WO2003072810A1 - Headloop dna amplification - Google Patents

Headloop dna amplification Download PDF

Info

Publication number
WO2003072810A1
WO2003072810A1 PCT/AU2003/000244 AU0300244W WO03072810A1 WO 2003072810 A1 WO2003072810 A1 WO 2003072810A1 AU 0300244 W AU0300244 W AU 0300244W WO 03072810 A1 WO03072810 A1 WO 03072810A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
primer
amplification
region
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2003/000244
Other languages
English (en)
French (fr)
Inventor
Keith Rand
Peter Laurence Molloy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to EP03707898A priority Critical patent/EP1483406A4/en
Priority to US10/505,779 priority patent/US7618773B2/en
Priority to JP2003571490A priority patent/JP4417723B2/ja
Priority to CA002477573A priority patent/CA2477573A1/en
Priority to AU2003212087A priority patent/AU2003212087B2/en
Publication of WO2003072810A1 publication Critical patent/WO2003072810A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers

Definitions

  • the present invention is concerned with the selective amplification of a template molecule, especially a nucleic acid.
  • the present invention is concerned with, but not limited to, a method for the amplification of DNA and novel primers for use in the method.
  • the present invention also extends to specific applications of the method of the invention.
  • PCR polymerase chain reaction
  • oligonucleotide primer annealing to the DNA template
  • primer extension by a DNA polymerase
  • the oligonucleotide primers used in PCR are designed to anneal to opposite strands of the DNA, and are positioned so that the DNA polymerase-catalysed extension product of one primer can serve as a template strand for the other primer,
  • the PCR amplification process results in the exponential increase of discrete DNA the length of which is defined by the 5' ends of the oligonucleotide primers.
  • oligonucleotides or PNA peptide nucleic acid molecules that anneal to one of the DNA strands, within the region to be amplified and/or overlapping the binding site of one of the primers, and prevent initiation or elongation of DNA synthesis.
  • PNA peptide nucleic acid
  • Such oligonucleotides are designed to preferentially anneal with and suppress amplification of one of two related sequences.
  • the present invention provides a method for the selective amplification of a target nucleic acid in a sample comprising the target nucleic acid and at least one non-target nucleic acid, the method comprising amplifying the nucleic acids by means of at least one oligonucleotide primer comprising: a primer region that can prime and extend on the target and non-target nucleic acids; and a region that is an inverted repeat of an internal sequence of an amplicon of the at least one non-target nucleic acid but which contains at least one mismatch to the corresponding internal sequence, if present, of an amplicon of the target nucleic acid.
  • the inverted repeat is an extension at the 5' end of the primer.
  • the primer of the first aspect is also referred to as the "headloop primer"
  • the amplification Whilst the present method may involve the use of a single primer, it is preferred that the amplification be "exponential" and so utilize a pair of primers, generally referred to as “forward” and “reverse” primers, one of which is complementary to a nucleic acid strand and the other of which is complementary to the complement of that strand. Where a pair of amplification primers is used, either one or both primers may include an inverted repeat sequence.
  • the amplification may be performed by any suitable amplification technique such as, for example, PCR.
  • the PCR may be real time PCR.
  • the length of the primer may be of any length suitable for the amplification method, typically between about 15 to 35 bases.
  • the inverted repeat portion of the primer (alternatively referred to herein as the head) may comprise a number of nucleotides sufficient to allow priming on a matched sequence under the annealing and extension conditions of the amplification, typically in the range of about 5 to 30 bases.
  • the present invention provides a method for the selective amplification of a target nucleic acid in. a sample comprising the target nucleic acid and at least one closely related non-target nucleic acid, the method comprising amplifying the nucleic acids by means of at least one oligonucleotide primer comprising a primer region that can prime and extend on the target and non-target nucleic acids; and a region that is an inverted repeat of an internal sequence of an amplicon of the at least one non-target nucleic acid but which contains at least one mismatch to the corresponding internal sequence, if present, of the target nucleic acid.
  • the nucleic acid may be a methylated nucleic acid.
  • the method of the invention may be used to enable selective amplification of either methylated or unmethylated DNA.
  • the present invention provides a method according to the first or second aspects in which the target and non-target nucleic acids are formed by chemical modification of nucleic acid prior to amplification.
  • the method may be applied to DNA chemically modified with sodium bisulphite in order to allow selective amplification of methylated DNA, whilst suppressing the unmethylated sequences
  • the methylated DNA may be sequences of a human gene, for example, GSTPI gene.
  • a diagnostic or prognostic assay for a disease or condition e.g. prostate cancer, liver cancer and breast cancer characterised by abnormal methylation of cytos ⁇ ne at a site or sites within the glutathione-S-transferase (GST) Pi gene and/or its regulatory flanking sequences.
