WO2003063792A2 - Compositions and methods related to tim-3, a th1-specific cell surface molecule - Google Patents

Compositions and methods related to tim-3, a th1-specific cell surface molecule Download PDF

Info

Publication number
WO2003063792A2
WO2003063792A2 PCT/US2003/002919 US0302919W WO03063792A2 WO 2003063792 A2 WO2003063792 A2 WO 2003063792A2 US 0302919 W US0302919 W US 0302919W WO 03063792 A2 WO03063792 A2 WO 03063792A2
Authority
WO
WIPO (PCT)
Prior art keywords
tevi
binding molecule
cells
subject
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2003/002919
Other languages
English (en)
French (fr)
Other versions
WO2003063792A8 (en
WO2003063792A3 (en
Inventor
Vijay K. Kuchroo
Laurent Monney
Edward A. Greefield
Jason L. Gaglia
Gordon J. Freeman
Hanspeter Waldner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Brigham and Womens Hospital Inc
Dana Farber Cancer Institute Inc
Original Assignee
Brigham and Womens Hospital Inc
Dana Farber Cancer Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham and Womens Hospital Inc, Dana Farber Cancer Institute Inc filed Critical Brigham and Womens Hospital Inc
Priority to CA2474497A priority Critical patent/CA2474497C/en
Priority to EP21197088.4A priority patent/EP4091631A1/en
Priority to EP03723627A priority patent/EP1467759A4/en
Priority to AU2003303082A priority patent/AU2003303082B2/en
Priority to JP2003563488A priority patent/JP4694128B2/ja
Publication of WO2003063792A2 publication Critical patent/WO2003063792A2/en
Publication of WO2003063792A8 publication Critical patent/WO2003063792A8/en
Publication of WO2003063792A3 publication Critical patent/WO2003063792A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/3955Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments

Definitions

  • the present invention relates generally to compositions and methods useful for regulating the immune response. More particularly, the invention relates to methods of promoting and inhibiting immune effector cell function at the level of T-cell trafficking to target tissues and macrophage activation, both of which are disclosed herein to be related to functions of the Thl -specific cell surface molecule T cell hnmuno globulin and Mucin domain-containing molecule-3 (TEVI-3). The invention also relates to methods of treating disorders such as cancer, infectious disease, allergy, asthma, and autoimmune disease.
  • Thl cells Activation of naive CD4+ T helper cells results in the development of at least two distinct effector populations, Thl cells and Th2 cells.
  • Thl cells produce cytokines (interferon gamma (IFN- ⁇ ), interleukin-2 (IL-2), tumor necrosis factor alpha (TNF- ⁇ ), and lymphotoxin) which are commonly associated with cell-mediated immune responses against intracellular pathogens, delayed- type hypersensitivity reactions (Sher A et al.
  • IFN- ⁇ interferon gamma
  • IL-2 interleukin-2
  • TNF- ⁇ tumor necrosis factor alpha
  • lymphotoxin lymphotoxin
  • Th2 cells produce cytokines (IL-4, IL-10, and IL-13) that are crucial for control of extracellular helminthic infections and promote atopic and allergic diseases. Sher A et al. (1992) Annu Rev Immunol 10:385-409. In addition to their distinct roles in disease, the Thl and Th2 cells cross-regulate each other's expansion and functions. Thus, preferential induction of Th2 cells inhibits autoimmune diseases (Kuchroo NK et al.
  • the human homolog of the murine 200 gene product is there disclosed as a 301 -amino acid membrane-bound member of the immunoglobulin (Ig) superfamily.
  • Ig immunoglobulin
  • Full-length nucleotide and amino acid sequences of the murine and human forms of the 200 gene and the 200 gene product, antibodies specific for the 200 gene product, and soluble forms of the 200 gene product are disclosed.
  • the function of the 200 gene and the endogenous ligand of the 200 gene are not disclosed in United States Patent No. 6,084,083.
  • the present invention is based in part on the identification and structural and functional characterization of a transmembrane protein, TIM-3, which is preferentially expressed on differentiated Thl cells.
  • a transmembrane protein TIM-3
  • Full-length nucleotide and amino acid sequences of both human and murine forms of TEVI-3 are disclosed. Comparison of these sequences with corresponding sequences of the independently discovered 200 genes and 200 gene products disclosed in United States Patent No. 6,084,083 reveals their identity.
  • EAE experimental autoimmune encephalomyelitis
  • TEVI-3 In vivo administration of antibody to TEVI-3 also increases the number and activation level of macrophages.
  • TEVI-3 may play an important role in the induction of autoimmune diseases by regulating macrophage activation and/or function.
  • TEVI-3 plays an important role in the activation and expansion of macrophages in peripheral lymphoid tissue.
  • cognate interaction between T cells and macrophages is involved in this macrophage expansion and activation. The expansion and activation of macrophages is directed by the Thl cells and is TIM-3-dependent.
  • the invention is also based in part on the unexpected finding that TEVI-3 expression on effector Thl cells promotes migration of Thl cells to target tissues to mediate inflammation and immune response.
  • TEVI-3-dependent trafficking of effector Thl cells can be augmented with antibody to TEVI-3 and inhibited with a soluble form of TEVI-3.
  • TEVI-3 Full-length TEVI-3 is believed to be expressed as a membrane-associated protein having an extracellular region including an IgN domain and a mucin domain, a transmembrane region, and a cytoplasmic region.
  • the invention is also based in part on the surprising discovery by the inventors of an alternatively spliced variant of TEVI-3 in which the mucin domain and transmembrane region are deleted.
  • This alternatively spliced variant of TEvI-3 is believed to represent a naturally occurring form of soluble TEVI-3.
  • a monoclonal antibody 8B.2C12 that binds specifically to TEVI-3 is provided. Also provided in another aspect of the invention is a hybridoma 8B.2C12 that expresses the monoclonal antibody 8B.2C12. In another aspect of the invention, the invention provides a monoclonal antibody
  • 25F.1D6 that binds specifically to TEVI-3.
  • a hybridoma 25F.1D6 that expresses the monoclonal antibody 25F.1D6.
  • the invention provides pharmaceutical compositions containing the foregoing monoclonal antibodies specific for TEVI-3.
  • the pharmaceutical composition includes monoclonal antibody 8B.2C12 and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition includes monoclonal antibody 25F.1D6 and a pharmaceutically acceptable carrier.
  • the invention provides a method for preparing a pharmaceutical composition.
  • the method involves placing monoclonal antibody 8B.2C12 in a pharmaceutically acceptable carrier.
  • the invention provides a method for preparing a pharmaceutical composition. The method involves placing monoclonal antibody 25F.1D6 in a pharmaceutically acceptable carrier.
  • the invention provides a method for treating a subject in need of an enhanced immune response in a target tissue.
  • the method involves administering to the subject a TEVI-3 -binding molecule in an effective amount to promote T-cell trafficking to the target tissue.
  • the TEVI-3 -binding molecule is an antibody specific for TEVI-3.
  • the TEVI-3 -binding molecule is a fragment of an antibody specific for TEVI-3.
  • the TEVI-3 -binding molecule is an antibody expressed by hybridoma 8B.2C12. In another embodiment the TEVI-3 -binding molecule is an antibody expressed by hybridoma 25F.1D6.
  • the TEVI-3 -binding molecule binds to an extracellular region of TEVI-3.
  • the extracellular region of TEVI-3 is an IgN domain or a fragment thereof, and in some embodiments the extracellular region of TEVI-3 is a mucin domain or a fragment thereof.
  • the subject has cancer or is at risk of having cancer. In some preferred embodiments the subject has an infection or is at risk of having an infection.
  • the target tissue is selected from the group consisting of: brain, breast, lung, kidney, liver, pancreas, stomach, intestine, ovary, uterus, testis, prostate, marrow, bone, muscle, and skin.
  • the target tissue is central nervous system.
  • the subject is a human.
  • the administering is to a site other than the target tissue. In some embodiments the administering is to a site other than a lymph node associated with the target tissue.
  • the administering is systemic. In a preferred embodiment the administering is intravenous.
  • the method further entails administering to the subject an adjuvant.
  • the method according to this aspect of the invention further involves administering to the subject an anti-tumor medicament.
  • the anti-tumor medicament includes a tumor-specific antibody or tumor-specific fragment thereof.
  • the method also includes administering to the subject a cytokine.
  • the method according to this aspect of the invention further involves administering to the subject an antibacterial medicament.
  • the method further involves administering to the subject an antiviral medicament.
  • the method according to this aspect of the invention further involves administering to the subject an antifungal medicament.
  • the method further involves administering to the subject an antiparasitic medicament.
  • the invention provides a method for treating a subject in need of treatment for a tumor.
  • the method according to this aspect involves administering to the subject a TEVI-3 -binding molecule in an effective amount to promote T-cell trafficking to the tumor.
  • the TIM-3-binding molecule is an antibody expressed by hybridoma 8B.2C12.
  • the TEVI-3-binding molecule is an antibody expressed by hybridoma 25F.1D6.
  • the invention provides a method for treating a subject in need of treatment for an infection. The method according to this aspect involves administering to the subject a TEVI-3 -binding molecule in an effective amount to promote T-cell trafficking to the infection.
  • the TEVI-3-binding molecule is an antibody expressed by hybridoma 8B.2C12. In another embodiment the TEVI-3 -binding molecule is an antibody expressed by hybridoma 25F.1D6.
  • the invention provides a method for reducing T-cell trafficking into a target tissue of a subject. The method according to this aspect involves administering to the subject a TEVI-3 ligand-binding molecule in an effective amount to reduce T-cell trafficking to a target tissue of the subject.
  • the TEVI-3 ligand-binding molecule includes at least one domain of an extracellular region of TEVI-3. In one embodiment the at least one domain is an IgV domain.
  • the TEVI-3 ligand-binding molecule is soluble TEVI-3.
  • the soluble TEVI-3 is a fusion protein including at least one domain of an extracellular region of TEVI-3 and a constant heavy chain or portion thereof of an immunoglobulin.
  • the at least one domain is an IgN domain.
  • the subject is in need of treatment for an autoimmune disease of the target tissue.
  • the target tissue is selected from the group consisting of: central nervous system, pancreatic islets, and joint synovia.
  • the autoimmune disease is selected from the group consisting of: multiple sclerosis, type 1 diabetes mellitus, and rheumatoid arthritis.
  • the invention provides a method for treating or preventing asthma or allergy.
  • the method according to this aspect of the invention involves increasing activity or expression of TEVI-3 in a T cell of a subject to treat or prevent asthma or allergy.
  • the T cell is a Th2 cell.
  • the invention provides a method for treating a Th2- mediated disorder in a subject.
  • the method involves expressing TEVI-3 on the surface of Th2 cells of a subject having a Th2-mediated disorder in an amount effective to treat the Th2- mediated disorder.
  • the Th2-mediated disorder is asthma.
  • a method for promoting antigen- presenting cell (APC) activation entails contacting an APC with a TEVI-3 ligand-binding molecule in an effective amount to activate the APC.
  • the APC is a macrophage. In some embodiments the APC is a dendritic cell.
  • the TEVI-3 ligand-binding molecule includes at least one domain of an extracellular region of TIM-3. hi one embodiment the at least one domain is an IgN domain. In some embodiments the TEVI-3 ligand-binding molecule is soluble TEVI-3. Preferably the soluble TEVI-3 is a fusion protein including at least one domain of an extracellular region of TEVI-3 and a constant heavy chain or portion thereof of an immunoglobulin. In one embodiment the at least one domain is an IgN domain.
  • the invention provides a method for promoting APC activation.
  • the method according to this aspect involves contacting a T cell with a TEVI-3 - binding molecule, and contacting an APC with the T cell to activate the APC.
  • the APC is a macrophage.
  • the APC is a dendritic cell.
  • the TEVI-3 -binding molecule is an antibody specific for TEVI-3.
  • the TEVI-3 -binding molecule is an antibody expressed by hybridoma 8B.2C12.
  • the TEVI-3 -binding molecule is an antibody expressed by hybridoma 25F.1D6.
  • the TEVI-3 -binding molecule is a fragment of an antibody specific for TEVI-3.
  • the TIM-3-binding molecule binds to an extracellular region of TIM-3.
  • the method further includes contacting the T cell with an antigen specifically bound by a T-cell antigen receptor of the T cell. In some embodiments the method further includes contacting the APC with an antibody specific for TIM-3.
  • the contacting the APC with the T cell is ex vivo.
  • the antigen is a tumor antigen. According to yet another aspect of the invention, a method is provided for inhibiting
  • APC activation involves contacting an APC with an agent that reduces activity or expression of TEVI-3 in an effective amount to inhibit activation of the APC.
  • the APC is a macrophage.
  • the APC is a dendritic cell.
  • the agent that reduces activity or expression of TEVI-3 is soluble TEVI-3.
  • the agent that reduces activity or expression of TEVI-3 includes at least one domain of an extracellular region of TEVI-3. In one embodiment the at least one domain is an IgN domain.
  • the agent that reduces activity or expression of TEVI-3 is a fusion protein including at least one domain of an extracellular region of TEvI-3 and a constant heavy chain or portion thereof of an immunoglobulin.
  • the at least one domain is an IgN domain.
  • the agent that reduces activity or expression of TEVI-3 is an antisense polynucleotide capable of hybridization with a nucleic acid encoding TEVI-3 under stringent hybridization conditions.
  • the invention further provides a method for treating or preventing intracellular infections. The method according to this aspect involves promoting macrophage activation by contacting a TEVI-3 ligand on the macrophage with a TEVI-3 expressing cell.
  • the invention provides a method for treating or preventing cancer. The method according to this aspect involves promoting APC activation by contacting a TEVI-3 ligand on the APC with a TEVI-3-expressing cell and contacting the APC with a cancer antigen.
  • Figure 1A is a series of graphs depicting flow cytometric analyses of various indicated cell types for expression of TEVI-3. Thl, Th2, Tel and Tc2 cells were stained with rat monoclonal antibody (mAb) to TEVI-3 (solid line) or isotype control (dotted line).
  • Figure IB is a graphical representation and comparison of deduced amino acid sequences of murine TIM-3 (mTEVI-3; SEQ ID NO:2) and human TEvI-3 (hTEvi-3; SEQ ID NO:4), pointing out the IgV-like domain, mucin domain, transmembrane region, and cytoplasmic region for each.
  • Figure 1C is a pair of graphs depicting flow cytometric analyses of Chinese hamster ovary (CHO) cells transfected with either mTEVI-3 cDNA (CHO mTEVI-3) or vector alone (CHO mock). Stable puromycin-resistant cells were stained with mAb to TEVI-3 (solid line) or isotype control (dotted line).
  • Figure ID is a bar graph depicting relative expression of TEVI-3 RNA to control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA as measured by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of total RNA from various indicated cell lines and cells purified from SJL mice.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase
  • Figure 2 is a series of graphs depicting flow cytometric analyses of TEVI-3 expression on the surface of Thl DO 11.10 CD4+ T cells (solid line, specific staining; dotted line, isotype control), plus intracellular expression of EFN- ⁇ , IL-4, and IL-10, after the various indicated numbers of rounds of stimulation under Thl- and Th2-polarizing conditions.
  • Figure 3 A is a pair of bar graphs depicting relative expression of TEVI-3 RNA to control GAPDH RNA over time as measured by RT-PCR analysis of total RNA from lymph node (LN) and brain cells harvested from SJL mice at the indicated number of days following immunization with peptide PLP 139-151 for the induction of EAE. Corresponding clinical disease scores are as indicated.
  • Figure 3B is a series of graphs depicting flow cytometric analyses of TEVI-3 expression on different indicated cell populations from brain, lymph node (LN), and spleen of SJL mice (solid line, specific staining; dotted line, isotype control) on day 10 following immunization with PLP 139-151 for the induction of EAE.
  • Figure 4 is a series of photomicrographs depicting the effects of anti-TEVI-3 antibody treatment on EAE. Panels A and B show inflammatory/demyelinating lesions in the spinal cord of an anti-TEVI-3 treated mouse on day 12 post-immunization at the peak of clinical disease. The infiltrate consists of a mixture of neutrophils and mononuclear cells.
  • Panels A, C, and E hematoxylin and eosin staining; panels B, D, and F, Kl ⁇ ver-Barrera staining for myelin.
  • Figure 5 A is a pair of graphs depicting in vitro proliferation of splenocytes taken from SJL mice 10 days after they were immunized with PLP 139-151 and given anti-TEVI-3 or control antibody (rlgG), in response to various indicated amounts of PLP 139-151 (PLP) or neuraminidase 101-120 (Nase) peptide.
  • PLP PLP 139-151
  • Nase neuraminidase 101-120
  • Figure 5B is a series of graphs depicting flow cytometric analyses of various indicated populations of splenocytes taken from SJL mice 10 days after they were immunized with PLP 139-151 and given anti-TEVI-3 or control antibody (rlgG).
  • Figure 5C is a bar graph depicting proliferative response of indicated populations of mixed and purified splenocytes taken from SJL mice 10 days after they were immunized with PLP 139-151 and given anti-TEVI-3 or control antibody (rIgG2a). Gray bars, purified T cells and non-T cells separated by a permeable 0.2 ⁇ m membrane; black bars, no membrane.
  • Figure 5D is a series of graphs depicting flow cytometric analyses of spleen cells taken on day 3 from SJL mice injected on day 0 with 5xl0 6 TEVI-3-expressing, PLP 139-151 specific Thl 5B6 cells and then immunized with PLP 139-151. The recipients were also injected with anti-TEVI-3 or anti-ICOS (control) antibody on days 0 and 2.
  • FSC forward scatter
  • SSC side scatter.
  • Figure 6A is a series of graphs depicting flow cytometric analyses of CFSE-labeled T
  • Figure 6B is a series of graphs depicting flow cytometric analyses of CFSE-labeled T cells taken on day 7 from spleens and brains of SJL mice injected on day 0 with lxl 0 7 TEVI-3-expressing, PLP 139-151 specific Thl 5B6 cells and then immunized with PLP 139- 151.
  • the recipients were also injected with anti-TEVI-3, anti-ICOS (control), or anti-ICOSL antibody on days 0, 2, 4, and 5.
  • Figure 7 is a series of graphs depicting flow cytometric analyses of various indicated cell lines (dendritic cell (DC), macrophage, and B cell) as stained by a biotinylated soluble TEVI-3 protein (TEVI-3Ig-biotin).
  • DC dendritic cell
  • macrophage macrophage
  • B cell a biotinylated soluble TEVI-3 protein
  • Figure 8A is a graph depicting proliferation of splenocytes obtained from SJL mice immunized with PLP 139-151 peptide and treated for ten days with PBS, control hlgG, or soluble TEvI-3 fusion protein (mTEVI-3Ig/hFc or mTEVI-3/hFc).
  • Figure 8B is a pair of graphs depicting the stimulatory effect of mTEVI-3/hFc on secretion of Thl cytokines IL-2 and EFN- ⁇ .
  • the present invention is related to the novel appreciation of functional characteristics of a molecule that is selectively expressed on the surface of activated Thl cells.
  • the primary nucleotide and amino acid sequences of the particular molecule, here termed TEVI-3, have previously been described in U.S. Patent No. 6,084,083. It has been discovered according to the present invention that TEVI-3 unexpectedly plays an important role in the activation and proliferation of macrophages. It has also been surprisingly discovered according to the present invention that TIM-3-dependent activation and expansion of macrophages involves a cognate interaction between the T cell expressing TEVI-3 and the macrophage. Consistent with this finding, it has further been discovered according to the present invention that antigen-presenting cells (APCs), including macrophages and dendritic cells, express a ligand or receptor for TEVI-3.
  • APCs antigen-presenting cells
  • TEVI-3 molecules that bind to TEVI-3, such as antibodies directed to TEVI-3, can, surprisingly, induce macrophage activation and proliferation.
  • the macrophage activation induced by binding molecules directed against TEVI-3 promotes migration of the macrophages into target tissues, including tissue within the central nervous system (CNS).
  • CNS central nervous system
  • anti-TEVI-3 of mice that are genetically susceptible of developing experimental allergic encephalomyehtis (EAE), an in vivo model for multiple sclerosis, a Thl -type autoimmune disease of the brain in humans, results in an unusually severe form of EAE characterized by massive infiltration of activated macrophages into the CNS.
  • EAE experimental allergic encephalomyehtis
  • the present invention provides methods that are useful for promoting APC activation, e.g., in treating or preventing intracellular infection, cancer, and autoimmune disease.
  • TEVI-3 expression on effector Thl cells promotes trafficking of Thl cells to target tissues.
  • TEVI-3-dependent trafficking of Thl cells to target tissue can be augmented with antibody for TEVI-3.
  • the present invention provides methods that are useful for promoting T-cell trafficking into a target tissue, e.g., in subjects in need of an enhanced immune response in the target tissue.
  • the present invention provides methods that are useful for reducing T-cell trafficking into a target tissue, e.g., in subjects with autoimmune disease.
  • TEVI-3 refers to the gene product encoded by the nucleotide sequence of SEQ ED NO:l (murine), SEQ ID NO:3 (human), as well as homologs, alleles, and functional variants thereof, e.g., SEQ ID NO:5.
  • the gene product corresponding to the murine nucleotide sequence of SEQ ED NO:l is SEQ ED NO:2.
  • the gene product corresponding to the human nucleotide sequence of SEQ ED NO:3 is SEQ ID NO:4; the gene product corresponding to the human nucleotide sequence of SEQ ID NO:5 is SEQ ID NO:6.
  • TEVI-3 is a transmembrane protein that includes an extracellular region (including a signal peptide, an IgN domain, and a mucin domain, each as described further below), a transmembrane region, and a cytoplasmic region.
  • TEVI-3 Normally TEVI-3 is preferentially expressed on the surface of activated Thl cells.
  • TEVI-3 cDNA sequences of the instant invention have been deposited at the GenBank database under accession numbers AF450241-AF450243, shown below as SEQ ID NOs:l, 3, and 5, respectively.
  • TEVI-3 amino acid sequences of the instant invention have been deposited at the GenBank database under accession numbers AAL65156-AAL65158, shown below as SEQ ID NOs:2, 4, and 6, respectively.
  • SEQ ED NO:2 Amino acid sequence of murine TEVI-3 GenBank Accession No. AAL65156
  • SEQ ID NO:4 Amino acid sequence of human TIJVI-3, clone 1 GenBank Accession No. AAL65157
  • SEQ ID NO: 6 Amino acid sequence of human TEVI-3, clone 2 GenBank Accession No. AAL65158
  • NELRDSRLAN DLRDSGATIR IGIYIGAGIC AGLALALIFG ALIFKWYSHS KEKIQNLSLI 240
  • Functional variants of TEVI-3 include molecules representing mutations, additions, deletions, and truncations of full-length TEVI-3, provided such molecules retain at least one functional characteristic of full-length TEVI-3.
  • a TEVI-3 molecule truncated so as to lack most or all of its cytoplasmic domain is expected to retain the ability to bind to ligands or receptors for TEVI-3.
  • Certain aspects of the invention involve methods which promote T-cell trafficking into selected tissues.
  • the invention provides a method for treating a subject in need of an enhanced immune response in a target tissue. The method involves administering to the subject a TEVI-3 -binding molecule in an effective amount to promote T-cell trafficking to the target tissue.
  • the invention provides a method for treating a subject in need of treatment for a tumor.
  • the method according to this aspect of the invention involves administering to a subject in need of treatment for a tumor a TEVI-3 -binding molecule in an effective amount to promote T-cell trafficking to the tumor.
  • the invention provides a method for treating a subject in need of treatment for an infection.
  • the method according to this aspect of the invention involves administering to a subject in need of treatment for an infection a TEVI-3-binding molecule in an effective amount to promote T-cell trafficking to the infection.
  • treat and “treating” refer to a therapeutic intervention in a subject to prevent the onset of, alleviate the symptoms of, or slow or stop the progression of a disorder or disease being treated in the subject.
  • the therapeutic intervention can be the administration of a therapeutically effective amount of a substance to prevent the onset of, alleviate the symptoms of, or slow or stop the progression of a disorder or disease being treated.
  • a “subject” as used herein refers to any vertebrate animal, preferably a mammal, and more preferably a human. Examples of subjects include humans, non-human primates, rodents, guinea pigs, rabbits, sheep, pigs, goats, cows, horses, dogs, cats, birds, and fish.
  • a "subject in need of an enhanced immune response” as used herein refers to a subject having or at risk of having a disease, disorder, or condition that is associated with a deficient or absent immune response, or that can be relieved by augmenting an immune response. Subjects in need of an enhanced immune response are common and are readily recognized by those of skill in the art.
  • target tissue refers to a tissue representing a site of immune effector activity.
  • a target tissue can be any tissue in a subject. Examples of target tissues include brain or central nervous system, breast, lung, kidney, liver, pancreas (including in particular pancreatic islets), stomach, intestine, ovary, uterus, testis, prostate, marrow, bone, joint synovia, muscle, and skin.
  • target tissues are tissues not primarily associated with lymphoid tissues, except in situations involving cancers, infections, and inflammatory conditions of those tissues.
  • target tissues can, but typically do not, include lymph nodes, spleen, mucosal lymphoid tissues (including, e.g., Peyer's patches), or thymus.
  • a "TEVI-3 -binding molecule” is any molecule that binds specifically to TEVI-3.
  • the TEVI-3 -binding molecule can be a small molecule, a polypeptide, an antibody or a fragment of an antibody, a polynucleotide, a carbohydrate including a polysaccharide, a lipid, a drug, as well as mimics, derivatives, and combinations thereof.
  • the TEVI-3-binding molecule can be found in nature or it can be derived or synthesized using suitable in vitro and synthetic methods known by those of skill in the art.
  • the TEVI-3-binding molecule can be a small molecule that is identified through screening a library of small molecules for the ability to bind to TEVI-3.
  • the TEVI-3 -binding molecule can be generated and identified using phage display of peptides.
  • the TEVI-3-binding molecule can be a TEVI-3 ligand, including a soluble TEVI-3 ligand.
  • a "TEVI-3 ligand" as used herein refers to a type of TEVI-3 -binding molecule that binds specifically to the extracellular region of TEVI-3.
  • TEVI-3 ligand is a naturally occurring receptor or counter-receptor for TEVI-3, and it is believed to be expressed on certain cells of the immune system, including macrophages and dendritic cells.
  • TIM-3 ligand can also be expressed on certain other cells that come in contact with TEVI-3 expressed on T cells, e.g., endothelial cells, mucosal epithelial cells, and the like. Engagement of TEVI-3 ligand by TEVI-3 can deliver a signal to the interior of the cell expressing TEVI-3 ligand on its surface and/or the cell expressing TEVI-3 on its surface.
  • a TEVI-3 ligand also refers to any TEVl-3-binding molecule that competes with a naturally occurring TEVI-3 ligand for binding to TEVI-3.
  • a TEVI-3 ligand thus includes but is not limited to a naturally occurring TEVI-3 ligand that binds to TEVI-3.
  • Soluble TEVI-3 ligand refers to any form of TEVI-3 ligand that is dissociated from cell membrane. Soluble TEVI-3 ligand can be a C-terminal truncated form of full-length TEVI-3 ligand or a transmembrane-deleted version of TEVI-3 ligand. In one embodiment soluble TEVI-3 ligand refers to a fusion protein that includes at least an extracellular domain of TEVI-3 ligand and another polypeptide.
  • the soluble TEVI-3 ligand is a fusion protein including the extracellular region of TEVI-3 ligand covalently linked, e.g., via a peptide bond, to an Fc fragment of an immunoglobulin such as IgG.
  • the TEVI-3-binding molecule is an antibody specific for TEVI-3 or is a fragment of an antibody specific for TEVI-3.
  • An "antibody specific for TEVI-3" as used herein refers to an immunoglobulin that binds specifically to a TEVI-3 epitope through interaction between the epitope and a variable domain of the immunoglobulin.
  • a “fragment of an antibody specific for TEVI-3” shall refer to a portion of an intact antibody specific for TEVI-3 that binds specifically to a TEVI-3 epitope through interaction between the epitope and a variable domain of the intact immunoglobulin from which the fragment is derived.
  • a “fragment of an antibody specific for TEVI-3” shall also refer to an engineered equivalent of a portion of an intact antibody specific for TEVI-3 that binds specifically to a TEVI-3 epitope through interaction between the epitope and a variable domain.
  • intact antibodies generally include both variable domains and at least one constant domain. The variable domain includes contributions from heavy and light chains that together provide stretches of contact residues specific for the binding of the antibody with an antigen.
