WO2003076632A1 - Procede de production de semences hybrides de mais - Google Patents
Procede de production de semences hybrides de mais Download PDFInfo
- Publication number
- WO2003076632A1 WO2003076632A1 PCT/FR2003/000711 FR0300711W WO03076632A1 WO 2003076632 A1 WO2003076632 A1 WO 2003076632A1 FR 0300711 W FR0300711 W FR 0300711W WO 03076632 A1 WO03076632 A1 WO 03076632A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ams
- gene
- transgene
- seeds
- phenotype
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Definitions
- the present invention relates to a method for producing and propagating corn plants homozygous for a transgene conferring male sterility, useful for the production of hybrid corn seeds.
- hybrids via "sexual hybridization" of parents with different genetic backgrounds is of great importance in the practice of modern agriculture. Indeed, the crossing between plants of the same species but not related produces a progeny which manifests characteristics, such as yield or resistance to diseases, superior to those of the parents: it is the effect of heterosis or hybrid vigor. Thus, the production of hybrids is often used to improve both the quality and the yield of cultivated plants. In addition, these descendants are genetically uniform, in particular for the characteristics of productivity, sensitivity to pours and drought, vigor at the start and susceptibility to diseases and pests, and therefore interesting for farmers.
- hybrids Without human intervention, the production of hybrids is limited by self-fertilization phenomena.
- the production of hybrid seeds therefore requires favoring cross-fertilization by preventing self-pollination by mechanical, chemical or genetic techniques.
- the different ways to prevent self-fertilization by controlling pollination include - manual, mechanical "castration” or chemical inactivation of the male organs of the plant,
- AMS artificial male sterility
- nuclear sterile recessive male plant is not easy to implement, in particular because of the maintenance of the sterile male character which requires the reselection of sterile male plants in the descendants obtained by self-fertilization of a heterozygous plant for the male recessive sterility gene.
- this system therefore involves the use of a marker closely linked to the male sterility gene and easily identifiable.
- Male sterility can be "acquired”, that is, it is independent of any genetic manipulation by the recombinant DNA pathway. We can distinguish cytoplasmic male sterility from nuclear male sterility.
- CMS Cytoplasmic male sterility
- AMS artificial male sterility
- AMS gene a gene conferring male sterility
- the AMS system avoids problems associated with other methods.
- the AMS system does not depend on the existence of a mutant. Maintaining the sterile character of the male line can be obtained through the use of a dominant male sterility gene linked to a marker gene which allows the selection of artificial sterile male plants.
- the general application of this technology is limited to the extent that the choice of the color marker is conditioned by the genotype of the plant containing the fertility restoration gene.
- the general application of this technology is limited to the extent that the choice of the color marker is conditioned by the genotype of the plant containing the fertility restoration gene.
- only plants whose genotype does not condition visible production of anthocyanin in seeds can be used.
- the present invention therefore provides a process for the production and multiplication of homozygous corn plants for a transgene conferring artificial nuclear male sterility, allowing production of hybrid seeds, and easily applicable on a large scale.
- An advantage of the proposed method is that its application is not conditioned by the genotype of the plants used.
- the "petit grain” phenotype is preferably obtained by the expression of the shrunken 2 and brittle 2 genes in antisense orientation.
- the brittle 2 gene codes for one of the 2 subunits of ADP glucose pyrophosphorylase, an enzyme involved in the synthesis of starch.
- the fragment was obtained by the RT-PCR technique from an extract of total RNA from the ear of corn and from the data of Genbank (acc. No. S72425). This fragment represents an incomplete cDNA of the brittle 2 gene.
- the shrunken 2 gene codes for the other subunit of ADP glucose pyrophosphoryrlase.
- the fragment was obtained by the RT-PCR technique from an extract of total RNA from the ear of corn and according to the data from Genbank (ace no. S72425). This fragment contains the complete sequence of the coding region of the shrunken 2 gene.
- the term "heterozygous for the AMS transgene” means a corn plant made male sterile by incorporating into its genome a single copy of a transgene conferring artificial nuclear male sterility ("AMS") . In the absence of any other indication, this plant does not contain the fertility restoration gene linked to a marker of the "small grain” phenotype.
- the term “homozygous for the AMS transgene” denotes a corn plant made male sterile by incorporating into its genome two copies located at the same location on each of the sister chromosomes of a transgene conferring male sterility artificial nuclear (AMS). In the absence of any other indication, this plant does not contain the fertility restoration gene linked to a marker of the "small grain” phenotype.
- fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of" small grain "phenotype” is meant a heterozygous or homozygous corn plant for said fertility restoration gene linked to a small grain phenotype marker.
- said corn plant is heterozygous. In the absence of any other indication, this plant does not contain a transgene conferring artificial nuclear male sterility (AMS).
- corn plant comprising in its genome an AMS transgene is meant a heterozygous or homozygous corn plant for said AMS transgene.
- wild genotype corn plant is meant a corn plant which contains in its genome neither a transgene conferring artificial nuclear male sterility (AMS), nor a fertility restoration gene linked to a phenotype marker " small grain ".
- AMS artificial nuclear male sterility
- said corn plant of wild genotype belongs to an elite line.
- small grain phenotype is meant grains whose density and / or size and / or mass is (are) less than that of a grain of normal size, preferably 40 to 50% lower. In the context of the present invention, these grains may be called “depressed grains” or “wrinkled grains”.
- marker of small grain phenotype or “gene which confers a small grain phenotype” or “gene coding a small grain phenotype”, is meant any gene, in sense orientation or in antisense orientation, which, when expressed in the plant gives a "petit grain” phenotype.
- shrunken 2, brittle 2, shrunken 1 genes, the miniature locus 1 which codes for an invertase can be cited in particular; and more generally any gene which makes it possible to reduce the starch content and does not alter the viability of the grains.
- grain of normal size or "grain normal” or “grain of normal phenotype” means in particular a grain whose size and / or density and / or mass has (have not been) changed (s), in particular by integration into the genome of the plant of a marker of "small grain” phenotype.
- lite line is meant a line with significant agronomic and commercial potential, at a given period.
- linkage or “genetic linkage” is meant a sufficiently small genetic distance so that the frequencies of recombination during meiosis are negligible.
- protein of interest is meant a protein of human or animal origin which may be of therapeutic and / or prophylactic interest, such as collagen, gastric lipase, antibodies, etc.
- One of the aims of the invention is therefore to propose a method for producing hybrid corn seeds by crossing a heterozygous corn plant for a transgene conferring artificial nuclear male sterility ("AMS") with a corn plant. of wild genotype.
- AMS artificial nuclear male sterility
- the system according to the present invention which advantageously makes it possible to maintain the sterile male character of corn plants is applicable independently of the genotype of the corn plants used.
- the solution provided by the invention consists in first producing corn seeds that are homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a phenotype marker " small grain ". From these seeds, breeders can easily introgress the homozygous genotype for the AMS transgene and heterozygous for a fertility restoration gene linked to a “small grain” phenotype marker in a wild-type corn line, and in particular in an elite line of interest, by successive backcrosses.
- AMS transgene conferring artificial nuclear male sterility
- a reconverted elite line homozygous for a transgene conferring artificial nuclear male sterility (“AMS”) and heterozygous for a gene for restoring fertility linked to a marker of "small grain” phenotype can thus be obtained.
- Self-fertilization of corn plants from these seeds then makes it possible to produce: seeds homozygous for the AMS transgene generating sterile male corn plants which, crossed with wild genotype corn plants, and in particular plants belonging to a Elite line used for conversion, where appropriate, will produce heterozygous seeds for the AMS transgene.
- the AMS transgene when the AMS transgene is genetically linked to a gene encoding a protein of interest, hybrid seeds homozygous for the AMS transgene prove to be particularly useful for generating corn plants producing said protein of interest.
- a selection of corn seeds by the “small grain” phenotype can in particular be implemented by a dimensional or densimetric sorting method.
- a dimensional sorting can be carried out so as to separate the grains according to their length, using for example a cell sorter, their width, with for example a disc sorter, or their thickness, using for example a sizer .
- the principle of a densimetric sorting is based on a separation of the grains according to their density and uses in particular a densimetric column or a densimetric table, or a flotation system.
- the cell sorter consists of a horizontal rotating cylinder. The separation is done by centrifugal force. The smallest grains enter the cells (which line the inside of the cylinder) and are held there by centrifugal force.
- the disc sorter consists of thick discs arranged vertically and hollowed out in their thickness of cells of suitable size.
- the most conventional calibrators are the calibrators by thickness composed of flat or cylindrical sieves with elongated perforations forcing the seed to appear at its smallest thickness to pass through.
- the calibrator with round perforations is of the same principle but the round orifices and small "redents" inside the cylinder force the seed to appear vertically to pass through the sieve.
- the densimetric column includes a vibrating distributor which introduces the mixture of grains to be sorted halfway up a hollow column in which a homogeneous air flow rises. Heavy particles descend while the lighter particles rise. The separation is thus carried out.
- Test weight is a measure of the mass of a quantity of seeds in relation to its volume.