  • the assay described in WO 99/55905 is based on the use of methylation specific primers that are specific for methylated cytosine at a site or sites within the GSTPI gene and/or its regulatory flarJdng sequence.
  • the method of the present invention is based on the use of primers that are capable of priming both target and non-target nucleic acid but owe their selectivity for amplification of target nucleic acid to the use of a primer including a region that is an inverted repeat of an internal sequence of an amplicon of the non-target nucleic acid.
  • the method of the present invention thus provides an alternative to the methylation specific primer methodology described in WO/9955905.
  • the present invention provides an assay for abnormal methylation of cytosine at a site or sites within the glutathione-S-transferase (GST) Pi gene and/or its regulatory flanking sequences, wherein the assay comprises exposing isolated DNA to reactants and conditions for the amplification of a target region within the GSTPJ gene and/or its regulatory flanking sequences, the target region being one or more sites at which abnormal cytosine methylation occurs, the amplification being carried out using of at least one oligonucleotide primer comprising: a primer region that can prime and extend on the target region and a non-target region that is non-methylated, within the isolated DNA and a region that is an inverted repeat of an internal sequence of an amplicon of the non-target region but which contains at least one mismatch to the corresponding internal sequence of the target region; and
  • the target region may be a nucleic acid sequence within the region of the
  • GSTPI gene and/or its regulatory flanking sequences defined by (and inclusive of) CpG sites -43 to +55.
  • the isolated DNA of the fourth aspect of the invention may be subjected to chemical modification to convert unmethylated cytosines to uracil.
  • the chemical modification may be achieved by bisulphite * treatment.
  • the assay of the fourth aspect may be used as a diagnostic or prognostic assay for a disease or condition in a subject, said disease or condition characterised by abnormal methylation of cytosine.
  • the disease or condition may be a cancer.
  • the cancer may be, for example, prostate, liver or breast cancer.
  • the method of the invention is used for the selective amplification of methylated DNA present in an excess of unmethylated sequences. Following treatment with sodium bisulphite, cytosines (Cs) are converted to uracils (Us) while methyl cytosines remain unconverted.
  • the head sequence is designed to be an inverted repeat of the downstream sequence expected to result from the bisulphite conversion of an unmethylated DNA fragment.
  • the added sequence causes self-priming on fragments derived from unmethylated DNA, leading to inhibition of the amplification of unmethylated fragments, Because the downstream sequence is chosen to contain several CpG sites (and which bisulphite conversion does not occur in the case of methylated DNA) there is insufficient complementarity to allow self-priming and thus little or no inhibition of the amplification of the methylated DNA fragments.
  • the method of the invention may also be used in other contexts, for instance, to distinguish allelic variants or mutations, and members of gene families.
  • DNAs containing mutations within a short sequence region can be amplified while suppressing amplification of the wild-type sequence (eg for tumour suppressor genes).
  • the present invention may also be applied to the selective amplification of DNA of minor species (eg of bacteria) in an environment, by suppression of amplification of sequences of dominant species.
  • the present invention includes oligonucleotide primers for template amplification, the primers including an inverse repeat of a nucleic acid sequence within the non-target amplicon but which is mismatched with the corresponding sequence of a target nucleic acid.
  • the invention further includes a kit, the kit including at least one oligonucleotide primer in accordance with the invention.
  • This invention also includes amplification methods and assays that utilize such primers, and kits for performing such assays.
  • primer and “primer region” as used in the present application, refer to an oligonucleotide which is capable of acting as a point of initiation of synthesis in the presence of nucleotide and a polymerization agent.
  • the primers are preferably single stranded but may be double stranded. If the primers are double stranded, the strands are separated prior to the amplification reaction.
  • the primers used in the present invention are selected so that they are sufficiently complementary to the different strands of the sequence to be amplified that the primers are able to hybridize to the strands of the sequence under the amplification reaction conditions.
  • oligonucleotide primers can be prepared by methods which are well known in the art or can be isolated from a biological source.
  • One method for synthesizing oligonucleotide primers on a solid support is disclosed in U.S. Pat. No. 4,458,068 the disclosure of which is herein incorporated by reference into the present application.
  • PCR refers to a polymerase chain reaction, which is a thermocyclic, polymerase-mediated, DNA amplification reaction.
  • a PCR typically includes nucleic acids, oligonucleotide primers complementary to each strand of the nucleic acids, a thermostable DNA polymerase, and deoxyribonucleotides, and involves three distinct methods that are multiply repeated to effect the amplification of the original nucleic acid.
  • the three methods denaturation, hybridization, and primer extension
  • the hybridization and primer extension methods can be performed concurrently.