  • the constant domain is not specific for the antigen but rather is more or less common to all antibodies of a particular isotype; it may be involved in binding complement or antigen- independent binding of the antibody to Fc receptors expressed on certain immune effector cells.
  • the antibody can be monoclonal or polyclonal. Furthermore, the antibody can be native or it can be engineered in part or in whole to reduce its potential immunogenicity in a treated host. Methods for generating and isolating polyclonal and monoclonal antibodies specific for a given antigen are well described in the art. See, for example, Kohler and Milstein (1975) Nature 256:495-7; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y., current edition.
  • the antibody specific for TEVI-3 is meant to encompass antibodies derived from any appropriate species.
  • antibodies for a particular antigen can be raised by immunizing an appropriate host with the antigen.
  • the immunized host can be selected from a variety of species, including, for example, mouse, rat, hamster, guinea pig, rabbit, goat, sheep, horse, monkey, and human. Methods for generating chimeric and humanized monoclonal antibodies are also well known in the art, and examples of such antibodies are in clinical use today.
  • isotypes or classes of immunoglobulin exist. These include, for example, IgG, IgA, IgE, IgM, and IgD.
  • human IgG subtypes include IgGl, IgG2, IgG3, and IgG4, while murine IgG subtypes include IgGl, IgG2a, IgG2b, and IgG3.
  • the antibody specific for TEVI-3 is meant to encompass any isotype and subtype. In some embodiments the antibody is an IgG.
  • the TEVI-3 -binding molecule binds to an extracellular region of TEVI-3.
  • extracellular region of TEVI-3 refers to that portion of the expressed TEVI-3 gene product that normally resides substantially on the extracellular surface of a cell expressing the TEVI-3 gene product.
  • the predicted amino acid sequence of TEVI-3 includes an extracellular region, a transmembrane region, and a cytoplasmic or intracellular region.
  • the extracellular region is predicted to include the N- terminal 191 amino acid residues of murine TEVI-3 and the N-terminal 200 amino acid residues of human TEVI-3, inclusive of a 21 amino acid signal peptide in each instance.
  • the signal peptide can be cleaved from the expressed protein product so that the extracellular region of murine TEVI-3 is 170 amino acids long and the extracellular region of human TEVI-3 is 179 amino acids long.
  • the extracellular region of TEVI-3 is believed to include at least two domains, an IgN domain and a mucin domain (see Fig. IB).
  • the IgN domain of TEVI-3 shares structural similarities with an immunoglobulin variable domain, and it is believed to occupy amino acids 22-132 in murine TEVI-3 and amino acids 22-131 in human TEVI-3.
  • the mucin domain is believed to occupy amino acids 133-191 in murine TEVI-3 and amino acids 132-200 in human TEVI-3.
  • IgN domain or a fragment thereof refers to the full- length IgN domain of the extracellular region of TEVI-3 or to a portion of the full-length IgN domain of the extracellular region of TEVI-3 sufficiently long to be used as an antigen for immunization of a host. It is generally believed that a linear determinant of a protein antigen that forms contacts with a specific antibody is about six amino acids long. Thus typically the fragment will include at least six contiguous amino acids according to SEQ ED NO:2 or SEQ ID NO:4 included in the IgN domain as specified above.
  • muc domain or a fragment thereof refers to the full- length mucin domain of the extracellular region of TEVI-3 or to a portion of the full-length mucin domain of the extracellular region of TEVI-3 sufficiently long to be used as an antigen for immunization of a host.
  • a fragment will typically include at least six contiguous amino acids according to SEQ ID ⁇ O:2 or SEQ ED NO:4 included in the mucin domain as specified above.
  • an "effective amount” as used herein is any amount that is sufficient either to promote the occurrence of a desired outcome or condition, or to reduce or inhibit the occurrence of an undesired outcome or condition.
  • a desired outcome or condition is an ideal that represents one end of a spectrum of possible outcomes or conditions.
  • an effective amount is any amount associated with an outcome or condition that is closer to the desired ideal than would be achieved or observed without the effective amount.
  • T-cell trafficking refers to migration of T lymphocytes to a site of immune response activity.
  • Naive T cells recirculate throughout the body, leaving and reentering the lymphoid tissues as they sample their environment for the presence of non-self antigens or "danger" signals.
  • Lymphoid tissues are specially adapted to help promote encounters between antigen-specific T-cell receptors expressed on T cells and their cognate antigens.
  • Specialized antigen-presenting cells concentrate within lymphoid tissues, and are specially adapted to interact with and to present antigens to T cells to initiate an immune response by T cells genetically programmed to recognize a particular antigen.
  • T cells proliferate, undergo differentiation to produce a variety of secreted and cell-associated products, including cytokines, and migrate to tissue sites associated with the antigen.
  • the result of this process is that na ⁇ ve T cells circulate randomly while activated T cells proliferate and home to specific tissue sites.
  • the subject has cancer or is at risk of having cancer.
  • a "cancer” as used herein refers to an uncontrolled growth of cells which interferes with the normal functioning of the bodily organs and systems.
  • a subject that has a cancer is a subject having objectively measurable cancer cells present in the subject's body.
  • a subject at risk of having a cancer is a subject that is predisposed to develop a cancer. Such a subject can include, for example, a subject with a family history of or a genetic predisposition toward developing a cancer.
  • a subject at risk of having a cancer also can include a subject with a known or suspected exposure to a cancer-causing agent.
  • Hemopoietic cancers such as leukemia, are able to out-compete the normal hemopoietic compartments in a subject, thereby leading to hemopoietic failure (in the form of anemia, thrombocytopenia and neutropenia) ultimately causing death.
  • a metastasis is a region of cancer cells, distinct from the primary tumor location resulting from the dissemination of cancer cells from the primary tumor to other parts of the body.
  • the subject may be monitored for the presence of metastases. Metastases are most often detected through the sole or combined use of magnetic resonance imaging (MRI) scans, computed tomography (CT) scans, blood and platelet counts, liver function studies, chest X-rays and bone scans in addition to the monitoring of specific symptoms.
  • MRI magnetic resonance imaging
  • CT computed tomography
  • Cancers include, but are not limited to, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; cervical cancer; choriocarcinoma; colon and rectum cancer; connective tissue cancer; cancer of the digestive system; endometrial cancer; esophageal cancer; eye cancer; cancer of the head and neck; gastric cancer; intra-epithelial neoplasm; kidney cancer; larynx cancer; leukemia; liver cancer; lung cancer (e.g., small cell and non-small cell); lymphoma including Hodgkin's and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cavity cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; cancer of the respiratory system; sarcoma;
  • the subject has an infection or is at risk of having an infection.
  • An "infection” as used herein refers to a disease or condition attributable to the presence in a host of a foreign organism or agent that reproduces within the host. Infections typically involve breach of a normal mucosal or other tissue barrier by an infectious organism or agent.
  • a subject that has an infection is a subject having objectively measurable infectious organisms or agents present in the subject's body.
  • a subject at risk of having an infection is a subject that is predisposed to develop an infection. Such a subject can include, for example, a subject with a known or suspected exposure to an infectious organism or agent.
  • a subject at risk of having an infection also can include a subject with a condition associated with impaired ability to mount an immune response to an infectious organism or agent, e.g., a subject with a congenital or acquired immunodeficiency, a subject undergoing radiation therapy or chemotherapy, a subject with a burn injury, a subject with a traumatic injury, a subject undergoing surgery or other invasive medical or dental procedure.
  • a subject with a condition associated with impaired ability to mount an immune response to an infectious organism or agent e.g., a subject with a congenital or acquired immunodeficiency, a subject undergoing radiation therapy or chemotherapy, a subject with a burn injury, a subject with a traumatic injury, a subject undergoing surgery or other invasive medical or dental procedure.
  • Eifections are broadly classified as bacterial, viral, fungal, or parasitic based on the category of infectious organism or agent involved.
  • Other less common types of infection are also known in the art, including, e.g., infections involving rickettsiae, mycoplasmas, and agents causing scrapie, bovine spongiform encephalopthy (BSE), and prion diseases (e.g., kuru and Creutzfeldt- Jacob disease).
  • BSE bovine spongiform encephalopthy
  • prion diseases e.g., kuru and Creutzfeldt- Jacob disease
  • An infection can be acute, subacute, chronic, or latent, and it can be localized or systemic.
  • an infection can be predominantly intracellular or extracellular during at least one phase of the infectious organism's or agent's life cycle in the host.
  • Bacteria include both Gram negative and Gram positive bacteria.
  • Gram positive bacteria include, but are not limited to Pasteurella species, Staphylococci species, and Streptococcus species.
  • Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species.
  • infectious bacteria include but are not limited to: Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansasii, M.
  • Streptococcus Streptococcus
  • Streptococcus agalactiae Group B Streptococcus
  • Streptococcus viridans group
  • Streptococcus faecalis Streptococcus bovis
  • Streptococcus anaerobic spp.
  • Streptococcus pneumoniae pathogenic Campylobacter spp.
  • Enterococcus spp. Haemophilus influenzae
  • Bacillus anthracis Corynebacterium diphtheriae, Corynebacterium spp., Erysipeloihrix rhusiopathiae
  • Clostridium perfringens Clostridium tetani
  • Enterobacter aerogenes Klebsiella pneumoniae, Pastwella multocida
  • Bacteroides spp. Fusobacterium nucleatum
  • Streptobacillus moniliformis
  • Retroviridae e.g., human immunodeficiency viruses, such as HIN-1 (also referred to as HTLN-III), HIN-2, LAN or HTLN-III/LAN, or HIV-III, and other isolates, such as HIN-LP; Picornaviridae (e.g., polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g., coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rab
  • fungi examples include: Aspergillus spp., Blastomyces dermatitidis, Candida albicans, other Candida spp., Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum, Chlamydia trachomatis, Nocardia spp., Pneumocystis carinii.
  • Parasites include but are not limited to blood-borne and/or tissues parasites such as Babesia microti, Babesia divergens, Entamoeba histolytica, Giardia lamblia, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, Plasmodium vivax, and Toxoplasma gondii, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii, flat worms, round worms.
  • tissues parasites such as Babesia microti, Babesia divergens, Entamoeba histolytica, Giardia lamblia, Leishmania tropica, Leishmania spp
  • lymph node associated with the target tissue refers to any lymph node or other lymphoid tissue to which lymph circulating from a tissue is expected or shown to return.
  • lymphocytes within the blood leave the circulation to sample tissues, m order to return to the circulation, lymphocytes in a tissue make their way through lymphatic endothelium into the lymphatic circulation, flowing to a draining lymph node via afferent lymphatics.
  • lymphatic endothelium The anatomy and association of lymph nodes and the tissues they serve are well known to those of skill in the art.
  • a given target tissue can have more than one draining lymph node.
  • lymph nodes include aortic, axillary, bronchopulmonary, buccal, celiac, cervical, cystic, deltopectoral, iliac, infraclavicular, inguinal, intercostal, internal thoracic, jugulodigastric, jugulo-omohyoid, lumbar, mastoid, mediastinal, mesenteric, occipital, para-aortic, pararectal, parotid, pectoral, popliteal, preaortic, pulmonary, retroauricular, retropharyngeal, submandibular, submental, subscapular, supratrochlear, tonsils, tracheobroncheal.
  • the method further entails administering to the subject an adjuvant.
  • adjuvant refers to an antigen-nonspecific stimulator of the immune response.
  • the use of adjuvants is essential to induce a strong antibody response to soluble antigens (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y. Current Edition; hereby incorporated by reference).
  • the overall effect of adjuvants is dramatic and their importance cannot be overemphasized.
  • the action of an adjuvant allows much smaller doses of antigen to be used and generates antibody responses that are more persistent.
  • the nonspecific activation of the immune response often can spell the difference between success and failure in obtaining an immune response.
  • Adjuvants should be used for first injections unless there is some very specific reason to avoid this. Most adjuvants incorporate two components. One component is designed to protect the antigen from rapid catabolism (e.g., liposomes or synthetic surfactants (Hunter et al. 1981)). Liposomes are only effective when the immunogen is incorporated into the outer lipid layer; entrapped molecules are not seen by the immune system. The other component is a substance that will stimulate the immune response nonspecifically. These substances act by raising the level of lymphokines. Lymphokines stimulate the activity of antigen-processing cells directly and cause a local inflammatory reaction at the site of injection.
  • Lymphokines stimulate the activity of antigen-processing cells directly and cause a local inflammatory reaction at the site of injection.
  • LPS lipopolysaccaride
  • lipid A is available in a number of synthetic and natural forms that are much less toxic than LPS but still retain most of the better adjuvant properties of parental LPS molecule.
  • Lipid A compounds are often delivered using liposomes.
  • Adjuvants include, but are not limited to, alum (e.g., aluminum hydroxide, aluminum' phosphate); saponins purified from the bark of the Q.
  • saponaria tree such as QS21 (a glycolipid that elutes in the 21 st peak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, MA); poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, MT), muramyl dipeptide (MDP; Ribi) andthreonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, WA), emulsion-based formulations including mineral oil, non-mineral oil, water-in-oil or oil-in- water-in oil emulsion, oil-
  • the method according to this aspect of the invention further involves administering to the subject an anti-tumor medicament.
  • an anti- tumor medicament or, equivalently, a “cancer medicament” refers to an agent which is administered to a subject for the purpose of treating a cancer.
  • treating cancer includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer.
  • the cancer medicament is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer.
  • Various types of medicaments for the treatment of cancer are described herein.
  • cancer medicaments are classified as chemotherapeutic agents, immunotherapeutic agents, cancer vaccines, hormone therapy, and biological response modifiers.
  • the methods of the invention are intended to embrace the use of more than one cancer medicament along with the TEVI-3- binding molecule of the present invention.
  • the TEVI-3 - binding molecule can be administered with a both a chemotherapeutic agent and an immunotherapeutic agent.
  • the cancer medicament can embrace an immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent, an immunotherapeutic agent and a cancer vaccine all administered to one subject for the purpose of treating a subject having a cancer or at risk of developing a cancer.
  • Cancer medicaments function in a variety of ways. Some cancer medicaments work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer medicaments can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells. Targeting of cancer cells via the epitopes expressed on their cell surface is accomplished through the use of monoclonal antibodies. This latter type of cancer medicament is generally referred to herein as immunotherapy.
  • oncogenes e.g., Ras, Her2, bcl-2
  • tumor suppressor genes e.g., EGF, p53, Rb
  • cell cycle targets e.g., CDK4,
  • cancer medicaments target cells other than cancer cells.
  • some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines).
  • Still other medicaments, called angiogenesis inhibitors function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exit the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer.
  • Angiogenesis inhibitors include basic FGF (b-FGF), NEGF, angiopoietins, angiostatin, endostatin, T ⁇ F- ⁇ , T ⁇ P-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins.
  • b-FGF basic FGF
  • NEGF NEGF
  • angiopoietins angiostatin
  • endostatin T ⁇ F- ⁇ , T ⁇ P-470
  • thrombospondin-1 thrombospondin-1
  • platelet factor 4 platelet factor 4
  • CAI platelet factor 4
  • chemotherapeutic agents embrace all other forms of cancer medicaments which do not fall into the categories of immunotherapeutic agents or cancer vaccines.
  • Chemotherapeutic agents as used herein encompass both chemical and biological agents. These agents function to inhibit a cellular activity upon which the cancer cell depends for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation.
  • Chemotherapeutic agents which are currently in development or in use in a clinical setting include, without limitation: 5-FU Enhancer, 9-AC, AG2037, AG3340, Aggrecanase Inhibitor, Aminoglutethimide, Amsacrine (m-AMSA), Angiogenesis Inhibitor, Anti-NEGF, Asparaginase, Azacitidine, Batimastat (BB94), BAY 12-9566, BCH-4556, Bis- ⁇ aphtalimide, Busulfan, Capecitabine, Carboplatin, Carmustaine + Polifepr Osan, cdk4/cdk2 inhibitors, Chlorombucil, CI-994, Cisplatin, Cladribine, CS-682, Cytarabine HCI, D2163, Dactinomycin, Daunorabicin HCI, DepoCyt, Dexifosamide, Docetaxel, Dolastain, Doxifluridine, Doxorubicin, D
  • MTA/LY 231514 Octreotide, OD ⁇ 698, OK-432, Oral Platinum, Oral Taxoid, Paclitaxel (TAXOL®), PARP Inhibitors, PD 183805, Pentostatin ( deoxycoformycin), PKC 412, Plicamycin, Procarbazine HCI, PSC 833, Ralitrexed, RAS Famesyl Transferase Inhibitor, RAS Oncogene Inhibitor, Semustine (methyl-CCNU), Streptozocin, Suramin, Tamoxifen citrate, Taxane Analog, Temozolomide, Teniposide (NM-26), Thioguanine, Thiotepa, Topotecan, Tyrosine Kinase, UFT (Tegafur/Uracil), Nalrubicin , NEGF/b-FGF Inhibitors, Ninblastine sulfate, Nindesine sulfate, NX-710, VX-853, YM
  • Immunotherapeutic agents are medicaments which derive from antibodies or antibody fragments which specifically bind or recognize a cancer antigen.
  • the goal of immunotherapy is to augment a patient's immune response to an established tumor.
  • One method of immunotherapy includes the use of adjuvants.
  • cancer cells are antigenic and thus can be targeted by the immune system.
  • the combined administration of TEVI-3 -binding molecule and cancer medicaments, particularly those which are classified as cancer immunotherapies, is useful for stimulating a specific immune response against a tumor antigen.
  • tumor antigen and “cancer antigen” are used interchangeably to refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells.
  • Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens.
  • cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations.
  • oncogenes e.g., activated ras oncogene
  • suppressor genes e.g., mutant p53
  • a tumor antigen is typically a peptide associated with the surface of a tumor or cancer cell and which is capable of provoking an immune response when expressed on the surface of an APC in the context of an MHC molecule.
  • Cancer antigens such as those present in cancer vaccines or those used to prepare cancer immunotherapies, can be prepared from crude cancer cell extracts, as described in Cohen PA et al. (1994) Cancer Res 54: 1055-8, or by partially purifying the antigens, using recombinant technology, or de novo synthesis of known antigens. Cancer antigens can be used in the form of immunogenic portions of a particular antigen or in some instances a whole cell or a tumor mass can be used as the antigen. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
  • tumor-specific antigens are antigens that are specifically associated with tumor cells but not normal cells.
  • tumor-specific antigens are viral antigens in tumors induced by DNA or RNA viruses.
  • Tumor-associated antigens are present in both tumor cells and normal cells but are present in a different quantity or a different form in tumor cells.
  • antigens examples include oncofetal antigens (e.g., carcinoembryonic antigen), differentiation antigens (e.g., T and Tn antigens), and oncogene products (e.g., HER/neu).
  • oncofetal antigens e.g., carcinoembryonic antigen
  • differentiation antigens e.g., T and Tn antigens
  • oncogene products e.g., HER/neu.
  • the polypeptide products of tumor-specific genes can be the targets for host immune surveillance and provoke selection and expansion of one or more clones of CTLs specific for the tumor-specific gene product.
  • Examples of this phenomenon include proteins and fragments thereof encoded by the MAGE family of genes.
  • MAGE a tumor- specific family of genes.
  • the expression products of these genes are processed into peptides which, in turn, are expressed on cell surfaces. This can lead to lysis of the tumor cells by specific CTLs.
  • tumor rejection antigen precursors or "TRAP” molecules
  • TRAP tumor rejection antigen precursors
  • TRAs tumor rejection antigens
  • NK cells natural killer cells
  • CTLs cytotoxic T lymphocytes
  • LAKs lymphokine- activated killer cells
  • activated macrophages can kill tumor cells without having been previously sensitized to specific antigens, and the activity does not require the presence of class I antigens encoded by the major histocompatibility complex (MHC) on target cells.
  • MHC major histocompatibility complex
  • NK cells are thought to participate in the control of nascent tumors and in the control of metastatic growth.
  • CTLs can kill tumor cells only after they have been sensitized to tumor antigens and when the target antigen is expressed on the tumor cells that also express MHC class I.
  • CTLs are thought to be effector cells in the rejection of transplanted tumors and of tumors caused by DNA viruses.
  • LAK cells are a subset of null lymphocytes distinct from the NK cell and CTL populations.
  • Activated macrophages can kill tumor cells in a manner that is not antigen-dependent nor MHC-restricted once activated. Activated macrophages are thought to decrease the growth rate of the tumors they infiltrate.
  • In vitro assays have identified other immune mechanisms such as antibody-dependent, cell-mediated cytotoxic reactions and lysis by antibody plus complement.
  • the anti-tumor medicament includes a tumor-specific antibody or tumor-specific fragment thereof
  • tumor-specific antibody refers to an antibody that specifically binds to a tumor antigen.
  • a "tumor-specific antibody fragment” as used herein refers to a fragment of a tumor-specific antibody that binds specifically to a tumor antigen. Typically the fragment includes at least part of a variable domain including a hypervariable region that contributes to antigen specificity and binding.
  • tumor- specific antibody fragments include, without limitation, Fab, Fv, Fab 1 , and F(ab') 2 fragments derived from tumor-specific antibodies.
  • the tumor antigen is expressed at the cell surface of the cancer cell.
  • the antigen is one which is not expressed by normal cells, or at least not expressed to the same level as in cancer cells.
  • Antibody-based immunotherapies may function by binding to the cell surface of a cancer cell and thereby stimulate the endogenous immune system to attack the cancer cell. Another way in which antibody-based therapy functions is as a delivery system for the specific targeting of toxic substances to cancer cells.
  • Antibodies are usually conjugated to toxins such as ricin (e.g., from castor beans), calicheamicin and maytansinoids, to radioactive isotopes such as Iodine-131 and Yttrium-90, to chemotherapeutic agents (as described herein), or to biological response modifiers. In this way, the toxic substances can be concentrated in the region of the cancer and non-specific toxicity to normal cells can be minimized.
  • antibodies which bind to vasculature such as those which bind to endothelial cells, are also useful in the invention.
  • Solid tumors generally are dependent upon newly formed blood vessels to survive, and thus most tumors are capable of recruiting and stimulating the growth of new blood vessels.
  • one strategy of many cancer medicaments is to attack the blood vessels feeding a tumor and/or the connective tissues (or stroma) supporting such blood vessels.
  • cancer immunotherapies which are currently being used or which are in development include but are not limited to Rituxan, IDEC-C2B8, anti-CD20 Mab, Panorex, 3622W94, anti-EGP40 (17-1 A) pancarcinoma antigen on adenocarcinomas Herceptin, anti- Her2, Anti-EGFr, BEC2, anti-idiotypic-GD epitope, Ovarex, B43.13, anti-idiotypic CA125, 4B5, Anti-NEGF, RhuMAb, MDX-210, anti-HER-2, MDX-22, MDX-220, MDX-447, MDX-260, anti-GD-2, Quadramet, CYT-424, EDEC-Y2B8, Oncolym, Lym-1, SMART M195, ATRAGE ⁇ , LDP-03, anti-CAMPATH, ior t6, anti CD6, MDX-11, ON103, Zenapax, Anti-Tac, anti-IL-2 receptor, MELIMMU ⁇ E-2,
  • Cancer vaccines are medicaments which are intended to stimulate an endogenous immune response against cancer cells.
  • Currently produced vaccines predominantly activate the humoral immune system (i.e., the antibody dependent immune response).
  • Other vaccines currently in development are focused on activating the cell-mediated immune system including cytotoxic T lymphocytes which are capable of killing tumor cells.
  • Cancer vaccines generally enhance the presentation of cancer antigens to both APCs (e.g., macrophages and dendritic cells) and/or to other immune cells such as T cells, B cells, and NK cells.
  • cancer vaccines can take one of several forms, as discussed infra, their purpose is to deliver cancer antigens and/or cancer associated antigens to APCs in order to facilitate the endogenous processing of such antigens by APC and the ultimate presentation of antigen presentation on the cell surface in the context of MHC class I molecules.
  • One form of cancer vaccine is a whole cell vaccine which is a preparation of cancer cells which have been removed from a subject, treated ex vivo and then reintroduced as whole cells in the subject. Lysates of tumor cells can also be used as cancer vaccines to elicit an immune response.
  • Another form of cancer vaccine is a peptide vaccine which uses cancer-specific or cancer-associated small proteins to activate T cells.
  • Cancer-associated proteins are proteins which are not exclusively expressed by cancer cells (i.e., other normal cells can still express these antigens). However, the expression of cancer-associated antigens is generally consistently upregulated with cancers of a particular type.
  • a dendritic cell vaccine which includes whole dendritic cells which have been exposed to a cancer antigen or a cancer-associated antigen in vitro. Lysates or membrane fractions of dendritic cells can also be used as cancer vaccines. Dendritic cell vaccines are able to activate APCs directly.
  • Other cancer vaccines include ganglioside vaccines, heat- shock protein vaccines, viral and bacterial vaccines, and nucleic acid vaccines.
  • the method also includes administering to the subject a cytokine.
  • cytokine refers to any of a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment.
  • cytokines include, but are not limited to interleukins IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, E -10, IL-12, IL- 15, IL-18; granulocyte-macrophage colony-stimulating factor (GM-CSF); granulocyte colony-stimulating factor (G-CSF); interferons including interferon-alpha (IFN- ⁇ ), interferon-beta (IFN- ⁇ ), and interferon-gamma (IFN- ⁇ ); tumor necrosis factor (TNF), transforming growth factor-beta (TGF- ⁇ ); FLT-3 ligand; and CD40 ligand.
  • interferon-alpha IFN- ⁇
  • IFN- ⁇ interferon-beta
  • IFN-gamma IFN-gamma
  • TGF tumor necrosis factor