- the principle of the device is a work plan (often made up of a wire or textile network) crossed by a uniform air flow which fluidizes the seed mixture and causes it to stratify schematically in two layers. Heavy products stay close to the table, light products above. The separation of the two layers is obtained by adjusting the inclination of the work surface (in two directions) and by a transverse back and forth stirring movement.
- a densimetric table such as that sold by the company Cimbria Heid GmbH (Stockerau, Austria).
- the flotation system is a system which makes it possible to separate the grains according to their density and / or mass based on their capacity of flotation on a liquid, in particular water.
- the heaviest grains (with the lowest buoyancy) are found at the bottom and the lightest grains (with the highest buoyancy) are found on the surface of the liquid, which allows separation.
- the seeds When this system is used, the seeds must remain as short as possible in contact with water so as not to alter their germination capacity. A drying step may sometimes be necessary.
- the present invention therefore provides a method of producing corn seeds homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a marker of "small grain” phenotype, comprising the steps of; a) cross a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain” phenotype, b) select by "small grain” phenotype corn seeds comprising in their genome a fertility restoration gene linked to a marker of "small grain” phenotype, c) self-fertilize the corn plants from the seeds selected according to step b), d ) select seeds that are homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker.
- AMS transgene conferring artificial nuclear male sterility
- At least one step of selecting the method comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.
- the selection step thus carried out has the advantage of allowing an easily achievable and automated sorting of the grains according to their "small grain” or "normal” phenotype.
- step b) of the method described above can advantageously be replaced by a genotyping step.
- the present invention therefore also provides a method for producing corn seeds homozygous for a transgene conferring artificial nuclear male sterility ("AMS") and heterozygous for a fertility restoration gene linked to a marker of "small grain” phenotype, comprising the steps of: a) crossing a sterile male corn plant heterozygous for the AMS transgene with a fertility restoring corn plant comprising in its genome a fertility restoration gene linked to a “small grain” phenotype marker, b) genotyping the seeds obtained by crossing according to step a), and selecting corn seeds comprising in their genome a gene for restoration of fertility linked to a marker of "small grain” phenotype, c) self-fertilize the maize plants derived from gen ⁇ typed seeds according to step b), d) select seeds homozygous for the AMS transgene and heterozygous for the restoration gene fertility linked to a marker
- the implementation of the methods described above makes it possible to produce a corn seed that is homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype.
- the present invention therefore relates to a corn seed homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype capable of being obtained by one of the preceding methods.
- the homozygous and heterozygous AMS genotype for a fertility restoration gene linked to a marker of “small grain” phenotype can be introgressed in a corn line of wild genotype, and in particular in an elite line of interest. , by successive backcrosses.
- the present invention therefore provides a process for the production of homozygous corn seeds for a transgene-conferring artificial nuclear male sterility ("AMS"), comprising the steps consisting in: a) self-fertilizing corn plants derived from homozygous seeds for the AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype, capable of being obtained by one of the methods previously described, b) selecting seeds homozygous for the AMS transgene.
- AMS transgene-conferring artificial nuclear male sterility
- the selection step comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.
- This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype.
- the method for producing seeds of homozygous corn for a transgene conferring artificial nuclear male sterility comprises the steps consisting in: a) crossing a sterile male corn plant heterozygous for the transgene AMS with a fertility restorer corn plant comprising in its genome a fertility restoration gene linked to a marker of "small grain” phenotype, b) selecting by the "small grain” phenotype corn seeds comprising in their genome a fertility restoration gene linked to a “small grain” phenotype marker, c) self-fertilize corn plants from seeds selected according to step b), d) select seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a small grain phenotype marker, e) self-fertilize corn plants from seeds according to the step d), f) select seeds homozygous for the AMS transgene.
- said heterozygous corn plant for a transgene conferring artificial nuclear male sterility further contains a gene encoding a protein of interest, preferably genetically linked to the AMS transgene.
- a successive backcrossing step with a corn plant of wild genotype, and in particular, a corn plant belonging to an elite line, so as to convert this plant from corn of wild genotype with the homozygous genotype for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker.
- the seeds from this backcrossing step are then used to continue the process.
- At least one selection step comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.
- This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype.
- step b) of the above method is replaced by a genotyping step.
- the present invention therefore also relates to a process for producing seeds of homozygous corn for a transgene conferring artificial nuclear male sterility ("AMS") comprising the steps consisting in: a) crossing a sterile male corn plant heterozygous for the transgene AMS with a fertility restorer corn plant comprising in its genome a fertility restoration gene linked to a “small grain” phenotype marker, b) genotyping the seeds obtained by crossing according to step a), and select the corn seeds comprising in their genome a fertility restoration gene linked to a marker of "small grain” phenotype, c) self-fertilize the corn plants derived from the seeds genotyped according to step b), d) select the seeds homozygous for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker, e) self-fertilize corn plants from seeds according to step d),
- said heterozygous corn plant for a transgene conferring artificial nuclear male sterility further contains a gene encoding a protein of interest, preferably genetically linked to the AMS transgene.
- Step e) of this process may possibly be preceded by a successive backcrossing step with a corn plant of wild genotype, and in particular, a corn plant belonging to an elite line, so as to convert this corn plant wild-type genotype with the homozygous genotype for the AMS transgene and heterozygous for the fertility restoration gene linked to a “small grain” phenotype marker.
- the seeds from this backcrossing step are then used to continue the process.
- At least one selection step comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.
- This step advantageously makes it possible to sort the seeds homozygous for the AMS transgene by their normal grain phenotype.
- the cultivation of seeds homozygous for the AMS transgene then makes it possible to generate sterile male corn plants which, crossed with plants of wild genotype, and in particular with plants belonging to an elite line, produce heterozygous seeds for the transgene AMS.
- the elite line used for this crossing can in particular be that used for the backcrossing step possibly implemented in the preceding methods.
- the seeds produced can be used to produce commercial seeds from a corn hybrid.
- the elite sauvate type line can be replaced by a corn hybrid to obtain seeds which will be used to produce a three-way hybrid.
- the process for producing corn seeds homozygous for the AMS transgene can be used for the production of proteins of interest, in particular therapeutic and / or prophylactic.
- the protein of interest can be produced throughout the plant or preferentially concentrated in specific organs, such as seeds.
- the method according to the invention has the advantage of making it possible to produce such proteins under controlled conditions and on a large scale. It is therefore of great interest in the pharmaceutical field.
- a vector containing the barnase gene, conferring male sterility, under the control of the A9 promoter and a gene of therapeutic interest and / or prophylactic can be built.
- This vector can be used to obtain plants, containing the gene conferring male sterility and the gene of therapeutic and / or prophylactic interest, which can then be used according to the production system as described in order to produce seeds expressing the protein of therapeutic and / or prophylactic interest.
- such a vector can be used to obtain a heterozygous corn plant for an AMS transgene (and therefore for the gene coding for the protein of interest), which corn plant can then be crossed with a corn plant.
- the gene of therapeutic and / or prophylactic interest is genetically linked to the AMS transgene.
- Such a system makes it possible to produce only the protein of therapeutic and / or prophylactic interest in the seed for example or in an organ of the plant and this whatever the stage of development as a function of the regulatory sequence used in the gene coding said protein of interest, since the protein conferring male sterility is not produced in the organs of the plant.
- This system thus makes it possible to avoid the dissemination of the transgene of therapeutic and / or prophylactic interest via pollen, since the plants are completely male sterile,
- the present invention therefore also relates to a method for producing a heterozygous seed for an AMS transgene comprising the crossing of a corn plant derived from a homozygous seed for an AMS transgene, capable of being obtained by one of the methods for producing a seed homozygous for the AMS transgene described above, with a corn plant of wild genotype.
- the method for producing a seed heterozygous for an AMS transgene is characterized in that one of the methods for producing a • seed homozygous for the AMS transgene described above further comprises the crossing of a corn plant derived from said homozygous seed for an AMS transgene with a corn plant of wild genotype.
- the fertilization of sterile male corn plants from these seeds by a wild genotype corn plant, unrelated, advantageously produces hybrid seeds benefiting from the vigor effect (heterosis).
- the system proposed by the present invention advantageously makes it possible to maintain corn plants homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain” phenotype.
- the corn seed production processes homozygous for the AMS transgene described above indeed comprise a final selection of seeds in particular on the basis of their normal grain phenotype.
- the seeds of the “small grain” phenotype not selected by these methods can be sown, then the plants generated self-fertilizing, thus producing in particular seeds homozygous for the transgene AMS and heterozygous for the gene for restoring fertility linked to a marker. of "petit grain” phenotype.
- the invention therefore relates to a method of propagating a corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of “small grain” phenotype comprising the steps consisting in: a) self-fertilizing corn plants homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain” phenotype, capable of being obtained from a seed from one of the homozygous seed production processes for an AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype previously described, b) selecting seeds homozygous for the AMS transgene and of “small grain” phenotype, c) selecting seeds homozygous for the AMS transgene and heterozygous for a fertility restoration gene linked to a marker of "small grain” phenotype obtained by self-fertilization of seedlings of.
- step b) of the above method comprises a densimetric sorting, in particular using a densimetric table or column, or a flotation system.
- the present invention also relates to nucleotide constructs, called expression cassettes, comprising a promoter nucleotide sequence operably linked to at least one gene of interest.