  • nucleic acid refers to a molecule of specific identity that can serve as a template for the synthesis of a complementary molecule.
  • the "nucleic acid” may be DNA or RNA, for example,, double or single stranded DNA or RNA or a double stranded DNA-RNA hybrid and or analogs and derivatives thereof.
  • a “nucleic acid” refers to the sequence between and including the two primers.
  • the nucleic acid of specific sequence may be derived from any of a number of sources, including humans, mammals, vertebrates, insects, bacteria, fungi, plants, and viruses.
  • the target nucleic acid is a nucleic acid whose presence or absence can be used for purposes including but no limited to medical or forensic purposes such as prognosis and or diagnosis of a disease or a cancer, selective species isolation, DNA fingerprinting, etc.
  • Any nucleic acid can be amplified using the present invention as long as a sufficient number of bases at both ends of the sequence are known so that oligonucleotide primers can be prepared which will hybridize to different strands of the sequence to be amplified.
  • a "target nucleic acid” may represent a fragment or fraction of the nucleic acids added to the reaction.
  • non-target nucleic acid is the equivalent region of nucleic acid from another species, another gene in the same species or any other related source.
  • deoxyribonucleoside triphosphates refers to dATP, dCTP, dGTP, and dTTP or other analogues.
  • polymerization agent refers to any compound or system that can be used to synthesize a primer extension product. Suitable compounds include, but are not limited to, thermostable polymerases, E. coli DNA polymerase I, Klenow fragment of E, coli DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, T. litoralis DNA polymerase, and reverse transcriptase.
  • thermostable polymerase refers to a DNA or RNA polymerase enzyme that can withstand extremely high temperatures, such as those approaching 100°C.
  • thermostable polymerases are derived from organisms that live in extreme temperatures, such as Thermus aquaticus.
  • Non-limiting examples of thermostable polymerases include, Taq, Tfh, Pfu, Vent, deep vent, UlTma, and variations and derivatives thereof.
  • E. coli polymerase I refers to the DNA polymerase I holoenzy e of the bacterium Escherichia coli.
  • the "Klenow fragment” refers to the larger of two proteolytic fragments of DNA polymerase I holoenzyme, which fragment retains polymerase activity but which has lost the 5 T -exonuclease activity associated with intact enzyme.
  • T7 DNA polymerase refers to a DNA polymerase enzyme from the bacteriophage T7.
  • An "amplicon” is a polynucleotide product generated in an amplification reaction.
  • references to "a mismatch" in the context of the present invention includes the case where a nucleotide in the inverted repeat region (head) of the primer does not or cannot pair through Watson-Crick base pairing with the corresponding nucleotide in the target amplicon derived from that part of the target nucleic acid corresponding to the internal sequence of the non-target nucleic acid (from which the inverted repeat region is derived).
  • adenine in the inverted repeat region would form a mismatch with adenine, cytosine, or guanine in the corresponding sequence in the target amplicon.
  • a mismatch occurs when a first nucleotide cannot pair with a second nucleotide because the second nucleotide is absent (i.e., an unmatched nucleotide) or be the result of additional nucleotide(s).
  • the inverted repeat region may contain more than one mismatches.
  • the absent or additional nucleotides could be either in the head of the primer or in the internal sequence in the target nucleic acid
  • a 5' extension (“head") is added to one or both of the primers used in PCR,
  • the sequence of the head is an inverted repeat of an internal sequence within the amplicon; it is designed to match with the sequence whose amplification is to be suppressed but to mismatch significantly with sequences that it is desired to amplify.
  • the head When copied, the head gives rise to a 3' terminal sequence that is capable of self-priming due to its complementarity to the downstream sequence. This would give rise to a long hairpin loop structure that cannot be efficiently used as a template for further rounds of amplification causing inhibition of the amplification of the unwanted fragment.
  • the PCR reaction includes three regions dete ⁇ nining specificity of amplification - the forward and reverse priming sites and the head priming site. By including a head on both the forward and reverse primers, four regions of selectivity can be incorporated into a single PCR reaction.
  • hairpin structures Whilst the formation of hairpin structures that lead to synthesis of unexpectedly high molecular weight fragments has been observed previously (N Pota an BioTechniques 27 1110-1114 (1999)) hairpin structures have not been utilised to provide for selective amplification.
  • Figure 1 is a schematic drawing of amplification of a target sequence using an embodiment of the method of the invention
  • Figure 2 shows sequences of the amplified region of fhel ⁇ S ribosomal RNA genes from E. coli, S. acidophilits and Sulfobacillus ther osidfldooxidans are aligned. Bases identical in all three species are shaded black and those identical in two of the three in grey. The sequences corresponding to the primers and to the headloop target regions are indicated.
  • FIG. 1 Diagram of EHL4S Headloop Priming.
  • FIG. 4 Mixtures of E. coli DNA with either S. acidophilus or S. thermos lfooxidans rDNA amplicons were prepared in the amounts shown above the panels. Amplifications used the reverse primer NR-Rli with either the non-selective forward primer NR-Fli or headloop primers EHL48, EHL64 or SAHL as indicated in the panels.