  • TGF- ⁇ transforming growth factor-beta
  • FLT-3 ligand FLT-3 ligand
  • Cytokines play a role in directing the T cell response.
  • Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells.
  • Most mature CD4+ T helper cells express one of two cytokine profiles: Thl or Th2.
  • the Thl subset in mice promotes delayed- type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG2a.
  • the Th2 subset in mice induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgGl and IgE.
  • the cytokine be a Thl cytokine.
  • the method according to this aspect of the invention further involves administering to the subject an antibacterial medicament.
  • An "antibacterial medicament” refers to an agent that kills or inhibits the growth or function of bacteria. Antibacterial agents which are effective for killing or inhibiting a wide range of bacteria are often referred to as broad spectrum antibiotics. Other types of antibacterial agents are predominantly effective against Gram-positive bacteria or Gram-negative bacteria. These types of antibacterial agents are frequently referred to as narrow spectrum antibiotics. Other antibacterial agents which are effective against a single organism or disease and not against other types of bacteria, are often referred to as limited spectrum antibiotics. Antibacterial agents are sometimes classified based on their primary mode of action.
  • antibacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors.
  • Antibacterial agents useful in the invention include but are not limited to natural penicillins, semi-synthetic penicillins, clavulanic acid, cephalolsporins, bacitracin, ampicillin, carbenicillin, oxacillin, azlocillin, mezlocillin, piperacillin, methicillin, dicloxacillin, nafcillin, cephalothin, cephapirin, cephalexin, cefamandole, cefaclor, cefazolin, cefuroxine, cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime, ceftriaxone, cefoperazone, ceftazidine, moxalactam, carbapenems, imipenems, monobactems, euztreonam
  • Amdinocillin Pivoxil Amicycline; Amifloxacin; Amifloxacin Mesylate; Amikacin;
  • Amikacin Sulfate Aminosalicylic acid; Aminosalicylate sodium; Amoxicillin; Amphomycin;
  • Cefatrizine Cefazaflur Sodium; Cefazolin; Cefazolin Sodium; Cefbuperazone; Cefdinir;
  • Cefepime Cefepime Hydrochloride
  • Cefetecol Cefixime
  • Cefmenoxime Hydrochloride
  • Cefmetazole Cefinetazole Sodium; Cefonicid Monosodium; Cefonicid Sodium;
  • Cefpiramide Cefpiramide Sodium; Cefpirome Sulfate; Cefpodoxime Proxetil; Ce ⁇ rozil;
  • Cefroxadine Cefsulodin Sodium; Ceftazidime; Ceftibuten; Ceftizoxime Sodium; Ceftriaxone
  • Chloramphenicol Sodium Succinate Chlorhexidine Phosphanilate; Chloroxylenol;
  • Chlortetracycline Bisulfate Chlortetracycline Hydrochloride; Cinoxacin; Ciprofloxacin;
  • Ciprofloxacin Hydrochloride Cirolemycin; Clarithromycin; Clinafloxacin Hydrochloride; Clindamycin; Clindamycin Hydrochloride; Clindamycin Palmitate Hydrochloride;
  • Demeclocycline Hydrochloride Demecycline; Denofungin; Diaveridine; Dicloxacillin;
  • Dicloxacillin Sodium Dihydrostreptomycin Sulfate; Dipyrithione; Dirithromycin;
  • Doxycycline Doxycycline; Doxycycline Calcium; Doxycycline Fosfatex; Doxycycline Hyclate; Droxacin Sodium; Enoxacin; Epicillin; Epitetracycline Hydrochloride; Erythromycin; Erythromycin
  • Fosfomycin Tromethamine Fumoxicillin; Furazolium Chloride; Furazolium Tartrate; Fusidate Sodium; Fusidic Acid; Gentamicin Sulfate; Gloximonam; Gramicidin; Haloprogin;
  • Hetacillin Hetacillin Potassium; Hexedine; Ibafloxacin; hnipenem; Isoconazole; Isepamicin;
  • Lomefloxacin Hydrochloride Lomefloxacin Mesylate; Loracarbef; Mafenide; Meclocycline; Meclocycline Sulfosahcylate; Megalomicin Potassium Phosphate; Mequidox; Meropenem;
  • Methacycline Methacycline Hydrochloride
  • Methenamine Methenamine Hippurate
  • Neomycin Sulfate Neomycin Undecylenate
  • Netilmicin Sulfate Neutramycin; Nifuradene;
  • Nifurthiazole Nitrocycline; Nitrofurantoin; Nitromide; Norfloxacin; Novobiocin Sodium;
  • Penicillin V Benzathine; Penicillin V Hydrabamine; Penicillin V Potassium; Pentizidone
  • Pivampicillin Probenate Polymyxin B Sulfate; Porfiromycin; Propikacin; Pyrazinamide;
  • Rosoxacin Rosoxacin; Roxarsone; Roxithromycin; Sancycline; Sanfetrinem Sodium; Sarmoxicillin; Sarpicillin; Scopafungin; Sisomicin; Sisomicin Sulfate; Sparfloxacin; Spectinomycin
  • Sulfacytine Sulfadiazine; Sulfadiazine Sodium; Sulfadoxine; Sulfalene; Sulfamerazine;
  • Sulfameter Sulfamethazine; Sulfamethizole; Sulfamethoxazole; Sulfamonomethoxine; Sulfamoxole; Sulfanilate Zinc; Sulfanitran; Sulfasalazine; Sulfasomizole; Sulfathiazole;
  • Sulfazamet Sulfisoxazole; Sulfisoxazole Acetyl; Sulfisoxazole Diolamine; Sulfomyxin;
  • Temafloxacin Hydrochloride Temocillin; Tetracycline; Tetracycline Hydrochloride;
  • Tetracycline Phosphate Complex Tetroxoprim; Thiamphenicol; Thiphencillin Potassium; Ticarcillin Cresyl Sodium; Ticarcillin Disodium; Ticarcillin Monosodium; Ticlatone;
  • Tiodonium Chloride Tiodonium Chloride; Tobramycin; Tobramycin Sulfate; Tosufloxacin; Trimethoprim;
  • Trimethoprim Sulfate Trisulfapyrimidines; Troleandomycin; Trospectomycin Sulfate;
  • an antiviral medicament refers to a compound which prevents infection of cells by viruses or replication of the virus within the cell.
  • an antiviral medicament refers to a compound which prevents infection of cells by viruses or replication of the virus within the cell.
  • antibacterial drugs There are many fewer antiviral drugs than antibacterial drugs because the process of viral replication is so closely related to D ⁇ A replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents.
  • These stages include, attachment of the virus to the host cell (immunoglobulin or binding peptides), uncoating of the virus (e.g., amantadine), synthesis or translation of viral mR ⁇ A (e.g., interferon), replication of viral R ⁇ A or D ⁇ A (e.g., nucleoside analogues), maturation of new virus proteins (e.g., protease inhibitors), and budding and release of the virus.
  • Nucleotide analogues are synthetic compounds which are similar to nucleotides, but which have an incomplete or abnormal deoxyribose or ribose group.
  • nucleotide analogues are in the cell, they are phosphorylated, producing the triphosphate formed which competes with normal nucleotides for incorporation into the viral DNA or RNA. Once the triphosphate form of the nucleotide analogue is incorporated into the growing nucleic acid chain, it causes irreversible association with the viral polymerase and thus chain termination.
  • Nucleotide analogues include, but are not limited to, acyclovir (used for the treatment of herpes simplex virus and varicella-zoster virus), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial virus), dideoxyinosine, dideoxycytidine, and zidovudine (azidothymidine).
  • the interferons are cytokines which are secreted by virus-infected cells as well as immune cells.
  • the interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the virus.
  • EFN- ⁇ and IFN- ⁇ also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition.
  • These interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection. At the dosages which are effective for antiviral therapy, interferons sometimes have severe side effects such as fever, malaise and weight loss.
  • Immunoglobulin therapy is used for the prevention of viral infection.
  • Immunoglobulin therapy for viral infections is different than bacterial infections, because rather than being antigen-specific, the immunoglobulin therapy functions by binding to extracellular virions and preventing them from attaching to and entering cells which are susceptible to the viral infection.
  • the therapy is useful for the prevention of viral infection for the period of time that the antibodies are present in the host.
  • immunoglobulin therapies there are two types of immunoglobulin therapies, normal immune globulin therapy and hyper-immune globulin therapy.
  • Normal immune globulin therapy utilizes an antibody product which is prepared from the serum of normal blood donors and pooled.
  • Hyper-immune globulin therapy utilizes antibodies which are prepared from the serum of individuals who have high titers of an antibody to a particular virus. Those antibodies are then used against a specific virus.
  • hyper- immune globulins examples include zoster immune globulin (useful for the prevention of varicella in immuno-compromised children and neonates), human rabies immunoglobulin (useful in the post-exposure prophylaxis of a subject bitten by a rabid animal), hepatitis B immune globulin (useful in the prevention of hepatitis B virus, especially in a subject exposed to the virus), and RSV immune globulin (useful in the treatment of respiratory syncitial virus infections).
  • antiviral medicaments useful in the invention include but are not limited to immunoglobulins, amantadine, interferon, nucleoside analogues, and protease inhibitors.
  • Specific examples of antiviral agents include but are not limited to Acemannan; Acyclovir; Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox; Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate; Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride; Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril; Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscarnet Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir
  • Idoxuridine Kethoxal; Lamivudine; Lobucavir; Memotine Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir; Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate; Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine; Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride; Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate; Viroxime; Zalcitabine; Zidovudine; and Zinviroxime.
  • the method according to this aspect of the invention further involves administering to the subject an antifungal medicament.
  • An "antifimgal medicament” is an agent that kills or inhibits the growth or function of infective fungi. Antifimgal medicaments are sometimes classified by their mechanism of action. Some anti- fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other antifungal agents function by destabilizing membrane integrity.
  • imidazoles such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafme, and terbinafine.
  • Other antifungal agents function by breaking down chitin (e.g., chitinase) or immunosuppression (501 cream).
  • the antifungal medicaments useful in the invention include but are not limited to imidazoles, 501 cream, and Acrisorcin, Ambruticin, Amorolfine, Amphotericin B, Azaconazole, Azaserine, Basifungin, BAY 38-9502, Bifonazole, Biphenamine Hydrochloride, Bispyrithione Magsulfex, Butenafme, Butoconazole Nitrate, Calcium
  • the method further involves administering to the subject an antiparasitic medicament.
  • An "antiparasitic medicament” refers to an agent that kills or inhibits the growth or function of infective parasites.
  • antiparasitic medicaments also referred to as parasiticides, useful in the invention include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCI, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxanide furoate, doxycycline, eflornithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox
  • Certain aspects of the invention involve methods which inhibit T-cell trafficking into selected tissues.
  • the invention provides a method for reducing T-cell trafficking into a target tissue of a subject.
  • the method according to this aspect involves administering to the subject a TEVI-3 ligand-binding molecule in an effective amount to reduce T-cell trafficking to a target tissue of the subject.
  • a "TEVI-3 ligand-binding molecule" as used herein refers to any molecule, including TEVI-3, that binds to TEVI-3 ligand.
  • the TEVI-3 ligand-binding molecule can be a small molecule, a polypeptide, an antibody or a fragment of an antibody, a polynucleotide, a carbohydrate including a polysaccharide, a lipid, a drug, as well as mimics, derivatives, and combinations thereof.
  • the TEVI-3 ligand-binding molecule can be found in nature or it can be derived or synthesized using suitable in vitro and synthetic methods known by those of skill in the art.
  • the TEVI-3 ligand-binding molecule can be a small molecule that is identified through screening a library of small molecules for the ability to bind to TEVI-3 ligand.
  • the TEVI-3 ligand-binding molecule can be generated and identified using phage display of peptides.
  • the TEVI-3 ligand-binding molecule is a soluble TIM-3.
  • “Soluble TEVI-3” refers to any form of TEVI-3, including functional variants of TEVI-3, that is dissociated from cell membrane. Soluble TEVI-3 can be a C-terminal truncated form of full- length TEVI-3 or a transmembrane-deleted version of TEVI-3.
  • the TEVI-3 ligand-binding molecule includes a single domain of the extracellular region of TEVI-3, i.e., the IgN domain or the mucin domain
  • the soluble TEVI-3 is an alternatively spliced variant of full-length TEVI-3, which includes the IgN domain and intracellular region but not the mucin domain or transmembrane region.
  • the TEVI-3 ligand-binding molecule includes an extracellular region of TEVI-3.
  • the soluble TEVI-3 is a fusion protein including at least one domain of an extracellular region of TEVI-3 and a constant heavy chain or portion thereof of an immunoglobulin.
  • soluble TEVI-3 refers to a fusion protein that includes at least one domain of an extracellular domain of TEVI-3 and another polypeptide.
  • the soluble TEVI-3 is a fusion protein including the extracellular region of TEVI-3 covalently linked, e.g., via a peptide bond, to an Fc fragment of an immunoglobulin such as IgG; such a fusion protein typically is a homodimer.
  • the soluble TEVI-3 is a fusion protein including just the IgN domain of the extracellular region of TEVI-3 covalently linked, e.g., via a peptide bond, to an Fc fragment of an immunoglobulin such as IgG; such a fusion protein typically is a homodimer.
  • an Fc fragment is a homodimer of two partial constant heavy chains. Each constant heavy chain includes at least a CHI domain, the hinge, and CH2 and CH3 domains.
  • Each monomer of such an Fc fusion protein includes an extracellular region of TEVI-3 linked to a constant heavy chain or portion thereof (e.g., hinge, CH2, CH3 domains) of an immunoglobulin.
  • the constant heavy chain in some embodiments will include part or all of the CHI domain that is N-terminal to the hinge region of immunoglobulin. In other embodiments the constant heavy chain will include the hinge but not the CHI domain. In yet other embodiments the constant heavy chain will exclude the hinge and the CHI domain, e.g., it will include only the CH2 and CH3 domains of IgG. some embodiments the subject is in need of treatment for an autoimmune disease of the target tissue. "Autoimmune disease" is a class of diseases in which a subject's own antibodies react with host tissue or in which immune effector T cells are autoreactive to endogenous self-peptides and cause destruction of tissue.
  • Autoimmune diseases include but are not limited to rheumatoid arthritis, Crohn's disease, multiple sclerosis, systemic lupus erythematosus (SLE), autoimmune encephalomyehtis, myasthenia gravis (MG), Hashimoto's thyroiditis, Goodpasture's syndrome, pemphigus (e.g., pemphigus vulgaris), Grave's disease, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic Addison's disease, autoimmune-associated infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), bullous pemphi
  • a "self-antigen" as used herein refers to an antigen of a normal host tissue. Normal host tissue does not include cancer cells. Thus an immune response mounted against a self- antigen, in the context of an autoimmune disease, is an undesirable immune response and contributes to destruction and damage of normal tissue, whereas an immune response mounted against a cancer antigen is a desirable immune response and contributes to destruction of the tumor or cancer.
  • the invention provides a method for treating or preventing asthma or allergy. The method according to this aspect of the invention involves increasing activity or expression of TEVI-3 in a T cell of a subject to treat or prevent asthma or allergy.
  • asthma shall refer to a disorder of the respiratory system characterized by inflammation and narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively, associated with atopic or allergic symptoms.
  • allergy shall refer to acquired hypersensitivity to a substance
  • allergen Allergic conditions include eczema, allergic rhinitis or coryza, hay fever, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
  • a "subject having an allergy” is a subject that has or is at risk of developing an allergic reaction in response to an allergen.
  • An “allergen” refers to a substance that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander, dust, fungal spores and drugs (e.g., penicillin).
  • Examples of natural animal and plant allergens include proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g., Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g., Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonicd); Alternaria (Alternaria alternatd); Alder; Alnus (Alnus gultinosd); Betula (Betula verrucosd); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g., Plantago lanceolat ⁇ ); Parietaria (e.g., Parietaria off ⁇ cinalis or Parietaria judaica); Blattella (e.g., Blattella germanicd); Ap
  • the invention provides a method for treating a Th2- mediated disorder in a subject
  • the method involves expressing TEVI-3 on the surface of Th2 cells of a subject having a Th2-mediated disorder in an amount effective to treat the Th2- mediated disorder.
  • a "Th2 -mediated disorder” as used herein refers to a disease that is associated with the development of a Th2 immune response.
  • a "Th2 immune response” as used herein refers to the induction of at least one Th2-cytokine or a Th2-antibody. In preferred embodiments more than one Th2-cytokine or Th2-antibody is induced.
  • Th2-mediated disease is a disease associated with the induction of a Th2 response and refers to the partial or complete induction of at least one Th2-cytokine or Th2-antibody or an increase in the levels of at least one Th2-cytokine or Th2-antibody.
  • atopic conditions such as asthma and allergy, including allergic rhinitis, gastrointestinal allergies, including food allergies, eosinophilia, conjunctivitis, glomerulonephritis, certain pathogen susceptibilities such as helminthic (e.g., leishmaniasis) and certain viral infections, including human immunodieficiency virus (HIV), and certain bacterial infections, including tuberculosis and lepromatous leprosy.
  • helminthic e.g., leishmaniasis
  • HIV human immunodieficiency virus
  • Thl -mediated disorder refers to a disease that is associated with the development of a Thl immune response.
  • Thl immune response refers to the induction of at least one Thl -cytokine or a Thl -antibody. In preferred embodiments more than one Thl -cytokine or Thl -antibody is induced.
  • a Thl -mediated disease is a disease associated with the induction of a Thl response and refers to the partial or complete induction of at least one Thl-cytokine or Thl- antibody or an increase in the levels of at least one Thl-cytokine or Thl-antibody.
  • autoimmune disorders include for instance, but are not limited to, autoimmune (especially organ-specific) disease, psoriasis, Thl inflammatory disorders, infection with extracellular parasites (e.g., response to helminths), solid organ allograft rejection (e.g., acute kidney allograft rejection), symptoms associated with hepatitis B (HBN) infection (e.g., HBV acute phase or recovery phase), chronic hepatitis C (HCV) infection, insulin-dependent diabetes mellitus (EDDM), multiple sclerosis (MS), subacute lymphocytic thyroiditis ("silent thyroiditis”), Crohn's disease, primary biliary cirrhosis, primary sclerosing cholangitis, sarcoidosis, atherosclerosis, acute graft-versus-host disease (GvHD), glomerulonephritis, anti-glomerular basement membrane disease, Wegener's granulomatosis, inflammatory myopathies, Sj
  • the invention provides a method for promoting APC activation.
  • the method according to this aspect involves contacting a T cell with a TEVI-3- binding molecule, and contacting an APC with the T cell to activate the APC.
  • an “antigen-presenting cell” or, equivalently, an “APC” as used herein refers to a specialized cell, either belonging to the immune system or capable of interacting with a cell belonging to the immune system, that presents on its cell surface a complex between an antigen and a major histocompatability complex (MHC) molecule.
  • MHC major histocompatability complex
  • APCs frequently also provide additional costimulatory signals to lymphocytes so engaged, through cognate interactions between additional cell surface receptor/counter-receptor pairs and through secreted products, e.g., cytokines and chemokines.
  • APCs are believed to include mononuclear phagocytes (e.g., monocyte/macrophages), B lymphocytes, dendritic cells, Langerhans cells, and certain endothelial cells.
  • an APC is a macrophage.
  • an APC is a dendritic cell. It has been discovered according to the present invention, for example, that certain APCs, including macrophages and dendritic cells, express TEVI-3 ligand on their cell surface.
  • a method for inhibiting APC activation.
  • the method involves contacting an APC with an an effective amount of an agent that reduces activity or expression of TEVI-3 to inhibit activation of the APC.
  • An "agent that reduces activity or expression of TEVI-3" as used herein refers to an agent that reduces the function of TEVI-3 either by effectively blocking interaction of TEVI-3 with its ligand or by interfering with expression of TEVI-3.
  • agents can take the form of TEVi-3- binding molecules, TEVI-3 ligand-binding molecules, and antisense to TEVI-3.
  • the invention further provides a method for treating or preventing intracellular infections.
  • the method according to this aspect involves promoting macrophage activation by contacting a TEVI-3 ligand on the macrophage with a TEVI-3 expressing cell.
  • An "intracellular infection” as used herein refers to an infection by an infectious organism or agent wherein the infectious organism or agent survives and replicates within a cell of the infected host.
  • a number of bacteria, fungi, parasites, and all viruses are involved in intracellular infections.
  • Intracellular bacteria such as Listeria monocytogenes and various mycobacteria, including M. tuberculosis, are resistant to degradation within macrophages and are therefore capable of surviving and replicating within phagocytes.
  • Such intracellular bacteria normally pose a special challenge to the immune system's ability to eradicate the infecting organisms.
  • Another important example of an intracellular infection is that involving the obligate intracellular protozoa of the genus Leishmania.
  • the TEVI-3 -binding molecule and TEVI-3 ligand- binding molecule of the present invention are administered in pharmaceutically acceptable preparations.
  • Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary agents such as adjuvants and cytokines, and optionally other therapeutic agents.
  • supplementary agents such as adjuvants and cytokines
  • "cocktails" including the TEVI-3-binding molecule and TEVI-3 ligand-binding molecule and optional supplementary agents are contemplated.
  • the supplementary agents themselves can be conjugated to TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule to enhance delivery of the supplementary agents.
  • the preferred amount of TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule in all pharmaceutical preparations made in accordance with the present invention should be a therapeutically effective amount thereof which is also a medically acceptable amount thereof.
  • Actual dosage levels of TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of TEVI-3-binding molecule or TEVI-3 ligand-binding molecule which is effective to achieve the desired therapeutic response for a particular patient, pharmaceutical composition of TEVI-3-binding molecule or TEVI-3 ligand-binding molecule, and mode of administration, without being toxic to the patient.
  • the selected dosage level and frequency of administration will depend upon a variety of factors including the route of administration, the time of administration, the rate of excretion of the therapeutic agent(s) including TEVI-3-binding molecule and TEVI-3 ligand- binding molecule, the duration of the treatment, other drugs, compounds and/or materials used in combination with TEVI-3-binding molecule or TEVI-3 ligand-binding molecule, the age, sex, weight, condition, general health and prior medical history of the patient being treated and the like factors well known in the medical arts.
  • the dosage regimen is likely to vary with pregnant women, nursing mothers and children relative to healthy adults.
  • a physician having ordinary skill in the art can readily determine and prescribe the therapeutically effective amount of the pharmaceutical composition required.
  • the physician could start doses of TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule employed in the pharmaceutical composition of the present invention at levels lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • the TIM-3-binding molecule and TEVI-3 ligand-binding molecule can be formulated as pharmaceutical compositions.
  • the pharmaceutical compositions of the invention contain an effective amount of TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule, and optionally another medicament, in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier means one or more compatible solid or liquid fillers, dilutants or encapsulating substances which are suitable for administration to a human or other vertebrate animal.
  • carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application.
  • the components of the pharmaceutical compositions also are capable of being commingled with the TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.
  • Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin.
  • the pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above.
  • the pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer R (1990) Science 249:1527-33, which is incorporated herein by reference.
  • an effective amount of the TIM-3 -binding molecule or TEVI-3 ligand-binding molecule can be administered to a subject by any mode that delivers the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule either systemically or to the desired surface, e.g., skin or mucosa.
  • Administration the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan.
  • Preferred routes of administration include but are not limited to oral, parenteral, intravenous, intramuscular, intracutaneous, subcutaneous, intradermal, subdermal, transdermal, topical, intranasal, intratracheal, inhalation, ocular, vaginal, and rectal.
  • the preferred route of administration is systemic or intravenous.
  • the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule in water-soluble form. Additionally, suspensions of the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • the TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • a suitable vehicle e.g., sterile pyrogen-free water
  • the TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated.
  • compositions for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP).
  • fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol
  • cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carb
  • disintegrating agents may be added, such as the crosslinked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
  • the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.
  • Dragee cores are provided with suitable coatings.
  • suitable coatings For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers, hi soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added.
  • suitable liquids such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added.
  • Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
  • the compositions may take the form of tablets or lozenges formulated in
  • the TEVI-3-binding molecule or TEVI-3 ligand- binding molecule for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • a powder mix of the compound and a suitable powder base such as lactose or starch.
  • suitable powder base such as lactose or starch.
  • Techniques for preparing aerosol delivery systems are well known to those of skill in the art. Generally, such systems should utilize components which will not significantly impair the biological properties of the therapeutic, such as the immunomodulatory capacity of the TIM-3-binding molecule or TEVI-3 ligand-binding molecule (see, for example, Sciarra and Cutie, "Aerosols," in Remington's Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712; incorporated by reference). Those of skill in the art can readily determine the various parameters and conditions for producing aerosols without resort to undue experimentation.
  • topical administration is preferred.
  • the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule according to the invention may be formulated as ointments, gels, creams, lotions, or as a transdermal patch for iontophoresis.