- Said gene of interest can also be associated with other regulatory elements such as activators and transcription termination sequences (terminators).
- Other elements such as introns, enhancers, polyadenylation sequences and derivatives "may also be present in the nucleic sequence of interest, to improve the expression or the functioning of the transforming gene.
- the expression cassette may also contain so-called "leader" 5 'sequences that can improve translation.
- the corn plant comprising an AMS transgene conferring artificial nuclear male sterility is characterized in that the AMS transgene, preferably the barase gene (Hartley, 1988; Gene Bank n ° X 12871), is included in an expression cassette, under the control of a promoter specific for pollenogenesis and of a terminator, genetically linked to a gene encoding a selection agent under the control of a promoter and d 'a terminator.
- said expression casette can also comprise a gene coding for a protein of interest.
- said gene encoding a protein of interest is genetically linked to the AMS transgene, in particular the barnase gene.
- the gene encoding a protein of interest is not under the control of said specific promoter of pollenogenesis.
- the specific promoter of pollenogenesis is in particular a promoter allowing specific expression in the anther chosen from the group consisting of the promoter A3 (WO 92 11379), the promoter A6, the promoter A9 (WO 92 11379), corresponding to the region 5 'non-coding of the A9 gene of Arabidopsis thaliana, and the specific promoters of the anther carpet such as TA29, TA26, TA13 (WO 89 10396) or Mac2 (WO 00 68 403).
- genes coding for a selection agent also called selection marker genes
- genes which confer resistance to an antibiotic can be used in particular (Herrera-Estrella et al., 1983), such as hygromycin, kanamycin, bleomycin or streptomycin or herbicides (EP 242 246), such as glufosinate, glyphosate or bromoxynil.
- said gene encoding a selection agent is selected from the bar gene (White et al., 1990; Gene Bank No. X 17220), which confers resistance to the herbicide Basta ® (glufosinate) and the NPTII gene which confers resistance to kanamycin (Bevan et al., 1983).
- the excision system for eliminating the gene encoding a selection agent can be a transposition system, such as in particular the Ac / Ds system of corn (WO
- a recombination system such as in particular the Cre / lox system of bacteriophage P1, the FLP / FRT system of yeast (Lyzrik et al., 1997), the Gin recombinase of phage Mu, the Pin recombinase of E. coli or the R RS system of the plasmid pSR1.
- a co-transformation system Komari et al., 1996) can also be used.
- the system used will be the Ac / Ds system of corn.
- said gene is included inside the transposable element Ds (also called dissociating element or mobilizable sequence of a transposon).
- the Ds element is an Ac element which has undergone significant mutations or deletions in the sequence encoding the transposase. H can only excise itself from its insertion site in the presence of an active Ac transposase source. It is therefore Ac dependent.
- a preferred system for eliminating a gene encoding a selection agent can have two components:
- a first plant having no active transposase in which a construct comprising the expression cassette of the gene of interest and that of the gene coding for a selection agent framed by the mobilizable sequences of a transposon can be integrated therein.
- the promoter associated with the gene. encoding a selection agent is a constitutive promoter, such as the Actin-lntron- promoter actin, corresponding to the 5 ′ non-coding region of the actin 1 gene of rice and its first intron (Me Elroy et al., 1991; Gene Bank n ° S 44221).
- the presence of the first actin intron makes it possible to increase the level of expression of a gene when it is fused 3 'to a promoter.
- This promoter sequence allows for example the constitutive expression of the bar gene.
- terminators which can be used with the AMS transgene of the gene encoding a selection agent, there may be mentioned in particular:
- the present invention relates to an expression cassette comprising a fertility restorer gene genetically linked to at least one gene coding for a "small grain" phenotype, associated with elements allowing their expression in plant cells, in particular a promoter and a transcription terminator.
- transcription promoters which can be used in association with the gene coding for a “small grain” phenotype, there may be mentioned in particular:
- HMWG High Molecular Weight Glutenin promoter corresponding to the 5 ′ non-coding region of the wheat glutenin gene (Triicum aes ⁇ vum), an albumen reserve protein. This seed-specific promoter is described in the publication by Robert et al. (1989)
- said expression cassette comprising a fertility restorer gene genetically linked to at least one gene coding for a "small grain" phenotype is characterized in that said fertility restorer gene is the barstar gene (Hartley, 1998 ) placed under the control of a specific promoter of pollenogenesis, in particular a specific promoter of the anther such as pA3, pA6, pA9, pTA29, or of the Mac2 promoter, and of the 3'CaMV terminator or 3'Nos, genetically linked to a gene encoding a selection agent under the control of the Actin-intron actin promoter and the 3'CaMV or 3'Nos terminator.
- a specific promoter of pollenogenesis in particular a specific promoter of the anther such as pA3, pA6, pA9, pTA29, or of the Mac2 promoter, and of the 3'CaMV terminator or 3'Nos, genetically linked to a gene encoding a selection agent under the
- genes coding for a selection agent genes which confer resistance to an antibiotic such as hygromycin, kanamycin, bleomycin or streptomycin or to herbicides such as glufosinate, glyphosate or bromoxynil can be used in particular.
- said gene encoding a selection agent is selected from the bar gene which confers resistance to the herbicide Basta ® and the NPTII gene which confers resistance to kanamycin.
- the gene coding for a “small grain” phenotype is chosen from the shrunken 2 and brittle 2 genes in antisense orientation.
- the invention relates to a vector, in particular a plasmid, characterized in that it contains at least one expression cassette as described above.
- the invention further relates to a cellular host, in particular a bacterium such as Agrobacterium tumefaciens, transformed by said vector.
- a cell host is useful for transfecting corn cells with a vector according to the invention.
- the invention therefore also relates to a corn cell transformed by at least one vector as described above.
- the transformation of plant cells can be carried out by transfer of the abovementioned vectors into the protoplasts, in particular after incubation of the latter in a polyethylene glycol (PG) solution in the presence of divalent cations (Ca 2+ ) according to the method described in the article of Krens et al. (1982).
- the transformation of plant cells can also be carried out by electroporation, in particular according to the method described in the article by Fromm et al.
- the transformation of plant cells can also be carried out by using a gene gun allowing the projection, at very high speed, of metallic particles covered with DNA sequences of interest, thus delivering genes inside the cell nucleus , in particular according to the technique described in the article by
- Another method of transforming plant cells is that of cytoplasmic or nuclear micro-injection.
- the plant cells are transformed by a vector according to the invention, said cellular host being capable of infecting said plant cells by allowing integration into the genome of the latter, DNA sequences of interest originally contained in the genome of the above vector.
- the above-mentioned cell host used is Agrobacterium tumefaciens, in particular according to the methods described in the articles by Bevan (1984) and An et al. (1986), or even Agrobacterium rhizogenes, in particular according to the method described in the article by Jouanin et al, (1987).
- the transformation of plant cells is carried out by the transfer of the T region of the extra-chromosomal circular plasmid inducing Ti tumors of Agrobacterium tumefaciens, using a binary system (Watson
- T-DNA region was deleted, with the exception of the right and left edges, a marker gene being inserted between them to allow selection in plant cells.
- the other partner of the binary system is a helper Ti plasmid, a modified plasmid which no longer has T-DNA but still contains the virulence genes vir, necessary for the transformation of the plant cell. This plasmid is maintained in Agrobacterium.
- Another object of the present invention is to produce transgenic corn plants, plant parts or plant extracts, characterized in that they are regenerated from the transformed plant cell.
- the invention relates in particular to a fertility restoring corn plant characterized in that it comprises in its genome a fertility restoring gene linked to a marker of "small grain” phenotype or a corn plant homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a "small grain” phenotype marker, obtained from a corn seed homozygous for an AMS transgene and heterozygous for a fertility restoration gene linked to a phenotype marker "petit grain”.
- the invention also relates to a kit for implementing a method of propagating a homozygous corn plant for an AMS transgene and heterozygous for a fertility restoration gene linked to a previously described "small grain" phenotype marker, characterized in that it comprises corn seeds homozygous for an AMS transgene and heterozygotes for a fertility restoration gene linked to a marker of “small grain” phenotype, and oligonucleotides specific for the AMS transgene useful as primers for the detection by PCR of seeds homozygous for an AMS transgene and heterozygotes for a fertility restoration gene linked to a phenotype marker "petit grain”.
- FIG. 1 represents the block diagram of a succession of steps leading to the production of a hybrid seed according to the invention.
- 2 shows the plasmid pRec 274 comprising the barnase gene conferring male sterility, and the bar gene conferring resistance to the herbicide Basta ®.
- FIG. 3 represents the donor plasmid pBIOS 274 comprising the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene, under the control of the A9 promoter, and of the bar gene, under the control of the rice actin promoter.
- FIG. 4 represents the donor plasmid pBIOS 424 comprising the promoter A9-bamase-terminator 3 'CaMV and the gene for resistance to kanamycin Npt11 in a dissociating element Ds.
- FIG. 5 represents the plasmid p3222 comprising the antisense sequence of the brittle 2 gene as well as the barstar gene restoring fertility.
- Figure 6 represents the plasmid p3223 comprising the antisense sequence of the shrunken 2 gene as well as the barstar fertility restorer gene.
