WO2003044194A1 - Selection et evolution d'acides nucleiques et de polypeptides - Google Patents

Selection et evolution d'acides nucleiques et de polypeptides Download PDF

Info

Publication number
WO2003044194A1
WO2003044194A1 PCT/US2002/037103 US0237103W WO03044194A1 WO 2003044194 A1 WO2003044194 A1 WO 2003044194A1 US 0237103 W US0237103 W US 0237103W WO 03044194 A1 WO03044194 A1 WO 03044194A1
Authority
WO
WIPO (PCT)
Prior art keywords
trna
mrna
molecule
nucleic acid
protein
Prior art date
Application number
PCT/US2002/037103
Other languages
English (en)
Inventor
Richard B. Williams
Original Assignee
Proteonova, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Proteonova, Inc. filed Critical Proteonova, Inc.
Priority to AU2002356984A priority Critical patent/AU2002356984A1/en
Publication of WO2003044194A1 publication Critical patent/WO2003044194A1/fr
Priority to US10/847,484 priority patent/US20040229271A1/en
Priority to US10/847,087 priority patent/US7410761B2/en
Priority to US10/960,453 priority patent/US7488600B2/en
Priority to US11/415,844 priority patent/US20070015181A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1062—Isolating an individual clone by screening libraries mRNA-Display, e.g. polypeptide and encoding template are connected covalently

