WO2003081250A1 - Novel compositions and methods in cancer associated with altered expression of prlr - Google Patents
Novel compositions and methods in cancer associated with altered expression of prlr Download PDFInfo
- Publication number
- WO2003081250A1 WO2003081250A1 PCT/US2003/007470 US0307470W WO03081250A1 WO 2003081250 A1 WO2003081250 A1 WO 2003081250A1 US 0307470 W US0307470 W US 0307470W WO 03081250 A1 WO03081250 A1 WO 03081250A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- nucleic acid
- expression
- sequences
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57515—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the breast
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/10—Composition for standardization, calibration, simulation, stabilization, preparation or preservation; processes of use in preparation for chemical testing
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10T—TECHNICAL SUBJECTS COVERED BY FORMER US CLASSIFICATION
- Y10T436/00—Chemistry: analytical and immunological testing
- Y10T436/25—Chemistry: analytical and immunological testing including sample preparation
Definitions
- the present invention relates to novel sequences for use in diagnosis and treatment of cancer, especially carcinomas including breast cancer, as well as the use of the novel compositions in screening methods.
- Oncogenes are genes that can cause cancer. Carcinogenesis can occur by a wide variety of mechanisms, including infection of cells by viruses containing oncogenes, activation of protooncogenes in the host genome, and mutations of protooncogenes and tumor suppressor genes.
- viruses There are a number of viruses known to be involved in human cancer as well as in animal cancer. Of particular interest here are viruses that do not contain oncogenes themselves; these are slow- transforming retroviruses. They induce tumors by integrating into the host genome and affecting neighboring protooncogenes in a variety of ways, including promoter insertion, enhancer insertion, and/or truncation of a protooncogene or tumor suppressor gene. The analysis of sequences at or near the insertion sites led to the identification of a number of new protooncogenes.
- murine leukemia retrovirus such as SL3-3 or Akv
- MoLV murine leukemia retrovirus
- SL3-3 or Akv murine leukemia retrovirus
- a number of sequences have been identified as relevant in the induction of lymphoma and leukemia by analyzing the insertion sites; see Sorensen et al., J. of Virology 74:2161 (2000); Hansen et al., Genome Res. 10(2):237-43 (2000); Sorensen et ⁇ l., J. Virology 70:4063 (1 90); Sorensen et ⁇ l., J.
- Breast cancer is one of the most significant diseases that affects women. At the current rate, American women have a 1 in 8 risk of developing breast cancer by age 95 (American Cancer Society, 1 92). Treatment of breast cancer at later stages is often futile and disfiguring, making early detection a high priority in medical management of the disease.
- PRLR is a prolactin receptor.
- the PRLR is a member of a larger family, known as the cytokine class-1 receptor superfamily, which currently has more than 20 different members.
- PRLRs are widely distributed throughout the body.
- the first step in the mechanism of action of PRL is the binding to a cell surface receptor.
- the PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. Dimerization of the receptor induces tyrosine phosphorylation and activation of the JAK kinase followed by phosphorylation of the receptor.
- Other receptor-associated kinases of the Src family have also been shown to be activated by PRL.
- One pathway of signaling involves phosphorylation of cytoplasmic Stat proteins, which themselves dimerize and translocate to nucleus and bind to specific promoter elements on PRL-responsive genes.
- the Ras/Raf/MAP kinase pathway is also activated by PRL and may be involved in the proliferative effects of the hormone.
- the present invention provides methods for screening for compositions which modulate carcinomas, especially breast cancer. Also provided herein are methods of inhibiting proliferation of a cell, preferably a breast cancer cell. Methods of treatment of carcinomas, including diagnosis, are also provided herein.
- a method of screening drug candidates comprises providing a cell that expresses a carcinoma associated (CA) gene or fragments thereof, such as PRLR.
- CA genes are genes which are differentially expressed in cancer cells, preferably lymphatic, breast, prostate or epithelial cells, compared to other cells.
- Preferred embodiments of CA genes used in the methods herein include, but are not limited to the nucleic acids selected from Table 1.
- the method further includes adding a drug candidate to the cell and determining the effect of the drug candidate on the expression of the CA gene.
- the method of screening drug candidates includes comparing the level of expression in the absence of the drug candidate to the level of expression in the presence of the drug candidate.
- Also provided herein is a method of screening for a bioactive agent capable of binding to a CA protein (CAP), the method comprising combining the CAP and a candidate bioactive agent, and determining the binding of the candidate agent to the CAP.
- CAP CA protein
- the method comprises combining the CAP and a candidate bioactive agent, and determining the effect of the candidate agent on the bioactivity of the CAP.
- Also provided is a method of evaluating the effect of a candidate carcinoma drug comprising administering the drug to a patient and removing a cell sample from the patient. The expression profile of the cell is then determined. This method may further comprise comparing the expression profile of the patient to an expression profile of a heathy individual.
- a method for inhibiting the activity of an CA protein comprises administering to a patient an inhibitor of a CA protein preferably selected from the group consisting of the sequences outlined in Table 1 or their complements.
- a method of neutralizing the effect of a CA protein preferably a protein encoded by a nucleic acid selected from the group of sequences outlined in Table 1 , is also provided.
- the method comprises contacting an agent specific for said protein with said protein in an amount sufficient to effect neutralization.
- biochip comprising a nucleic acid segment which encodes ⁇ CA protein, preferably selected from the sequences outlined in Table 1.
- Also provided herein is a method for diagnosing or determining the propensity to carcinomas, especially breast cancer by sequencing at least one carcinoma or breast cancer gene of an individual.
- a method for determining carcinoma including breast cancer gene copy number in an individual is provided.
- Figure 1 depicts mRNA expression of PRLR in breast cancer tissue compared with expression in normal tissue.
- Samples 1-50 are breast cancer samples.
- Samples 51 and 52 are normal tissue. Bars represent the mean of expression level. Error bars represent standard deviation.
- the present invention is directed to a number of sequences associated with carcinomas, especially lymphoma, breast cancer or prostate cancer.
- the relatively tight linkage between clonally-integrated proviruses and protooncogenes forms "provirus tagging", in which slow-transforming retroviruses that act by an insertion mutation mechanism are used to isolate protooncogenes.
- uninfected animals have low cancer rates, and infected animals have high cancer rates.
- retroviruses involved do not carry transduced host protooncogenes or pathogenic frans-acting viral genes, and thus the cancer incidence must therefor be a direct consequence of proviral integration effects into host protooncogenes. Since proviral integration is random, rare integrants will "activate" host protooncogenes that provide a selective growth advantage, and these rare events result in new proviruses at clonal stoichiometries in tumors.
- oncogenic retroviruses whose sequences insert into the genome of the host organism resulting in carcinoma, allows the identification of host sequences involved in carcinoma. These sequences may then be used in a number of different ways, including diagnosis, prognosis, screening for modulators (including both agonists and antagonists), antibody generation (for immunotherapy and imaging), etc.
- oncogenes that are identified in one type of cancer such as breast cancer have a strong likelihood of being involved in other types of cancers as well.
- sequences outlined herein are initially identified as correlated with breast cancer, they can also be found in other types of cancers as well, outlined below.
- the present invention provides nucleic acid and protein sequences that are associated with carcinoma, herein termed “carcinoma associated” or “CA” sequences.
- CA carcinoma associated
- the present invention provides nucleic acid and protein sequences that are associated with carcinomas which originate in mammary tissue, which are known as breast cancer sequences or "BA”.
- Suitable cancers which can be diagnosed or screened for using the methods of the present invention include cancers classified by site or by.histological type. Cancers classified by site include cancer of the oral cavity and pharynx (lip, tongue, salivary gland, floor of mouth, gum and other mouth, nasopharynx, tonsil, oropharynx, hypopharynx, other oral/pharynx); cancers of the digestive system (esophagus; stomach; small intestine; colon and rectum; anus, anal canal, and anorectum; liver; intrahepatic bile duct; gallbladder; other biliary; pancreas; retroperitoneum; peritoneum, omentum, and mesentery; other digestive); cancers of the respiratory system (nasal cavity, middle ear, and sinuses; larynx; lung and bronchus; pleura; trachea, mediastinum, and other respiratory); cancers of the mesothelioma;
- Neoplasm malignant; Carcinoma, NOS; Carcinoma, undifferentiated, NOS; Giant and spindle cell carcinoma; Small cell carcinoma, NOS; Papillary carcinoma, NOS; Squamous cell carcinoma, NOS; Lymphoepifheli ⁇ l carcinoma; Basal cell carcinoma, NOS; Pilomatrix carcinoma; Transitional cell carcinoma, NOS; Papillary transitional cell carcinoma; Adenocarcinoma, NOS; Gastrinoma, malignant; Cholangiocarcinoma; Hepatocellular carcinoma, NOS; Combined hepatocellular carcinoma and cholangiocarcinoma; Trabecular adenocarcinoma; Adenoid cystic carcinoma; Adenocarcinoma in adenomatous polyp; Adenocarcinoma, familial pplyposis coli; Solid carcinoma, NOS; Carcinoid tumor, malignant
- Ameloblastoma malignant; Ameloblasfic fibros ⁇ rcom ⁇ ; Pine ⁇ lom ⁇ , malignant; Chordoma; Glioma, malignant; Ependymoma, NOS; Astrocytoma, NOS; Protoplasmic astrocytoma; Fibrillary astrocytoma; Astroblastoma; Glioblastoma, NOS; Oligodendroglioma, NOS; Oligodendroblastoma; Primitive neuroectodermal; Cerebellar sarcoma, NOS; Ganglioneuroblastoma; Neuroblastoma, NOS; Retinoblastoma, NOS; Olfactory neurogenic tumor; Meningioma, malignant; Neurofibrosarcoma; Neurilemmoma, malignant; Granular cell tumor, malignant; Malignant lymphoma, NOS; Hodgkin's disease, NOS; Hodgkin's; para
- genes may be involved in other diseases, such as but not limited to diseases associated with aging or neurodegenerative diseases.
- CA sequences include those that are up-regulated (i.e. expressed at a higher level), as well as those that are down-regulated (i.e. expressed at a lower level), in carcinomas.
- CA sequences also include sequences which have been altered (i.e., truncated sequences or sequences with substitutions, deletions or insertions, including point mutations) and show either the same expression profile or an altered profile.
- the CA sequences are from humans; however, as will be appreciated by those in the art, CA sequences from other organisms may be useful in animal models of disease and drug evaluation; thus, other CA sequences are provided, from vertebrates, including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, farm animals (including sheep, goats, pigs, cows, horses, etc). In some cases, prokaryotic CA sequences may be useful. CA sequences from other organisms may be obtained using the techniques outlined below.
- CA sequences can include both nucleic acid and amino acid sequences.
- the CA sequences are recombinant nucleic acids.
- recombinant nucleic acid herein is meant nucleic acid, originally formed in vitro, in general, by the manipulation of nucleic acid by polymerases and endonucleases, in a form not normally found in nature.
- an isolated nucleic acid, in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined are both considered recombinant for the purposes of this invention.
- nucleic acid once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e. using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purposes of the invention.
- a "recombinant protein” is a protein made using recombinant techniques, i.e. through the expression of a recombinant nucleic acid as depicted above.
- a recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics.
- the protein may be isolated or purified away from some or all of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure.
- an isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably at least about 5% by weight of the total protein in a given sample.
- a substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at least about 90% being particularly preferred.
- the definition includes the production of an CA protein from one organism in a different organism or host cell.
- the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels.
- the protein may be in a form not normally found in nature, as in the addition of an epitope tag or amino acid substitutions, insertions and deletions, as discussed below.
- the CA sequences are nucleic acids.
- CA sequences are useful in a variety of applications, including diagnostic applications, which will detect naturally occurring nucleic acids, as well as screening applications; for example, biochips comprising nucleic acid probes to the CA sequences can be generated.
- diagnostic applications which will detect naturally occurring nucleic acids, as well as screening applications; for example, biochips comprising nucleic acid probes to the CA sequences can be generated.
- biochips comprising nucleic acid probes to the CA sequences can be generated.
- nucleic acid or oligonucleotide or grammatical equivalents herein means at least two nucleotides covalently linked together.