  • One method for accomplishing topical administration includes transdermal administration, such as by iontophoresis.
  • Iontophoretic transmission can be accomplished by using commercially available patches which deliver a compound continuously through unbroken skin for periods of hours to days to weeks, depending on the particular patch. This method allows for the controlled delivery of the TEVI-3 -binding molecule or TEVI-3 ligand- binding molecule and/or additional medicament through the skin in relatively high
  • TM concentrations concentrations.
  • an iontophoretic patch is the LECTRO PATCH sold by General Medical Company of Los Angeles, CA.
  • the patch provides dosages of different concentrations which can be continuously or periodically administered across the skin using electronic stimulation of reservoirs containing the TEVI-3-bmding molecule or TEVI-3 ligand- binding molecule and/or additional medicament.
  • ointments, gels creams, and lotions can be formulated with an aqueous or oily base alone or together with suitable thickening and/or gelling agents.
  • Lotions can be formulated with an aqueous or oily base and, typically, further include one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents.
  • emulsifying agents include those organic and inorganic materials employed to block ultraviolet light.
  • Illustrative organic sunscreen compounds are derivatives of p- aminobenzoic acid (PABA), cinnamate, salicylate, benzophenones, anthranilates, dibenzoylmethanes, and camphores; examples or inorganic sunscreen compounds include zinc oxide and titanium dioxide.
  • PABA p- aminobenzoic acid
  • cinnamate cinnamate
  • salicylate benzophenones
  • anthranilates dibenzoylmethanes
  • camphores examples or inorganic sunscreen compounds
  • examples or inorganic sunscreen compounds include zinc oxide and titanium dioxide.
  • octyl methoxycinnamate and 2-hydroxy-4- methoxy benzophenone also known as oxybenzone
  • Octyl methoxycinnamate and 2-hydroxy-4-methoxy benzophenone are commercially available under the trademarks Parsol MCX and Benzophenone-3, respectively.
  • sunscreen examples include 2- phenylbenzimidazole-5-sulfonic acid (commercially available as Eusolex 232 from Rona), and octyldimethyl p-amino benzoic acid (octyl dimethyl PABA commercially available from Haarmann & Reimer).
  • the exact amount of sunscreen employed in the emulsions can vary depending upon the degree of protection desired from the sun's UV radiation.
  • the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides. h addition to the formulations described previously, the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule may also be formulated as a depot preparation. Such long- acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • the pharmaceutical compositions also can include suitable solid or gel phase carriers or excipients.
  • suitable solid or gel phase carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • the TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule and additional medicament may be administered per se (neat) or in the form of a pharmaceutically acceptable salt.
  • the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: acetic, benzene sulphonic, citric, formic, hydrobromic, hydrochloric, maleic, malonic, methane sulphonic, naphthalene-2-sulphonic, nitric, p-toluene sulphonic, phosphoric, salicylic, succinic, sulfuric, and tartaric.
  • such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium , salts of the carboxylic acid group.
  • Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v).
  • Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chiorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
  • Pharmaceutical compositions may be conveniently presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.
  • All methods include the step of bringing the TEVI-3 -binding molecule or TEVI-3 ligand-binding molecule into association with a carrier which constitutes one or more accessory ingredients.
  • the compositions are prepared by uniformly and intimately bringing the TEVI-3- binding molecule or TEVI-3 ligand-binding molecule into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.
  • Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the TEVI-3-binding molecule or TEVI-3 ligand-binding molecule of the invention, increasing convenience to the subject and the physician.
  • Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as polytactic and polyglycolic acid, polyanhidrides and polycaprolactone; wax coatings, compressed tablets using conventional binders and excipients, and the like.
  • Bioadhesive polymer systems to enhance delivery of a material to the intestinal epithelium are known and described in published PCT application WO 93/21906.
  • compositions for delivering agents to the intestinal epithelium also are described in published PCT application WO 93/19660.
  • the compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may for example include metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • Thl -Specific mAb To identify new Thl-specific cell surface proteins, Lewis and Lou/M rats were immunized with Thl T cell clones and lines, including the established Thl-specific clone AE7 and in vitro differentiated Thl cell lines derived from 5B6 (Waldner H et al. (2000) Proc Natl Acad Sci USA 97:3412-17) and DO 11.10 TCR transgenic mice. Lewis and Lou/M female rats (Harlan Sprague-Dawley, Inc.) were immunized three times by a combination of subcutaneous (s.c.) injection with either l-5xl0 7 Thl-polarized T cell clones and/or lines.
  • s.c. subcutaneous
  • the rats were boosted and four days later spleen cells were fused with myeloma cells (ATCC No. CRL8006) using polyethylene glycol 1450 and selection in HAT medium. Kohler G et al. (1975) Nature 256:495-97. A panel of approximately 20,000 monoclonal antibodies (mAb) was generated. The supernatants from the fusion plate wells were screened by flow cytometry on Thl and Th2 T cells. All hybridoma wells that gave a positive shift on Thl, but not Th2, T cell clones were expanded and subcloned twice by limiting dilution. Two of the mAbs that selectively stained Thl cells, 8B.2C12 and 25F.1D6, were further characterized. These mAbs recognize a cell surface protein present on established CD4+ Thl cells and CD8+ Tel cells, but absent on CD4+ Th2 cells and CD8+ Tc2 cells (Fig. 1 A).
  • Example 2 Cloning of TIM-3.
  • a eukaryotic expression library was constructed using mRNA from the AE7 Thl clone and the pAXF vector. Library screening was carried out by expression cloning according to the method developed by Seed. Seed B et al. (1987) Proc Natl Acad Sci USA 84:3365-69. hnmunoselected individual plasmids were transfected into COS cells followed by indirect immunofiuorescence staining with anti-TEVI-3 antibody. Positive clones were sequenced.
  • a murine cDNA was identified that encodes a type I membrane protein of 281 amino acids with the following regions: an extracellular domain consisting of an IgV-like domain followed by a mucin-like domain consisting of 31% serine and threonine residues; a transmembrane region; and a cytoplasmic region (Fig. IB).
  • This gene product expressed by the cDNA was named TEVI-3, T cell Enmunoglobulin and Mucin domain containing molecule.
  • the cytoplasmic region contains six tyrosines, one of which is part of a tyrosine phosphorylation motif, RSEENIY (SEQ ID NO:7).
  • the extracellular domain contains four sites for N-linked glycosylation and five sites for O-linked glycosylation.
  • TEVI-3 The human homologue of TEVI-3 was identified through genomic database searches and reverse transcriptase-polymerase chain reaction (RT-PCR). It has 63% amino acid identity to murine TEVI-3 overall with 77% identity in the cytoplasmic domain, including conservation of the tyrosine phosphorylation site (Fig. IB). Database searches revealed that TEVI-3 is related to Kidney ijury Molecule-1 (KIM- 1)/H AVer- 1 , the receptor for human hepatitis A virus, and TIM-2. All three family members (KEVI-1, TEVI-2 and TEVI-3) have a similar Ig/mucin structure, and their genes are located on human chromosome 5q33.2 and mouse chromosome 11. Mcfritire JJ et al. (2001) Natlmmunol 2:1109-1116.
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • Example 3 Expression of TIM-3 in vitro.
  • a TIM-3 cDNA expression construct was used to stably transfect Chinese Hamster Ovary (CHO) cells. Flow cytometry and immunoprecipitation analysis of the stable transfectants confirmed that the cloned protein is TEVI-3 and that it is expressed at the cell surface (Fig. 1C).
  • TEVI-3 transcripts were present at the highest level only in Thl cells, although in vivo-derived CDllb+ cells also showed low-level expression (Fig. ID).
  • Flow cytometric analysis using anti-TEVI-3 antibodies confirmed that TEVI-3 is not expressed on naive T cells, B cells, macrophages or dendritic cells.
  • na ⁇ ve DO11.10 TCR transgenic T cells were activated in vitro under Thl- or Th2-polarizing conditions. After each round of restimulation, Thl and Th2 cells were stimulated with PMA/ionomycin for the induction of cytokines and then stained with mAbs to TEVI-3 and CD4, and cytokine expression was detected by intracellular staining.
  • TEVI-3 was not observed on Th2 cells but was detectable on Thl cells after the third round of in vitro polarization (Fig. 2).
  • TEVI-3 is therefore expressed at a late stage of T-cell differentiation, suggesting that TIM-3 may not contribute to T-cell differentiation per se but can play a role in the trafficking and/or effector functions of Thl cells.
  • Example 5 Expression of TIM-3 in EAE. Expression of TEVI-3 was then examined during the development of EAE, a Thl-mediated autoimmune disease of the CNS. EAE- susceptible SJL mice were immunized with the encephalitogenic proteolipid protein (PLP) 139-151 peptide HSLGKWLGHPDKF (SEQ ID NO:8; Quality Controlled Biochemicals). Female SJL mice (4-8 weeks old) (The Jackson Laboratory) were injected s.c.
  • PBP proteolipid protein
  • mice were examined daily for signs of EAE, which were graded as follows: flaccid tail, 1; uneven gait and impaired righting reflex, 2; total hindlimb paralysis, 3; fore- and hindlimb paralysis, 4; and moribund, 5. Mice were scored for disease and sacrificed at various time points following immunization, and spleen, brain and lymph nodes were removed and tested for the expression of TEVI-3.
  • RT-QPCR Real-time reverse transcriptase-quantitative polymerase chain reaction
  • Total RNA was isolated by TRIzol and treated with DNase I.
  • RNA was converted to cDNA by reverse transcription, and 10 ng of cDNA was used for Taqman® PCR.
  • the expression levels of TIM-3 and internal reference glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) were measured by multiplex PCR using probes labeled with 6-carboxyfluorescein (FAM) or VIC® (Applied Biosystems), respectively.
  • FAM 6-carboxyfluorescein
  • VIC® Applied Biosystems
  • TEVI-3 primers and probes were designed in the 3* UTR of the 2.8 kb transcript using Primer Express vl .0 software (Applied Biosystems).
  • the GAPDH primer/probe set was purchased from Applied Biosystems.
  • the following TEVI-3-specific primers and probe were employed for TEVI-3: forward primer: CAAGCCGGTGGACCTCAGT (SEQ ID NO:9); reverse primer: AGATGGGAGCCAGCACAG (SEQ ID NO: 10); probe: AGCTGCCTGCCCAGTGCCCTT (SEQ ID NO: 11).
  • PCRs were performed using the Taqman® Universal PCR Master Mix and the ABI PRISM 7700 Sequence Detection System.
  • a comparative threshold cycle (C T ) was used to determine gene expression relative to the no- tissue control (calibrator). Hence steady-state mRNA levels were expressed as an n-fold difference relative to the calibrator.
  • ⁇ C CTTM-3-CT GAPDH - TO determine relative expression levels
  • ⁇ Cj ⁇ c ⁇ (i) S ampie- ⁇ c ⁇ (i Calibrator
  • ⁇ CT ⁇ CT .
  • Fig. 3 A shows expression of TEVI-3 RNA relative to control GAPDH expression.
  • TEVI-3 mRNA was demonstrated to be upregulated in the lymph node following immunization, with expression peaking at day 7 post-immunization, just prior to EAE onset. Expression in the lymph nodes was then downregulated as the disease progressed. In the brain, TEVI-3 mRNA expression steadily increased and peaked at the beginning of the disease (around day 10-13). TIM-3 mRNA expression was then downregulated to near basal levels at the maximal disease score (Fig. 3A). This expression pattern was confirmed at the protein level by flow cytometric (FACS) analysis (Fig. 3B).
  • FACS flow cytometric
  • TEVI-3 On day 10, cells from brain, spleen and lymph nodes were stained with mAbs to TEVI-3, CD4, CD8, CDl lb, CD 19 and B220. Histograms represent TEVI-3 expression on different cell populations (dotted line, isotype control; solid line, specific staining). Whereas TEVI-3 was expressed on very few CD4+ T cells ( ⁇ 2%) in the periphery following immunization, TEVI-3 was specifically expressed on the majority of CD4+ and CD8+ T cells present in the CNS at the onset of clinical signs of disease (Fig. 3B). The number of TEVI-3+ T cells decreased in the CNS as the disease progressed. These data suggest that TEVI-3 is expressed in vivo on T cells and plays an important role in the initiation of EAE. These data further suggest that
  • TEVI-3 expression on differentiated Thl cells allows Thl cells preferentially to infiltrate CNS tissue and that TEVI-3-expressing cells have an advantage for expansion in the CNS.
  • Example 6 Hyperacute EAE Following Administration of Anti-TIM-3.
  • SJL mice previously immunized with PLP 139-151 peptide were administered anti-TEVI-3 antibody or isotype-matched control rat Ig (rIgG2a) and observed for the development of EAE.
  • Female SJL mice (4-8 weeks old) (The Jackson Laboratory) were injected s.c.
  • mice were also injected i.v. with 100 ng of pertussis toxin (List Biological Laboratories) in 0.1 mL of PBS. Mice were injected intraperitoneally (i.p.) every other day beginning on day 0 and continuing for 10-16 days with either 100 ⁇ g anti-TEVI-3 (endotoxin activity of 0.2 to 0.8 EU/mg) or 100 ⁇ g control rlgG or PBS. Mice were examined daily for signs of EAE, which were graded as described above. At the peak of the disease or at the end of the experiment, brains and spinal cords were removed and fixed in 10% formalin and examined histopathologically for inflammation and demyelination.
  • mice treated with anti-TEVI-3 developed a hyperacute and atypical EAE, with increased weight loss, malaise, ataxia and paralysis of the forelimbs, without hindlimb paralysis and while sometimes retaining tail tone. While disease onset was normal in the group treated with anti-TEVI-3 antibody, disease progression was accelerated and resulted in significantly more severe clinical disease and increased mortality compared to the control group treated with rIgG2a (Table 1).
  • the anti-TEVI-3-treated mice generally showed typical findings of acute EAE, but with increased numbers of inflammatory foci both in the meninges and parenchyma compared to the control rIgG2a-treated group (Table 1).
  • Anti-TEVI-3 -treated animals that were sacrificed immediately after the onset of clinical signs showed a preponderance of neutrophils and mononuclear cells in the CNS inflammatory infiltrates with focal perivascular fibrin deposition, indicating vascular damage and a hyperacute inflammatory response (Fig. 4A, 4B).
  • anti-TEVI-3 -treated animals that were sacrificed at 30 days showed more extensive demyelinating lesions compared to rIgG2a-treated animals
  • Fig. 4C, 4D versus Fig. 4E, 4F The demyelinating lesions in anti-TEVI-3 -treated mice were filled with activated macrophages with detectable phagocytosed myelin fragments (Fig. 4D, inset). It has previously been shown that activated macrophages are the primary cells responsible for demyelination in EAE (Gordon EJ et al. (1995) J Neuroimmunol 62:153-60), and that depletion of activated macrophages leads to an inhibition of EAE. Tran EH et al. (1998) J Immunol 161 :3767-75. Thus, it is the applicants' belief that activated macrophages induced by anti-TEVI-3 antibody treatment are responsible for the hyperacute disease phenotype and enhanced inflammation and demyelination.
  • Example 7 Anti-TIM-3 -Mediated Activation and Proliferation ofCDllb+ Cells in vitro.
  • EAE-prone female SJL mice (4-8 weeks old) were injected s.c. in each flank with 50 ⁇ g of PLP 139-151 emulsified in CFA and injected i.p. every other day with either 100 ⁇ g anti- TEVI-3 or 100 ⁇ g control rlgG or PBS. Mice were sacrificed on day 10, and spleens were removed and spleen cells were isolated.
  • the spleen cells were plated at 5x10 5 cells/well in round-bottom 96-well plates and stimulated for 48 hrs with increasing concentrations (0-100 ⁇ g/mL) of PLP 139-151 or neuraminidase 101-120 peptide
  • EALVRQGLAKVAYVYKPNNT SEQ ID NO: 12; Nase; Quality Controlled Biochemicals
  • Plates were then pulsed with 1 ⁇ Ci 3 [H]-thymidine/per well for 12 hrs.
  • the incorporated radiolabeled thymidine was measured utilizing a Beta Plate scintillation counter (Wallac).
  • spleen cells from control rIgG2a-treated mice showed a low basal (background) proliferative response (1000-5000 cpm) and a dose-dependent increase in proliferation with the addition of specific antigen
  • the spleen cells from anti-TEVI-3 -treated mice had 6-10 times the basal response in the absence of antigen, although the response to specific antigen was similar (Fig. 5A).
  • Flow cytometric analysis of spleen cells from anti- TEVI-3-treated mice revealed a 2-3 fold increase in CDl lb+ cell population, i.e., the population of cells that includes predominantly monocyte/macrophages.
  • T cells and non-T cells were purified from the spleen cells of the anti-TEVI-3- and rIgG2a-treated mice. Either whole splenocytes or T cells (10 5 ) were incubated in the presence or absence of either 2xl0 5 B cells, 2xl0 5 CDl lb+ cells, or irradiated splenocytes, and the proliferative response was measured ( 3 H- thymidine incorporation in triplicate wells).
  • Example 9 Cognate Interaction Between T Cells and Non-T Cells. To determine whether a cognate interaction was required between T cells and non-T cells for the increase in the basal responses, in a separate set of experiments T cells and non-T cells were separated with a permeable 0.2 ⁇ m Anapore membrane that inhibits cell contact, and proliferative responses were measured. As also shown in Fig. 5C (gray bars), separation of anti-TEVI-3 - treated T cells from anti-TEVI-3-treated non-T cells resulted in a dramatic decrease in the proliferative responses, indicating that a cognate interaction between T cells and non-T cells is necessary.
  • Example 10 TIM-3 -Expressing T Cells Regulate the Expansion and Activation of APCs.
  • 5x10 TEVI-3+ Thl 5B6 transgenic T cells (with specificity for PLP 139-151) were adoptively transfened to na ⁇ ve SJL recipients, which were then also immunized with PLP 139-151 and treated with anti-TEVI-3 or anti-ICOS antibody (as a T-cell antibody binding control) on days 0 and 2.
  • Spleen cells were removed on day 3 and the cells were stained with mAbs to CDl lb, F4/80, B220 and MHC class II.
  • Anti-TEVI-3 may cross-link TEVI-3 protein on the surface of differentiated Thl cells in vivo and amplify the production of pro-inflammatory cytokines (e.g., IFN- ⁇ and TNF), which in turn may induce activation of macrophages;
  • pro-inflammatory cytokines e.g., IFN- ⁇ and TNF
  • anti-TEVI-3 antibody could enhance migration of differentiated Thl cells into the brain where these cells may increase the cellular influx of macrophages from the circulation;
  • anti-TEVI-3 could block a cognate interaction of TEVI-3 with its potential inhibitory ligand on macrophages, thus leading to enhanced macrophage activation in the presence of pro-inflammatory cytokines produced by Thl cells. It is to be understood that these different possible mechanisms of action are not necessarily mutually exclusive, nor are they to be understood to exclude any other mechanism of action.
  • TEVI-3 since Thl cells and Th2 cells cross-regulate each other's functions, expression of TEVI-3 on Thl cells and subsequent trafficking of TEVI-3-bearing Thl cells to target tissue sites is believed also to have a role in the regulation of asthma and atopy.
  • TEVI-3 in addition to being a molecule that is selectively expressed on the surface of Thl cells, plays a functional role in macrophage activation and increased severity of an autoimmune disease.
  • TIM-3 Promotes Trafficking of Thl Cells to Target Tissues.
  • TEVI-3 has a role in trafficking of effector Thl cells. More specifically, TEVI-3 expression promotes trafficking of Thl cells into sites of inflammation and into the target tissues where they can mediate tissue injury and autoimmunity. Thus affecting the expression of TBVI-3 on the surface of Thl cells or interaction of TEVI-3 with its ligand might either inhibit or enhance the trafficking of the Thl cells into the tissue sites to mediate immune response and inflammation. The following experiment was performed to test the hypothesis that expression of
  • TEVI-3 promotes trafficking of differentiated Thl cells to target tissue.
  • PLP 139-151 specific transgenic T cells derived from 5B6 transgenic mice were activated and polarized under Thl conditions. All the cells were tested for TEVI-3 expression by FACS staining. The activated, polarized T cells were harvested 10 days after the final activation and stained with the dye 5,6-carboxyfluorescein diacetate succinimidyl ester (CFSE), which marks these cells and which dilutes as the cells divide.
  • CFSE 5,6-carboxyfluorescein diacetate succinimidyl ester
  • the 5B6 Thl cells were incubated at room temperature in PBS supplemented with 3 ⁇ M CFSE (Molecular Probes, Eugene, OR) at lxl 0 7 cells/mL for 5-10 min.
  • the cells were subsequently washed in RPMI, resuspended in PBS, and transferred (lxl 0 7 cells/mouse) into naive syngeneic recipients.
  • the recipients were then immunized with the PLP 139-151 peptide in CFA and were also given 100 ⁇ g of anti-TEVI-3 or control antibodies (anti-ICOS or anti-ICOSL) every other day during the course of the experiment.
  • the mice were sacrificed on day 3 and day 7, and the presence and number (percentage) of CFSE-labeled cells were analyzed in the lymph nodes, spleens and brains of the transferred mice by flow cytometry.
  • the CFSE-labeled cells were detected only in the spleens and not in the lymph nodes or brains of the transferred recipients (Fig. 6A). However, on day 7 in the group treated with anti-TEVI-3 antibody, the vast majority of CFSE-labeled cells were detected in the brains with a decrease in the number of CFSE-labeled cells in the spleen (Fig. 6B). In contrast, in the control antibody-treated groups the vast majority of the CFSE-labeled cells were still detected in the spleens of these mice and very few cells were detected in the brains of these mice (Fig. 6B). The results of this experiment suggest that anti-TIM-3 antibody treatment in vivo accelerates migration and trafficking of the TTM-3-expressing T cells into tissue sites including the CNS and thus enhances EAE induction.
  • Example 12 TIM-3 Ligand Ls Expressed on APCs. To further elucidate the mechanism for activation of macrophages and CDllb+ cells by crosslinking of TEVI-3 on Thl cells, an experiment was performed to establish the presence of a ligand or receptor for TEVI-3 expressed on macrophages and other CDl lb+ cell. A soluble TEVI-3Ig fusion protein was prepared, in which TEVI-3 was genetically fused with human immunoglobulin constant region. This soluble protein was biotinylated and used in flow cytometry experiments to identify the ligand for TIM-3 on various cell types. As shown in Fig.
  • Example 13 Soluble TLM-3.
  • Full-length and alternatively spliced forms of murine TEVI-3 were isolated using a RT-PCR based approach.
  • Primers were designed in the 5' and 3' untranslated region (UTR) of the murine TEVI-3 gene, and subjected to PCR using cDNA generated from concanavalin A activated splenocytes.
  • the predicted amino acid translation of the lkb amplicon demonstrated an open reading frame consisting of a signal peptide, IgN, mucin, transmembrane, and cytoplasmic domains, hi contrast, analysis of the open reading frame from the 800bp product demonstrated the presence of only the signal peptide, IgN, and cytoplasmic domains.
  • a deduced amino acid sequence for the alternatively spliced, soluble form of TIM-3 is provided as SEQ D NO: 13.
  • Example 14 Soluble TIM-3 Fusion Protein Construction. Two fusion proteins containing extracellular portions of mouse TIM-3 fused to a human Fc tail were constructed to identify potential TIM-3 ligand(s) and to determine the functional role of TIM-3 ligand in regulating T-cell responses. One construct, mTIM-3/hFc fusion protein, contains the entire extracellular portion of mouse TIM-3 (IgN and mucin domains) fused to a human Fc tail. A second construct, mTIM-3Ig/hFc fusion protein, contains only the IgV domain of mouse TIM-3 fused to a human Fc tail.
  • This second fusion protein was constructed as the data suggesting the alternatively spliced form of TIM-3 containing only the signal peptide, IgV, and cytoplasmic domains suggests that this secreted form of TIM-3 may have an Ig-specific ligand.
  • These two fusion proteins being TIM-3 ligand-binding molecules, can be used to identify and interact with TEVI-3 ligand.
  • Example 15 Hyperacute EAE Following Administration of Soluble TIM-3.
  • EAE autoimmune encephalomyehtis
  • SJL mice were immunized with 50 ⁇ g PLP 139-151 in complete Freund's adjuvant (CFA) plus 100 ng of pertussis toxin intravenously and treated with intraperitoneal administration 100 ⁇ g of mTIM-3/hFc or 100 ⁇ g of mTIM-3Ig/hFc or 100 ⁇ g of human IgG (control) or 100 ⁇ l PBS every other day from day 0-10.
  • CFA complete Freund's adjuvant
  • mice treated with either mTEVI-3Ig/hFc or mTIM-3/hFc developed a more severe form of EAE, as demonstrated by both disease severity and mortality (see Table 2).
  • Mice treated with mTEVI-3/hFc had an average disease score of 2.69 versus an average disease score of 1.86 and 1.89 for hlgG- and PBS-freated controls, respectively.
  • Mice treated with mTEVI-3/hFc also exhibited increased mortality- 31.3% versus 5.8% and 5.6% for hlgG- and PBS-treated controls, respectively.
  • mice that were immunized and treated with fusion protein or control as described in Example 15 were sacrificed on day 10, and spleens were removed.
  • Whole spleen cells were plated at 5x10 5 cells/well for a proliferation assay measured by thymidine incorporation. While basal proliferation for hlgG- and PBS-treated controls was low (approximately 10,000 cpm), spleen cells from mice treated with mTEVI-3/hFc (approximately 60,000 cpm) or mTEVI-3Ig/hFc (approximately 140,000 cpm) proliferated at very high levels without peptide restimulation (Figure 8A).
  • mice were treated with anti-TEVI-3 antibody Cytokine production was measured by sandwich ELISA on supernatants taken at 48h.
  • Mice treated with mTIM-3/hFc produced high levels of EFN- ⁇ (4111 pg/ml) and IL-2 (592 pg/ml), while hlgG- and PBS-treated controls did not produce any IFN- ⁇ or IL-2 ( Figure 8B).
  • Mice treated with mTEVI-3/hFc also produced three times more IL-4 than hlgG-treated controls ( Figure 8B).
  • Example 17 Use of Soluble TIM-3 to Identify TIM-3 Ligand.
  • the mTIM-3/hFc and mTIM-3Ig/hFc fusion proteins were used for staining naive spleen cells from SJL, NOD, BALB/c and C57BL/6 mice. Individual populations of spleen cells were identified by co-staining with appropriately selected cell surface markers. Flow cytometric analysis revealed that mTIM-3Ig/hFc specifically stained naive and activated CD4+ T cells. Thus one potential ligand for the alternatively spliced, soluble form of TIM-3 appeared to be expressed on CD4+ T cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Diabetes (AREA)
  • Pulmonology (AREA)
  • Endocrinology (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Neurology (AREA)
  • Hematology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Neurosurgery (AREA)
  • Oncology (AREA)
  • Pain & Pain Management (AREA)
  • Biomedical Technology (AREA)
  • Obesity (AREA)
  • Communicable Diseases (AREA)
  • Emergency Medicine (AREA)
PCT/US2003/002919 2002-01-30 2003-01-30 Compositions and methods related to tim-3, a th1-specific cell surface molecule Ceased WO2003063792A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA2474497A CA2474497C (en) 2002-01-30 2003-01-30 Compositions and methods related to tim-3, a th1-specific cell surface molecule
EP21197088.4A EP4091631A1 (en) 2002-01-30 2003-01-30 A tim-3 binding molecule for use in the treatment of a disease
EP03723627A EP1467759A4 (en) 2002-01-30 2003-01-30 COMPOSITIONS AND METHODS ASSOCIATED WITH TIM-3, TH1-SPECIFIC CELL SURFACE MOLECULE
AU2003303082A AU2003303082B2 (en) 2002-01-30 2003-01-30 Compositions and methods related to TIM-3, a Th1-specific cell surface molecule
JP2003563488A JP4694128B2 (ja) 2002-01-30 2003-01-30 TIM−3、Th1特異的細胞表面分子に関連した組成物および方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US35310702P 2002-01-30 2002-01-30
US60/353,107 2002-01-30

