-10-18 Alpine Immune Sciences, Inc. CD155 variant immunomodulatory proteins and uses thereof
CA3040296A1 (en) 2016-10-20 2018-04-26 Alpine Immune Sciences, Inc. Secretable variant immunomodulatory proteins and engineered cell therapy
CN110546265A (zh) 2017-02-09 2019-12-06 因达普塔治疗公司 工程化自然杀伤(nk)细胞及其组合物和方法
PT3596116T (pt) 2017-03-16 2023-12-04 Alpine Immune Sciences Inc Proteínas imunomoduladoras de pd-l1 variante e suas utilizações
JP2020511144A (ja) 2017-03-16 2020-04-16 アルパイン イミューン サイエンシズ インコーポレイテッド Pd−l2バリアント免疫調節タンパク質及びその使用
EP3596114A2 (en) 2017-03-16 2020-01-22 Alpine Immune Sciences, Inc. Cd80 variant immunomodulatory proteins and uses thereof
AU2018266111B2 (en) 2017-05-08 2024-11-07 Flagship Pioneering Innovations V, Inc. Compositions for facilitating membrane fusion and uses thereof
SMT202600062T1 (it) 2017-10-18 2026-03-09 Alpine Immune Sciences Inc Proteine immunomodulatrici del ligando di icos variante e composizioni e metodi correlati
SG11202006148UA (en) 2018-01-03 2020-07-29 Alpine Immune Sciences Inc Multi-domain immunomodulatory proteins and methods of use thereof
CA3091478A1 (en) 2018-02-17 2019-08-22 Flagship Pioneering Innovations V, Inc. Compositions and methods for membrane protein delivery
AU2019269593A1 (en) 2018-05-15 2020-11-26 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
US11505782B2 (en) 2018-06-04 2022-11-22 Calidi Biotherapeutics, Inc. Cell-based vehicles for potentiation of viral therapy
KR102662837B1 (ko) 2018-06-04 2024-05-03 카리디 바이오테라퓨틱스, 인크. 바이러스 치료법의 강화를 위한 세포-기반 비히클
US12065476B2 (en) 2018-06-15 2024-08-20 Alpine Immune Sciences, Inc. PD-1 variant immunomodulatory proteins and uses thereof
EP3820509A1 (en) 2018-07-09 2021-05-19 Flagship Pioneering Innovations V, Inc. Fusosome compositions and uses thereof
EP3844276A2 (en) 2018-08-28 2021-07-07 Actym Therapeutics, Inc. Engineered immunostimulatory bacterial strains and uses thereof
EP3875119A4 (en) * 2018-10-30 2022-08-31 The University of Tokyo ONCOLYTIC VIRUS FOR CANCER THERAPY
EP3876951A1 (en) 2018-11-06 2021-09-15 Calidi Biotherapeutics, Inc. Enhanced systems for cell-mediated oncolytic viral therapy
SG11202105079QA (en) 2018-11-14 2021-06-29 Flagship Pioneering Innovations V Inc Fusosome compositions for cns delivery
EP3880832A1 (en) 2018-11-14 2021-09-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for hematopoietic stem cell delivery
US12496274B2 (en) 2018-11-14 2025-12-16 Flagship Pioneering Innovations V, Inc. Compositions and methods for compartment-specific cargo delivery