- a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below (for example in antisense applications or when a candidate agent is a nucleic acid), nucleic acid analogs may be used that have alternate backbones, comprising, for example, phosphoramidate (Beaucage et al., Tetrahedron 49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem.35:3800 (1970); SRocl et al., Eur. J. Biochem.81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986); Sawai et al, Chem.
- nucleic acid analogs may find use in the present invention.
- mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
- the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence.
- the depiction of a single strand "Watson” also defines the sequence of the other strand "Crick"; thus the sequences described herein also includes the complement of the sequence.
- the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.
- nucleoside includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides.
- nucleoside includes non-naturally occurring analog structures. Thus for example the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside.
- An CA sequence can be initially identified by substantial nucleic acid and/or amino acid sequence homology to the CA sequences outlined herein. Such homology can be based upon the overall nucleic acid or amino acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions.
- the CA sequences of the invention were initially identified as described herein; basically, infection of mice with murine leukemia viruses (MLV) resulted in lymphoma.
- the sequences were subsequently validated by determining expression levels of the gene product, i.e. mRNA, in breast cancer samples.
- the CA sequences outlined herein comprise the insertion sites for the virus.
- the retrovirus can cause carcinomas in three basic ways: first of all, by inserting upstream of a normally silent host gene and activating it (e.g. promoter insertion); secondly, by truncating a host gene that leads to oncogenesis; or by enhancing the transcription of a neighboring gene.
- retrovirus enhancers including SL3-3, are known to act on genes up to approximately 200 kilobases of the insertion site.
- CA sequences are those that are up-regulated in carcinomas; that is, the expression of these genes is higher in carcinoma tissue as compared to normal tissue of the same differentiation stage.
- Up-regulation as used herein means at least about 50%, more preferably at least about 100%, more preferably at least about 150%, more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.
- CA sequences are those that are down-regulated in carcinomas; that is, the expression of these genes is lower in carcinoma tissue as compared to normal I tissue of the same differentiation stage.
- Down-regulation as used herein means at least about 50%, more preferably at least about 100%, more preferably at least about 150%, more preferably, at least about 200%, with from 300 to at least 1000% being especially preferred.
- CA sequences are those that are altered but show either the sameexpression profile or an altered profile as compared to normal lymphoid tissue of the same differentiation stage.
- altered CA sequences refers to sequences which are truncated, contain insertions or contain point mutations.
- CA proteins of the present invention may be classified as secreted proteins, transmembrane proteins or intracellular proteins.
- the CA protein is an intracellular protein.
- Intracellular proteins may be found in the cytoplasm and/or in the nucleus. Intracellular proteins are involved in all aspects of cellular function and replication (including, for example, signaling pathways); aberrant expression of such proteins results in unregulated or disregulated cellular processes. For example, many intracellular proteins have enzymatic activity such as protein kinase activity, protein phosphatase activity, protease activity, nucleotide cyclase activity, polymerase activity and the like. Intracellular proteins also serve as docking proteins that are involved in organizing complexes of proteins, or targeting proteins to various subcellular localizations, and are involved in maintaining the structural integrity of organelles.
- Src-homology-2 (SH2) domains bind tyrosine- phosphorylated targets in a sequence dependent manner.
- PTB domains which are distinct from SH2 domains, also bind tyrosine phosphorylated targets.
- SH3 domains bind to proline-rich targets.
- PH domains, tefratricopeptide repeats and WD domains io name only a few, have been shown to mediate protein-protein interactions.
- these motifs can be identified on the basis of primary sequence; thus, an analysis of the sequence of proteins may provide insight into both the enzymatic potential of the molecule and/or molecules with which the protein may associate.
- the CA sequences are transmembrane proteins.
- Transmembrane proteins are molecules that span the phospholipid bilayer of a cell. They may have an intracellular domain, an extracellular domain, or both.
- the intracellular domains of such proteins may have a number of functions including those already described for intracellular proteins.
- the intracellular domain may have enzymatic activity and/or may serve as a binding site for additional proteins.
- the intracellular domain of transmembrane proteins serves both roles".
- certain receptor tyrosine kinases have both protein kinase activity and SH2 domains.
- autophosphorylation of tyrosines on the receptor molecule itself creates binding sites for additional SH2 domain containing proteins.
- Transmembrane proteins may contain from one to many transmembrane domains.
- receptor tyrosine kinases certain cytokine receptors, receptor guanylyl cyclases and receptor serine/threonine protein kinases contain a single transmembrane domain.
- various other proteins including channels and adenylyl cyclases contain numerous transmembrane domains.
- Many important cell surface receptors are classified as "seven transmembrane domain" proteins, as they contain 7 membrane spanning regions.
- transmembrane protein receptors include, but are not limited to insulin receptor, insulin-like growth factor receptor, human growth hormone receptor, glucose transporters, transferrin receptor, epidermal growth factor receptor, low density lipoprotein receptor, epidermal growth factor receptor, leptin receptor, interleukin receptors, e.g. IL-1 receptor, IL-2 receptor, etc.
- transmembrane domains include. approximately 20 consecutive hydrophobic amino acids that may be followed by charged amino acids. Therefore, upon analysis of the amino acid sequence of a particular protein, the localization and number of transmembrane domains within the protein may be predicted.
- extracellular domains are involved in binding to other molecules.
- extracellular domains are receptors.
- Factors that bind the receptor domain include circulating ligands, which may be peptides, proteins, or small molecules such as adenosine and the like.
- growth factors such as EGF, FGF and PDGF are circulating growth factors that bind to their cognate receptors to initiate a variety of cellular responses.
- Other factors include cytokines, mitogenic factors, neurotrophic factors and the like.
- Extracellular domains also bind to cell-associated molecules. Inihis respect, they mediate cell-cell interactions.
- Cell-associated ligands can be tethered to the cell for example via a glycosylphosphatidylinositol (GPI) anchor, or may themselves be transmembrane proteins. Extracellular domains also associate with the extracellular matrix and contribute to the maintenance of the cell structure.
- GPI glycosylphosphatidylinositol
- CA proteins that are transmembrane are particularly preferred in the present invention as they are good targets for immunotherapeutics, as are described herein.
- transmembrane proteins can be also useful in imaging modalities.
- transmembrane protein can be made soluble by removing transmembrane sequences, for example through recombinant methods.
- transmembrane proteins that have been made soluble can be made to be secreted through recombinant means by adding an appropriate signal sequence.
- the CA proteins are secreted proteins; the secretion of which can be either constitutive or regulated. These proteins have a signal peptide or signal sequence that targets the molecule to the secretory pathway.
- Secreted proteins are involved in numerous physiological events; by virtue of their circulating nature, they serve to transmit signals to various other cell types.
- the secreted protein may function in an autocrine manner (acting on the cell that secreted the factor), a paracrine manner (acting on cells in close proximity to the cell that secreted the factor) or an endocrine manner (acting on cells at a distance).
- CA proteins that are secreted proteins are particularly preferred in the present invention as they serve as good targets for diagnostic markers, for example for blood tests.
- CA sequence is initially identified by substantial nucleic acid and/or amino acid sequence homology to the CA sequences outlined herein. Such homology can be based upon the overall nucleic acid or amino acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions.
- a nucleic acid is a "CA nucleic acid” if the overall homology of the nucleic acid sequence to one of the nucleic acids of Table 1 is preferably greater than about 75%, more preferably greater than about 80%, even more preferably greater than about 85% and most preferably greater than 90%. In some embodiments the homology will be as high as about 93 to 95 or 98%.
- the sequences which are used to determine sequence identity or similarity are selected from those of the nucleic acids of Table 1.
- the sequences are naturally occurring allelic variants of the sequences of the nucleic acids of Table 1.
- the sequences are sequence variants as further described herein.
- Homology in this context means sequence similarity or identify, with identity being preferred.
- a preferred comparison for homology purposes is to compare the sequence containing sequencing errors to the correct sequence. This homology will be determined using standard techniques known in the art, including, but not limited to, the local homology algorithm of Smith & Waterman, Adv. Appl. Math.2:482 (1981 ), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
- PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol.35:351-360 (1987); the method is similar to that described by Higgins & Sharp CABIOS 5:151-153 (1989).
- Useful PILEUP parameters including a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps.
- BLAST BLAST algorithm
- WU-BLAST-2 WU-BLAST-2 uses several search parameters, most of which are set to the default values.
- the HSP S and HSP S2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.
- a % amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region.
- the "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).
- percent (%) nucleic acid sequence identity is defined as the percentage of nucleotide residues in a candidate sequence that are identical with the nucleotide residues of the nucleic acids of Table 1.
- a preferred method utilizes the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.
- the alignment may include the introduction of gaps in the sequences to be aligned.
- sequences which contain either more or fewer nucleotides than those of the nucleic acids of Table 1 it is understood that the percentage of homology will be determined based on the number of homologous nucleosides in relation to the total number of nucleosides. Thus, for example, homology of sequences shorter than those of the sequences identified herein and as discussed below, will be determined using the number of nucleosides in the shorter sequence.
- the nucleic acid homology is determined through hybridization studies.
- nucleic acids which hybridize under high stringency to the nucleic acids identified in the figures, or their complements are considered CA sequences.
- High stringency conditions are known in the art; see for example Maniatis et ⁇ l.. Molecular Cloning: A Laboratory Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed. Ausubel, et al., both of which are hereby incorporated by reference.
- Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
- Tm thermal melting point
- Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g. 10 to 50 nucleotides) and at least about 60°C for long probes (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- less stringent hybridization conditions are used; for example, moderate or low stringency conditions may be used, as are known in the art; see Maniatis and Ausubel, supra, and Tijssen, supra.
- CA nucleic acid sequences of the invention are fragments of larger genes, i.e. they are nucleic acid segments.
- the CA nucleic acid sequences can serve as indicators of oncogene position, for example, the CA sequence may be an enhancer that activates a protooncogene.
- "Genes" in this context includes coding regions, non-coding regions, and mixtures of coding and non-coding regions.
- CA genes can be obtained, using techniques well known in the art for cloning either longer sequences or the full length sequences; see Maniatis et al., and Ausubel, et al., supra, hereby expressly incorporated by reference. In general, this is done using PCR, for example, kinetic PCR.
- CA nucleic acid Once the CA nucleic acid is identified, if can be cloned and, if necessary, its constituent parts recombined to form the entire CA nucleic acid.
- the recombinant CA nucleic acid Once isolated from its natural source, e.g., contained within a plasmid or other vector or excised therefrom as a linear nucleic acid segment, the recombinant CA nucleic acid can be further used as a probe to identify and isolate other CA nucleic acids, for example additional coding regions. It can also be used as a "precursor" nucleic acid to make modified or variant CA nucleic acids and proteins.
- CA nucleic acids of the present invention are used in several ways.
- nucleic acid probes to the CA nucleic acids are made and attached to biochips to be used in screening and diagnostic methods, as outlined below, or for administration, for example for gene therapy and/or antisense applications.
- the CA nucleic acids that include coding regions of CA proteins can be put into expression vectors for the expression of CA proteins, again either for screening purposes or for administration to a patient.
- nucleic acid probes to CA nucleic acids are made.
- the nucleic acid probes attached to the biochip are designed to be substantially complementary to the CA nucleic acids, i.e. the target sequence (either the target sequence of the sample or to other probe sequences, for example in sandwich assays), such that hybridization of the target sequence and the probes of the present invention occurs.
- this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention.
- the sequence is not a complementary target sequence.
- substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions, particularly high stringency conditions, as outlined herein.
- a nucleic acid probe is generally single stranded but can be partially single and partially double stranded.
- the strandedness of the probe is dictated by the structure, composition, and properties of the target sequence.
- the nucleic acid probes range from about 8 to about 100 bases long, with from about 10 to about 80 bases being preferred, and from about 30 to about 50 bases being particularly preferred. That is, generally whole genes are not used. In some embodiments, much longer nucleic acids can be used, up to hundreds of bases.
- more than one probe per sequence is used, with either overlapping probes or probes to different sections of the target being used. That is, two, three, four or more probes, with three being preferred, are used to build in a redundancy for a particular target.
- the probes can be overlapping (i.e. have some sequence in common), or separate.
- nucleic acids can be attached or immobilized to a solid support in a wide variety of ways.