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP15155007.6A Previously-Filed-Application EP3020413A1 (en) 2002-01-30 2003-01-30 Compositions and methods related to TIM-3, a TH1-specific cell surface molecule

Publications (3)

Publication Number Publication Date
WO2003063792A2 true WO2003063792A2 (en) 2003-08-07
WO2003063792A8 WO2003063792A8 (en) 2003-10-16
WO2003063792A3 WO2003063792A3 (en) 2004-04-01

Family

ID=27663176

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2003/002919 Ceased WO2003063792A2 (en) 2002-01-30 2003-01-30 Compositions and methods related to tim-3, a th1-specific cell surface molecule

Country Status (6)

Country Link
US (7) US7470428B2 (https=)
EP (3) EP1467759A4 (https=)
JP (2) JP4694128B2 (https=)
AU (2) AU2003303082B2 (https=)
CA (1) CA2474497C (https=)
WO (1) WO2003063792A2 (https=)

Cited By (93)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005033144A3 (en) * 2003-10-03 2005-06-16 Brigham & Womens Hospital Tim-3 polypeptides
JP2008506637A (ja) * 2004-06-14 2008-03-06 ザ・ボード・オブ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・イリノイ 胎児起源の細胞に対する抗体
EP1740224A4 (en) * 2004-03-24 2008-07-02 Telos Pharmaceuticals Llc ADJUVANT COMPOSITIONS ENHANCING IMMUNE RESPONSE TO VACCINES AND METHODS OF USE
WO2008060617A3 (en) * 2006-11-15 2008-12-24 Brigham & Womens Hospital Therapeutic uses of tim-3 modulators
US7741271B2 (en) 2004-03-12 2010-06-22 The Brigham And Women's Hospital, Inc. Methods of modulating immune responses by modulating tim-1, tim-2 and tim-4 function
WO2010117057A1 (ja) 2009-04-10 2010-10-14 協和発酵キリン株式会社 抗tim-3抗体を用いた血液腫瘍治療法
WO2009097394A3 (en) * 2008-01-29 2010-12-23 The Brigham And Women's Hospital, Inc. Methods for modulating a population of myeloid-derived suppressor cells and uses thereof
WO2011155607A1 (ja) 2010-06-11 2011-12-15 協和発酵キリン株式会社 抗tim-3抗体
JP2012102096A (ja) * 2004-03-31 2012-05-31 Univ De La Mediterranee 膵構造から誘導される糖ペプチド、抗体ならびに診断および治療におけるそれらの応用
EP2212350B1 (en) * 2007-10-26 2013-08-28 Governing Council of the University of Toronto Treating chronic viral infection by targetting TIM-3
WO2016071448A1 (en) * 2014-11-06 2016-05-12 F. Hoffmann-La Roche Ag Anti-tim3 antibodies and methods of use
WO2017019897A1 (en) * 2015-07-29 2017-02-02 Novartis Ag Combination therapies comprising antibody molecules to tim-3
US9605070B2 (en) 2014-01-31 2017-03-28 Novartis Ag Antibody molecules to TIM-3 and uses thereof
WO2017055484A1 (en) 2015-09-29 2017-04-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for determining the metabolic status of lymphomas
WO2017055404A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for pd1 and tim3
WO2017118634A1 (en) 2016-01-04 2017-07-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of pd-1 and tim-3 as a measure for cd8+ cells in predicting and treating renal cell carcinoma
US9803017B2 (en) 2013-07-05 2017-10-31 University Of Washington Through Its Center For Commercialization Soluble MIC neutralizing monoclonal antibody for treating cancer
WO2017214943A1 (zh) * 2016-06-16 2017-12-21 毛侃琅 促进 tim-3 基因表达的慢病毒表达载体及其应用
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
WO2018036561A1 (en) * 2016-08-26 2018-03-01 Beigene, Ltd. Anti-tim-3 antibodies and use thereof
CN107847589A (zh) * 2015-04-01 2018-03-27 安奈普泰斯生物有限公司 针对t细胞免疫球蛋白和粘蛋白蛋白3(tim‑3)的抗体
WO2018085698A1 (en) 2016-11-04 2018-05-11 Aximmune, Inc. Beta-alethine, immune modulators, and uses thereof
US9988452B2 (en) 2014-10-14 2018-06-05 Novartis Ag Antibody molecules to PD-L1 and uses thereof
WO2018129261A1 (en) 2017-01-05 2018-07-12 Brown University Methods and compositions relating to anti-chi3l1 antibody reagents
US10077306B2 (en) 2016-07-14 2018-09-18 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
WO2018172508A1 (en) 2017-03-24 2018-09-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2018204303A1 (en) 2017-05-01 2018-11-08 The Children's Medical Center Coporation Methods and compositions relating to anti-pd1 antibody reagents
EP3265486A4 (en) * 2015-03-06 2018-11-14 Sorrento Therapeutics, Inc. Antibody therapeutics that bind tim3
WO2019134946A1 (en) 2018-01-04 2019-07-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma resistant
WO2019143607A1 (en) 2018-01-16 2019-07-25 Bristol-Myers Squibb Company Methods of treating cancer with antibodies against tim3
WO2019162325A1 (en) 2018-02-21 2019-08-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of sk1 as biomarker for predicting response to immunecheckpoint inhibitors
US10570204B2 (en) 2013-09-26 2020-02-25 The Medical College Of Wisconsin, Inc. Methods for treating hematologic cancers
US10639368B2 (en) 2016-05-27 2020-05-05 Agenus Inc. Anti-TIM-3 antibodies and methods of use thereof
WO2020104496A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Bispecific antibody targeting transferrin receptor 1 and soluble antigen
WO2020104479A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers and resistant cancers with anti transferrin receptor 1 antibodies
WO2020115261A1 (en) 2018-12-07 2020-06-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2020120592A1 (en) 2018-12-12 2020-06-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating melanoma
WO2020127885A1 (en) 2018-12-21 2020-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions for treating cancers and resistant cancers
WO2020127411A1 (en) 2018-12-19 2020-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers by immuno-modulation using antibodies against cathespin-d
WO2020157131A1 (en) 2019-01-30 2020-08-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for identifying whether a subject suffering from a cancer will achieve a response with an immune-checkpoint inhibitor
WO2020161083A1 (en) 2019-02-04 2020-08-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating blood-brain barrier
WO2020165370A1 (en) 2019-02-13 2020-08-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for selecting a cancer treatment in a subject suffering from cancer
US10752687B2 (en) 2014-01-24 2020-08-25 Novartis Ag Antibody molecules to PD-1 and uses thereof
WO2020221796A1 (en) 2019-04-30 2020-11-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2020227431A1 (en) 2019-05-06 2020-11-12 Brown University Bispecific antibodies against chi3l1 and pd1 with enhanced t cell-mediated cytotoxic effects on tumor cells
EP3789402A1 (en) 2014-11-20 2021-03-10 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
WO2021048292A1 (en) 2019-09-11 2021-03-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2021064180A1 (en) 2019-10-03 2021-04-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating macrophages polarization
WO2021074391A1 (en) 2019-10-17 2021-04-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosing nasal intestinal type adenocarcinomas
WO2021077794A1 (zh) * 2018-10-25 2021-04-29 浙江大学 可溶性Tim-3重组蛋白及其突变型蛋白的制备和应用
WO2021083959A1 (en) 2019-10-29 2021-05-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating uveal melanoma
WO2021123243A1 (en) 2019-12-19 2021-06-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and vaccine compositions to treat cancers
WO2021144426A1 (en) 2020-01-17 2021-07-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2021156360A1 (en) 2020-02-05 2021-08-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for discontinuing a treatment with a tyrosine kinase inhibitor (tki)
WO2021170777A1 (en) 2020-02-28 2021-09-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosing, prognosing and managing treatment of breast cancer
US11214615B2 (en) 2017-07-28 2022-01-04 Phanes Therapeutics, Inc. Anti-TIM-3 antibodies and uses thereof
WO2022023379A1 (en) 2020-07-28 2022-02-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for preventing and treating a cancer
US11285207B2 (en) 2017-04-05 2022-03-29 Hoffmann-La Roche Inc. Bispecific antibodies specifically binding to PD1 and LAG3
WO2022084531A1 (en) 2020-10-23 2022-04-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating glioma
EP3991749A2 (en) 2015-07-14 2022-05-04 Kyowa Kirin Co., Ltd. A therapeutic agent for a tumor comprising an ido inhibitor administered in combination with an antibody
WO2022101484A1 (en) 2020-11-16 2022-05-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating uveal melanoma
WO2022101481A1 (en) 2020-11-16 2022-05-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating uveal melanoma
US11344620B2 (en) 2014-09-13 2022-05-31 Novartis Ag Combination therapies
US11413331B2 (en) 2017-04-03 2022-08-16 Hoffmann-La Roche Inc. Immunoconjugates
WO2022194908A1 (en) 2021-03-17 2022-09-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2022223791A1 (en) 2021-04-23 2022-10-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cell senescence accumulation related disease
US11623953B2 (en) 2017-02-27 2023-04-11 Caerus Therapeutics, Inc. Antibody constructs and methods of treating cancer
WO2023078900A1 (en) 2021-11-03 2023-05-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating triple negative breast cancer (tnbc)
WO2023118165A1 (en) 2021-12-21 2023-06-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
US11753472B2 (en) 2016-11-01 2023-09-12 Tesaro, Inc. Antibodies directed against T cell immunoglobulin and mucin protein 3 (TIM-3)
WO2024033400A1 (en) 2022-08-10 2024-02-15 Institut National de la Santé et de la Recherche Médicale Sk2 inhibitor for the treatment of pancreatic cancer
WO2024033399A1 (en) 2022-08-10 2024-02-15 Institut National de la Santé et de la Recherche Médicale Sigmar1 ligand for the treatment of pancreatic cancer
US11926665B2 (en) 2017-01-09 2024-03-12 Tesaro, Inc. Methods of treating cancer with anti-TIM-3 antibodies
WO2024056716A1 (en) 2022-09-14 2024-03-21 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical compositions for the treatment of dilated cardiomyopathy
WO2024084034A1 (en) 2022-10-21 2024-04-25 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical compositions for the treatment of osteoarthritis
WO2024161015A1 (en) 2023-02-03 2024-08-08 Institut National de la Santé et de la Recherche Médicale Method to treat age-related diseases
WO2024200571A1 (en) 2023-03-28 2024-10-03 Institut National de la Santé et de la Recherche Médicale Method for discriminating mono-immunotherapy from combined immunotherapy in cancers
WO2024231384A1 (en) 2023-05-10 2024-11-14 Institut National de la Santé et de la Recherche Médicale Compositions for treating senescence related disease
WO2024236156A1 (en) 2023-05-17 2024-11-21 Institut National de la Santé et de la Recherche Médicale Anti-cathepsin-d antibodies
WO2024245951A1 (en) 2023-05-26 2024-12-05 Institut National de la Santé et de la Recherche Médicale Combination of slc8a1 inhibitor and mitochondria-targeted antioxidant for treating melanoma
WO2024256635A1 (en) 2023-06-15 2024-12-19 Institut National de la Santé et de la Recherche Médicale Dpm1 inhibitor for treating cancer
US12252535B2 (en) 2014-03-14 2025-03-18 Novartis Ag Antibody molecules to LAG-3 and uses thereof
WO2025068180A1 (en) 2023-09-25 2025-04-03 Institut National de la Santé et de la Recherche Médicale Methods of treatment of cancer by targetting cancer - associated fibroblasts
WO2025073765A1 (en) 2023-10-03 2025-04-10 Institut National de la Santé et de la Recherche Médicale Methods of prognosis and treatment of patients suffering from melanoma
WO2025078632A1 (en) 2023-10-12 2025-04-17 Institut National de la Santé et de la Recherche Médicale Methods of prognosis and treatment of patients suffering from cancer
WO2025132479A1 (en) 2023-12-18 2025-06-26 Institut National de la Santé et de la Recherche Médicale Flt3 inhibitor for modulating macrophages polarization
WO2025132770A1 (en) 2023-12-22 2025-06-26 Institut National de la Santé et de la Recherche Médicale Affitins for the treatment of cancer
WO2025210123A1 (en) 2024-04-03 2025-10-09 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for treating cancers
WO2025219330A1 (en) 2024-04-15 2025-10-23 Institut National de la Santé et de la Recherche Médicale Detection of ppix for use in methods for melanoma ferroptosis sensitivity and targeted therapy resistance prediction
WO2025228998A1 (en) 2024-04-30 2025-11-06 Institut National de la Santé et de la Recherche Médicale Use of hdac4 inhibitors for the treatment of melanoma
WO2025247829A1 (en) 2024-05-27 2025-12-04 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for treating prostate cancer
WO2026013071A1 (en) 2024-07-09 2026-01-15 Institut National de la Santé et de la Recherche Médicale Setdb1 inhibitor for use in the treatment of uveal melanoma
US12600777B2 (en) 2015-07-29 2026-04-14 Novartis Ag Combination therapies comprising antibody molecules to LAG-3