- FIG. 7 represents the plasmid p4962 comprising the antisense sequences of the shrunken 2 and brittle 2 genes as well as the barstar fertility restorer gene.
- FIG. 8 represents the plasmid pDM 302 comprising the expression cassette for the bar gene.
- FIG. 9 represents the donor plasmid pBIOS 273 which comprises an expression cassette comprising the rice actin promoter, the Bar gene, and the 3'Nos terminator.
- FIG. 1 A non-limiting illustration of one of the methods according to the present invention is described in FIG. 1.
- EXAMPLE 1 Built AMS.
- the vector used for the transformation of maize by Agrobacterium tumefaciens is in the form of a superbinary plasmid of approximately 50 kb (pRec 274).
- the superbinary vector used for the transformation contains:
- origin of Col E1 plasmid replication necessary for the maintenance and multiplication of the plasmid in Escherichia coli. This origin of replication is not functional in Agrobacterium tumefaciens,
- the barnase gene is under the control of the A9 promoter and the 3 'CaMV terminator; the bar gene being under the control of the actin-intron rice actin promoter and of the 3 'Nos terminator.
- the bar gene of Streptomyces hygroscopicus encodes a Phosphinothricin Acyl Transferase (PAT) which detoxifies phosphinothricin (agent for selection of the herbicide Basta ® ) by acetylation (White et al., 1990). It is generally used to select transformed plants which contain both the gene of interest and this gene encoding a selection agent, and which are therefore resistant to the herbicide.
- Phosphinothricin Acyl Transferase Phosphinothricin Acyl Transferase
- the barnase gene which confers male sterility, codes for a Ribonuclease (RNase). This gene was isolated from Bacillus amyloliquefasciens and is described in the publication by Hartley (1988).
- the superbinary plasmid pRec 274 is shown in Figure 2.
- This superbinary vector is obtained by homologous recombination of an acceptor plasmid pSB1 (EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with a donor plasmid pBIOS 274 (FIG. 3), derived from pUC (Messing, 1983).
- the donor plasmid has the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene, under the control of the A9 promoter, and of the bar gene, which is also a selection gene, under the control of the Actin promoter. rice.
- the donor and acceptor plasmids have a region of homology sufficient to allow homologous recombination and to obtain the vector known as superbinary.
- the transformation technique with Agrobacterium tumefaciens allows the integration of the only T-DNA consisting of the right (RB) and left (LB) borders surrounding the gene of interest (barnase) and the gene encoding a selection agent.
- RB right
- LB left
- ase gene of interest
- pRec 424 Construction of a plasmid (pRec 424) comprising the barnase gene conferring male sterility linked to. NPT-II gene conferring resistance to kanamycin.
- the vector used for the transformation of maize by Agrobacterium tumefaciens is in the form of a superbinary plasmid of approximately 50 kb (pRec 424).
- the superbinary vector used for the transformation contains:
- origin of Col E1 plasmid replication necessary for maintaining and multiplying the plasmid in Escherichia coli. This origin of replication is not functional in Agrobacterium tumefaciens,
- the barnase gene is under the control of the A9 promoter and the 3 'CaMV terminator; the Nptll gene inserted into a Ds element being under the control of the Actin promoter and of the 3 'Nos terminator and terminator.
- the Npt11 gene was isolated from the Tn5 transposon of Escherichia coli (Berg et al. 1983). This gene codes for the enzyme neomycin phosphotransferase type 11 which catalyzes the O-phosphorylation of aminoglycoside antibiotics such as neomycin, kanamycin, gentamycin and G418 (Davies and Smith, 1978). This gene confers resistance to kanamycin, which is used as a selection agent during plant genetic transformation. It is described by Bevan et al. (Genbank No. U00004).
- the barnase gene which confers male sterility, codes for a Ribonuclease as mentioned in Example 1.a above.
- This superbinary vector is obtained by homologous recombination of an acceptor plasmid pSB1 (EP. 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with a donor plasmid pBIOS 424 (FIG. 4) derived from pUC (Messing, 1983).
- the donor plasmid pBIOS 424 has the spectinomycin resistance gene as well as the T-DNA carrying the barnase gene under the control of the A9 promoter and of the Npt11 gene placed under the control of the Actin promoter inserted into a Ds element.
- the donor plasmid pBIOS 424 (A9 promoter-barnase-terminator 3 'CaMV and the kanamycin resistance gene Npt11 in a dissociative element Ds) was generated in the following way: The fragment containing the A9 promoter cassette - barnase gene - terminator
- 3 'CaMV was isolated by: a) restriction with hol, b) treatment with T4 DNA Polymerase to generate blunt ends, and c) restriction with XI a from the plasmid pBIOS 274 (FIG. 3). This fragment (X / iol / blunt - Xba ⁇ ) was then introduced into the vector pBIOS
- the EcoRV-X al fragment thus generated contains the plasmid sequences of the vector pSB12 (Japan Tobacco, EP 672 752) and the cassette element Ds - Actin promoter - actin intron - NPTII gene - Nos terminator - Ds element.
- Plasmid pBIOS 415 contains the GFP gene under the control of the promoter
- the vector pBIOS 340 is a vector containing the plasmid sequences of the vector pSB12 (Japan Tobacco, EP 672 752) and the cassette Ds element - Actin promoter - actin intron - NPTII gene - terminator
- the donor and acceptor plasmids have a region of homology sufficient to allow the production of the so-called superbinary vector by homologous recombination.
- the transformation technique with Agrobacterium tumefaciens allows the integration of the only T-DNA consisting of the right (RB) and left (LB) borders surrounding the gene of interest (barnase gene) and the gene coding for a selection agent.
- EXAMPLE 2 Constructed Phenotypic Restorer-Marker linked to grain size.
- the brittle 2 gene codes for a subunit of ADP Glucose Pyrophosphorylase, an enzyme involved in the synthesis of starch. In antisense orientation, it inhibits the synthesis of this subunit, which produces a mutant phenotype whose grain size is 50% smaller than normal size.
- the barstar gene codes for a specific Barnase inhibitor. It was isolated from Bacillus amyloliquefaciens and is described in Hartley (1998) (Genbank N ° X1 5545). Plasmid p3222 carries two individually cloned expression cassettes. The first cassette comprising the HMWG promoter, the brittle 2 gene in antisense orientation and the Nos terminator. The second cassette comprising the A9 promoter, the Barstar gene and the CaMV terminator.
- the brittle 2 gene was synthesized by PCR from corn albumen cDNA with the oligonucleotides Bt5 (CCGGATCCATGTGACAGACAGTGTTA, SEQ ID No. 1) containing a BamHI site, and Bt3 (AAGCCCGGGACTTGTACTAACTGTTTC, SEQ ID No. 2) Smal site.
- Bt5 CCGGATCCATGTGACAGACAGTGTTA, SEQ ID No. 1
- Bt3 AAGCCCGGGACTTGTACTAACTGTTTC, SEQ ID No. 2
- the 600 bp PCR fragment thus obtained was digested with SmaI and BamHI and cloned between the HMWG promoter and the nos terminator region of the plasmid p3214 opened by Smal and BamHI.
- the plasmid p3215 thus obtained contains the HMWG-brittle 2 promoter expression cassette (antisense orientation) -nos.
- a 270 bp fragment containing the barstar gene was amplified by PCR from the plasmid pWP127 with the oligonucleotides BPR5 (TATCGGATCCAAATCATAAGAAAGGAG, SEQ ID No. 3) containing a BamHI site, and BPR4 (GAAGATCTATATTGTTCATCCCATTG, SEQ ID No. 4) Bglll site.
- the PCR fragment thus obtained was digested with BamHI and Bgl11 and cloned between the A9 promoter and the CaMV terminator region of the plasmid p1415 opened with BamHI.
- the plasmid p3072 thus obtained contains the barstar gene under the control of the A9 promoter and of the CaMV terminator region.
- the plasmid p3222 according to Example 2.a) corresponds to the insertion of the HMWG-brittle 2 promoter cassette (antisense orientation) -nos (Kpnl-Sacl fragment) from p3215 into p3072 opened with Kpnl and Sacl.
- the shrunken 2 gene codes for the other subunit of ADP Glucose Pyrophosphorylase, an enzyme involved in the synthesis of starch. In antisense orientation, it inhibits the synthesis of this subunit which produces a mutant phenotype whose grain size is 40% smaller than normal size.
- Plasmid p3223 carries two individually cloned expression cassettes.
- the first cassette comprising the HMWG promoter, the shrunken 2 gene in antise ⁇ s orientation and the Nos terminator.
- the second cassette comprising the A9 promoter, the Barstar gene and the CaMV terminator.
- the shrunken 2 gene was synthesized by PCR from corn albumen cDNA with the oligonucleotides New Sh5 (GCACCCGGG AGGAGATATGCAGTTTG, SEQ ID no 5) containing a Smal site, and Sh3 (GACTGCAGCACAAATGGTCAAG, SEQ ID no 6) containing a Pstl site.
- the 1800 bp PCR fragment thus obtained was digested with SmaI and PstI and cloned between the HMWG promoter and the nos terminator region of the plasmid p3214 opened by SmaI and PstI.