- immobilized and grammatical equivalents herein is meant the association or binding between the nucleic acid probe and the solid support is sufficient to be stable under the conditions of binding, washing, analysis, and removal as outlined below.
- the binding can be covalent or non-covalent.
- non- covalent binding and grammatical equivalents herein is meant one or more of either electrostatic, hydrophilic, and hydrophobic interactions. Included in non-covalent binding is the covalent attachment of a molecule, such as, streptavidin to the support and the non-covalent binding of the biotinylated probe to the streptavidin.
- covalent binding and grammatical equivalents herein is meant that the two moieties, the solid support and the probe, are attached by at least one bond, including sigma bonds, pi bonds and coordination bonds. Covalent bonds can be formed directly between the probe and the solid support or can be formed by a cross linker or by inclusion of a specific reactive group on either the solid support or the probe or both molecules. Immobilization may also involve a combination of covalent and non-covalent interactions.
- the probes are attached to the biochip in a wide variety of ways, as will be appreciated by those in the art.
- the nucleic acids can either be synthesized first, with subsequent attachment to the biochip, or can be directly synthesized on the biochip.
- the biochip comprises a suitable solid substrate.
- substrate or “solid support” or other grammatical equivalents herein is meant any material that can be modified to contain discrete individual sites appropriate for the attachment or association of the nucleic acid probes and is amenable to at least one detection method.
- the number of possible substrates are very large, and include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonTM, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, etc.
- the substrates allow optical detection and do not appreciably fluoresce.
- the surface of the biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two.
- the biochip is derivatized with a chemical functional group including, but not limited to, amino groups, carboxy groups, oxo groups and thiol groups, with amino groups being particularly preferred.
- the probes can be attached using functional groups on the probes.
- nucleic acids containing amino groups can be attached to surfaces comprising amino groups, for example using linkers as are known in the art; for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference).
- additional linkers such as alkyl groups (including substituted and heteroalkyl groups) may be used.
- the oligonucleotides are synthesized as is known in the art, and then attached to the surface of the solid support. As will be appreciated by those skilled in the art, either the 5' or 3' terminus may be attached to the solid support, or attachment may be via an internal nucleoside.
- the immobilization to the solid support may be very strong, yet non-covalent.
- biotinylated oligonucleotides can be made, which bind to surfaces covalently coated with streptavidin, resulting in attachment.
- the oligonucleotides may be synthesized on the surface, as is known in the art.
- photoactivation techniques utilizing photopolymerization compounds and techniques are used.
- the nucleic acids can be synthesized in sit ⁇ , using well known photolithographic techniques, such as those described in WO 95/251 16; WO 95/35505; U.S. Patent Nos. 5,700,637 and 5,445,934; and references cited within, all of which are expressly incorporated by reference; these methods of attachment form the basis of the Affymefrix GeneChip technology.
- PCR kinetic polymerase chain reaction
- oligonucleotide primers designed to preferentially adhere to single-stranded nucleic acid sequences bracketing the target site. This pair of oligonucleotide primers form specific, non-covalently bound complexes on each strand of the target sequence. These complexes facilitate in vitro transcription of double-stranded DNA in opposite orientations.
- Temperature cycling of the reaction mixture creates a continuous cycle of primer binding, transcription, and re-melting of the nucleic acid to individual strands. The result is an exponential increase of the target dsDNA product.
- This product can be quantified in real time either through the use of an intercalating dye or a sequence specific probe.
- SYBR® Greene I is an example of an intercalating dye, that preferentially binds to dsDNA resulting in a concomitant increase in the fluorescent signal.
- Sequence specific probes such as used with TaqMan® technology, consist of a fluorochrome and a quenching molecule covalently bound to opposite ends of an oligonucleotide. The probe is designed to selectively bind the target DNA sequence between the two primers.
- the fluorochrome is cleaved from the probe by the exonuclease activity of the polymerase resulting in signal dequenching.
- the probe signaling method can be more specific than the intercalating dye method, but in each case, signal strength is proportional to the dsDNA product produced.
- Each type of quantification method can be used in multi-well liquid phase arrays with each well representing primers and/or probes specific to nucleic acid sequences of interest. When used with messenger RNA preparations of tissues or cell lines, and an array of probe/primer reactions can simultaneously quantify the expression of multiple gene products of interest. See Germer, S., et al.. Genome Res. 10:258-266 (2000); Heid, C. A., et al.. Genome Res. 6, 986-994 (1996).
- CA nucleic acids encoding CA proteins are used to make a variety of expression vectors to express CA proteins which can then be used in screening assays, as described below.
- the expression vectors may be either self-replicating extrachromosomal vectors or vectors which integrate into a host genome.
- these expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleic acid encoding the CA protein.
- control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
- the control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site.
- Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
- Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- operably linked means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
- the transcriptional and translational regulatory nucleic acid will generally be appropriate to ⁇ the host cell used to express the CA protein; for example, transcriptional and translational regulatory nucleic acid sequences from Bacillus are preferably used to express the CA protein in Bacillus. Numerous types of appropriate expression vectors, and suitable regulatory sequences are known in the art for a variety of host cells.
- the transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences.
- the regulatory sequences include a promoter and transcriptional start and stop sequences.
- Promoter sequences encode either constitutive or inducible promoters.
- the promoters may be either naturally occurring promoters or hybrid promoters.
- Hybrid promoters which combine elements of more than one promoter, are also known in the art, and are useful in the present invention.
- the expression vector may comprise additional elements.
- the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example in mammalian or insect cells for expression and in a procaryotic host for cloning and amplification.
- the expression vector contains at least one sequence homologous to the host cell genome, and preferably two homologous sequences which flank the expression construct.
- the integrating vector may be directed to a specific locus in the host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are well known in the art.
- the expression vector contains a selectable marker gene to allow the selection of transformed host cells.
- Selection genes are well known in the art and will vary with the host cell used.
- the CA proteins of the present invention are produced by culturing a host cell transformed with an expression vector containing nucleic acid encoding an CA protein, under the appropriate conditions to induce or cause expression of the CA protein.
- the conditions appropriate for CA protein expression will vary with the choice of the expression vector and the host cell, and will be easily ascertained by one skilled in the art through routine experimentation.
- the use of constitutive promoters in the expression vector will require optimizing the growth and proliferation of the host cell, while the use of an inducible promoter requires the appropriate growth conditions for induction.
- the timing of the harvest is important.
- the baculoviral systems used in insect cell expression are lytic viruses, and thus harvest time selection can be crucial for product yield.
- Appropriate host cells include yeast, bacteria, archaebacteria, fungi, and insect, plant and animal cells, including mammalian cells. Of particular interest are Drosophila melanogaster cells, Saccharomyces cerevisiae and other yeasts, E. coli. Bacillus s ⁇ btilis, Sf9 cells, C129 cells, 293 cells, Ne ⁇ rospora, BHK, CHO, COS, HeLa cells, THP1 cell line (a macrophage cell line) and human cells and cell lines.
- the CA proteins are expressed in mammalian cells.
- Mammalian expression systems are also known in the art, and include retroviral systems.
- a preferred expression vector system is a retroviral vector system such as is generally described in PCT/US97/01019 and PCT/US97/01048, both of which are hereby expressly incorporated by reference.
- mammalian promoters are the promoters from mammalian viral genes, since the viral genes are often highly expressed and have a broad host range. Examples include the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter, herpes simplex virus promoter, and the CMV promoter.
- transcription termination and polyadenylation sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence.
- transcription terminator and polyadenlytion signals include those derived form SV40.
- the methods of introducing exogenous nucleic acid into mammalian hosts, as well as other hosts, is well known in the art, and will vary with the host cell used. Techniques include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, viral infection, encapsulation of the polynucleotide (s) in liposomes, and direct microinjection of the DNA into nuclei.
- CA proteins are expressed in bacterial systems.
- Bacterial expression systems are well known in the art. Promoters from bacteriophage may also be used and are known in the art.
- synthetic promoters and hybrid promoters are also useful; for example, the tac promoter is a hybrid of the trp and lac promoter sequences.
- a bacterial promoter can include naturally occurring promoters of non-bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription. In addition to a functioning promoter sequence, an efficient ribosome binding site is desirable.
- the expression vector may also include a signal peptide sequence that provides for secretion of the CA protein in bacteria.
- the protein is either secreted into the growth media (gram-positive bacteria) or into the periplasmic space, located between the inner and outer membrane of the cell (gram-negative bacteria).
- the bacterial expression vector may also include a selectable marker gene to allow for the selection of bacterial strains that have been transformed. Suitable selection genes include genes which render the bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin and tetracycline. Selectable markers also include biosynthetic genes, such as those in the histidine, tryptophan and leucine biosynthetic pathways. These components are assembled into expression vectors.
- .Expression vectors for bacteria are well known in the art, and include vectors for Bacillus s ⁇ btilis, E. coli, Streptococcus cremoris, and Streptococcus lividans, among others.
- the bacterial expression vectors are transformed into bacterial host cells using techniques well known in the art, such as calcium chloride treatment, electroporation, and others.
- CA proteins are produced in insect cells.
- Expression vectors for the transformation of insect cells and in particular, baculovirus-based expression vectors, are well known in the art.
- CA protein is produced in yeast cells.
- Yeast expression systems are well known in the art, and include expression vectors for Saccharomyces cerev/srae, Candida atbicans and C. ma/fosa, Hansen ⁇ la polymorpha, Kl ⁇ yveromyces fragllis and K. lactis, P/ch a guillerimondii and P. pasforis, Schizosaccharomyces pombe, and Varrowia
- the CA protein may also be made as a fusion protein, using techniques well known in the art. Thus, for example, for the creation of monoclonal antibodies. If the desired epitope is small, the CA protein may be fused to a carrier protein to form an immunogen. Alternatively, the CA protein may be made as a fusion protein to increase expression, or for other reasons. For example, when the CA protein is an CA peptide, the nucleic acid encoding the peptide may be linked to other nucleic acid for expression purposes.
- the CA nucleic acids, proteins and antibodies of the invention are labeled.
- labeled herein is meant that a compound has at least one element, isotope or chemical compound attached to enable the detection of the compound.
- labels fall into three classes: a) isotopic labels, which may be radioactive or heavy isotopes; b) immune labels, which may be antibodies or antigens; and c) colored or fluorescent dyes.
- the labels may be incorporated into the CA nucleic acids, proteins and antibodies at any position.
- the label should be capable of producing, either directly or indirectly, a detectable signal.
- the detectable moiety may be a radioisotope, such as 3 H, , C, 32 P, 35 S, or 125 l, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.
- a radioisotope such as 3 H, , C, 32 P, 35 S, or 125 l
- a fluorescent or chemiluminescent compound such as fluorescein isothiocyanate, rhodamine, or luciferin
- an enzyme such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.
- Any method known in the art for conjugating the antibody to the label may be employed, including those methods described by Hunter et al., Nature, 144:945 (1962); David e
- the present invention also provides CA protein sequences.
- An CA protein of the present invention may be identified in several ways. "Protein” in this sense includes proteins, polypeptides, and peptides.
- the nucleic acid sequences of the invention can be used to generate protein sequences. There are a variety of ways to do this, including cloning the entire gene and verifying its frame and amino acid sequence, or by comparing it to known sequences to search for homology to provide a frame, assuming the CA protein has homology to some protein in the database being used.
- the nucleic acid sequences are input into a program that will search all three frames for homology. This is done in a preferred embodiment using the following NCBI Advanced BLAST parameters.
- the program is blastx or blastn.
- the database is nr.
- the input data is as "Sequence in FASTA format”.
- the organism list is “none”.
- the “expect” is 10; the filter is default.
- the “descriptions” is 500, the “alignments” is 500, and the “alignment view” is pairwise.
- the "query Genetic Codes” is standard (1 ).
- the matrix is BLOSUM62; gap existence cost is 11 , per residue gap cost is 1 ; and the lambda ratio is .85 default. This results in the generation of a putative protein sequence.
- CA proteins are amino acid variants of the naturally occurring sequences, as determined herein.
- the variants are preferably greater than about 75% homologous to the wild-type sequence, more preferably greater than about 80%, even more preferably greater than about 85% and most preferably greater than 90%.
- the homology will be as high as about 93 to 95 or 98%.