WO2020102503A2 (en) 2018-11-14 2020-05-22 Flagship Pioneering Innovations V, Inc. Fusosome compositions for t cell delivery
US12410402B2 (en) 2018-11-21 2025-09-09 Indapta Therapeutics, Inc. Methods for expansion of natural killer (NK) cell subset and related compositions and methods
WO2020113141A2 (en) 2018-11-30 2020-06-04 Alpine Immune Sciences, Inc. Cd86 variant immunomodulatory proteins and uses thereof
CN113748124A (zh) 2019-02-27 2021-12-03 阿克蒂姆治疗有限公司 工程化以定植肿瘤、肿瘤驻留免疫细胞和肿瘤微环境的免疫刺激性细菌
US12024709B2 (en) 2019-02-27 2024-07-02 Actym Therapeutics, Inc. Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
WO2020252455A1 (en) 2019-06-13 2020-12-17 The General Hospital Corporation Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells
KR20230088306A (ko) 2020-04-22 2023-06-19 인답타 세라뷰틱스 인코포레이티드 자연 살해(nk) 세포 조성물 및 이를 생성하는 방법
WO2021236852A1 (en) 2020-05-20 2021-11-25 Sana Biotechnology, Inc. Methods and compositions for treatment of viral infections
EP4185600A4 (en) 2020-07-24 2024-12-04 The General Hospital Corporation Enhanced virus-like particles and methods of use thereof for delivery to cells
US20230303665A1 (en) 2020-08-28 2023-09-28 Sana Biotechnology, Inc. Modified anti-viral binding agents
WO2022147481A1 (en) 2020-12-30 2022-07-07 Ansun Biopharma Inc. Combination therapy of an oncolytic virus delivering a foreign antigen and an engineered immune cell expressing a chimeric receptor targeting the foreign antigen
US20250230511A1 (en) 2021-10-29 2025-07-17 Sana Biotechnology, Inc. Methods and reagents for amplifying viral vector nucleic acid products
US20250223584A2 (en) 2021-12-03 2025-07-10 The Broad Institute, Inc. Compositions and methods for efficient in vivo delivery
WO2023133595A2 (en) 2022-01-10 2023-07-13 Sana Biotechnology, Inc. Methods of ex vivo dosing and administration of lipid particles or viral vectors and related systems and uses
US20250144235A1 (en) 2022-02-02 2025-05-08 Sana Biotechnology, Inc. Methods of repeat dosing and administration of lipid particles or viral vectors and related systems and uses
CN120303407A (zh) 2022-05-17 2025-07-11 恩维洛普治疗有限责任公司 用于有效体内递送的组合物和方法
WO2024026377A1 (en) 2022-07-27 2024-02-01 Sana Biotechnology, Inc. Methods of transduction using a viral vector and inhibitors of antiviral restriction factors
US20260055146A1 (en) 2022-08-24 2026-02-26 Sana Biotechnology, Inc. Delivery of heterologous proteins
KR20260016952A (ko) 2023-05-23 2026-02-04 사나 바이오테크놀로지, 인크. 탠덤 퓨소젠 및 관련 지질 입자
WO2025184529A1 (en) 2024-03-01 2025-09-04 Sana Biotechnology, Inc. Viral particles with fusogen display and related compositions and methods