- the plasmid p3217 thus obtained contains the HMWG-shrunken 2 promoter expression cassette (antisense orientation) -nos.
- a 270 bp fragment containing the barstar gene was amplified by PCR from the plasmid pWP127 with the oligonucleotides BPR5 (TATCGGATCCAAATCATAAGAAAGGAG, SEQ ID No. 7) containing a BamHI site, and BPR4 (GAAGATCTATATTGTTCATCCCATTG, SEQ ID No. 8) Bglll site.
- the PCR fragment thus obtained was digested with BamHI and Bgl11 and cloned between the A9 promoter and the CaMV terminator region of the plasmid p1415 opened with BamHI.
- the plasmid p3072 thus obtained has the barstar gene under the control of the A9 promoter and of the CaMV terminator region.
- the plasmid p3223 according to Example 2.b) corresponds to the insertion of the HMWG-shrunken 2 promoter cassette (antisense orientation) -nos (Kpnl-Sacl fragment) from p3217 into p3072 opened with Kpnl and Sacl.
- Plasmid p4962 ( Figure 7) carries two individually cloned expression cassettes.
- the first cassette comprising the HMWG promoter, the shrunken 2 gene in antisense orientation, the brittle 2 gene in antisense orientation and the Nos terminator.
- the second cassette comprising the Mac2.1 promoter, the Barstar gene and the CaMV terminator. This plasmid was constructed by conventional molecular biology techniques known to those skilled in the art.
- the plasmid p4962 is in the form of a donor vector derived from the vector pSB12 (Japan Tobacco, EP 672 752) of approximately 11.7 kb comprising: - an ori region: origin of plasmid replication Col E1, necessary for maintaining and multiplication of the plasmid in the bacteria,
- T-DNA comprising the male fertility restoration gene (barstar gene) and the antisense sequences of the shrunken 2 and brittle 2 genes conferring a v phenotype
- the barstar gene is under the control of the Mac2.1 promoter and of the 3'CaMV terminator, the shrunken 2 and brittle 2 genes in antisense orientation being under the control of the HMWG promoter and of the 3'Nos terminator.
- the superbinary vector pRec 4962 is obtained by homologous recombination of an acceptor plasmid pSB1 (Japan Tobacco, EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with the donor plasmid p4962.
- the bar gene is used to select the transformed plants which are resistant to the herbicide Basta ®.
- the plasmid pDM302 (Cao et al., 1992) carries the expression cassette comprising the promoter Actin-lntron-actin, the Bar gene and the terminator Nos.
- This plasmid pDM302 was obtained in the following manner:
- the coding region of the bar gene of Streptomyces hygroscopicus coding for PAT activity was excised from the plasmid plJ4104 (White et al., 1990) by the restriction enzyme Smal (fragment of 600 bp) and cloned in the expression vector pCOR113 (McEIroy et al., 1991) behind the 5 ′ fragment (promoter and first intron) of the rice Actin 1 (Act-1) gene. This generated the 4.9 kb plasmid pDM301 containing the Act1-bar expression cassette.
- the Act1-bar expression cassette of pDM301 was excised as a 2.0 kb Xhol-Xbal restriction fragment and cloned between the SalI and Xbal sites upstream of the terminator sequence of the nos gene coding for nopaline synthase (plasmid pNOS72) .
- the 4.7 kb plasmid pDM302 thus obtained contains the Act1-bar-nos expression cassette.
- the plasmid pBIOS 273 (FIG. 9) carries an expression cassette comprising the rice actin promoter, the Bar gene, and the 3 'Nos terminator. This plasmid was constructed by conventional molecular biology techniques known to those of skill in the art.
- the plasmid pBIOS 273 is in the form of a donor vector derived from the vector pSB12 (Japan Tobacco, EP 672 752), of about 8.6 kb comprising:
- ori origin origin of Col E1 plasmid replication, necessary for the maintenance and multiplication of the plasmid in the bacteria
- the plasmid pBIOS 273 was generated in two stages:
- the vector obtained, having a unique Xhol site, is named pBIOS 273.
- the superbinary vector pRec 273 is obtained by homologous recombination of an acceptor plasmid pSB1 (Japan Tobacco, EP 672 752) derived from a Ti plasmid of Agrobacterium tumefaciens with the donor plasmid pBIOS 273.
- AMS / + Production of a sterile male corn line heterozygous for the AMS transgene (AMS / +) by transformation of the corn with the plasmid described according to Example 1a (pRec 274).
- a heterozygous sterile male corn line expressing the barnase (conferring male sterility) and bar (glufosinate resistance) genes respectively under the control of the A9 promoters (Paul et al., 1992) and actin-intron (Me Elroy et al., 1991 ) is obtained by transformation with Agrobacterium tumefaciens according to the method described by Ishida et al. (1996).
- AMS / + sterile heterozygous male corn line
- Agrobacterium tumefaciens Other transformation techniques known to those skilled in the art can be used.
- Corn on the cob is decontaminated for 15 to 20 minutes in 20% Domestos with stirring and then rinsed with sterile water before taking the immature embryos which are placed in LSinf medium.
- the optimal size of immature embryos is 1 to 1.2 mm, which corresponds to 10 +/- 2 days after fertilization.
- the embryos are then vortexed, the LSinf medium is removed, and rinsing in LSinf medium is performed before vortexing again.
- Agrobacterium tumefaciens bacteria (strain LBA 4404) containing the super binary plasmid pRec 274 (as described according to example 1a) are cultured in YP medium supplemented with a selective agent suitable for the strain. 2 to 3 days later, the bacteria are suspended in LSinf medium + 100 ⁇ M acetosyringone. The concentration of the inoculum is considered to be 1.10 9 bacteria / ml.
- the embryos are transferred to LSD5 medium and placed in numbers of 25 per box sealed with Urgopore. Incubation for 2 weeks at 25 ° C in the dark (1 st selection) is performed. A 2 nd selection involves transferring the embryos on medium LSD10 by cutting germination. Incubation for three weeks is carried out in the same conditions as 1 st selection. A 3 ee selection is carried out by excising the type I calluses -jolis- so as to obtain fragments of 1-2 mm. A culture on LSD10 medium, then an incubation of 3 weeks under the same conditions as in first and second selection are carried out.
- Type I calli proliferated are placed on medium LSZ2 and the cans are sealed with film ® and placed in a culture chamber at 27 ° C for 2 weeks.
- the type I calluses which have proliferated are again subcultured, separated and placed on RM + G4C100 medium.
- the dishes are sealed with scellofrais ® and placed in a culture chamber at 27 ° C.
- the regenerated seedlings are subcultured on T1 G4 medium and placed under continuous illumination, at 27 ° C for one to two weeks. The seedlings having reached sufficient development are transferred to the phytotron.
- a selection step is carried out with a Basta F1 solution (Agri ⁇ vo France).
- the application of this solution is done by "Leaf Painting” (ie by brushing the leaves) on corn plants at the 4-5 leaf stage.
- the concentration of ammonium glufosinate in the treatment solution is 0.75 grams per liter.
- Resistant plants have a non-necrotic area 5 days after the application of the herbicide. Sensitive plants show necrosis in the treated area; we then observe the death of chlorophyll tissues. The plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized. 4.b) Production of a sterile male corn line heterozygous for the AMS transgene (AMS / +) by transformation of the corn with the plasmid described according to Example 1b (pRec 424).
- a sterile heterozygous male corn line expressing the barnase gene conferring male sterility, under the control of the A9 promoter (Paul et al., 1992), is obtained by transformation with A. tumefasciens according to the method described by Ishida et al. (1996).
- the transformation technique with Agrobacterium tumefaciens, non-limiting, used in this example is identical to that used in Example 4. a.
- Transformation with the A9-Bamase-3'CaMV-Ds : NPTII expression cassette comprising the barnase gene under the control of the A9 promoter and of the 3'CaMV terminator (according to Example 1 b) on a vector usable in transformation via Agrobacterium and comprising the selection marker "Kanamycin" inside the transposable element Ds has the advantage of eliminating the marker gene which will not be found in the transformed corn line.
- the identification of the seedlings having integrated the transgene is done as follows:
- Regeneration of transformed seedlings Calluses of type I which have proliferated are placed on LSZ2 medium and the boxes are sealed with scellofrais ® and placed in a culture chamber at 27 ° C for 2 weeks. The type I calluses which have proliferated are again subcultured, separated and placed on RM + G4C100 medium. The dishes are sealed with scellofrais ® and placed in a culture chamber at 27 ° C. The regenerated seedlings are subcultured on T1 G4 medium and placed under continuous illumination, at 27 ° C for one to two weeks. The seedlings having reached sufficient development are transferred to the phytotron.
- a selection step (by the cornet drop test) is carried out with a kanamycin solution at a concentration of 500 mg / l added with 1% of
- Tween. 2 to 3 drops of this solution are applied to corn plants at the 4-5 leaf stage.
- the plants are analyzed 5 days after the application of kanamycin.
- Sensitive plants show the appearance of whitish areas (death of chlorophyll tissues).
- Resistant plants do not show the appearance of whitish areas 5 days after the application of kanamycin.