- nucleic acids homology in this context means sequence similarity or identity, with identify being preferred. This homology will be determined using standard techniques known in the art as are outlined above for the nucleic acid homologies.
- CA proteins of the present invention may be shorter or longer than the wild type amino acid sequences.
- included within the definition of CA proteins are portions or fragments of the wild type sequences herein.
- the CA nucleic acids of the invention may be used to obtain additional coding regions, and thus additional protein sequence, using techniques known in the art.
- the CA proteins are derivative or variant CA proteins as compared to the wild-type sequence. That is, as outlined more fully below, the derivative CA peptide will contain at least one amino acid substitution, deletion or insertion, with amino acid substitutions being particularly preferred. The amino acid substitution, insertion or deletion may occur at any residue within the CA peptide.
- variants are also included in an embodiment of CA proteins of the present invention. These variants fall into one or more of three classes: substitutional, insertional or deletional variants. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the CA protein, using cassette or PCR mutagenesis or other techniques well known in the art, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture as outlined above. However, variant CA protein fragments having up to about 100-150 residues may be prepared by in vitro synthesis using established techniques.
- Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the CA protein amino acid sequence.
- the variants typically exhibit the same qualitative biological activity as the naturally occurring analogue, although variants can also be selected which have modified characteristics as will be more fully outlined below.
- the mutation per se need not be predetermined.
- random mutagenesis may be conducted at the target codon or region and the expressed CA variants screened for the optimal combination of desired activity.
- Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example. Ml 3 primer mutagenesis and LAR mutagenesis. Screening of the mutants-is done using assays of CA protein activities.
- Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1 to 20 amino acids, although considerably larger insertions may be tolerated. Deletions range from about 1 to about 20 residues, although in some cases deletions may be much larger.
- substitutions deletions, insertions or any combination thereof may be used to arrive at a final derivative. Generally these changes are done on a few amino acids to minimize the alteration of the molecule. However, larger changes may be tolerated in certain circumstances. When small alterations in the characteristics of the CA protein are desired, substitutions are generally made in accordance with the following chart:
- substitutions that are less conservative than those shown in Chart I.
- substitutions may be made which more significantly affect: the structure of the polypeptide backbone in the area of the alteration, for example the alpha-helical or beta-sheet structure; the charge or hydrophobicity of the molecule at the target site; or the bulk of the side chain.
- the substitutions which in general are expected to produce the greatest changes in the polypeptide's properties are those in which (a) a hydrophilic residue, e.g. seryl or threonyl is substituted for (or by) a hydrophobic residue, e.g.
- leucyi isoleucyl, phenylalanyl, valyl or alanyl
- a cysteine or proline is substituted for (or by) any other residue
- a residue having an electropositive side chain e.g. lysyl, arginyl, or histidyl
- an electronegative residue e.g. glutamyl or aspartyl
- a residue having a bulky side chain e.g. phenylalanine, is substituted for (or by) one not having a side chain, e.g. glycine.
- variants typically exhibit the same qualitative biological activity and will elicit the same immune response as the naturally-occurring analogue, although variants also are selected to modify the characteristics of the CA proteins as needed.
- the variant may be designed such that the biological activity of the CA protein is altered. For example, glycosylation sites may be altered or removed, dominant negative mutations created, etc.
- Covalent modifications of CA polypeptides are included within the scope of this invention, for example for use in screening.
- One type of covalent modification includes reacting targeted amino acid residues of an CA polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N-or C-terminal residues of an CA polypeptide.
- Derivatization with bifunctional agents is useful, for instance, for crosslinking CA polypeptides to a water-insoluble support matrix or surface for use in the method for purifying anti-CA antibodies or screening assays, as is more fully described below.
- crosslinking agents include, e.g., l,1-bis(diazoacetyl)-2- phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4- azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maleimido-1,8- octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate.
- Another type of covalent modification of the CA polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
- "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence CA polypeptide, and/or adding one or more glycosylation sites that are not present in the native sequence CA polypeptide.
- Addition of glycosylation sites to CA polypeptides may be accomplished by altering the amino acid sequence thereof.
- the alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence CA polypeptide (for O-linked glycosylation sites).
- the CA amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the CA polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
- Another means of increasing the number of carbohydrate moieties on the CA polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330 published 1 1 September 1987, and in Aplin and Wriston, LA Crit. Rev. Biochem., pp.259-306 (1981).
- Removal of carbohydrate moieties present on the CA polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation.
- Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al.. Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al., Anal. Biochem., 1 18:131 (1981).
- Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo-and exo-glycosidases as described by Thotakura et al., Meth. Enzymol., 138:350 (1987).
- CA polypeptide comprises linking the CA polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4, 179,337.
- nonproteinaceous polymers e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes
- CA polypeptides of the present invention may also be modified in a way to form chimeric molecules comprising an CA polypeptide fused to another, heterologous polypeptide or amino acid sequence.
- a chimeric molecule comprises a fusion of an CA polypeptide with a tag polypeptide which provides an epitope to which an anti- tag antibody can selectively bind.
- the epitope tag is generally placed at the amino-or carboxyl-terminus of the CA polypeptide, although internal fusions may also be tolerated in some instances. The presence of such epitope-tagged forms of an CA polypeptide can be detected using an antibody against the tag polypeptide.
- the epitope tag enables the CA polypeptide to be readily purified by affinity purification using an anti- tag antibody or another type of affinity matrix that binds to the epitope tag.
- the chimeric molecule may comprise a fusion of an CA polypeptide with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be to the Fc region of an IgG molecule.
- tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky et al..
- tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.. Science, 255:192-194 (1992)]; tubulin epitope peptide [Skinner et al., J. Biol. Chem., 266:15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].
- CA protein also included with the definition of CA protein in one embodiment are other CA proteins of the CA family, and CA proteins from other organisms, which are cloned and expressed as outlined below.
- probe or degenerate polymerase chain reaction (PCR) primer sequences may be used to find other related CA proteins from humans or other organisms.
- particularly useful probe and/or PCR primer sequences include the unique areas of the CA nucleic acid sequence.
- preferred PCR primers are from about 15 to about 35 nucleotides in length, with from about 20 to about 30 being preferred, and may contain inosine as needed.
- the conditions for the PCR reaction are well known in the art.
- CA proteins can be made that are longer than those encoded by the nucleic acids of the figures, for example, by the elucidation of additional sequences, the addition of epitope or purification tags, the addition of other fusion sequences, etc.
- CA proteins may also be identified as being encoded by CA nucleic acids.
- CA - proteins are encoded by nucleic acids that will hybridize to the sequences of the sequence listings, or their complements, as outlined herein.
- the invention provides CA antibodies.
- the CA protein when the CA protein is to be used to generate antibodies, for example for immunotherapy, the CA protein should share at least one epitope or determinant with the full length protein.
- epitope or “determinant” herein is meant a portion of a protein which will generate and/or bind an antibody or T-cell receptor in the context of MHC. Thus, in most instances, antibodies made to a smaller CA protein will be able to bind to the full length protein.
- the epitope is unique; that is, antibodies generated to a unique epitope show little or no cross-reactivity.
- antibody includes antibody fragments, as are known in the art, including Fab, Fab 2 , single chain antibodies (Fv for example), chimeric antibodies, etc., either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA technologies.
- Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
- the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
- the immunizing agent may include a protein encoded by a nucleic acid of the figures or fragment thereof or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
- immunogenic proteins examples include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
- adjuvants examples include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation.
- the antibodies may, alternatively, be monoclonal antibodies.
- Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
- a hybridoma method a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro.
- the immunizing agent will typically include a polypeptide encoded by a nucleic acid of Table 1 , or fragment thereof or a fusion protein thereof.
- peripheral blood lymphocytes are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired.
- the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp.59-103].
- Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
- the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- the culture medium for the hybridom ⁇ s typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
- the antibodies are bispecific antibodies.
- Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
- one of the binding specificities is for a protein encoded by a nucleic acid of Table 1 , or a fragment thereof, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit, preferably one that is tumor specific.
- the antibodies to CA are capable of reducing or eliminating the biological function of CA, as is described below. That is, the addition of anti-CA antibodies (either polyclonal or preferably monoclonal) to CA (or cells containing CA) may reduce or eliminate the CA activity. Generally, at least a 25% decrease in activity is preferred, with at least about 50% being particularly preferred and about a 95-100% decrease being especially preferred.
- the antibodies to the CA proteins are humanized antibodies.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- CDR complementary determining region
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also corhprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the framework residues (FR) regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321 :522-525 (1986); Riechmann et al.. Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
- Fc immunoglobulin constant region
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al.. Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
- humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991 ); Marks et al., J. Mol. Biol., 222:581 (1 91 )].
- the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies [Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(l):86-95 (1991)].
- human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S.
- immunotherapy is meant treatment of a carcinoma with an antibody raised against an CA protein.
- immunotherapy can be passive or active.
- Passive immunotherapy as defined herein is the passive transfer of antibody to a recipient (patient).
- Active immunization is the induction of antibody and/or T-cell responses in a recipient (patient).
- Induction of an immune response is the result of providing the recipient with an antigen to which antibodies are raised.
- the antigen may be provided by injecting a polypeptide against which antibodies are desired to be raised into a recipient, or contacting the recipient with a nucleic acid capable of expressing the antigen and under conditions for expression of the antigen.
- oncogenes which encode secreted growth factors may be inhibited by raising antibodies against CA proteins that are secreted proteins as described above. Without being bound by theory, antibodies used for treatment, bind and prevent the secreted protein from binding to its receptor, thereby inactivating the secreted CA protein.
- the CA protein to which antibodies are raised is a transmembrane protein.
- antibodies used for treatment bind the extracellular domain of the CA protein and prevent it from binding to other proteins, such as circulating ligands or cell-associated molecules.
- the antibody may cause down-regulation of the transmembrane CA protein.
- the antibody may be a competitive, non-competitive or uncompetitive inhibitor of protein binding to the extracellular domain of the CA protein.
- the antibody is also an antagonist of the CA protein. Further, the antibody prevents activation of the transmembrane CA protein. In one aspect, when the antibody prevents the binding of other molecules to the CA protein, the antibody prevents growth of the cell.
- the antibody may also sensitize the cell to cytotoxic agents, including, but not limited to TNF-a, TNF- ⁇ , IL— 1 , INF- ⁇ and IL-2, or chemotherapeutic agents including 5FU, vinblastine, actinomycin D, cisplatin, methotrexate, and the like.
- cytotoxic agents including, but not limited to TNF-a, TNF- ⁇ , IL— 1 , INF- ⁇ and IL-2, or chemotherapeutic agents including 5FU, vinblastine, actinomycin D, cisplatin, methotrexate, and the like.
- the antibody belongs to a sub-type that activates serum complement when complexed with the transmembrane protein thereby mediating cytotoxicity.
- carcinomas may be treated by administering to a patient antibodies directed against the transmembrane CA protein.
- the antibody is conjugated to a therapeutic moiety.
- the therapeutic moiety is a small molecule that modulates the activity of the CA protein.
- the therapeutic moiety modulates the activity of molecules associated with or in close proximity to the CA protein.
- the therapeutic moiety may inhibit enzymatic activity such as protease or protein kinase activity associated with carcinoma.
- the therapeutic moiety may also be a cytotoxic agent. In this method, targeting the cytotoxic agent to tumor tissue or cells, results in a reduction in the number of afflicted cells, thereby reducing symptoms associated with carcinomas, including lymphoma or breast cancer.
- Cytotoxic agents are numerous and varied and include, but are not limited to, cytotoxic drugs or toxins or active fragments of such toxins. Suitable toxins and their corresponding fragments include diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, crotin, phenomycin, enomycin and the like. Cytotoxic agents also include radiochemicals made by conjugating radioisotopes to antibodies raised against CA proteins, or binding of a radionuclide to a chelating agent that has been covalently attached to the antibody.
- Targeting the therapeutic moiety to transmembrane CA proteins not only serves to increase the local concentration of therapeutic moiety in the carcinoma of interest, i.e., lymphoma or breast cancer, but also serves to reduce deleterious side effects that may be associated with the therapeutic moiety.
- the CA protein against which the antibodies are raised is an intracellular protein.
- the antibody may be conjugated to a protein which facilitates entry into the cell.
- the antibody enters the cell by endocyfosis.