Families Citing this family (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2258793T5 (es) * 1996-05-24 2010-01-25 Biogen Idec Ma Inc. Moduladores de la regeneracion tisular.
ATE425249T1 (de) * 2000-06-16 2009-03-15 Biogen Idec Inc Renale regulatorische elemente und deren verwendung
DK1401869T3 (da) * 2001-06-01 2008-04-28 Biogen Idec Inc Molekyler og fremgangsmåder til inhibering af udskillkelse af kim 1
US8709412B2 (en) * 2001-06-29 2014-04-29 The Board Of Trustees Of The Leland Stanford Junior University Modulation of TIM receptor activity in combination with cytoreductive therapy
US7470428B2 (en) * 2002-01-30 2008-12-30 The Brigham And Women's Hospital, Inc. Compositions and methods related to TIM-3, a Th1-specific cell surface molecule
EP2025345A1 (en) * 2002-12-30 2009-02-18 Biogen Idec MA Inc. KIM-1 antagonists and use to modulate immune system
KR101213894B1 (ko) * 2005-03-02 2012-12-20 바이오겐 아이덱 엠에이 인코포레이티드 Th2 매개성 병태를 치료하기 위한 kim-1 항체
WO2011159877A2 (en) 2010-06-18 2011-12-22 The Brigham And Women's Hospital, Inc. Bi-specific antibodies against tim-3 and pd-1 for immunotherapy in chronic immune conditions
WO2013006490A2 (en) * 2011-07-01 2013-01-10 Cellerant Therapeutics, Inc. Antibodies that specifically bind to tim3
WO2013151665A2 (en) 2012-04-02 2013-10-10 modeRNA Therapeutics Modified polynucleotides for the production of proteins associated with human disease
WO2014022332A1 (en) 2012-07-31 2014-02-06 The Brigham And Women's Hospital, Inc. Modulation of the immune response
WO2014151648A1 (en) * 2013-03-15 2014-09-25 Coronado Biosciences, Inc. Treatment of autoimmune disease using helminthic parasites
SI3148579T1 (sl) 2014-05-28 2021-07-30 Agenus Inc. Proti GITR antitelesa in postopki z njihovo uporabo
CA2985350A1 (en) * 2015-05-08 2016-11-17 Wilson Wolf Manufacturing Improved culture methods and devices for testing
US20180230431A1 (en) 2015-08-07 2018-08-16 Glaxosmithkline Intellectual Property Development Limited Combination Therapy
JP6981973B2 (ja) * 2015-10-01 2021-12-17 ヒート バイオロジクス,インコーポレイテッド I型及びii型細胞外ドメインを異種キメラタンパク質として連結する組成物及び方法
CN108883173B (zh) 2015-12-02 2022-09-06 阿吉纳斯公司 抗体和其使用方法
EP3494140A1 (en) 2016-08-04 2019-06-12 GlaxoSmithKline Intellectual Property Development Ltd Anti-icos and anti-pd-1 antibody combination therapy
JOP20190013A1 (ar) 2016-08-25 2019-01-31 Lilly Co Eli أجسام مضادة لـ (تي آي ام -3)
JOP20190133A1 (ar) 2016-12-08 2019-06-02 Innovent Biologics Suzhou Co Ltd أجسام مضادة لـ Tim-3 لمزجها بأجسام مضادة لـ PD-1
US20200197389A1 (en) * 2017-05-12 2020-06-25 The Regents Of The University Of California Methods for detecting dysbiosis and treating subjects with dysbiosis
CA3066747A1 (en) 2017-06-27 2019-01-03 Novartis Ag Dosage regimens for anti-tim-3 antibodies and uses thereof
CA3072087A1 (en) 2017-08-11 2019-02-14 Board Of Regents, The University Of Texas System Targeting kinases for the treatment of cancer metastasis
AU2018360389B2 (en) 2017-11-06 2024-09-19 Aurigene Oncology Limited Conjoint therapies for immunomodulation
US11643438B2 (en) 2018-07-20 2023-05-09 The Board Of Regents Of The University Of Oklahoma Antimicrobial peptides and methods of use
EP3897648B1 (en) 2018-12-20 2023-08-23 Novartis AG Extended low dose regimens for mdm2 inhibitors
CN113473979B (zh) 2019-02-28 2024-09-27 爱默蕾大学 双缩二胍化合物、药物组合物和在管理癌症中的用途
US12377063B2 (en) 2019-07-11 2025-08-05 Emory University Combination therapies for managing cancer
WO2021053490A1 (en) 2019-09-16 2021-03-25 Novartis Ag Use of high-affinity, ligand-blocking, humanized anti-t-cell immunoglobulin domain and mucin domain-3 (tim-3) igg4 antibody for the treatment of myelofibrosis
CN114786679A (zh) 2019-10-21 2022-07-22 诺华股份有限公司 具有维奈托克和tim-3抑制剂的组合疗法
CN114599372A (zh) 2019-11-04 2022-06-07 阿斯利康(瑞典)有限公司 用于治疗癌症的组合疗法
EP4326773A4 (en) 2021-04-23 2025-09-24 Suzhou Neologics Bioscience Co Ltd ANTIBODIES TARGETING TIM-3 AND THEIR USES
AU2023314782A1 (en) 2022-07-27 2025-01-30 Umoja Biopharma, Inc. Differentiation of stem cells in suspension culture
EP4608390A1 (en) 2022-10-24 2025-09-03 Cancer Research Technology Limited Tumour sensitisation to checkpoint inhibitors with redox status modifier
EP4608995A1 (en) 2022-10-24 2025-09-03 Memorial Sloan-Kettering Cancer Center Tumour stratification for responsiveness to an immune checkpoint inhibitor
EP4649173A1 (en) 2023-01-13 2025-11-19 Akrivia Biomedics Limited Method of profiling diseases
NL2037811B1 (en) 2024-05-29 2025-12-12 Univ Oslo Treatment for Cancer
GB202408360D0 (en) 2024-06-11 2024-07-24 Cancer Research Tech Ltd Tumour sensitisation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5587289A (en) 1995-03-14 1996-12-24 Ludwig Institute For Cancer Research Isolated nucleic acid molecules which are members of the MAGE-Xp family and uses thereof

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5342774A (en) 1991-05-23 1994-08-30 Ludwig Institute For Cancer Research Nucleotide sequence encoding the tumor rejection antigen precursor, MAGE-1
WO1993019660A1 (en) 1992-04-03 1993-10-14 Baylor College Of Medicine Gene therapy using the intestine
US6197346B1 (en) 1992-04-24 2001-03-06 Brown Universtiy Research Foundation Bioadhesive microspheres and their use as drug delivery and imaging systems
WO1994014459A1 (en) 1992-12-22 1994-07-07 Ludwig Institute For Cancer Research Methods for detection and treatment of individuals having abnormal cells expressing hla-a2/tyrosinase peptide antigens
US5620886A (en) 1993-03-18 1997-04-15 Ludwig Institute For Cancer Research Isolated nucleic acid sequence coding for a tumor rejection antigen precursor processed to at least one tumor rejection antigen presented by HLA-A2
US5571711A (en) 1993-06-17 1996-11-05 Ludwig Institute For Cancer Research Isolated nucleic acid molecules coding for BAGE tumor rejection antigen precursors
US5610013A (en) 1993-07-22 1997-03-11 Ludwig Institute For Cancer Research Method for diagnosing a disorder by determining expression of gage tumor rejection antigen precursors
DE69535002T2 (de) 1994-03-08 2006-12-07 Memorial Sloan-Kettering Cancer Center Rekombinante humanisierte antikörper gegen fb5
US5589334A (en) 1994-06-03 1996-12-31 Ludwig Institute For Cancer Research Isolated nucleic acid molecule which codes for a tumor rejection antigen precursor which is processed to an antigen presented by HLA-B44, and uses thereof
US5830753A (en) 1994-09-30 1998-11-03 Ludwig Institute For Cancer Research Isolated nucleic acid molecules coding for tumor rejection antigen precursor dage and uses thereof.
JP3039307B2 (ja) 1995-02-15 2000-05-08 日本電気株式会社 圧電トランス及びその製造方法
US5563153A (en) 1995-02-22 1996-10-08 University Of Kansas Medical Center Sterile topical anesthetic gel
US6066322A (en) * 1995-03-03 2000-05-23 Millennium Pharmaceuticals, Inc. Methods for the treatment of immune disorders
US5939526A (en) 1995-03-21 1999-08-17 Ludwig Institute For Cancer Research Isolated RAGE-1 derived peptides which complex with HLA-B7 molecules and uses thereof
US5821122A (en) 1995-06-07 1998-10-13 Inserm (Institute Nat'l De La Sante Et De La Recherche . .) Isolated nucleic acid molecules, peptides which form complexes with MHC molecule HLA-A2 and uses thereof
AU5309600A (en) * 1999-06-02 2000-12-18 Millennium Pharmaceuticals, Inc. Compositions and methods for the treatment and diagnosis of immune disorders
WO2000074634A2 (en) * 1999-06-03 2000-12-14 Au Jessie L S Methods and compositions for modulating cell proliferation and cell death
CA2380991A1 (en) * 1999-08-13 2001-02-22 The Rockfeller University Protective antigen of epstein barr virus
EP1254169B1 (en) * 1999-12-30 2007-05-09 President And Fellows of Harvard College Methods relating to modulation of th2 cell subset activity by modulation of xbp-1 activity
US7553939B2 (en) * 2001-06-29 2009-06-30 The Board Of Trustees Of The Leland Stanford Junior University T cell regulatory genes and methods of use thereof
US7470428B2 (en) * 2002-01-30 2008-12-30 The Brigham And Women's Hospital, Inc. Compositions and methods related to TIM-3, a Th1-specific cell surface molecule
CA2541006C (en) 2003-10-03 2015-02-17 Brigham And Women's Hospital Tim-3 polypeptides
US9204354B2 (en) 2011-08-11 2015-12-01 Mediatek Inc. Method for small cell discovery in heterogeneous network

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5587289A (en) 1995-03-14 1996-12-24 Ludwig Institute For Cancer Research Isolated nucleic acid molecules which are members of the MAGE-Xp family and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
COHEN PA ET AL., CANCER RES, vol. 54, 1994, pages 1055 - 8
See also references of EP1467759A4