- the plants thus regenerated are acclimatized and then cultivated in a greenhouse where they can be crossed or self-fertilized.
- Fertilization is carried out manually by a technique known to those skilled in the art by depositing pollen from the source of transposase Ac on the bristles of the transformants, preferably in the sense of the male plant having the transposase in the female plant containing l 'element Ds :: Nptll.
- the F1 grains are put to germinate to obtain seedlings.
- the seedlings are evaluated for their resistance to kanamycin (the resistant plants are preserved) and a PCR test is carried out to detect somatic excisions (somatic excision does not generally affect the gametes and leads to the formation of seeds and chimeric individuals most of whose cells still have the gene encoding the selection agent).
- the primers used for this PCR test which makes it possible to search for somatic excisions on F1 plants resistant to the selection agent are the following:
- the pair of primers Barn5 / EM11 makes it possible to visualize the excision (other suitable primers can also be used).
- the amplification is different depending on whether or not there has been excision.
- the F1 plants where somatic excision has taken place are therefore selected, then crossed with a wild genotype plant (WT).
- WT wild genotype plant
- the F2 plants are screened in order to identify the plants with the gene of interest without a gene encoding the selection agent (a germline excision affects the gametes and leads to the formation of seeds and individuals made up of cells which no longer possess the gene encoding the selection agent).
- the Southern methodology (1975) is used to demonstrate the insertion of the transgene into the plant genome and to assess the number of copies and characterize the integration profile.
- Plant genomic DNA (8 ⁇ g) is extracted from plant leaves following a CTAB (cetyltrimethylammonium bromide) extraction protocol, according to the Keller J protocol (DNAP 6701 San Pablo Ave Oakland CA 94608 USA) modified by Bancroft I. (Department of MolecularGenetics, Cambridge Laboratory,
- the DNA obtained was digested with different restriction enzymes, separated by agarose gel electrophoresis and transferred to nylon membrane N + hybond and then hybridized with radioactive probes.
- the Bar probe for molecular analyzes is prepared in the following manner.
- the plasmid pDM302 (described in Example 3a) of the present invention) is digested with the enzyme Sma I.
- the fragment of interest of 0.6 Kb is recovered after migration of the digestion product on electrophoresis gel and purification with the Gene Clean kit (Bio 101, Ozyme). After labeling with P32 30 ng of fragment, this is used as a probe to hybridize the different blots.
- the sterile male transformation event (STB27b) is a transformant obtained by transformation via Agrobacterium tumefaciens according to Example 4a) described above, and which has a single copy insertion of the T-DNA as described according to example 1a.
- the results of hybridization of the DNA digested with different restriction enzymes (Ncol, Spel, EcoR V, Hindlll and Ecor I), then hybridized with the Bar probe show that a single fragment is highlighted whatever the enzyme used.
- the size of the fragment revealed by Hind III digestion is 1.7 kb. This same type of molecular characterization is carried out for the transformants obtained by transformation via Agrobacterium tumefaciens according to Example 4b).
- a method of genetic transformation is used which leads to the stable integration of the modified genes into the genome of the plant.
- This method is based on the use of a particle gun.
- other transformation techniques known to those skilled in the art can be used.
- the ear samples are taken when the immature embryos have reached a size of 1.5 mm to 2 mm, that is to say 10 to 11 days after fertilization in our culture conditions (temperature of 25 ° C on day and 18 ° C at night, photoperiod 16/8). Disinfection:
- the harvested ears are stripped of their husks and their bristles and are then disinfected with Domestos ® 20% (v / v) for 15 minutes with stirring.
- the ears of corn will be rinsed three times with sterile water.
- the upper part of the grain is cut to reveal the albumen, then a light pressure on the grain allows to release the albumen.
- the immature embryo which is still in the grain (against the pericarp) is extracted and then deposited on the N6P6 callogenesis medium, orienting it flat side on the agar. Thirty six embryos per dish are cultured for 4 days in a culture chamber at 26 ° C and in the dark. This is the initiation period.
- the embryos are deposited 4 hours before firing on the 0.4 M N6P6 osmotic shock medium and are arranged by 36 in a small square of 2 cm 2 in the center of the dish.
- the dishes are sealed with fresh seal and incubated in a culture chamber (dark at 26 ° C).
- the plasmids carrying the genes to be introduced are purified on a Qiagen ® column according to the manufacturer's instructions. They are then precipitated on tungsten particles (M 10) following the protocol described by Klein (1987). The particles thus coated are projected towards the target cells using the cannon and according to the protocol described by J. Finer (1992).
- Suitable selective agents generally consist of active compounds of certain herbicides (Basta ®, Roundup ®) or certain antibiotics (Hygromycin, Kanamycin ).
- the gene for resistance to the herbicide Basta ® be used.
- MM + G2 maturation medium which promotes the development of somatic embryos.
- the callus is spread over the surface of the medium MM + G2.
- the dishes are placed in a culture chamber in the dark and at 26 ° C. After 15 days (minimum) on the MM + G2 medium, somatic embryos appear. These are subcultured on RM + G2 regeneration medium (20 to 25 per dish) and cultured at 28 ° C and in the light (16h / 24h). It is considered that 4 boxes in regeneration are sufficient to obtain regenerants.
- the embryos After approximately 15 days on the RM + G2 medium, the embryos have developed into seedlings which are then subcultured in tubes on the T1 + G2 rooting medium. It is considered that 5 seedlings per event are necessary for successful acclimatization to the phytotron and shipments. These seedlings are placed in a culture chamber in the light.
- calluses including. growth is not inhibited by the selection agent (ammonium glufosinate), usually and mainly composed of cells resulting from the division of a cell having integrated into its genetic heritage one or more copies of the selection gene.
- the transformation efficiency is 10%.
- calluses are identified, individualized, amplified and then cultivated so as to regenerate seedlings. In order to avoid any interference with untransformed cells, all these operations are carried out on culture media containing the selective agent.
- the acclimatization of the seedlings is carried out when the latter have sufficiently developed on T1 + G2, that is to say when the roots reach the bottom of the tube and when the hill axis is sufficiently rigid and developed.
- the seedlings are acclimated to the phytotron in pots with slightly enriched potting soil.
- the buckets are arranged on a shelf located 1.5 meters from the lamps.
- the acclimatization of 2 seedlings to the phytotron is necessary. On average, two weeks are required for weaning the seedlings.
- the plants thus regenerated and acclimatized are then cultivated in a greenhouse where they can be crossed or self-fertilized.
- This embodiment consisting in producing a heterozygous fertility restoring corn line for the fertility restoring gene (SSB / +) by co-transformation of a corn plant with the plasmids of examples 2a, 2b and 3a is the first embodiment.
- a second embodiment consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) consists in co-transforming a corn plant with the plasmids of examples 2a and 3a according to the same protocol as described above.
- a third embodiment consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) consists in co-transforming a corn plant with the plasmids of examples 2b and 3a according to the same protocol as described above.
- the production of the fertility restoring corn line according to the present example 5b is carried out by co-transformation of a corn plant with the plasmids described according to examples 2c and 3b according to the technique of co-transformation by Agrobacterium tumefaciens known from one skilled in the art.
- the bar gene (gene encoding the selection agent) is eliminated during co-transformation. 10% of the transformants obtained contain the 2 expression cassettes contained in the plasmids of Examples 2c and 3b. There will be segregation in the offspring.
- This embodiment (4 th mode) consisting in producing a corn line restoring heterozygous fertility for the fertility restoring gene (SSB / +) is the preferred mode according to the present invention. However, other transformation techniques known to those skilled in the art can be used. 5, c) Molecular characterization of the transformants.
- the transformant SSB-001a obtained according to Example 5a) was characterized by the same methodology as that described according to Example 4c of the present invention.
- Hybridizations with probes pA9 and pHMWG reveal a large number of bands, reflecting an integration in several copies of the plasmids p3222 and p3223.
- Hybridization with the Bar probe shows a simple profile, a major band is revealed for the 2 enzymes Eco RV and Hind III. The size of the fragment revealed by Hind III digestion is 8 kb. The very low intensity bands correspond to the very intense signals revealed previously with the pA9 and pHMWG probes.
- the male-sterile corn line heterozygous (AMS / +) resistant to the herbicide Basta ® obtained according to Example 4a is crossed with the restorer corn lines heterozygous for the fertility restorer gene of fertility (SSB / +), plant resistant to the herbicide Basta ®, obtained according to example 5 to obtain F1 plants.
- the same type of cross can be carried out between the heterozygous sterile male corn line (AMS / +), obtained according to Example 4b, and the heterozygous fertility restoring corn line for the fertility restorer gene (SSB / + ), obtained according to example 5.
- the fertilization is carried out manually by a technique known to those skilled in the art.
- the sterile male plant is led to flowering, the pollen of the plant (SSB / +) is deposited on the bristles of the sterile male line.
- genetic analyzes are carried out on F1 plants. Genetic analyzes consist of counting, in relation to the presence of the different markers, among the descendants.
- F1 is therefore composed of half of normal grains, the other half being depressed grains (phenotype 'petit grain' caused by the shrunken2 and brittle2 genes in antisense orientation).
- the depressed grains are selected by visual sorting on the ear of corn. These grains are all resistant to Basta ® herbicide.