- a nucleic acid encoding the antibody is administered to the individual or cell.
- an antibody thereto contains a signal for that target localization, i.e., a nuclear localization signal.
- CA antibodies of the invention specifically bind to CA proteins.
- specifically bind herein is meant that the antibodies bind to the protein with a binding constant in the range of at least 1CH- 1CH 5 M-', with a preferred range being 1C - 10-° M -1 .
- the CA protein is purified or isolated after expression.
- CA proteins may be isolated or purified in a variety of ways known to those skilled in the art depending on what other components are present in the sample. Standard purification methods include electrophoretic, molecular, immunological and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse-phase HPLC chromatography, and chromatofocusing.
- the CA protein may be purified using a standard anti-CA antibody column. Ultrafiltration and diafiltration techniques, in conjunction with protein concentration, are also useful. For general guidance in suitable purification techniques, see Scopes, R., Protein Purification, Springer- Verlag, NY (1982). The degree of purification necessary will vary depending on the use of the CA protein. In some instances no purification will be necessary.
- CA proteins and nucleic acids are useful in a number of applications.
- the expression levels of genes are determined for different cellular states in the carcinoma phenotype; that is, the expression levels of genes in normal tissue and in carcinoma tissue (and in some cases, for varying severities of lymphoma or breast cancer that relate to prognosis, as outlined below) are evaluated to provide expression profiles.
- An expression profile of a particular cell state or point of development is essentially a "fingerprint" of the state; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is unique to the state of the cell.
- differential expression refers to both qualitative as well as quantitative differences in the genes temporal and/or cellular expression patterns within and among the cells.
- a differentially expressed gene can qualitatively have its expression altered, including an activation or inactivation, in, for example, normal versus carcinoma tissue. That is, genes may be turned on or turned off in a particular state, relative to another state. As is apparent to the skilled artisan, any comparison of two or more states can be made. Such a qualitatively regulated gene will exhibit an expression pattern within a state or cell type which is detectable by standard techniques in one such state or cell type, but is not detectable in both.
- the determination is quantitative in that expression is increased or decreased; that is, the expression of the gene is either upregulated, resulting in an increased amount of transcript, or downregulated, resulting in a decreased amount of transcript.
- the degree to which expression differs need only be large enough to quantify via standard characterization techniques as outlined below, such as by use of Affymetrix GeneChip® expression arrays, Lockhart, Nature Biotechnology, 14:1675-1680 (1996), hereby expressly incorporated by reference.
- Other techniques include, but are not limited to, quantitative reverse transcriptase PCR, Northern analysis and RNase protection.
- the change in expression i.e. upregulation or downregulation
- this may be done by evaluation at either the gene transcript, or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes to the DNA or RNA equivalent of the gene transcript, and the quantification of gene expression levels, or, alternatively, the final gene product itself (protein) can be monitored, for example through the use of antibodies to the CA protein and standard immunoassays (ELISAs, etc.) or other techniques, including mass spectroscopy assays, 2D gel electrophoresis assays, etc.
- ELISAs standard immunoassays
- the proteins co ⁇ esponding to CA genes i.e. those identified as being important in a particular carcinoma phenotype, i.e., breast cancer or lymphoma, can be evaluated in a diagnostic test specific for that carcinoma.
- gene expression monitoring is done and a number of genes, i.e. an expression profile, is monitored simultaneously, although multiple protein expression monitoring can be done as well. Similarly, these assays may be done on an individual basis as well.
- the CA nucleic acid probes may be attached to biochips as outlined herein for the detection and quantification of CA sequences in a particular cell.
- the assays are done as is known in the art. As will be appreciated by those in the art, any number of different CA sequences may be used as probes, with single sequence assays being used in some cases, and a plurality of the sequences described herein being used in other embodiments. In addition, while solid-phase assays are described, any number of solution based assays may be done as well.
- both solid and solution based assays may be used to detect CA sequences that are up-regulated or down-regulated in carcinomas as compared to normal tissue.
- the protein will be detected as outlined herein.
- nucleic acids encoding the CA protein are detected.
- DNA or RNA encoding the CA protein may be detected, of particular interest are methods wherein the mRNA encoding ⁇ CA protein is detected.
- the presence of mRNA in ⁇ sample is an indication that the CA gene, such as PRLR has been transcribed to form the mRNA, and suggests that the protein is expressed.
- Probes to detect the mRNA can be any nucleotide/deoxynucleotide probe that is complementary to and base pairs with the mRNA and includes but is not limited to oligonucleotides, cDNA or RNA. Probes also should contain a detectable label, as defined herein.
- the mRNA is detected after immobilizing the nucleic acid to be examined on a solid support such as nylon membranes and hybridizing the probe with the sample. Following washing to remove the non- specifically bound probe, the label is detected.
- detection of the mRNA is performed » sit ⁇ .
- permeabilized cells or tissue samples are contacted with a detectably labeled nucleic acid probe for sufficient time to allow the probe to hybridize with the target mRNA. Following washing to remove the non-specifically bound probe, the label is detected.
- RNA probe for example a digoxygenin labeled riboprobe (RNA probe) that is complementary to the mRNA encoding a CA protein is detected by binding the digoxygenin with an anti-digoxygenin secondary antibody and developed with nitro blue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate.
- any of the three classes of proteins as described herein secreted, transmembrane or intracellular proteins are used in diagnostic assays.
- the CA proteins, antibodies, nucleic acids, modified proteins and cells containing CA sequences are used in diagnostic assays. This can be done on an individual gene or co ⁇ esponding polypeptide level, or as sets of assays.
- CA proteins find use as markers of carcinomas, including breast cancer or lymphomas such as, but not limited to, Hodgkin's and non-Hodgkin lymphoma. Detection of these proteins in putative carcinoma tissue or patients allows for a determination or diagnosis of the type of carcinoma. Numerous methods known to those of ordinary skill in the art find use in detecting carcinomas.
- antibodies are used to detect CA proteins.
- a prefe ⁇ ed method separates proteins from a sample or patient by electrophoresis on a gel (typically a denaturing and reducing protein gel, but may be any other type of gel including isoelectric focusing gels and the like). Following separation of proteins, the CA protein is detected by immunoblotting with antibodies raised against the CA protein. Methods of immunoblotting are well known to those of ordinary skill in the art.
- antibodies to the CA protein find use in in sit ⁇ imaging techniques.
- cells are contacted with from one to many antibodies to the CA protein (s). Following washing to remove non-specific antibody binding, the presence of the antibody or antibodies is detected.
- the antibody is detected by incubating with a secondary antibody that contains a detectable label.
- the primary antibody to the CA protein(s) contains a detectable label.
- each one of multiple primary antibodies contains a distinct and detectable label. This method finds particular use in simultaneous screening for a plurality of CA proteins. As will be appreciated by one of ordinary skill in the art, numerous other histological imaging techniques are useful in the invention.
- the label is detected in a fluorometer which has the ability to detect and distinguish emissions of different wavelengths.
- a fluorescence activated cell sorter FACS
- FACS fluorescence activated cell sorter
- antibodies find use in diagnosing carcinomas from blood samples.
- certain CA proteins are secreted/circulating molecules. Blood samples, therefore, are useful as samples to be probed or tested for the presence of secreted CA proteins.
- Antibodies can be used to detect the CA proteins by any of the previously described immunoassay techniques including ELISA, immunoblotting (Western blotting), immunoprecipitation, BIACORE technology and the like, as will be appreciated by one of ordinary skill in the art.
- a ⁇ ays In a prefe ⁇ ed embodiment, in sit ⁇ hybridization of labeled CA nucleic acid probes to tissue a ⁇ ays is done. For example, a ⁇ ays of tissue samples, including CA tissue and/or normal tissue, are made. In sit ⁇ hybridization as is known in the art can then be done.
- the CA proteins, antibodies, nucleic acids, modified proteins and cells containing CA sequences are used in prognosis assays.
- gene expression profiles can be generated that co ⁇ elate to carcinoma, especially breast cancer or lymphoma, severity, in terms of long term prognosis. Again, this may be done on either a protein or gene level, with the use of genes being prefe ⁇ ed.
- the CA probes are attached to biochips for the detection and quantification of CA sequences in a tissue or patient. The assays proceed as outlined for diagnosis.
- any of the CA sequences as described herein are used in drug screening assays.
- the CA proteins, antibodies, nucleic acids, modified proteins and cells containing CA sequences are used in drug screening assays or by evaluating the effect of drug candidates on a "gene expression profile" or expression profile of polypeptides.
- the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, Zlokarnik, et al.. Science 279, 84-8 (1998), Heid, et al.. Genome Res., 6:986-994 (1996).
- the CA proteins, antibodies, nucleic acids, modified proteins and cells containing the native or modified CA proteins are used in screening assays. That is, the present invention provides novel methods for screening for compositions which modulate the carcinoma phenotype. As above, this can be done by screening for modulators of gene expression or for modulators of protein activity. Similarly, this may be done on an individual gene or protein level or by evaluating the effect of drug candidates on a "gene expression profile".
- the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent, see Zlokarnik, supra.
- assays may be run on an individual gene or protein level. That is, having identified a particular gene as abe ⁇ antly regulated in carcinoma, candidate bioactive agents may be screened to modulate the genes response. "Modulation" thus includes both an increase and a decrease in gene expression or activity. The prefe ⁇ ed amount of modulation will depend on the original change of the gene expression in normal versus tumor tissue, with changes of at least 10%, preferably 50%, more preferably 100-300%, and in some embodiments 300- 1000% or greater.
- the protein will be detected as outlined herein. As will be appreciated by those in the art, this may be done by evaluation at either the gene or the protein level; that is, the amount of gene expression may be monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, the level of the gene product itself can be monitored, for example through the use of antibodies to the CA protein and standard immunoassays. Alternatively, binding and bioactivity assays with the protein may be done as outlined below.
- gene expression monitoring is done and a number of genes, i.e. an expression profile, is monitored simultaneously, although multiple protein expression monitoring can be done as well.
- the CA nucleic acid probes are attached to biochips as outlined herein for the detection and quantification of CA sequences in a particular cell.
- the assays are further described below.
- a candidate bioactive agent is added to the cells prior to analysis.
- screens are provided to identify a candidate bioactive agent which modulates a particular type of carcinoma, modulates CA proteins, binds to a CA protein, or interferes between the binding of a CA protein and an antibody.
- candidate bioactive agent or “drug candidate” or grammatical equivalents as used herein describes any molecule, e.g., protein, oligopeptide, small organic or inorganic molecule, polysaccharide, polynucleotide, etc., to be tested for bioactive agents that are capable of directly or indirectly altering either the carcinoma phenotype, binding to and/or modulating the bioactivity of an CA protein, or the expression of a CA sequence, including both nucleic acid sequences and protein sequences.
- the candidate agent suppresses a CA phenotype, for example to a normal tissue fingerprint.
- the candidate agent preferably suppresses a severe CA phenotype.
- a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
- a candidate agent will neutralize the effect of an CA protein.
- neutralize is meant that activity of a protein is either inhibited or counter acted against so as to have substantially no effect on a cell.
- Candidate agents encompass numerous chemical classes, though typically they are organic or inorganic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Prefe ⁇ ed small molecules are less than 2000, or less than 1500 or less than 1000 or less than 500 D.
- Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
- the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
- Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Particularly prefe ⁇ ed are peptides.
- Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification to produce structural analogs.
- the candidate bioactive agents are proteins.
- protein herein is meant at least two covalently attached amino acids, which includes proteins, polypeptides, oligopeptides and peptides.
- the protein may be made up of naturally occu ⁇ ing amino acids and peptide bonds, or synthetic peptidomimetic structures.
- amino acid or “peptide residue”, as used herein means both naturally occu ⁇ ing and synthetic amino acids. For example, homo-phenylalanine, citrulline and noreleucine are considered amino acids for the purposes of the invention.
- Amino acid also includes imino acid residues such as proline and hydroxyproline.
- the side chains may be in either the (R) or the (S) configuration.
- the amino acids are in the (S) or L- configuration. If non-naturally occu ⁇ ing side chains are used, non-amino acid substituents may be used, for example to prevent or retard in vivo degradations.
- the candidate bioactive agents are naturally occu ⁇ ing proteins or fragments of naturally occu ⁇ ing proteins.
- cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts may be used.
- libraries of procaryotic and eucaryotic proteins may be made for screening in the methods of the invention.
- Particularly preferred in this embodiment are libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being prefe ⁇ ed, and human proteins being especially prefe ⁇ ed.
- the candidate bioactive agents are peptides of from about 5 to about 30 amino acids, with from about 5 to about 20 amino acids being prefe ⁇ ed, and from about 7 to about 15 being particularly preferred.
- the peptides- may be digests of naturally occu ⁇ ing proteins as is outlined above, random peptides, or "biased” random peptides.
- randomized or grammatical equivalents herein is meant that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. Since generally these random peptides (or nucleic acids, discussed below) are chemically synthesized, they may incorporate any nucleotide or amino acid at any position.
- the synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized candidate bioactive proteinaceous agents.
- the library is fully randomized, with no sequence preferences or constants at any position.
- the library is biased. That is, some positions within the sequence are either held constant, or are selected from a limited number of possibilities.
- the nucleotides or amino acid residues are randomized within a defined class, for example, of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
- the candidate bioactive agents are nucleic acids, as defined above.
- nucleic acid candidate bioactive agents may be naturally occu ⁇ ing nucleic acids, random nucleic acids, or "biased" random nucleic acids.
- digests of procaryotic or eucaryotic genomes may be used as is outlined above for proteins.
- the candidate bioactive agents are organic chemical moieties, a wide variety of which are available in the literature.
- the sample containing the target sequences to be analyzed is added to the biochip.
- the target sequence is prepared using known techniques.
- the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR occu ⁇ ing as needed, as will be appreciated by those in the art.
- an in vitro transcription with labels covalently attached to the nucleosides is done.
- the nucleic acids are labeled with a label as defined herein, with biotin-FITC or PE, cy3 and cy5 being particularly prefe ⁇ ed.
- the target sequence is labeled with, for example, a fluorescent, chemiluminescent, chemical, or radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe.
- the label also can be an enzyme, such as, alkaline phosphatase or horseradish peroxidase, which when provided with an appropriate substrate produces a product that can be detected.
- the label can be a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme.
- the label also can be a moiety or compound, such as, an epitope tag or biotin which specifically binds to streptavidin.
- the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence.
- unbound labeled streptavidin is removed prior to analysis.
- these assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as is generally outlined in U.S. Patent Nos.5,681,702, 5,597,909, 5,545,730, 5,594,1 17, 5,591,584, 5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802, 5,635,352, 5,594,1 18, 5,359,100, 5,124,246 and 5,681 ,697, all of which are hereby incorporated by reference.
- the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex.
- hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions as outlined above.
- the assays are generally run under stringency conditions which allows formation of the label probe hybridization complex only in the presence of target.
- Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc.
- reaction may include a variety of other reagents may be included in the assays. These include reagents like salts, buffers, neutral proteins, e.g. albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used, depending on the sample preparation methods and purity of the target. In addition, either solid phase or solution based (i.e., kinetic PCR) assays may be used.
- the data is analyzed to determine the expression levels, and changes in expression levels as between states, of individual genes, forming a gene expression profile.
- screens can be run to alter the expression of the genes individually. That is, screening for modulation of regulation of expression of a single gene can be done. Thus, for example, particularly in the case of target genes whose presence or absence is unique between two states, screening is done for modulators of the target gene expression.
- screens can be done for novel genes that are induced in response to a candidate agent. After identifying a candidate agent based upon its ability to suppress a CA expression pattern leading to a normal expression pattern, or modulate a single CA gene expression profile so as to mimic the expression of the gene from normal tissue, a screen as described above can be performed to identify genes that are specifically modulated in response to the agent. Comparing expression profiles between normal tissue and agent treated CA tissue reveals genes that are not expressed in normal tissue or CA tissue, but are expressed in agent treated tissue.
- agent specific sequences can be identified and used by any of the methods described herein for CA genes or proteins. In particular these sequences and the proteins they encode find use in- marking or identifying agent treated cells.
- antibodies can be raised against the agent induced proteins and used to target novel therapeutics to the treated CA tissue sample.
- a candidate agent is administered to a population of CA cells, that thus has an associated CA expression profile.
- administration or “contacting” herein is meant that the candidate agent is added to the cells in such a manner as to allow the agent to act upon the cell, whether by uptake and intracellular action, or by action at the cell surface.
- nucleic acid encoding a proteinaceous candidate agent i.e. a peptide
- a viral construct such as a retroviral construct and added to the cell, such that expression of the peptide agent is accomplished; see PCT US97/01019, hereby expressly incorporated by reference.
- the cells can be washed if desired and are allowed to incubate under preferably physiological conditions for some period of time. The cells are then harvested and a new gene expression profile is generated, as outlined herein.
- CA tissue may be screened for agents that reduce or suppress the CA phenotype.
- a change in at least one gene of the expression profile indicates that the agent has an effect on CA activity.
- screens for new drugs that alter the phenotype can be devised.
- the drug target need not be known and need not be represented in the original expression screening platform, nor does the level of transcript for the target protein need to change.
- screens may be done on individual genes and gene products (proteins). That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of either the expression of the gene or the gene product itself can be done.
- CA proteins The gene products of differentially expressed genes are sometimes refe ⁇ ed to herein as "CA proteins” or an "CAP".
- the CAP may be a fragment, or alternatively, be the full length protein to the fragment encoded by the nucleic acids of Table 1.
- the CAP is a fragment.
- sequences are sequence variants as further described herein.
- the CAP is a fragment of approximately 14 to 24 amino acids long. More preferably the fragment is a soluble fragment. Preferably, the fragment includes a non- transmembrane region. In a prefe ⁇ ed embodiment, the fragment has an N-terminal Cys to aid in solubility. In one embodiment, the c-terminus of the fragment is kept as a free acid and the n-terminus is a free amine to aid in coupling, i.e., to cysteine.
- CA proteins are conjugated to an immunogenic agent as discussed herein. In one embodiment the CA protein is conjugated to BSA.
- screening is done to alter the biological function of the expression product of the CA gene, such as PRLR.
- the CA gene such as PRLR.
- screens are designed to first find candidate agents that can bind to CA proteins, and then these agents may be used in assays that evaluate the ability of the candidate agent to modulate the CAP activity and the carcinoma phenotype.
- assays there are a number of different assays which may be run; binding assays and activity assays.
- binding assays are done.
- purified or isolated gene product is used; that is, the gene products of one or more CA nucleic acids are made. In general,. this is done as is known in the art.
- antibodies are generated to the protein gene products, and standard immunoassays are run to determine the amount of protein present.
- cells comprising the CA proteins can be used in the assays.
- the methods comprise combining ⁇ CA protein and a candidate bioactive agent, and determining the binding of the candidate agent to the CA protein.
- Prefe ⁇ ed embodiments utilize the human or mouse CA protein, although other mammalian proteins may also be used, for example for the development of animal models of human disease.
- variant or derivative CA proteins may be used.
- the CA protein or the candidate agent is non-diffusably bound to an insoluble support having isolated sample receiving areas (e.g. a microtiter plate, an a ⁇ ay, etc.).
- the insoluble supports may be made of any composition to which the compositions can be bound, is readily separated from soluble material, and is otherwise compatible with the overall method of screening.
- the surface of such supports may be solid or porous and of any convenient shape.
- suitable insoluble supports include microtiter plates, a ⁇ ays, membranes and beads.
- Microtiter plates and a ⁇ ays are especially convenient because a large number of assays can be ca ⁇ ied out simultaneously, using small amounts of reagents and samples.
- the particular manner of binding of the composition is not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition and is nondiffusable.
- Prefe ⁇ ed methods of binding include the use of antibodies (which do not sterically block either the ligand binding site or activation sequence when the protein is bound to the support), direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or agent, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.
- BSA bovine serum albumin
- the CA protein is bound to the support, and a candidate bioactive agent is added to the assay.
- the candidate agent is bound to the support and the CA protein is added.
- Novel binding agents include specific antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.
- the determination of the binding of the candidate bioactive agent to the CA protein may be done in a number of ways.
- the candidate bioactive agent is labeled, and binding determined directly. For example, this may be done by attaching all or a portion of the CA protein to a solid support, adding a labeled candidate agent (for example a fluorescent label), washing off excess reagent, and determining whether the label is present on the solid support.
- a labeled candidate agent for example a fluorescent label
- washing off excess reagent for example a fluorescent label
- determining whether the label is present on the solid support Various blocking and washing steps may be utilized as is known in the art.
- label herein is meant that the compound is either directly or indirectly labeled with a label which provides a detectable signal, e.g. radioisotope, fluorescers, enzyme, antibodies, particles such as magnetic particles, chemiluminescers, or specific binding molecules, etc.
- Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
- the complementary member would normally be labeled with a molecule which provides for detection, in accordance with known procedures, as outlined above.
- the label can directly or indirectly provide a detectable signal.
- the proteins may be labeled at tyrosine positions using ,25 l, or with fluorophores.
- more than one component may be labeled with different labels; using ,2 l for the proteins, for example, and a fluorophor for the candidate agents.
- the binding of the candidate bioactive agent is determined through the use of competitive binding assays.
- the competitor is a binding moiety known to bind to the target molecule (i.e. CA protein), such as an antibody, peptide, binding partner, ligand, etc.
- the target molecule i.e. CA protein
- the candidate bioactive agent is labeled.
- Either the candidate bioactive agent, or the competitor, or both, is added first to the protein for a time sufficient to allow binding, if present.
- Incubations may be performed at any temperature which facilitates optimal activity, typically between 4 and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high through put screening. Typically between 0.1 and 1 hour will be sufficient. Excess reagent is generally removed or washed away. The second component is then added, and the presence or absence of the labeled component is followed, to indicate binding.
- the competitor is added first, followed by the candidate bioactive agent.
- Displacement of the competitor is an indication that the candidate bioactive agent is binding to the CA protein and thus is capable of binding to, and potentially modulating, the activity of the CA protein.
- either component can be labeled.
- the presence of label in the wash solution indicates displacement by the agent.
- the candidate bioactive agent is labeled, the presence of the label on the support indicates displacement.
- the candidate bioactive agent is added first, with incubation and washing, followed by the competitor.
- the absence of binding by the competitor may indicate that the bioactive agent is bound to the CA protein with a higher affinity.
- the candidate bioactive agent is labeled, the presence of the label on the support, coupled with a lack of competitor binding, may indicate that the candidate agent is capable of binding to the CA protein.
- the methods comprise differential screening to identity bioactive agents that are capable of modulating the activity of the CA proteins.
- the methods comprise combining a CA protein and a competitor in a first sample.
- a second sample comprises a candidate bioactive agent, a CA protein and a competitor.
- the binding of the competitor is determined for both samples, and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to the CA protein and potentially modulating its activity. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent is capable of binding to the CA protein.
- a prefe ⁇ ed embodiment utilizes differential screening to identify drug candidates that bind to the native CA protein, but cannot bind to modified CA proteins.
- the structure of the CA protein may be modeled, and used in rational drug design to synthesize agents that interact with that site.
- Drug candidates that affect CA bioactivity are also identified by screening drugs for the ability to either enhance or reduce the activity of the protein.
- Positive controls and negative controls may be used in the assays.
- Preferably all control and test samples are performed in at least triplicate to obtain statistically significant results. Incubation of all samples is for a time sufficient for the binding of the agent to the protein. Following incubation, all samples are washed free of non-specifically bound material and the amount of bound, generally labeled agent determined. For example, where a radiolabel is employed, the samples may be counted in a scintillation counter to determine the amount of bound compound.
- reagents may be included in the screening assays. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc which may be used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used. The mixture of components may be added in any order that provides for the requisite binding.
- methods for screening for a bioactive agent capable of modulating the activity of CA proteins comprise the steps of adding a candidate bioactive agent to a sample of CA proteins, as above, and determining an alteration in the biological activity of CA proteins.
- “Modulating the activity of an CA protein” includes an increase in activity, a decrease in activity, or a change in the type or kind of activity present.
- the candidate agent should both bind to CA proteins (although this may not be necessary), and alter its biological or biochemical activity as defined herein.
- the methods include both in vitro screening methods, as are generally outlined above, and in vivo screening of cells for alterations in the presence, distribution, activity or amount of CA proteins.