Cited By (153)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012006959A (ja) * 2003-10-03 2012-01-12 Brigham & Womens Hospital Inc Tim−3ポリペプチド
JP2008500013A (ja) * 2003-10-03 2008-01-10 ザ ブライハム アンド ウイメンズ ホスピタル,インコーポレイテッド Tim−3ポリペプチド
JP2014039558A (ja) * 2003-10-03 2014-03-06 Brigham & Women's Hospital Inc Tim−3ポリペプチド
US9346876B2 (en) 2003-10-03 2016-05-24 The Brigham And Women's Hospital, Inc. TIM-3 ligands and methods of modulating immune responses
WO2005033144A3 (en) * 2003-10-03 2005-06-16 Brigham & Womens Hospital Tim-3 polypeptides
US8329660B2 (en) 2003-10-03 2012-12-11 The Brigham And Women's Hospital, Inc. Tim-3 ligands and methods thereof
US7741271B2 (en) 2004-03-12 2010-06-22 The Brigham And Women's Hospital, Inc. Methods of modulating immune responses by modulating tim-1, tim-2 and tim-4 function
EP1740224A4 (en) * 2004-03-24 2008-07-02 Telos Pharmaceuticals Llc ADJUVANT COMPOSITIONS ENHANCING IMMUNE RESPONSE TO VACCINES AND METHODS OF USE
JP2015063524A (ja) * 2004-03-31 2015-04-09 ユニヴェルシテ デクス−マルセイユUniversite D’Aix−Marseille 膵構造から誘導される糖ペプチド、抗体ならびに診断および治療におけるそれらの応用
JP2012102096A (ja) * 2004-03-31 2012-05-31 Univ De La Mediterranee 膵構造から誘導される糖ペプチド、抗体ならびに診断および治療におけるそれらの応用
US8026054B2 (en) 2004-06-14 2011-09-27 The Board Of Trustees Of The University Of Illinois Antibodies against cells of fetal origin
JP2008506637A (ja) * 2004-06-14 2008-03-06 ザ・ボード・オブ・トラスティーズ・オブ・ザ・ユニバーシティ・オブ・イリノイ 胎児起源の細胞に対する抗体
WO2008060617A3 (en) * 2006-11-15 2008-12-24 Brigham & Womens Hospital Therapeutic uses of tim-3 modulators
US11261231B2 (en) 2007-10-26 2022-03-01 Altor BioScience, LLC. Methods for inhibiting HIV or HCV infection by administering TIM-3 binding inhibitors
US9416165B2 (en) 2007-10-26 2016-08-16 The Regents Of The University Of California Methods of inhibiting viral replication and improving T cell function employing soluble Tim-3 inhibitors
EP2212350B1 (en) * 2007-10-26 2013-08-28 Governing Council of the University of Toronto Treating chronic viral infection by targetting TIM-3
WO2009097394A3 (en) * 2008-01-29 2010-12-23 The Brigham And Women's Hospital, Inc. Methods for modulating a population of myeloid-derived suppressor cells and uses thereof
US9958446B2 (en) 2009-04-10 2018-05-01 Kyowa Hakko Kirin Co., Ltd Method for treatment of blood tumor using anti-TIM-3 antibody
US9487591B2 (en) 2009-04-10 2016-11-08 Kyowa Hakko Kirin Co., Ltd Method for treatment of blood tumor using anti-TIM-3 antibody
WO2010117057A1 (ja) 2009-04-10 2010-10-14 協和発酵キリン株式会社 抗tim-3抗体を用いた血液腫瘍治療法
US8647623B2 (en) 2009-04-10 2014-02-11 Kyowa Hakko Kirin Co., Ltd Method for treatment of blood tumor using anti-TIM-3 antibody
US9103832B2 (en) 2009-04-10 2015-08-11 Kyowa Hakko Kirin Co., Ltd. Method for treatment of blood tumor using anti-TIM-3 antibody
EP3363499A1 (en) 2010-06-11 2018-08-22 Kyowa Hakko Kirin Co., Ltd. Anti-tim-3 antibody
US9556270B2 (en) 2010-06-11 2017-01-31 Kyowa Hakko Kirin Co., Ltd Anti-TIM-3 antibody
CN103079644B (zh) * 2010-06-11 2017-02-15 协和发酵麒麟株式会社 抗tim‑3抗体
CN103079644A (zh) * 2010-06-11 2013-05-01 协和发酵麒麟株式会社 抗tim-3抗体
US10550181B2 (en) 2010-06-11 2020-02-04 Kyowa Kirin Co., Ltd Anti-TIM-3 antibody
WO2011155607A1 (ja) 2010-06-11 2011-12-15 協和発酵キリン株式会社 抗tim-3抗体
EP3708189A1 (en) 2013-07-05 2020-09-16 University of Washington through its Center for Commercialization Soluble mic neutralizing monoclonal antibody for treating cancer
US9803017B2 (en) 2013-07-05 2017-10-31 University Of Washington Through Its Center For Commercialization Soluble MIC neutralizing monoclonal antibody for treating cancer
US10570204B2 (en) 2013-09-26 2020-02-25 The Medical College Of Wisconsin, Inc. Methods for treating hematologic cancers
US11708412B2 (en) 2013-09-26 2023-07-25 Novartis Ag Methods for treating hematologic cancers
US10752687B2 (en) 2014-01-24 2020-08-25 Novartis Ag Antibody molecules to PD-1 and uses thereof
US11827704B2 (en) 2014-01-24 2023-11-28 Novartis Ag Antibody molecules to PD-1 and uses thereof
US11155620B2 (en) 2014-01-31 2021-10-26 Novartis Ag Method of detecting TIM-3 using antibody molecules to TIM-3
US9884913B2 (en) 2014-01-31 2018-02-06 Novartis Ag Antibody molecules to TIM-3 and uses thereof
US10981990B2 (en) 2014-01-31 2021-04-20 Novartis Ag Antibody molecules to TIM-3 and uses thereof
US10472419B2 (en) 2014-01-31 2019-11-12 Novartis Ag Antibody molecules to TIM-3 and uses thereof
US9605070B2 (en) 2014-01-31 2017-03-28 Novartis Ag Antibody molecules to TIM-3 and uses thereof
US12252535B2 (en) 2014-03-14 2025-03-18 Novartis Ag Antibody molecules to LAG-3 and uses thereof
US11344620B2 (en) 2014-09-13 2022-05-31 Novartis Ag Combination therapies
US10851165B2 (en) 2014-10-14 2020-12-01 Novartis Ag Antibody molecules to PD-L1 and methods of treating cancer
US9988452B2 (en) 2014-10-14 2018-06-05 Novartis Ag Antibody molecules to PD-L1 and uses thereof
CN107001475A (zh) * 2014-11-06 2017-08-01 豪夫迈·罗氏有限公司 抗tim3抗体及使用方法
AU2015341801B2 (en) * 2014-11-06 2021-05-06 F. Hoffmann-La Roche Ag Anti-TIM3 antibodies and methods of use
CN107001475B (zh) * 2014-11-06 2021-01-29 豪夫迈·罗氏有限公司 抗tim3抗体及使用方法
RU2723708C2 (ru) * 2014-11-06 2020-06-17 Ф.Хоффманн-Ля Рош Аг Анти-tim3 антитела и способы их применения
EP3632935A1 (en) * 2014-11-06 2020-04-08 F. Hoffmann-La Roche AG Anti-tim3 antibodies and methods of use
WO2016071448A1 (en) * 2014-11-06 2016-05-12 F. Hoffmann-La Roche Ag Anti-tim3 antibodies and methods of use
EP4141032A1 (en) 2014-11-20 2023-03-01 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
EP3789402A1 (en) 2014-11-20 2021-03-10 F. Hoffmann-La Roche AG Combination therapy of t cell activating bispecific antigen binding molecules and pd-1 axis binding antagonists
EP3265486A4 (en) * 2015-03-06 2018-11-14 Sorrento Therapeutics, Inc. Antibody therapeutics that bind tim3
CN107847589A (zh) * 2015-04-01 2018-03-27 安奈普泰斯生物有限公司 针对t细胞免疫球蛋白和粘蛋白蛋白3(tim‑3)的抗体
EP3277321A4 (en) * 2015-04-01 2018-12-12 AnaptysBio, Inc. Antibodies directed against t cell immunoglobulin and mucin protein 3 (tim-3)
US10508149B2 (en) 2015-04-01 2019-12-17 Anaptysbio, Inc. Antibodies directed against T cell immunoglobulin and mucin protein 3 (TIM-3)
US11352427B2 (en) 2015-04-01 2022-06-07 Anaptysbio, Inc. Antibodies directed against T Cell immunoglobulin and mucin protein 3 (TIM-3)
IL254559B1 (en) * 2015-04-01 2023-03-01 Anaptysbio Inc Antibodies directed against T-cell immunoglobulin and myokine protein 3 (T-IM-3)
IL283006B1 (en) * 2015-04-01 2023-06-01 Anaptysbio Inc Antibodies directed against T-cell immunoglobulin and myokine protein 3 (T-IM-3)
IL254559B2 (en) * 2015-04-01 2023-07-01 Anaptysbio Inc Antibodies directed against T-cell immunoglobulin and myokine protein 3 (T-IM-3)
CN107847589B (zh) * 2015-04-01 2022-03-29 安奈普泰斯生物有限公司 针对t细胞免疫球蛋白和粘蛋白蛋白3(tim-3)的抗体
IL283006B2 (en) * 2015-04-01 2023-10-01 Anaptysbio Inc Antibodies directed against T-cell immunoglobulin and myokine protein 3 (T-IM-3)
EP4442712A3 (en) * 2015-04-01 2024-12-04 AnaptysBio, Inc. Antibodies directed against t cell immunoglobulin and mucin protein 3 (tim-3)
EP3991749A2 (en) 2015-07-14 2022-05-04 Kyowa Kirin Co., Ltd. A therapeutic agent for a tumor comprising an ido inhibitor administered in combination with an antibody
WO2017019897A1 (en) * 2015-07-29 2017-02-02 Novartis Ag Combination therapies comprising antibody molecules to tim-3
EP3878465A1 (en) * 2015-07-29 2021-09-15 Novartis AG Combination therapies comprising antibody molecules to tim-3
US12600777B2 (en) 2015-07-29 2026-04-14 Novartis Ag Combination therapies comprising antibody molecules to LAG-3
WO2017055484A1 (en) 2015-09-29 2017-04-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for determining the metabolic status of lymphomas
WO2017055404A1 (en) 2015-10-02 2017-04-06 F. Hoffmann-La Roche Ag Bispecific antibodies specific for pd1 and tim3
US11130810B2 (en) 2015-10-02 2021-09-28 Hoffmann-La Roche Inc. Bispecific antibodies specific for PD1 and TIM3
US10287352B2 (en) 2015-10-02 2019-05-14 Hoffman-La Roche Inc. Bispecific antibodies specific for PD1 and TIM3
US12391757B2 (en) 2015-10-02 2025-08-19 Hoffmann-La Roche Inc. Bispecific antibodies specific for PD1 and TIM3
WO2017118634A1 (en) 2016-01-04 2017-07-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of pd-1 and tim-3 as a measure for cd8+ cells in predicting and treating renal cell carcinoma
US11839653B2 (en) 2016-05-27 2023-12-12 Agenus Inc. Anti-TIM-3 antibodies and methods of use thereof
US12011481B2 (en) 2016-05-27 2024-06-18 Agenus Inc. Anti-TIM-3 antibodies and methods of use thereof
US10912828B2 (en) 2016-05-27 2021-02-09 Agenus Inc. Anti-TIM-3 antibodies and methods of use thereof
US10639368B2 (en) 2016-05-27 2020-05-05 Agenus Inc. Anti-TIM-3 antibodies and methods of use thereof
WO2017214943A1 (zh) * 2016-06-16 2017-12-21 毛侃琅 促进 tim-3 基因表达的慢病毒表达载体及其应用
WO2017220989A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 and il-2 cytokines
WO2017220988A1 (en) 2016-06-20 2017-12-28 Kymab Limited Multispecific antibodies for immuno-oncology
WO2017220990A1 (en) 2016-06-20 2017-12-28 Kymab Limited Anti-pd-l1 antibodies
US11591392B2 (en) 2016-07-14 2023-02-28 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
US12312403B2 (en) 2016-07-14 2025-05-27 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
US10077306B2 (en) 2016-07-14 2018-09-18 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
US10533052B2 (en) 2016-07-14 2020-01-14 Bristol-Myers Squibb Company Antibodies against TIM3 and uses thereof
WO2018036561A1 (en) * 2016-08-26 2018-03-01 Beigene, Ltd. Anti-tim-3 antibodies and use thereof
US11203637B2 (en) 2016-08-26 2021-12-21 Beigene, Ltd. Anti-Tim-3 antibodies and use thereof
US11753472B2 (en) 2016-11-01 2023-09-12 Tesaro, Inc. Antibodies directed against T cell immunoglobulin and mucin protein 3 (TIM-3)
EP4545093A2 (en) 2016-11-04 2025-04-30 Aximmune, Inc. Beta-alethine, immune modulatos, and uses thereof
WO2018085698A1 (en) 2016-11-04 2018-05-11 Aximmune, Inc. Beta-alethine, immune modulators, and uses thereof
US10752700B2 (en) 2017-01-05 2020-08-25 Brown University Methods and compositions relating to anti-CHI3L1 antibody reagents to treat nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NFALD) or metabolic syndrome
EP3565596A1 (en) 2017-01-05 2019-11-13 Brown University Methods and compositions relating to anti-chi3l1 antibody reagents
WO2018129261A1 (en) 2017-01-05 2018-07-12 Brown University Methods and compositions relating to anti-chi3l1 antibody reagents
US11667725B2 (en) 2017-01-05 2023-06-06 Brown University Methods and compositions relating to anti-CHI3L1 antibody reagents for the treatment of cancer
US11926665B2 (en) 2017-01-09 2024-03-12 Tesaro, Inc. Methods of treating cancer with anti-TIM-3 antibodies
US11623953B2 (en) 2017-02-27 2023-04-11 Caerus Therapeutics, Inc. Antibody constructs and methods of treating cancer
WO2018172508A1 (en) 2017-03-24 2018-09-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
US12023368B2 (en) 2017-04-03 2024-07-02 Hoffmann-La Roche Inc. Immunoconjugates
US11413331B2 (en) 2017-04-03 2022-08-16 Hoffmann-La Roche Inc. Immunoconjugates
US11285207B2 (en) 2017-04-05 2022-03-29 Hoffmann-La Roche Inc. Bispecific antibodies specifically binding to PD1 and LAG3
US12611457B2 (en) 2017-04-05 2026-04-28 Hoffmnn-La Roche Inc. Bispecific antibodies specifically binding to PD1 and LAG3
WO2018204303A1 (en) 2017-05-01 2018-11-08 The Children's Medical Center Coporation Methods and compositions relating to anti-pd1 antibody reagents
US11214615B2 (en) 2017-07-28 2022-01-04 Phanes Therapeutics, Inc. Anti-TIM-3 antibodies and uses thereof
WO2019134946A1 (en) 2018-01-04 2019-07-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma resistant
WO2019143607A1 (en) 2018-01-16 2019-07-25 Bristol-Myers Squibb Company Methods of treating cancer with antibodies against tim3
WO2019162325A1 (en) 2018-02-21 2019-08-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Use of sk1 as biomarker for predicting response to immunecheckpoint inhibitors
WO2021077794A1 (zh) * 2018-10-25 2021-04-29 浙江大学 可溶性Tim-3重组蛋白及其突变型蛋白的制备和应用
WO2020104496A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Bispecific antibody targeting transferrin receptor 1 and soluble antigen
WO2020104479A1 (en) 2018-11-20 2020-05-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers and resistant cancers with anti transferrin receptor 1 antibodies
WO2020115261A1 (en) 2018-12-07 2020-06-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2020120592A1 (en) 2018-12-12 2020-06-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating melanoma
WO2020127411A1 (en) 2018-12-19 2020-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cancers by immuno-modulation using antibodies against cathespin-d
WO2020127885A1 (en) 2018-12-21 2020-06-25 INSERM (Institut National de la Santé et de la Recherche Médicale) Compositions for treating cancers and resistant cancers
WO2020157131A1 (en) 2019-01-30 2020-08-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for identifying whether a subject suffering from a cancer will achieve a response with an immune-checkpoint inhibitor
WO2020161083A1 (en) 2019-02-04 2020-08-13 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating blood-brain barrier
WO2020165370A1 (en) 2019-02-13 2020-08-20 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for selecting a cancer treatment in a subject suffering from cancer
WO2020221796A1 (en) 2019-04-30 2020-11-05 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2020227431A1 (en) 2019-05-06 2020-11-12 Brown University Bispecific antibodies against chi3l1 and pd1 with enhanced t cell-mediated cytotoxic effects on tumor cells
WO2021048292A1 (en) 2019-09-11 2021-03-18 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2021064180A1 (en) 2019-10-03 2021-04-08 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for modulating macrophages polarization
WO2021074391A1 (en) 2019-10-17 2021-04-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosing nasal intestinal type adenocarcinomas
WO2021083959A1 (en) 2019-10-29 2021-05-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating uveal melanoma
WO2021123243A1 (en) 2019-12-19 2021-06-24 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and vaccine compositions to treat cancers
WO2021144426A1 (en) 2020-01-17 2021-07-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2021156360A1 (en) 2020-02-05 2021-08-12 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for discontinuing a treatment with a tyrosine kinase inhibitor (tki)
WO2021170777A1 (en) 2020-02-28 2021-09-02 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods for diagnosing, prognosing and managing treatment of breast cancer
WO2022023379A1 (en) 2020-07-28 2022-02-03 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for preventing and treating a cancer
WO2022084531A1 (en) 2020-10-23 2022-04-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating glioma
WO2022101481A1 (en) 2020-11-16 2022-05-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating uveal melanoma
WO2022101484A1 (en) 2020-11-16 2022-05-19 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for predicting and treating uveal melanoma
WO2022194908A1 (en) 2021-03-17 2022-09-22 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2022223791A1 (en) 2021-04-23 2022-10-27 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating cell senescence accumulation related disease
WO2023078900A1 (en) 2021-11-03 2023-05-11 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating triple negative breast cancer (tnbc)
WO2023118165A1 (en) 2021-12-21 2023-06-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and compositions for treating melanoma
WO2024033399A1 (en) 2022-08-10 2024-02-15 Institut National de la Santé et de la Recherche Médicale Sigmar1 ligand for the treatment of pancreatic cancer
WO2024033400A1 (en) 2022-08-10 2024-02-15 Institut National de la Santé et de la Recherche Médicale Sk2 inhibitor for the treatment of pancreatic cancer
WO2024056716A1 (en) 2022-09-14 2024-03-21 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical compositions for the treatment of dilated cardiomyopathy
WO2024084034A1 (en) 2022-10-21 2024-04-25 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical compositions for the treatment of osteoarthritis
WO2024161015A1 (en) 2023-02-03 2024-08-08 Institut National de la Santé et de la Recherche Médicale Method to treat age-related diseases
WO2024200571A1 (en) 2023-03-28 2024-10-03 Institut National de la Santé et de la Recherche Médicale Method for discriminating mono-immunotherapy from combined immunotherapy in cancers
WO2024231384A1 (en) 2023-05-10 2024-11-14 Institut National de la Santé et de la Recherche Médicale Compositions for treating senescence related disease
WO2024236156A1 (en) 2023-05-17 2024-11-21 Institut National de la Santé et de la Recherche Médicale Anti-cathepsin-d antibodies
WO2024245951A1 (en) 2023-05-26 2024-12-05 Institut National de la Santé et de la Recherche Médicale Combination of slc8a1 inhibitor and mitochondria-targeted antioxidant for treating melanoma
WO2024256635A1 (en) 2023-06-15 2024-12-19 Institut National de la Santé et de la Recherche Médicale Dpm1 inhibitor for treating cancer
WO2025068180A1 (en) 2023-09-25 2025-04-03 Institut National de la Santé et de la Recherche Médicale Methods of treatment of cancer by targetting cancer - associated fibroblasts
WO2025073765A1 (en) 2023-10-03 2025-04-10 Institut National de la Santé et de la Recherche Médicale Methods of prognosis and treatment of patients suffering from melanoma
WO2025078632A1 (en) 2023-10-12 2025-04-17 Institut National de la Santé et de la Recherche Médicale Methods of prognosis and treatment of patients suffering from cancer
WO2025132479A1 (en) 2023-12-18 2025-06-26 Institut National de la Santé et de la Recherche Médicale Flt3 inhibitor for modulating macrophages polarization
WO2025132770A1 (en) 2023-12-22 2025-06-26 Institut National de la Santé et de la Recherche Médicale Affitins for the treatment of cancer
WO2025210123A1 (en) 2024-04-03 2025-10-09 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for treating cancers
WO2025219330A1 (en) 2024-04-15 2025-10-23 Institut National de la Santé et de la Recherche Médicale Detection of ppix for use in methods for melanoma ferroptosis sensitivity and targeted therapy resistance prediction
WO2025228998A1 (en) 2024-04-30 2025-11-06 Institut National de la Santé et de la Recherche Médicale Use of hdac4 inhibitors for the treatment of melanoma
WO2025247829A1 (en) 2024-05-27 2025-12-04 Institut National de la Santé et de la Recherche Médicale Methods and pharmaceutical composition for treating prostate cancer
WO2026013071A1 (en) 2024-07-09 2026-01-15 Institut National de la Santé et de la Recherche Médicale Setdb1 inhibitor for use in the treatment of uveal melanoma

Also Published As

Publication number Publication date
US20150044230A1 (en) 2015-02-12
US20140242094A1 (en) 2014-08-28
US7470428B2 (en) 2008-12-30
JP2005526018A (ja) 2005-09-02
AU2003303082B2 (en) 2009-07-02
US8697069B2 (en) 2014-04-15
US20180271977A1 (en) 2018-09-27
AU2009202143A1 (en) 2009-06-18
EP3020413A1 (en) 2016-05-18
US9333256B2 (en) 2016-05-10
US20090110687A1 (en) 2009-04-30
CA2474497C (en) 2013-12-03
JP4694128B2 (ja) 2011-06-08
US20120315286A1 (en) 2012-12-13
AU2009202143B2 (en) 2013-02-21
US20040005322A1 (en) 2004-01-08
US20150044229A1 (en) 2015-02-12
WO2003063792A8 (en) 2003-10-16
EP1467759A4 (en) 2006-05-31
CA2474497A1 (en) 2003-08-07
JP2009235099A (ja) 2009-10-15
US9962440B2 (en) 2018-05-08
EP1467759A2 (en) 2004-10-20
AU2003303082A1 (en) 2003-08-28
US8101176B2 (en) 2012-01-24
EP4091631A1 (en) 2022-11-23
WO2003063792A3 (en) 2004-04-01

Similar Documents

Publication Publication Date Title
US9962440B2 (en) Methods related to TIM 3, a TH1-specific cell surface molecule, for activating antigen presenting cells
JP7720375B2 (ja) シグレック-15に対する抗体及びその使用方法
TWI684600B (zh) 抗-egfr抗體及抗體藥物結合物
Demangel et al. Single chain antibody fragments for the selective targeting of antigens to dendritic cells
TW202540190A (zh) 結合淋巴球活化基因-3 (lag-3)之抗體最佳化及其用途
CA2480162A1 (en) Induction of anti-tumor ctl immunity through in vivo triggering of 4-1bb and/or cd40
JP2010013486A (ja) 抗cd40モノクローナル抗体
TW201024315A (en) Antitumor combinations containing antibodies recognizing specifically CD38 and cyclophosphamide
SK287400B6 (sk) Prostriedok s obsahom imunostimulačnej nukleovej kyseliny a jeho použitie na stimuláciu imunitnej reakcie
JP2007284450A (ja) 抗cd40モノクローナル抗体
AU2013200694B2 (en) Compositions and methods related to TIM-3, a TH1-specific cell surface molecule
WO2009023055A2 (en) Blockade of the inhibitory qa-1-cd94/nkg2a pathway for treatment of autoimmune disease
US20250154251A1 (en) Companion diagnostic for human ceacam1 directed therapeutic agents
ES2393539T3 (es) Utilización terapéutica de anticuerpos anti-CS1
RU2855512C2 (ru) Антитела против siglec-15 и способы их применения
OA21025A (en) Engineered hepatitis B virus neutralizing antibodies and uses thereof.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): CA JP

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LU MC NL PT SE SI SK TR

121 Ep: the epo has been informed by wipo that ep was designated in this application
CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: IN PCT GAZETTE 32/2003 UNDER (81) ADD "AU"

WWE Wipo information: entry into national phase

Ref document number: 2003723627

Country of ref document: EP

Ref document number: 2474497

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2003303082

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2003563488

Country of ref document: JP

WWP Wipo information: published in national office

Ref document number: 2003723627

Country of ref document: EP