  • a MgCl 2 was at lJmM, primers at 200 ⁇ M.
  • Panel B MgCk was at 1.3mM, primers at 400nM and for Panel C MgCl 2 at 1.5 mM, primers 400nM.
  • melting curve analysis was done by monitoring the change in SyberGreen fluorescence with increasing temperature (in an ABI Prism 7700 real time PCR instrument).
  • Figure 5 All PCRs were done using primers SAHL and NR-Rli at 400nM, with ratios of input rDNA amplicons as shown above the panels.
  • Panel A shows the melting profiles of PCR products from reactions in which the MgQta concentration was either 1.3mM or 1.5mM. In both Panels B and C the optimum M Cl2 concentration of 1.3 mM was used.
  • Panel D shows reactions done in the absence or in the presence of 0.6M betaine; MgCl 2 was at 1.5mM. The lowering of the melting temperature in the presence of betaine is evident.
  • Figure 6 shows amplification of either methylated or unmethylated plasmid DNA using different headloop primers.
  • Figure 7 shows dissociation curves of PCR products obtained from methylated, unmethylated and a mixture of DNAs using the control CLUR-F2 primer
  • Figure 8 shows dissociation curves of PCR products obtained from methylated, unmethylated and a mixture of DNAs using the headloop CLUH-F2 primer
  • Figure 9 is a comparison of amplification by control and headloop primers from plasmid DNA mixtures using Taqman detection of unmethylated PCR products
  • Figure 10 is a comparison of amplification by control and headloop primers from plasmid DNA mixture using Taqman detection of methylated PCR products.
  • Figure 11 is a comparison of amplification by control and headloop primers from genomic DNA mixture using Taqman detection of methylated PCR products
  • Figure 12 is a comparison of amplification by control and headloop primers from genomic DNA mixture using Taqman detection of unmethylated PCR products
  • Figure 13 is the sequence of the GSTPI gene from 64 bases upstream to 96 bases downstream of the transcription start site, either unmodified (upper) or following bisulphite conversion and PCR amplification, assuming CpG sites are methylated (lower, B-M). Positions of CpG sites -7 to +10 are shown above the sequence. The position of forward primer F52A is shown (note the base mismatch at CpG site-3). The position of the base primers for the headloops Hlint5-10Ni (GSTintRl li) and Hlint5-10 and 5-10X (GSTintRl) are shown beneath their target sequences. The head regions for the primers are shown under their target sequences. For each headloop primer the head sequence joins to its primer part as shown by the arrows.
  • Hlint5-10Ni GSTintRl li
  • Hlint5-10 and 5-10X GSTintRl
  • Figure 14 A mix of two plasmids encompassing the region to be amplified and derived from methylated and unmethylated bisulphite-treated DNA was prepared in a ratio of 1000 unmethylated: 1 methylated molecule. Amplifications were done using F52A and the headloop primer shown; cycling conditions as described in the text with MgCla at 1.1 mM. Melting curve profiles are shown; the peak corresponding to the methylated sequence is to the right.
  • Figure 15 PCR amplifications were done on plasmid mixes representing 10 unmethylated: 10 3 methylated molecules. Amplifications were done using F52A and the headloop primers Hlint5-10 and Hlint5-10Ni. Concentrations of MgCl 2 were as shown in the panels.
  • FIG. 16 PCR amplifications using F52A and the headloop primer Hlint5-10 were done on plasmid mixes representing 10 s unmethylate :10 3 methylated molecules. Amplifications were done in an Eppendorf Mastercycler temperature gradient PCR machine and de ⁇ aturation profiles of the PCR products analysed in an Applied Biosystems ABI 7700 instrument,
  • Figure 17 is a schematic of loopback priming on "unmethylated" DNA following copying of primer LUH-F2 during reverse strand synthesis.
  • FIG. 1 shows the sequences of the target region of 16S ribosomal RNAs of the bacterial species.
  • E. call Sulfolobulus acidophilus and Sulfoldbulus th&rmosidfidooxidans and the regions to which the "universal" ⁇ rimers, NR-Rli and NR-Fli, bind.
  • the forward primer NR-Lli was used as the base for design of headloop primers for inhibition of amplification of DNA of either E. coli (EHL prefixes) or S. acidophilus rDNA (see Table).
  • EHL prefixes E. coli
  • S. acidophilus rDNA S. acidophilus rDNA
  • An example of headloop priming for the EHL48 primer is shown in Figure 3.
  • EHL48 primer After the initial priming cycle, in a subsequent cycle extension of the reverse primer leads to incorporation of sequences complementary to the EHL48 "head" at the 3' end of the synthesised strand.
  • These head sequences can loop back and anneal to their complementary target sequences within the amplicon.
  • the head forms a perfect match to the E. coh target sequences and so can prime and extend to form an extended hairpin loop structure. It is expected that such structures will be refractory to further amplification.
  • the head sequence has four mismatches to the complementary region,
  • EHL2a headloop primer
  • the headloop primer SAHL that targets the same region as EHL48 and EHL64, but is designed to anneal with and prime on the S. acidophilus sequence was also tested for its capacity to suppress ampification of the S. acidophilus rDNA (Panel D). Starting with a 50:1 mix of S. acidophilus to E. coli rDNA, amplification of S. acidophilus DNA was strongly suppressed and products showed a slight excess of the E. coli amplicon.
  • Betaine has been previously shown to improve the amplification of G+C rich DNAs. Addition of betaine was also found to increase the selectivity of headloop PCR. In Figure 3, Panel D the proportion of the E. coli amplicon is significantly increased in the reaction containing 0.6 M betaine.