- the methods comprise combining a CA sample and a candidate bioactive agent, and evaluating the effect on CA activity.
- CA activity or grammatical equivalents herein is meant one of the CA protein's biological activities, including, but not limited to, its role in tumorigenesis, including cell division, preferably in lymphatic tissue, cell proliferation, tumor growth and transformation of cells.
- CA activity includes activation of or by a protein encoded by a nucleic acid of Table 1.
- An inhibitor of CA activity is the inhibition of any one or more CA activities.
- the activity of the CA protein is increased; in another prefe ⁇ ed embodiment, the activity of the CA protein is decreased.
- bioactive agents that are antagonists are prefe ⁇ ed in some embodiments, and bioactive agents that are agonists may be prefe ⁇ ed in other embodiments.
- the invention provides methods for screening for bioactive agents capable of modulating the activity of a CA protein.
- the methods comprise adding a candidate bioactive agent, as defined above, to a cell comprising CA proteins.
- Prefe ⁇ ed cell types include almost any cell.
- the cells contain a recombinant nucleic acid that encodes a CA protein.
- a library of candidate agents are tested on a plurality of cells.
- the assays are evaluated in the presence or absence or previous or subsequent exposure of physiological signals, for example hormones, ' antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e. cell-cell contacts).
- physiological signals for example hormones, ' antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e. cell-cell contacts).
- the determinations are determined at different stages of the cell cycle process.
- a method of inhibiting carcinoma cancer cell division comprises administration of a carcinoma cancer inhibitor.
- a method of inhibiting lymphoma carcinoma cell division comprising administration of a lymphoma carcinoma inhibitor.
- a method of inhibiting breast cancer carcinoma cell division comprising administration of a breast camcer carcinoma inhibitor.
- a method of inhibiting tumor growth comprises administration of a carcinoma cancer inhibitor.
- a method of inhibiting tumor growth in lymphatic tissue comprising administration of a lymphoma inhibitor.
- a method of inhibiting tumor growth is provided.
- the method comprises administration of a carcinoma cancer inhibitor.
- a method of inhibiting tumor growth in mammary tissue comprising administration of a breast cancer inhibitor.
- carcinoma cancer inhibitor In one embodiment the carcinoma is a breast cancer carcinoma. In an alternative embodiment, the carcinoma is a lymphoma carcinoma.
- a carcinoma cancer inhibitor is an antibody as discussed above.
- the carcinoma cancer inhibitor is an antisense molecule.
- Antisense molecules as used herein include antisense or sense oligonucleotides comprising a singe- stranded nucleic acid sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for carcinoma cancer molecules.
- Antisense or sense oligonucleotides, according to the present invention comprise a fragment generally at least about 14 nucleotides, preferably from about 14 to 30 nucleotides.
- Antisense molecules may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753.
- Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors.
- conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its co ⁇ esponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.
- a sense or an antisense oligonucleotide may be introduced into a cell containing the target nucleic acid sequence by formation of an oligonucleotide-lipid complex, as described in WO 90/10448. It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods of treatment.
- the compounds having the desired pharmacological activity may be administered in a physiologically acceptable ca ⁇ ier to a host, as previously described.
- the agents may be administered in a variety of ways, orally, parenterally e.g., subcutaneously, intraperitoneally, intravascularly, etc. Depending upon the manner of introduction, the compounds may be formulated in a variety of ways.
- the concentration of therapeutically active compound in the formulation may vary from about 0.1-100% wgt/vol.
- the agents may be administered alone or in combination with other treatments, i.e., radiation.
- compositions can be prepared in various forms, such as granules, tablets, pills, suppositories, capsules, suspensions, salves, lotions and the like.
- Pharmaceutical grade organic or inorganic ca ⁇ iers and/or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds.
- Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.
- the invention provides methods for identifying cells containing variant CA genes comprising determining all or part of the sequence of at least one endogenous CA genes in a cell. As will be appreciated by those in the art, this may be done using any number of sequencing techniques.
- the invention provides methods of identifying the CA genotype of an individual comprising determining all or part of the sequence of at least one CA gene, such as PRLR of the individual. This is generally done in at least one tissue of the individual, and may include the evaluation of a number of tissues or different samples of the same tissue.
- the method may include comparing the sequence of the sequenced CA gene to a known CA gene, such as PRLR, i.e., a wild-type gene.
- a known CA gene such as PRLR, i.e., a wild-type gene.
- the sequence of all or part of the CA gene can then be compared to the sequence of a known CA gene to determine if any differences exist. This can be done using any number of known homology programs, such as Bestfit, etc.
- the presence of a difference in the sequence between the CA gene, such as PRLR of the patient and the known CA gene is indicative of a disease state or a propensity for a disease state, as outlined herein.
- the CA genes are used as probes to determine the number of copies of the CA gene, such as PRLR in the genome. For example, some cancers exhibit chromosomal deletions or insertions, resulting in an alteration in the copy number of a gene.
- CA genes are used as probes to determine the chromosomal location of the CA genes.
- Information such as chromosomal location finds use in providing a diagnosis or prognosis in particular when chromosomal abnormalities such as translocations, and the like are identified in CA gene, such as PRLR, loci.
- methods of modulating CA in cells or organisms comprise administering to a cell an anti-CA antibody that reduces or eliminates the biological activity of an endogenous CA protein.
- the methods comprise administering to a cell or organism a recombinant nucleic acid encoding a CA protein.
- this may be accomplished in any number of ways.
- the activity of the CA gene is increased by increasing the amount of CA in the cell, for example by overexpressing the endogenous CA or by administering a gene encoding the CA sequence, using known gene-therapy techniques, for example.
- the gene therapy techniques include the incorporation of the exogenous gene using enhanced homologous recombination (EHR), for example as described in PCT/US93/03868, hereby incorporated by reference in its entirety.
- EHR enhanced homologous recombination
- the activity of the endogenous CA gene is decreased, for example by the administration of a CA antisense nucleic acid.
- the CA proteins of the present invention may be used to generate polyclonal and monoclonal antibodies to CA proteins, which are useful as described herein.
- the CA proteins can be coupled, using standard technology, to affinity chromatography columns. These columns may then be used to purify CA antibodies.
- the antibodies are generated to epitopes unique to a CA protein; that is, the antibodies show little or no cross-reactivity to other proteins. These antibodies find use in a number of applications.
- the CA antibodies may be coupled to standard affinity chromatography columns and used to purify CA proteins.
- the antibodies may also be used as blocking polypeptides, as outlined above, since they will specifically bind to the CA protein.
- ⁇ therapeutically effective dose of a CA or modulator thereof is administered to a patient.
- therapeutically effective dose herein is meant a dose that produces the effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art, adjustments for CA degradation, systemic versus localized delivery, and rate of new protease synthesis, as well as the age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.
- a "patient” for the purposes of the present invention includes both humans and other animals, particularly mammals, and organisms. Thus the methods are applicable to both human therapy and veterinary applications. In the prefe ⁇ ed embodiment the patient is a mammal, and in the most prefe ⁇ ed embodiment the patient is human.
- CA proteins and modulators of the present invention can be done in a variety of ways as discussed above, including, but not limited to, orally, subcutaneously, intravenously, infranasally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly.
- the CA proteins and modulators may be directly applied as a solution or spray.
- compositions of the present invention comprise a CA protein in a form suitable for administration to a patient.
- the pharmaceutical compositions are in a water soluble form, such as being present as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts.
- “Pharmaceutically acceptable acid addition salt” refers to those salts that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.
- inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like
- organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid,
- “Pharmaceutically acceptable base addition salts” include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Particularly prefe ⁇ ed are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occu ⁇ ing substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine.
- compositions may also include one or more of the following: carrier proteins such as serum albumin; buffers; fillers such as microcrystalline cellulose, lactose, corn and other starches; binding agents; sweeteners and other flavoring agents; coloring agents; and polyethylene glycol.
- carrier proteins such as serum albumin
- buffers such as buffers
- fillers such as microcrystalline cellulose, lactose, corn and other starches
- binding agents such as microcrystalline cellulose, lactose, corn
- CA proteins and modulators are administered as therapeutic agents, and can be formulated as outlined above.
- CA genes (including both the full-length sequence, partial sequences, or regulatory sequences of the CA coding regions) can be administered in gene therapy applications, as is known in the art.
- These CA genes can include antisense applications, either as gene therapy (i.e. for incorporation into the genome) or as antisense compositions, as will be appreciated by those in the art.
- CA genes such as PRLR
- DNA vaccines are administered as DNA vaccines, either single genes or combinations of CA genes. Naked DNA vaccines are generally known in the art. Brower, Nature Biotechnology, 16:1304-1305 (1998).
- CA genes of the present invention are used as DNA vaccines.
- Methods for the use of genes as DNA vaccines are well known to one of ordinary skill in the art, and include placing a CA gene or portion of a CA gene under the control of a promoter for expression in a patient with carcinoma.
- the CA gene used for DNA vaccines can encode full-length CA proteins, but more preferably encodes portions of the CA proteins including peptides derived from the CA protein.
- a patient is immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a CA gene.
- expression of the polypeptide encoded by the DNA vaccine, cytotoxic T-cells, helper T-cells and antibodies are induced which recognize and destroy or eliminate cells expressing CA proteins.
- the DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine.
- adjuvant molecules include cytokines that increase the immunogenic response to the CA polypeptide encoded by the DNA vaccine. Additional or alternative adjuvants are known to those of ordinary skill in the art and find use in the invention.
- CA genes find use in generating animal models of carcinomas, particularly breast cancer or lymphoma carcinomas.
- gene therapy technology wherein antisense RNA directed to the CA gene will also diminish or repress expression of the gene.
- An animal generated as such serves as an animal model of CA that finds use in screening bioactive drug candidates.
- gene knockout technology for example as a result of homologous recombination with an appropriate gene targeting vector, will result in the absence of the CA protein.
- tissue-specific expression or knockout of the CA protein may be necessary.
- CA protein is overexpressed in carcinoma.
- transgenic animals can be generated that overexpress the CA protein.
- promoters of various strengths can be employed to express the transgene.
- the number of copies of the integrated transgene can be determined and compared for a determination of the expression level of the transgene. Animals generated by such methods find use as animal models of CA and are additionally useful in screening for bioactive molecules to treat carcinoma.
- CA nucleic acid sequences of the invention are depicted in Table 1.
- the sequences in each Table include genomic sequence, mRNA and coding sequences for both mouse and human.
- N/A indicates a gene that has been identified, but for which there has not been a name ascribed.