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5585096A (en) * 1994-06-23 1996-12-17 Georgetown University Replication-competent herpes simplex virus mediates destruction of neoplastic cells
US5728379A (en) * 1994-06-23 1998-03-17 Georgetown University Tumor- or cell-specific herpes simplex virus replication
US6264940B1 (en) * 1998-08-05 2001-07-24 The Research Foundation Of State University Of New York Recombinant poliovirus for the treatment of cancer
US6428968B1 (en) * 1999-03-15 2002-08-06 The Trustees Of The University Of Pennsylvania Combined therapy with a chemotherapeutic agent and an oncolytic virus for killing tumor cells in a subject
US6723316B2 (en) * 1999-12-22 2004-04-20 Onyx Pharmaceuticals, Inc. Herpes simplex virus-1 Glycoprotein C mutants for treating unwanted hyperproliferative cell growth
WO2001074861A2 (en) * 2000-03-31 2001-10-11 Mayo Foundation For Medical Education And Research Compositions and methods for tissue specific gene regulation therapy
EP1327688A1 (en) * 2002-01-14 2003-07-16 Vereniging Voor Christelijk Wetenschappelijk Onderwijs Adenoviruses with enhanced lytic potency

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7361354B1 (en) 1999-11-25 2008-04-22 Viralytics Limited Methods for treating malignancies expressing ICAM-1 using coxsackie a group viruses
US8722036B2 (en) 1999-11-25 2014-05-13 Viralytics Limited Methods for treating malignancies using coxsackieviruses
US7485292B2 (en) 2002-12-18 2009-02-03 Viralytics Limited Method of treating a malignancy in a subject via direct picornaviral-mediated oncolysis
JP2008546801A (ja) * 2005-06-23 2008-12-25 ベイラー カレッジ オブ メディスン 癌の治療のための単純ヘルペスウイルス2型変異体の使用
CN101495126B (zh) * 2005-06-23 2016-01-06 休斯顿大学 Ⅱ型单纯疱疹病毒突变体在治疗癌症中的用途
KR20170095270A (ko) * 2014-12-18 2017-08-22 암젠 인크 안정한 동결된 단순 포진 바이러스 제제
WO2016100364A1 (en) * 2014-12-18 2016-06-23 Amgen Inc. Stable frozen herpes simplex virus formulation
KR102549746B1 (ko) 2014-12-18 2023-07-03 암젠 인크 안정한 동결된 단순 포진 바이러스 제제
US12473547B2 (en) 2017-11-22 2025-11-18 Mesoblast International Sàrl Use of mesenchymal lineage precursor cells or stem cells (MLPSCs) for delivery of oligonucleotides in the treatment of cancer
CN108070569A (zh) * 2018-02-05 2018-05-25 翁炳焕 一种产前基因芯片检测的改良方法
WO2020109389A1 (en) 2018-11-28 2020-06-04 Innovative Molecules Gmbh Helicase primase inhibitors for treating cancer in a combination therapy with oncolytic viruses
US12364723B2 (en) 2018-12-27 2025-07-22 Amgen Inc. Thermostable compositions comprising live attenuated herpes simplex virus type 1
WO2021024207A1 (en) 2019-08-05 2021-02-11 Mesoblast International Sarl Cellular compositions comprising viral vectors and methods of treatment
WO2021087019A1 (en) * 2019-11-01 2021-05-06 University Of Houston System Oncolytic virotherapy with induced anti-tumor immunity
WO2022034506A1 (en) 2020-08-10 2022-02-17 Mesoblast International Sárl Cellular compositions and methods of treatment

Also Published As

Publication number Publication date
AU2003258060B2 (en) 2007-07-12
CA2479763A1 (en) 2003-10-09
WO2003082200A3 (en) 2004-09-30
EP1494613A4 (en) 2008-06-18
EP1494613A2 (en) 2005-01-12
JP2005521398A (ja) 2005-07-21
US20040009604A1 (en) 2004-01-15
AU2003258060A1 (en) 2003-10-13

Similar Documents

Publication Publication Date Title
AU2003258060B2 (en) Potent oncolytic herpes simplex virus for cancer therapy
US10039796B2 (en) Mutant herpes simplex virus-2 for cancer therapy
KR101170653B1 (ko) 폭스바이러스 및 암과 관련된 방법 및 조성물
JP5078195B2 (ja) 腫瘍治療を目的とするヘルペスベクターの使用
US7247297B2 (en) Use of DF3/MUC1 regulated expression in gene therapy
US20240123004A1 (en) Oncolytic virus for systemic delivery and enhanced anti-tumor activities
US20150246086A1 (en) Use of Mutant Herpes Simplex Virus-2 for Cancer Therapy
CN116782917A (zh) 用于全身递送的溶瘤病毒及增强的抗肿瘤活性
HK1104964A (en) Use of herpes vectors for tumor therapy

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003258060

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2479763

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003579743

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2003745618

Country of ref document: EP

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWP Wipo information: published in national office

Ref document number: 2003745618

Country of ref document: EP

WWG Wipo information: grant in national office

Ref document number: 2003258060

Country of ref document: AU