- the depressed seeds which have the genotype (AMS / +; SSB / +) or (+ / +; SSB / +), are selected, then sown and germinated.
- EXAMPLE 7 Self-fertilization of F1 plants for production of F2.
- F1 plants resistant to Basta ® herbicide from depressed grains according to Example 6 are self-fertilized in order to obtain the F2 plants.
- the F1 plants derived from depressed grains being made up of both genotype plants (SSB / +; + / +) and genotype plants (SSB / +; AMS / +), two cases of self-fertilization then arise:
- the F1 plants of genotype (SSB / +; + / +) obtained according to Example 6 are self-fertilized. At the end of this self-fertilization, genetic analyzes are carried out on F2 plants:
- This self-fertilization step of plants of genotype can be advantageously eliminated by a genotyping step by carrying out a specific PCR of the AMS transgene on F1 plants derived from depressed grains according to Example 6.
- the depressed kernels are germinated, corn plants self-fertilized, and molecular sorting is performed by PCR. Only plants positive for the detection of the AMS transgene by PCR are conserved.
- the specific primers of the AMS gene of interest pA9-Barnase-3'CaMV) allowing its amplification by PCR are the following:
- the F1 plants of genotype (AMS / +; SSB / +) obtained according to Example 6 are self-fertilized in order to obtain the F2 progeny.
- genetic analyzes are carried out on the F2 progeny:
- EXAMPLE 8 Sowing of the depressed grains of the F2 progeny and genotyping of the plants (AMS / AMS; SSB / +).
- AMS / AMS homozygous for the transgene from STB-27b
- SSBOOIa heterozygous for the transgene from SSBOOIa
- the genomic DNA of the offspring was extracted from 50 mg of leaves according to the protocol and use of the Qiagen Dneasy 96 plant kit extraction kit (Qiagen SA, 91974 Courtaboeuf cedex, France).
- the Southern methodology is used to identify molecular profiles.
- the genotype sought in this study is homozygosity for the T-DNA of STB-27b (“2 copies” of the Bar gene) and heterozygosity for the Bar gene SSB-001a (“1 copy” of the Bar gene).
- Southern blots were carried out with the DNA of 8 daughter plants coming from an ear and this, on the 9 selected ears. 58 plants were genotyped according to the protocol described above. All the expected genotypes are represented among the 9 plants analyzed (2 different ears).
- a total of 10 plants have the genotype of interest, namely: homozygosity for the T-DNA of STB-27b ("2 copies" of the Bar gene) and heterozygosity for the Bar gene SSB-001 a ("1 copy" of the gene Bar).
- the observed frequencies are very close to the expected theoretical frequencies whatever the genotype considered (Ta ' bleau
- EXAMPLE 9 Obtaining pre-basic seeds (AMS / AMS; + / +), basic seeds (AMS / +; + / +), and hybrid seeds.
- the advantage of this cross is to multiply the line with the genotype (AMS / AMS; SSB / +) as well as to produce seeds with the genotype (AMS / AMS; + / +) or pre-basic seeds.
- AMS / AMS; + / + All normal grains have the genotype (AMS / AMS; + / +). These are pre-basic seeds. 75% of the depressed grains have the genotype (AMS / AMS; SSB / +). Plants from these depressed seeds can be self-fertilized to multiply (maintain) genotype plants (AMS / AMS; SSB / +). The genotype plant (AMS / AMS; SSB / +) is also called a sterility maintenance plant.
- Plants from depressed grains are crossed with an elite WT line. At the end of this crossing, the genetic analyzes are carried out:
- Plants from genotype seeds are crossed with an elite line.
- this elite line is identical to that used in the successive backcrossing step in order to introgress the genotype (AMS / AMS; SSB / +).
- Plants from genotype seeds (AMS / +; + / +) are crossed with an elite male line.
- the elite line used in this cross is different from that used in the cross described in Example 9.c).
- EXAMPLE 10 Sort by densimetric table of depressed grains.
- the densimetric table used makes it possible to divide into six fractions, grains of equivalent size and surface quality, but which differ between them by their specific weight.
- a densimetric sorting is carried out on a batch of F3 ear seeds, coming from the self-fertilization of plants of genotype (+ / +; SSB / +). Theoretically, these ears have a proportion of 75% of depressed grains and 25% of normal grains. 33 ears were seeded so as to obtain approximately 500 grams of seeds. 6 grain fractions were formed by densimetric sorting.
- Fractions 1 and 2 contain only depressed grains. In fractions 3, 4 and 5 we mainly have depressed grains but we also find some normal grains (ie 6.1, 8.2 and 19.1% respectively for fractions 3, 4 and 5).
- Fractions 1 to 5 therefore correspond to depressed grains and fraction 6 to normal grains. There is also a small amount of unsorted grain. This small amount corresponds to both normal and depressed grains. However, visually, the depressed grains are larger in number compared. with normal grains.
- the results of genetic analyzes confirm those of the sorting done on the grain phenotype for each of the fractions.
- Fractions 1 to 5 correspond to depressed grains and fraction 6 to normal grains.
- Example 11 Evaluation of the various stages of the production of hybrid seeds of corn starting from this new process.
- AMS / AMS; + / + The production of pre-basic seeds (genotype (AMS / AMS; + / +)) was ensured by the cultivation of plants of genotype (AMS / AMS; SSB / +). These plants have been observed to be fertile males.
- Plants of genotype (AMS / AMS; SSB / +) are self-fertilized. About 25% of the grains obtained in the offspring correspond to pre-basic seeds.
- AMS / +; + / + The production of basic seeds (genotype (AMS / +; + / +)) was ensured by the cultivation of plants of genotype (AMS / AMS; + / +). These plants have been observed sterile males and have no deleterious effect on the vegetative aspect of the plant attesting that the use of an AMS transgene in the homozygous state is compatible with the hybrid corn seed production system such as as described in the present invention.
- the genotype plants (AMS / AMS; + / +) were crossed with a wild genotype plant. 100% of the grains obtained in the offspring correspond to basic seeds.
- hybrid seeds were obtained by crossing between sterile male plants of genotype (AMS / +; + / +) derived from basic seeds with a wild elite line. All plants of genotype (AMS / +; + / +) did show complete male sterility (100% sterility).
- These grains can be separated by a densimetric sorting, preferably using a densimetric table.
- All normal grains have the genotype (AMS / +; + / +). These grains can be separated by densimetric sorting, preferably using a densimetric table. This crossing saves time in obtaining hybrid seeds (6 to 12 months less) compared to the crossing described in the example.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Priority Applications (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US10/506,946 US20050120416A1 (en) | 2002-03-08 | 2003-03-05 | Novel method for the production of hybrid maize seeds |
AU2003227816A AU2003227816A1 (en) | 2002-03-08 | 2003-03-05 | Novel method for the production of hybrid maize seeds |
CA002478126A CA2478126A1 (fr) | 2002-03-08 | 2003-03-05 | Procede de production de semences hybrides de mais |
EP03725269A EP1485493A1 (fr) | 2002-03-08 | 2003-03-05 | Procede de production de semences hybrides de mais |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0202968A FR2836782B1 (fr) | 2002-03-08 | 2002-03-08 | Nouveau procede de production de semences hybrides de mais |
FR02/02968 | 2002-03-08 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2003076632A1 true WO2003076632A1 (fr) | 2003-09-18 |
Family
ID=27763666
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/FR2003/000711 WO2003076632A1 (fr) | 2002-03-08 | 2003-03-05 | Procede de production de semences hybrides de mais |
Country Status (7)
Country | Link |
---|---|
US (1) | US20050120416A1 (fr) |
EP (1) | EP1485493A1 (fr) |
AR (1) | AR038894A1 (fr) |
AU (1) | AU2003227816A1 (fr) |
CA (1) | CA2478126A1 (fr) |
FR (1) | FR2836782B1 (fr) |
WO (1) | WO2003076632A1 (fr) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007002267A2 (fr) * | 2005-06-24 | 2007-01-04 | Pioneer Hi-Bred International, Inc. | Sequences nucleotidiques mediatrices de la fertilite male et son procede d'utilisation |
US7612251B2 (en) | 2000-09-26 | 2009-11-03 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
US7696405B2 (en) | 2003-12-16 | 2010-04-13 | Pioneer Hi-Bred International, Inc. | Dominant gene suppression transgenes and methods of using same |
US7910802B2 (en) | 2007-08-03 | 2011-03-22 | Pioneer Hi-Bred International, Inc. | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US7915478B2 (en) | 2007-08-03 | 2011-03-29 | Pioneer Hi-Bred International, Inc. | Msca1 nucleotide sequences impacting plant male fertility and method of using same |