  • the DNA sequence that results from bisulphite conversion will be the same regardless of the overall methylation status of the fragments.
  • Selective enrichment of the methylated form is achieved by the inclusion of a 5' extension in one or both of the primers used in the PCR.
  • the sequence of the head is an inverted repeat of a downstream sequence in the DNA fragment that is to be selected against. When copied the head gives rise to a 3' terminal sequence that is capable of self-priming due to its complementarity to the downstream sequence. This gives rise to long hairpin loop structure that is not expected to be efficiently used as template for further rounds of amplification, causing inhibition of the amplification of the unwanted fragment.
  • the head sequence is designed to be an inverted repeat of a downstream sequence expected to result from the bisulphite conversion of an unmethylated DNA fragment. After incorporation the added sequence causes self-priming on fragments derived from unmethylated DNA, leading to inhibition of the amplification of unmethylated fragments. Because the downstream sequence is chosen to contain several CpG sites (at which bisulphite conversion does not occur in the case of methylated DNA) there is insufficient complementarity to allow self-priming and thus little or no inhibition of the amplification of the 'methylated' DNA fragments.
  • the plasmids #77 and #58 were used in this work. They resulted from the insertion into pGEM-T (Promega) of PCR products derived from the amplification of a GST fragments from bisulphite-treated human. The sequences of the inserts in these plasmids are shown below.
  • This sequence corresponds to the sequence expected to result from amplification of bisulphite-treated human GST fragment when the DNA is methylated at CpG positions. For simplicity, referred to as 'Methylated DNA' .
  • the full sequence of the insert is shown.
  • the first CpG in the DNA fragment is -41 and the last (most 3' in the diagram) is CpG +10.
  • This sequence corresponds to the sequence expected to result from amplification of bisulphite-treated human GST fragment when the DNA is not methylated at CpG positions. For simplicity, referred to here as 'unmethylated' DNA.
  • the sequence of the insert within the amplified region is shown, from CpG site -39 to -29. Sequences of the forward primer F2 and the reverse primer R1T target region are boxed. The head portions of the headloop primers LUH F2, CLUH F2 and FT F2 are shown beneath their inverse complement sequences. Symbols used in the sequences are-
  • T T residue in the original sequence
  • t T residue expected to result from bisulphite conversion of a C residue in the original sequence
  • C C residue that was methylated (because part of a CpG sequence) and thus resistant to conversion by bisulphite treatment.
  • t T residue resulting from conversion of a C that was unmethylated despite being in a CpG sequence.
  • Conversion-Specific primers are designed to regions that include several converted t's (arising from conversion of C's) so that they will selectively amplify DNA fragments that have been successfully converted by the bisulphite treatment. By avoiding regions containing CpG sites these primers should be able to amplify DNA fragments regardless of their methylation status at CpG residues, i.e. both methylated and unmethylated forms of the fragment should be amplified equally well,
  • the regions to which these primers hybridize to the target fragment are boxed in the diagram above.
  • the regions to which the primers bind are identical in the methylated and unmethylated forms of the DNA fragment.
  • CLUH F2 and FT F2 all have 5' extensions that are an inverse repeat of a sequence within the unmethylated DNA fragment.
  • the 5' extension of a C a C C a aACA C a C a al targets the tttt G t G A T G T t t t G G t G t sequence downstream of the F2 priming site.
  • Bases are shown as: A: A complementary to T in original sequence a: A complementary to converted C (U) in original sequence, not part of CpG site, a: A complementary to converted C (U) in original sequence, part of CpG site.
  • the CLURF2 primer is a control. It has the same number of A's, C's and T's in its 5' extension as has CLUH F2, but in an order that does not match any sequence within the relevant region of the GST gene.
  • the reverse primer R1T was used at 1 uM.
  • F2 was used at 200 nM. All of the other primers were used at 40 nM.
  • the hot start system based on Platinum Taq Polymerase (Invitrogen) and buffer supplied were used. DNA input;
  • Methylated (10 s molecules) or unmethylated (10 8 molecules) plasmid was used in PCR reactions with the three different headloop primers, LUH-F2, CLUH-F2 and FT-F2 in combination with the reverse primer R1T and amplification monitored with Sybergreen ( Figure 6), All three primers amplified the methylated plasmid with similar efficiency. With unmethylated plasmid the appearance of PCR product was significantly delayed despite the use of 100 fold more plasmid in reactions. Primers LUH-F2 and FT-F2 gave the greatest differential in amplification between methylated and unmethylated DNA.
  • the samples were heated and the reduction in Sybergreen fluorescence that occurs when the DNA strands separate was monitored,
  • the two forms of amplified DNA can be distinguished because of a difference in melting temperature; the unmethylated fragment is less GC rich and thus melts at a lower temperature, ⁇ 76°C, than the methylated DNA ⁇ 80°C.
  • the mixture of plasmids (10000X excess of unmethylated) gives a PCR product similar to that given by the unmethylated plasmid, indicating that as expected the 'unmethylated' product predominates. Note that position of sample in the Applied Biosystems 7700 block affects results slightly, so positions of melting curve peaks are not expected to be identical even in duplicate samples.