- the different sequences are assigned the following SEQ ID Nos:
- mice gene Prlr; human gene PRLR
- Mouse genomic sequence SEQ ID NO: 1
- Mouse mRNA sequence SEQ ID NO: 2
- Mouse coding sequence SEQ ID NO: 3
- Human genomic sequence SEQ ID NO: 4
- Human mRNA sequence SEQ ID NO: 5
- Human coding sequence SEQ ID NO: 6
- MOUSE SEQUENCE - GENOMIC (SEQ ID NO:l)
- CTAGATAGGCACC GACGTAGGCTGCAAAGAAGACAAATGGGTGGAAGATGTCTCTATAAATATACATGGTTGTTAGGGCAAACTGACCA
- AAAATAATAT TGAAGATGGCAACAAAAATTAAAATGCTCACTTTAAATGTTTCCCAACTAGCTGACACATCCAGCATTGTTTGGCTTGGAA
- TAGATGT TACCTAGGCCTGTTCTACTTCATTGACCTGfiGAA d ⁇ AC ⁇ AGTCAAATGGAAAGTGGGGCCCCGATTTGCTTGATAAATAGC
- MOUSE SEQUENCE - CODING (SEQ ID NO: 3)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- General Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hospice & Palliative Care (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP03716474A EP1490689A4 (en) | 2002-03-20 | 2003-03-12 | NEW COMPOSITIONS AND METHODS FOR CANCER RELATED TO A CHANGED PRLR EXPRESSION |
| CA 2479721 CA2479721A1 (en) | 2002-03-20 | 2003-03-12 | Novel compositions and methods in cancer associated with altered expression of prlr |
| JP2003578933A JP2005526508A (ja) | 2002-03-20 | 2003-03-12 | Prlrの変化した発現に関連する癌における新規組成物および方法 |
| AU2003220178A AU2003220178B2 (en) | 2002-03-20 | 2003-03-12 | Novel compositions and methods in cancer associated with altered expression of PRLR |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/105,948 | 2002-03-20 | ||
| US10/105,948 US7645441B2 (en) | 2000-12-22 | 2002-03-20 | Compositions and methods in cancer associated with altered expression of PRLR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003081250A1 true WO2003081250A1 (en) | 2003-10-02 |
| WO2003081250A8 WO2003081250A8 (en) | 2005-02-03 |
Family
ID=28452455
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2003/007470 Ceased WO2003081250A1 (en) | 2002-03-20 | 2003-03-12 | Novel compositions and methods in cancer associated with altered expression of prlr |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US7645441B2 (cg-RX-API-DMAC7.html) |
| EP (2) | EP1490689A4 (cg-RX-API-DMAC7.html) |
| JP (2) | JP2005526508A (cg-RX-API-DMAC7.html) |
| AU (2) | AU2003220178B2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2479721A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2003081250A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008535494A (ja) * | 2005-04-07 | 2008-09-04 | サグレシュ ディスカバリー, インコーポレイテッド | 癌関連遺伝子(prlr) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9528124B2 (en) | 2013-08-27 | 2016-12-27 | Recombinetics, Inc. | Efficient non-meiotic allele introgression |
| US10920242B2 (en) | 2011-02-25 | 2021-02-16 | Recombinetics, Inc. | Non-meiotic allele introgression |
| US10779518B2 (en) | 2013-10-25 | 2020-09-22 | Livestock Improvement Corporation Limited | Genetic markers and uses therefor |
| WO2016049182A1 (en) | 2014-09-23 | 2016-03-31 | Aggentics, Inc. | Materials and methods for producing animals with short hair |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003008583A2 (en) * | 2001-03-02 | 2003-01-30 | Sagres Discovery | Novel compositions and methods for cancer |
Family Cites Families (55)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4179337A (en) * | 1973-07-20 | 1979-12-18 | Davis Frank F | Non-immunogenic polypeptides |
| US4179937A (en) * | 1978-06-02 | 1979-12-25 | Ocean Ecology Ltd. | Sound measuring device |
| JPS6023084B2 (ja) * | 1979-07-11 | 1985-06-05 | 味の素株式会社 | 代用血液 |
| US4469863A (en) * | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US4640835A (en) * | 1981-10-30 | 1987-02-03 | Nippon Chemiphar Company, Ltd. | Plasminogen activator derivatives |
| US4816567A (en) * | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4496689A (en) * | 1983-12-27 | 1985-01-29 | Miles Laboratories, Inc. | Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer |
| US5430136A (en) * | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
| US5235033A (en) * | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5034506A (en) * | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| EP0206448B1 (en) * | 1985-06-19 | 1990-11-14 | Ajinomoto Co., Inc. | Hemoglobin combined with a poly(alkylene oxide) |
| WO1987005330A1 (en) | 1986-03-07 | 1987-09-11 | Michel Louis Eugene Bergh | Method for enhancing glycoprotein stability |
| US4791192A (en) * | 1986-06-26 | 1988-12-13 | Takeda Chemical Industries, Ltd. | Chemically modified protein with polyethyleneglycol |
| US5124246A (en) * | 1987-10-15 | 1992-06-23 | Chiron Corporation | Nucleic acid multimers and amplified nucleic acid hybridization assays using same |
| US5359100A (en) * | 1987-10-15 | 1994-10-25 | Chiron Corporation | Bifunctional blocked phosphoramidites useful in making nucleic acid mutimers |
| US5700637A (en) * | 1988-05-03 | 1997-12-23 | Isis Innovation Limited | Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays |
| US5216141A (en) * | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| GB8823869D0 (en) * | 1988-10-12 | 1988-11-16 | Medical Res Council | Production of antibodies |
| US4992378A (en) * | 1988-12-16 | 1991-02-12 | The Royal Institution For The Advancement Of Learning (Mcgill University) | C-DNA encoding human prolactin receptor |
| CA2049028A1 (en) | 1989-03-07 | 1990-09-08 | Genentech, Inc. | Covalent conjugates of lipid and oligonucleotide |
| US5143854A (en) * | 1989-06-07 | 1992-09-01 | Affymax Technologies N.V. | Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof |
| WO1991004753A1 (en) | 1989-10-02 | 1991-04-18 | Cetus Corporation | Conjugates of antisense oligonucleotides and therapeutic uses thereof |
| US5014802A (en) * | 1990-06-04 | 1991-05-14 | General Motors Corporation | Rear steer controller |
| US5386023A (en) * | 1990-07-27 | 1995-01-31 | Isis Pharmaceuticals | Backbone modified oligonucleotide analogs and preparation thereof through reductive coupling |
| US5602240A (en) * | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| ATE158021T1 (de) * | 1990-08-29 | 1997-09-15 | Genpharm Int | Produktion und nützung nicht-menschliche transgentiere zur produktion heterologe antikörper |
| US5625126A (en) * | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) * | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5545806A (en) * | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5661016A (en) * | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5644048A (en) * | 1992-01-10 | 1997-07-01 | Isis Pharmaceuticals, Inc. | Process for preparing phosphorothioate oligonucleotides |
| AU4115693A (en) | 1992-04-24 | 1993-11-29 | Sri International | In vivo homologous sequence targeting in eukaryotic cells |
| US5681697A (en) * | 1993-12-08 | 1997-10-28 | Chiron Corporation | Solution phase nucleic acid sandwich assays having reduced background noise and kits therefor |
| US5637684A (en) * | 1994-02-23 | 1997-06-10 | Isis Pharmaceuticals, Inc. | Phosphoramidate and phosphorothioamidate oligomeric compounds |
| US6015880A (en) | 1994-03-16 | 2000-01-18 | California Institute Of Technology | Method and substrate for performing multiple sequential reactions on a matrix |
| US5807522A (en) | 1994-06-17 | 1998-09-15 | The Board Of Trustees Of The Leland Stanford Junior University | Methods for fabricating microarrays of biological samples |
| US5597909A (en) * | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5580731A (en) * | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5681702A (en) * | 1994-08-30 | 1997-10-28 | Chiron Corporation | Reduction of nonspecific hybridization by using novel base-pairing schemes |
| US5759776A (en) * | 1995-06-05 | 1998-06-02 | California Pacific Medical Center | Targets for breast cancer diagnosis and treatment |
| DK0877752T3 (da) | 1996-01-23 | 2003-09-15 | Univ Leland Stanford Junior | Fremgangsmåder til screening af transdominante effektorpeptider og RNA molekyler |
| US5776683A (en) * | 1996-07-11 | 1998-07-07 | California Pacific Medical Center | Methods for identifying genes amplified in cancer cells |
| US5928870A (en) * | 1997-06-16 | 1999-07-27 | Exact Laboratories, Inc. | Methods for the detection of loss of heterozygosity |
| US6074825A (en) * | 1997-07-31 | 2000-06-13 | Maine Medical Center | Stable encapsulated reference nucleic acid and method of making |
| US6153441A (en) * | 1998-02-17 | 2000-11-28 | Smithkline Beecham Corporation | Methods of screening for agonists and antagonists for human CCR7 receptor and CKβ-9 ligand and interaction thereof |
| CA2411601A1 (en) | 2000-06-05 | 2001-12-13 | Avalon Pharmaceuticals | Cancer gene determination and therapeutic screening using signature gene sets |
| US6812339B1 (en) * | 2000-09-08 | 2004-11-02 | Applera Corporation | Polymorphisms in known genes associated with human disease, methods of detection and uses thereof |
| US20030143539A1 (en) | 2000-12-08 | 2003-07-31 | Francois Bertucci | Gene expression profiling of primary breast carcinomas using arrays of candidate genes |
| US20030194702A1 (en) * | 2000-12-22 | 2003-10-16 | Engelhard Eric K. | Novel compositions and methods for cancer |
| US20040072264A1 (en) * | 2000-12-22 | 2004-04-15 | Morris David W. | Novel compositions and methods for cancer |
| JP2005503760A (ja) | 2001-01-24 | 2005-02-10 | プロテイン デザイン ラブス, インコーポレイテッド | 乳癌の診断方法、組成物および乳癌のモジュレーターのスクリーニング方法 |
| US20030099974A1 (en) * | 2001-07-18 | 2003-05-29 | Millennium Pharmaceuticals, Inc. | Novel genes, compositions, kits and methods for identification, assessment, prevention, and therapy of breast cancer |
| NL1033850C2 (nl) | 2007-05-15 | 2008-11-18 | 3Force B V | Brandersysteem met voorgemengde branders en vlam-overdrachtsmiddelen. |
| CN104010774B (zh) | 2011-09-15 | 2017-10-13 | 康富真信息技术股份有限公司 | 用于自动生成机器人程序的系统和方法 |
| ES2741897T3 (es) | 2012-02-13 | 2020-02-12 | Radius Eng Inc | Cartucho reutilizable para moldeo por inyección |
-
2002
- 2002-03-20 US US10/105,948 patent/US7645441B2/en not_active Expired - Fee Related
-
2003
- 2003-03-12 JP JP2003578933A patent/JP2005526508A/ja active Pending
- 2003-03-12 CA CA 2479721 patent/CA2479721A1/en not_active Abandoned
- 2003-03-12 AU AU2003220178A patent/AU2003220178B2/en not_active Ceased
- 2003-03-12 EP EP03716474A patent/EP1490689A4/en not_active Withdrawn
- 2003-03-12 WO PCT/US2003/007470 patent/WO2003081250A1/en not_active Ceased
- 2003-03-12 EP EP20100173936 patent/EP2253643A1/en not_active Withdrawn
-
2009
- 2009-06-03 JP JP2009133806A patent/JP2009225807A/ja active Pending
-
2010
- 2010-01-12 US US12/686,334 patent/US20100216713A1/en not_active Abandoned
- 2010-02-26 AU AU2010200731A patent/AU2010200731A1/en not_active Abandoned
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003008583A2 (en) * | 2001-03-02 | 2003-01-30 | Sagres Discovery | Novel compositions and methods for cancer |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008535494A (ja) * | 2005-04-07 | 2008-09-04 | サグレシュ ディスカバリー, インコーポレイテッド | 癌関連遺伝子(prlr) |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2003081250A8 (en) | 2005-02-03 |
| EP1490689A4 (en) | 2006-03-15 |
| JP2009225807A (ja) | 2009-10-08 |
| JP2005526508A (ja) | 2005-09-08 |
| CA2479721A1 (en) | 2003-10-02 |
| AU2010200731A1 (en) | 2010-03-18 |
| US20030064383A1 (en) | 2003-04-03 |
| AU2003220178A1 (en) | 2003-10-08 |
| US7645441B2 (en) | 2010-01-12 |
| EP2253643A1 (en) | 2010-11-24 |
| EP1490689A1 (en) | 2004-12-29 |
| AU2003220178B2 (en) | 2010-03-25 |
| US20100216713A1 (en) | 2010-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2014669A2 (en) | Compositions and methods for cancer | |
| EP1469769A2 (en) | Novel compositions and methods for cancer | |
| US20100216713A1 (en) | Novel compositions and methods in cancer associated with altered expression of prlr | |
| US20030194702A1 (en) | Novel compositions and methods for cancer | |
| WO2003071933A2 (en) | Novel compositions and methods for cancer | |
| AU2003225826B2 (en) | Novel compositions and methods in cancer associated with altered expression of MCM3AP | |
| US20030099963A1 (en) | Novel compositions and methods in cancer associated with altered expression of TBX21 | |
| US7700274B2 (en) | Compositions and methods in cancer associated with altered expression of KCNJ9 | |
| AU2003218331B2 (en) | Novel compositions and methods in cancer associated with altered expression of PRDM 11 | |
| AU2003230669C1 (en) | Novel compositions and methods in cancer associated with altered expression of TBX21 | |
| AU2008207455A1 (en) | Novel compositions and methods in cancer associated with altered expression of TBX21 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NI NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2479721 Country of ref document: CA Ref document number: 2003578933 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003220178 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2003716474 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2003716474 Country of ref document: EP |
|
| WR | Later publication of a revised version of an international search report |