US7919676B2 (en) | 2007-08-03 | 2011-04-05 | Pioneer Hi-Bred International, Inc. | Msca1 nucleotide sequences impacting plant male fertility and method of using same |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080244765A1 (en) * | 2004-12-16 | 2008-10-02 | Pioneer Hi-Bred International, Inc. | Methods and compositions for pollination disruption |
EP2257076B1 (fr) * | 2009-05-28 | 2015-02-25 | Advanced Digital Broadcast S.A. | Signal de données vidéo, systême et procédé pour contrôler les verres obturateurs |
CN105018475B (zh) * | 2015-06-03 | 2017-02-22 | 北京首佳利华科技有限公司 | 基于Ms1基因构建的介导玉米雄性生育力的多控不育载体及其应用 |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992011379A1 (fr) * | 1990-12-24 | 1992-07-09 | Nickerson Biocem Limited | Promoteurs specifiques de tapetum provenant des brassicaceae spp |
WO1995034634A2 (fr) * | 1994-06-06 | 1995-12-21 | Plant Genetic Systems, N.V. | Utilisation de genes de l'anthocyanine pour la conservation de plantes males steriles |
WO1995034660A1 (fr) * | 1994-06-16 | 1995-12-21 | Advanced Technologies (Cambridge) Limited | Modification de la teneur en amidon de plantes |
WO1999004023A1 (fr) * | 1997-07-14 | 1999-01-28 | Pioneer Hi-Bred International, Inc. | Induction de la sterilite male dans des plantes par l'expression de niveaux eleves d'avidine |
-
2002
- 2002-03-08 FR FR0202968A patent/FR2836782B1/fr not_active Expired - Fee Related
-
2003
- 2003-03-05 CA CA002478126A patent/CA2478126A1/fr not_active Abandoned
- 2003-03-05 US US10/506,946 patent/US20050120416A1/en not_active Abandoned
- 2003-03-05 WO PCT/FR2003/000711 patent/WO2003076632A1/fr not_active Application Discontinuation
- 2003-03-05 AU AU2003227816A patent/AU2003227816A1/en not_active Abandoned
- 2003-03-05 EP EP03725269A patent/EP1485493A1/fr not_active Withdrawn
- 2003-03-07 AR ARP030100785A patent/AR038894A1/es unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1992011379A1 (fr) * | 1990-12-24 | 1992-07-09 | Nickerson Biocem Limited | Promoteurs specifiques de tapetum provenant des brassicaceae spp |
WO1995034634A2 (fr) * | 1994-06-06 | 1995-12-21 | Plant Genetic Systems, N.V. | Utilisation de genes de l'anthocyanine pour la conservation de plantes males steriles |
WO1995034660A1 (fr) * | 1994-06-16 | 1995-12-21 | Advanced Technologies (Cambridge) Limited | Modification de la teneur en amidon de plantes |
WO1999004023A1 (fr) * | 1997-07-14 | 1999-01-28 | Pioneer Hi-Bred International, Inc. | Induction de la sterilite male dans des plantes par l'expression de niveaux eleves d'avidine |
Non-Patent Citations (1)
Title |
---|
BHAVE M ET AL: "Identification and molecular characterization of shrunken-2 cDNA clones of maize", PLANT CELL, AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, US, vol. 2, 1 June 1990 (1990-06-01), pages 581 - 588, XP000652283, ISSN: 1040-4651 * |
Cited By (26)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7893318B2 (en) | 2000-09-26 | 2011-02-22 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7612251B2 (en) | 2000-09-26 | 2009-11-03 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
US8614367B2 (en) | 2000-09-26 | 2013-12-24 | Pioneer Hi Bred International Inc | Nucleotide sequences mediating plant male fertility and method of using same |
US8178750B2 (en) | 2000-09-26 | 2012-05-15 | Pioneer Hi Bred International Inc | Nucleotide sequences mediating male fertility and method of using same |
US7759544B2 (en) | 2000-09-26 | 2010-07-20 | Pioneer Hi-Bred International, Inc | Nucleotide sequences mediating plant male fertility and method of using same |
US7759543B2 (en) | 2000-09-26 | 2010-07-20 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7863500B2 (en) | 2000-09-26 | 2011-01-04 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7875764B2 (en) | 2000-09-26 | 2011-01-25 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating male fertility and method of using same |
US7888550B2 (en) | 2000-09-26 | 2011-02-15 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7888551B2 (en) | 2000-09-26 | 2011-02-15 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7893319B2 (en) | 2000-09-26 | 2011-02-22 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US7893317B2 (en) | 2000-09-26 | 2011-02-22 | Pioneer Hi-Bred International, Inc | Nucleotide sequences mediating plant male fertility and method of using same |
US8013218B2 (en) | 2000-09-26 | 2011-09-06 | Pioneer Hi-Bred International, Inc. | Nucleotide sequences mediating plant male fertility and method of using same |
US8067667B2 (en) | 2003-12-16 | 2011-11-29 | Pioneer Hi-Bred International, Inc. | Dominant gene suppression transgenes and methods of using same |
US7696405B2 (en) | 2003-12-16 | 2010-04-13 | Pioneer Hi-Bred International, Inc. | Dominant gene suppression transgenes and methods of using same |
US8933296B2 (en) | 2003-12-16 | 2015-01-13 | Pioneer Hi Bred International Inc | Dominant gene suppression transgenes and methods of using same |
WO2007002267A2 (fr) * | 2005-06-24 | 2007-01-04 | Pioneer Hi-Bred International, Inc. | Sequences nucleotidiques mediatrices de la fertilite male et son procede d'utilisation |
EP2295585A1 (fr) * | 2005-06-24 | 2011-03-16 | Pioneer Hi-Bred International Inc. | Séquences nucléotidiques médiatrices de la fertilité mâle et son procédé d'utilisation |
WO2007002267A3 (fr) * | 2005-06-24 | 2007-04-26 | Pioneer Hi Bred Int | Sequences nucleotidiques mediatrices de la fertilite male et son procede d'utilisation |
US7919676B2 (en) | 2007-08-03 | 2011-04-05 | Pioneer Hi-Bred International, Inc. | Msca1 nucleotide sequences impacting plant male fertility and method of using same |
US8648228B2 (en) | 2007-08-03 | 2014-02-11 | Pioneer Hi Bred International Inc | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US9803215B2 (en) | 2007-08-03 | 2017-10-31 | Pioneer Hi-Bred International, Inc. | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US8293970B2 (en) | 2007-08-03 | 2012-10-23 | Pioneer Hi-Bred International Inc. | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US8927805B2 (en) | 2007-08-03 | 2015-01-06 | Pioneer Hi Bred International Inc | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US7910802B2 (en) | 2007-08-03 | 2011-03-22 | Pioneer Hi-Bred International, Inc. | MSCA1 nucleotide sequences impacting plant male fertility and method of using same |
US7915478B2 (en) | 2007-08-03 | 2011-03-29 | Pioneer Hi-Bred International, Inc. | Msca1 nucleotide sequences impacting plant male fertility and method of using same |
Also Published As
Publication number | Publication date |
---|---|
FR2836782A1 (fr) | 2003-09-12 |
US20050120416A1 (en) | 2005-06-02 |
AR038894A1 (es) | 2005-02-02 |
FR2836782B1 (fr) | 2004-06-04 |
EP1485493A1 (fr) | 2004-12-15 |
AU2003227816A1 (en) | 2003-09-22 |
CA2478126A1 (fr) | 2003-09-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN111465321B (zh) | 用于植物细胞的细胞重编程的系统和方法 | |
US11807861B2 (en) | Methods and compositions for expression of transgenes in plants | |
EP1000164B1 (fr) | Induction de le sterilite male dans des plantes par l'expression de niveaux eleves de streptavidine | |
JPH05505933A (ja) | 結実能力のある遺伝子変換コーン | |
WO2004053055A2 (fr) | Mais transgenique a phenotype ameliore | |
CA2570626C (fr) | Procede de transformation d'agrobacterium pour des plants de mais diploide | |
US20130024985A1 (en) | Male and female sterility lines used to make hybrids in genetically modified plants | |
MX2008014405A (es) | Plataformas de cromosomas artificiales de plantas por medio de truncamiento de telomeros. | |
EP1395667B1 (fr) | Methode d'obtention de plante monocotyledone contenant un gene d'interet sans sequence auxiliaire etrangere | |
WO2003076632A1 (fr) | Procede de production de semences hybrides de mais | |
US20100281565A1 (en) | Transformation of Crambe Abyssinica | |
CA2282726C (fr) | Nouvelles utilisations de la sterilite male chez les plantes | |
CA2385763C (fr) | Promoteurs specifiques de l'albumen des graines de vegetaux | |
JP3755876B2 (ja) | 選択マーカーを含まない組換え植物の作出方法、ならびに該方法により作出される組換え植物 | |
WO2002081647A2 (fr) | Plantes bioluminescentes et leurs methodes de production | |
FR2827613A1 (fr) | Acides nucleiques codant pour un polypeptide isum2a et utilisation de ces acides nucleiques pour l'obtention de plantes transformees produisant des graines affectees dans le developpement du germe | |
FR2816320A1 (fr) | Utilisation d'un acide nucleique pour conferer a une plante une resistance a l'agression par un pathogene, et plante transformee avec un tel acide nucleique | |
EP1044272A2 (fr) | Procede de controle de la division et/ou de l'elongation de cellules eucaryotes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2478126 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2003725269 Country of ref document: EP |
|
WWP | Wipo information: published in national office |
Ref document number: 2003725269 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10506946 Country of ref document: US |
|
NENP | Non-entry into the national phase |
Ref country code: JP |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: JP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2003725269 Country of ref document: EP |