  • Taqman probes allow monitoring of PCR products during amplification. Probes selective for detection of methylated and unmethylated GSTPI sequences were prepared.
  • TET * Tetrachlorofluorescein
  • TAMRA Carboxytetramethylrhodamine
  • DNA was isolated from LNCaP prostate cancer cells in which the GSTPI gene is methylated and from Placenta that is expected to be unmethylated in the GSTPI gene,
  • AAAACCTTTCCCTCTTTCCCAAA (AAAACCTTTCCCTCTTTCCCAAA)were designed to amplify bisulphite-treated DNA regardless of methylation status and lie outside the region amplified by the headloop primers and RlT.
  • a mixture of the two can be used to mimic the situation in which a small amount of tumour- derived DNA (methylated GSTPI) might need to be detected despite the presence of an excess of normal (unmethylated GSTPI) DNA-
  • the mixture used in the following experiment was referred to as e LP(l:100).): 1/10,000 dilution of 1 st round PCR product amplified using GSTAS56 and R4 from bisulphite-treated LNCaP DNA plus 1/100 dilution of 1 st round PCR product amplified using GSTAS56 and R4 from bisulphite-treated Placental DNA.
  • control primer F2 When the control primer F2 is used, almost all product is derived from the unmethylated DNA (as detected by PRE U), However, when the headloop primers with the 5' extensions are used, the methylated DNA is selectively amplified and only low levels of unmethylated DNA are made.
  • Headloop primers were designed to bisulphite-treated DNA of a region within the transcribed sequences of the GSTPI gene. Sequences of the primers are shown in the table below. Inosine is included in primers GSTRlli and GSTHLint5-10Ni at a position corresponding to a CpG site at which the bisulphite-converted DNA may be either a C or U depending on the state of methylation. Similarly the F52A primer contains a deliberate mismatch (A) at the position of a C in a CpG site so as not to bias amplification of methylated or unmethylated DNA.
  • A deliberate mismatch
  • Headloop primers use either GSTintRl (HLint5-10 and HLint5-10X) or GSTintRl li (HLint5-10Ni). The position of the primers is shown on the sequence of this region of the GSTPI gene in Figure 13. PCR using these primers was used to identify factors contributing to optimal selective amplification using headloop primers. Primers were at a final concentration of 200 nM and other reaction components as described above. PCR cycling conditions, unless otherwise indicated were:
  • the efficacy of the three headloop primers was compared using plasmid DNAs derived from cloning of amplified bisulphite-treated DNA and corresponding to either methylated or unmethylated GSTPI sequences. Plasmid DNAs were mixed in a ratio of 10 7 unmethylated: 10 4 methylated molecules and amplified using the different headloop primers in combination with the F52A forward primer ( Figure 14). Enrichment of 1000 fold or more for the methylated sequences was seen with the three headloop primers, with HLint5-10X showing the greatest level of suppression of amplification of unmethylated sequences. The effect of varying the concentration of Mg 2+ ions is shown in Figure 15.
  • Amplifications using either HLmtS-lONi or HLi ⁇ t5-10X were done in the presence of 1.1, 1.3 or 1.5 mM MgCl 2 . In both cases there was a concentration-dependent improvement in selectivity with decreasing levels of MgCl 2 . This effect has been seen with a number of different headloop primers. Optimal headloop selectivity is consistently seen at the lowest Mg 24" levels used that allow PCR amplification of the target sequences. In most cases this has corresponded to a level of free Mg 2;l" ions of 0,3 mM.
  • Betaine was shown to improve the selectivity of headloop amplification of 16S ribosomal RNA gene sequences.
  • the effects of betaine and variation of the annealing/extension temperature on selective amplification of methylated and unmethylated sequences from bisulphite-treated DNA are shown in Figure 16.
  • Betaine at 0.8M substantially improves selectivity of headloop PCR; the optimal effects of betaine are seen across the range of 0.6 to 1.2 M.
  • the effectiveness of the HLint5-10 headloop is also seen to depend on the annealing/elongation temperature.
  • the headloop primer method can be used separately or may be combined with other methods for selective amplification, such as "methylation specific PCR" (Herman et al., Proc Natl Acad Sci U S A. 93: 9821-6 (1996)).
  • methylation specific PCR Herman et al., Proc Natl Acad Sci U S A. 93: 9821-6 (1996).
  • the position of the target sequences within the amplicon has varied with respect to the position of the primer on which the head forms an extension.
  • the target region for headloop priming was about 40 bases downstream of the base primer.
  • the target sequence was close to the priming end of the base primer (EDint5-10) or overlapped the primer by 3 to 5 bases (EHL2a, SAHL, LUHF2. CLUHF2, FTF2, Hlint5-10Ni and Hlint5-10X).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/AU2003/000244 2002-02-26 2003-02-26 Headloop dna amplification Ceased WO2003072810A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP03707898A EP1483406A4 (en) 2002-02-26 2003-02-26 HEADLOOP DNA Amplification
US10/505,779 US7618773B2 (en) 2002-02-26 2003-02-26 Headloop DNA amplification
JP2003571490A JP4417723B2 (ja) 2002-02-26 2003-02-26 ヘッドループdnaの増幅
CA002477573A CA2477573A1 (en) 2002-02-26 2003-02-26 Headloop dna amplification
AU2003212087A AU2003212087B2 (en) 2002-02-26 2003-02-26 Headloop DNA amplification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AUPS0768A AUPS076802A0 (en) 2002-02-26 2002-02-26 Selective nucleic acid amplification
AUPS0768 2002-02-26

Publications (1)

Publication Number Publication Date
WO2003072810A1 true WO2003072810A1 (en) 2003-09-04

Family

ID=3834367

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2003/000244 Ceased WO2003072810A1 (en) 2002-02-26 2003-02-26 Headloop dna amplification

Country Status (8)

Country Link
US (1) US7618773B2 (https=)
EP (1) EP1483406A4 (https=)
JP (1) JP4417723B2 (https=)
CN (1) CN100516234C (https=)
AU (1) AUPS076802A0 (https=)
CA (1) CA2477573A1 (https=)
WO (1) WO2003072810A1 (https=)
ZA (1) ZA200407147B (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008152144A1 (de) * 2007-06-13 2008-12-18 Attomol Gmbh Molekulare Diagnostika Verfahren und sonden/primersystem zum 'real time' nachweis eines nukleinsäuretargets
EP2071035A1 (en) 2007-12-13 2009-06-17 Epigenomics AG Facilitator and method for amplification
US20100196890A1 (en) * 2007-03-08 2010-08-05 Wittwer Carl T Primers for melting analysis
WO2012142656A1 (en) 2011-04-18 2012-10-26 Garvan Institute Of Medical Research Method of diagnosing cancer
WO2016041010A1 (en) 2014-09-15 2016-03-24 Garvan Institute Of Medical Research Methods for diagnosis, prognosis and monitoring of breast cancer and reagents therefor
EP3599283A1 (en) * 2018-07-25 2020-01-29 Blue DNA Companion Method for assessing fecal pollution in water

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2011224534B2 (en) 2010-03-08 2014-10-09 Dana-Farber Cancer Institute, Inc. Full COLD-PCR enrichment with reference blocking sequence
EP2691541B1 (en) 2011-03-31 2017-10-18 Dana-Farber Cancer Institute, Inc. Method for enriching in single-stranded mutant sequences from mixture of wild-type and mutant sequences
WO2012162621A1 (en) 2011-05-26 2012-11-29 Brandeis University Methods for suppression pcr
US20140322717A1 (en) * 2011-11-18 2014-10-30 The Trustees Of Columbia University In The City Of New York Selective amplification and detection of mutant gene alleles
US9133490B2 (en) 2012-05-16 2015-09-15 Transgenomic, Inc. Step-up method for COLD-PCR enrichment
CN104845967B (zh) * 2015-04-15 2020-12-11 苏州新海生物科技股份有限公司 寡聚核苷酸片段及使用其的选择性扩增目标核酸序列变异体的方法及应用
WO2018111835A1 (en) 2016-12-12 2018-06-21 Dana-Farber Cancer Institute, Inc. Compositions and methods for molecular barcoding of dna molecules prior to mutation enrichment and/or mutation detection
WO2018209092A1 (en) 2017-05-10 2018-11-15 Board Of Regents, The University Of Texas System Methods and devices related to amplifying nucleic acid at a variety of temperatures
US11174511B2 (en) 2017-07-24 2021-11-16 Dana-Farber Cancer Institute, Inc. Methods and compositions for selecting and amplifying DNA targets in a single reaction mixture
US10513730B2 (en) * 2017-11-22 2019-12-24 Safeguard Biosystems Holdings Ltd. Asymmetric PCR methods, primers and kits
CN110283913A (zh) * 2019-07-21 2019-09-27 广州奥百阕谱生物科技有限公司 Rassf1a基因甲基化状态检测试剂盒及其应用
CN110607369A (zh) * 2019-09-24 2019-12-24 广州奥百阕谱生物科技有限公司 Septin9基因甲基化状态检测试剂盒及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5565340A (en) * 1995-01-27 1996-10-15 Clontech Laboratories, Inc. Method for suppressing DNA fragment amplification during PCR
WO1999055905A1 (en) * 1998-04-23 1999-11-04 Commonwealth Scientific And Industrial Research Organisation ASSAY FOR METHYLATION IN THE GST-Pi GENE

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9812768D0 (en) * 1998-06-13 1998-08-12 Zeneca Ltd Methods

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5565340A (en) * 1995-01-27 1996-10-15 Clontech Laboratories, Inc. Method for suppressing DNA fragment amplification during PCR
WO1999055905A1 (en) * 1998-04-23 1999-11-04 Commonwealth Scientific And Industrial Research Organisation ASSAY FOR METHYLATION IN THE GST-Pi GENE

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1483406A4 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100196890A1 (en) * 2007-03-08 2010-08-05 Wittwer Carl T Primers for melting analysis
US8399189B2 (en) * 2007-03-08 2013-03-19 University Of Utah Research Foundation Primers for melting analysis
AU2008222649B2 (en) * 2007-03-08 2014-06-12 Biofire Defense, Llc Primers for melting analysis
US9771610B2 (en) 2007-03-08 2017-09-26 University Of Utah Research Foundation Primers for melting analysis
WO2008152144A1 (de) * 2007-06-13 2008-12-18 Attomol Gmbh Molekulare Diagnostika Verfahren und sonden/primersystem zum 'real time' nachweis eines nukleinsäuretargets
EP2071035A1 (en) 2007-12-13 2009-06-17 Epigenomics AG Facilitator and method for amplification
WO2012142656A1 (en) 2011-04-18 2012-10-26 Garvan Institute Of Medical Research Method of diagnosing cancer
WO2016041010A1 (en) 2014-09-15 2016-03-24 Garvan Institute Of Medical Research Methods for diagnosis, prognosis and monitoring of breast cancer and reagents therefor
EP3599283A1 (en) * 2018-07-25 2020-01-29 Blue DNA Companion Method for assessing fecal pollution in water
WO2020021010A1 (en) * 2018-07-25 2020-01-30 Blue Dna Companion Method for assessing fecal pollution in water

Also Published As

Publication number Publication date
CA2477573A1 (en) 2003-09-04
US7618773B2 (en) 2009-11-17
AUPS076802A0 (en) 2002-03-21
JP2005518217A (ja) 2005-06-23
JP4417723B2 (ja) 2010-02-17
EP1483406A4 (en) 2007-10-24
EP1483406A1 (en) 2004-12-08
US20050221312A1 (en) 2005-10-06
CN1650029A (zh) 2005-08-03
CN100516234C (zh) 2009-07-22
ZA200407147B (en) 2006-02-22

Similar Documents

Publication Publication Date Title
US7618773B2 (en) Headloop DNA amplification
US5849497A (en) Specific inhibition of the polymerase chain reaction using a non-extendable oligonucleotide blocker
US8455197B2 (en) Nucleic acid amplification
US6063604A (en) Target nucleic acid sequence amplification
JP6652693B2 (ja) ブロッキングオリゴヌクレオチドを用いたdna増幅の方法
US8431347B2 (en) Isothermal strand displacement amplification using primers containing a non-regular base
EP1446508B1 (en) A method of reducing non-specific amplification in pcr
CN114032234A (zh) 使用重叠非等位基因特异性引物和等位基因特异性阻断剂寡核苷酸进行等位基因特异性扩增
US20080044812A1 (en) Melting Temperature Dependent Dna Amplification
US20100233683A1 (en) Amplification of dna fragments
EP1876246A1 (en) Self-complementary primers used in LAMP gene amplification method
AU2003212087B2 (en) Headloop DNA amplification
WO2001081630A2 (en) Template-specific termination in a polymerase chain reaction
JP7306722B2 (ja) プライマー及びその使用
AU2003209812B2 (en) Melting temperature dependent DNA amplification
HK40065933A (en) Allele-specific amplification using overlapping non-allele-specific primer and allele-specific blocker oligonucleotides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2003571490

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2477573

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003212087

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1295/KOLNP/2004

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2004/07147

Country of ref document: ZA

Ref document number: 200407147

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 2003707898

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2003809391X

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2003707898

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10505779

Country of ref document: US