Definitions

  • the present invention relates to compositions and methods for the selection of nucleic acids and polypeptides.
  • Ligand-rcceptor interactions are of interest for many reasons, from elucidating basic biological site recognition mechanisms to drug screening and rational drug design. It has been possible for many years to drive / ' // vitro evolution of nucleic acids by selecting molecules out of large populations that preferentially bind to a selected target, then amplifying and mutating them for subsequent rc-selcction (Tuerk and Gold, Science 249:505 (1 90), herein incorporated by reference).
  • proteins as compared to nucleic acids, is particularly advantageous because the twenty diverse amino acid side chains in proteins have far more binding possibilities than the four similar chains in nucleic acid side. Further, many biologically and medically relevant ligands bind proteins.
  • nucleic acid and protein evolution methods require access to a large and highly varied population of test molecules, a way to select members of the population that exhibit the desired properties, and the ability to reproduce the selected molecules with mutated variations to obtain another large population for subsequent selection.
  • Puromycin is a tRNA acceptor stem analog which accepts the nascent peptide chain under the action of the ribosomal peptidyl transferasc and binds it stably and irreversibly, thereby halting translation.
  • These methods suffer from certain disadvantages.
  • the coding sequence encoding each peptide must be known and be modified both initially and between each selection.
  • the modified coding sequence adds several steps to the process.
  • the attached puromycin on the linker molecules may compete in the translation reaction with the native tRNAs for the A site on the ribosome reading its coding sequence or a nearby ribosome, and could thus "poison" the translation process, just as would unattached puromycin in the translation reaction solution. Inadvertent interactions between puromycin and ribosomcs could result in two kinds of reaction non-specificity: prematurely shortened proteins and proteins attached to the wrong message.
  • Mg Mg
  • concentration may be titrated to control for the first kind of non-specificity, i.e. premature termination of translation, it will not affect the second type, i.e. inaccurate mRNA-protein linkage.
  • the present invention provides compositions and methods to select and evolve desired properties of proteins and nucleic acids.
  • the current invention provides modified tRNA's and tRNA analogs.
  • Other embodiments include methods for generating polypeptides, assays enabling selection of individual members of the population of polypeptides having desired characteristics, methods for amplifying the nucleic acids encoding such selected polypeptides, and methods for generating new variants to screen for enhanced properties.
  • the present invention permits the attachment of a protein to its respective mRNA without requiring modification of native mRNA, although modified mRNA may still be used.
  • the specificity of the methods embodied in various aspects of the current invention arc determined by the specificity of the codon-anticodon interaction.
  • the invention permits the selection of nucleic acids by selecting the proteins for which they code. This may be accomplished by connecting the protein to its cognate mRNA at the end of translation, which in turn is done by connecting both the protein and mRNA to a tRNA or tRNA analog.
  • a preferred embodiment of the invention includes a tRNA molecule capable of covalently linking a nucleic acid encoding a polypeptidc and the polypeptidc to the tRNA, wherein the linkage of the nucleic acid occurs on a portion of the tRNA other than the linkage to the polypcptide and wherein the tRNA comprises a linking molecule associated with the anticodon of the tRNA.
  • This anticodon of the tRNA is capable of forming a crosslink to the mRNA under irradiation with light of a required wavelength, preferably a furan-sided psoralen monoadduct on the anticodon irradiated with UVA, preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
  • a amino acid or amino acid analog is attached to the 3' end of a 1RNA molecule by a stable bond to generate a stable aminoacyl tRNA analog
  • RNA comprising a psoralcn, preferably located in the 3' region of the reading frame, more preferably at the most 3' codon of the reading frame, most preferably at the 3' slop codon of the reading frame.
  • linkage between the tRNA and the mRNA is a cross-linked psoralcn molecule, more preferably a furan-sided psoralen monoadduct.
  • a further embodiment of the invention provides a method of forming a monoadduct.
  • a target ohgonucleotide with at least one uridinc and at least one modified uridine is contacted with psoralen, and the target olignucleotide and psoralcn are coupled to form a monoadduct.
  • the modified uridine according to this embodiment may be modified to avoid coupling with psoralcn, and preferably the modified uridine is pseudouridinc.
  • the target ohgonucleotide may be a tRNA molecule, such as tRNA, modified tRNA and tRNA analogs or a mRNA molecule, such as mRNA, modified mRNA and mRNA analogs.
  • the psoralcn is coupled to the target ohgonucleotide by one or more cross-links.
  • a second ohgonucleotide with a nuclcotidc sequence complementary to the target ohgonucleotide sequence may be present.
  • This second ohgonucleotide may contain no uridine or may contain uridine residues that are modified to avoid cross-linking with the target ohgonucleotide.
  • the modified uridine is pseudouridinc.
  • Several embodiments of the present invention include a method of stably linking a nucleic acid, a tRNA, and a polypeptidc encoded by the nucleic acid together to form a linked nucleotidc-polypcptide complex.
  • the nucleic acid is an mRNA and the linked nucleotidc-polypcptide complex is a mRNA-polypeptide complex.
  • the method can further comprise providing a plurality of distinct nucleic acid-polypcptide complexes, providing a ligand with a desired binding characteristic, contacting the complexes with the ligand, removing unbound complexes, and recovering complexes bound to the ligand.
  • this invention comprises amplifying the nucleic acid component of the recovered complexes and introducing variation to the sequence of the nucleic acids.
  • the method further comprises translating polypeptides from the amplified and varied nucleic acids, linking them together using tRNA, and contacting them with the ligand to select another new population of bound complexes.
  • Several embodiments of the present invention use selected protein-mRNA complexes in a process of in vitro evolution, in particular the iterative process in which the selected mRNA is reproduced with variation, translated and again connected to cognate protein for selection.
  • Figure 1 illustrates schematically one example of the complex formed by the mRNA and its protein product when linked by a modified tRNA or analog.
  • a codon of the mRNA pairs with the anticodon of a modified tRNA and is covalcntly crosslinked to a psoralen monoadduct by UV irradiation.
  • the translated polypeptidc is linked to the modified tRNA via the ribosomal peptidyl transferasc Both linkages occur while the mRNA and nascent protein are held in place by the ribosome.
  • Figure 2 illustrates schematically an example of the in vitro selection and evolution process, wherein the starting nucleic acids and their protein products are linked (e.g., according to Figure 1 ) and are selected by a particular characteristic exhibited by the protein. Proteins not exhibiting the particular characteristic are discarded and those having the characteristic arc amplified with variation, preferably via amplification with variation of the mRNA, to form a new population. In various embodiments, nonbinding proteins will be selected. The new population is translated and linked via a modified tRNA or analog, and the selection process is repeated. As many selection and amplification/mutation rounds as desired can be performed to optimize the protein product.
  • Figure 3 illustrates one method of construction of a tRNA molecule of the invention.
  • the 5' end of a tRNA, a nucleic acid encoding an anticodon loop and having a molecule capable of stably linking to mRNA (such as psoralcn, as used in this example) are ligated to form a complete modified tRNA for use in the in vitro evolution methods of the invention.
  • Figure 4 describes two alternative embodiments by which the crosslinking molecule psoralen can be positioned such that it is capable of linking the mRNA with the tRNA in the methods of the invention.
  • a first embodiment includes linking the psoralen monoadduct to the mRNA
  • a second embodiment includes linking the psoralen to the anticodon of the tRNA.
  • Psoralen can cither be monoadducted to the anticodon or the 3' terminal codon of the reading frame for known or partially known messages. This can be done in a separate procedure from translation, i.e. before translation occurs.
  • Figure 5 illustrates the chemical structures for uridine and pseudouridinc.
  • Pseudouridine is a naturally occurring base found in tRNA that forms hydrogen bonds just as uridine does, but lacks the 5-6 double bond that is the target for psoralen.
  • RNA mechanism that links messenger RNA (mRNA) to its translated protein product, forming a "cognate pair.”
  • mRNA messenger RNA
  • mRNA messenger RNA
  • the cognate pairs are preferably attached via a linking tRNA, modified tRNA, or tRNA analog.
  • the tRNA is connected to the nascent peptide by the ribosomal peptidyl transferasc and to the mRNA through an ultraviolet induced cross link between the anticodon of the tRNA or tRNA analog and the codon of the RNA message.
  • the linker is a psoralen crosslink made from a psoralcn monoadduct pre-placcd on either the mRNA or preferably on the tRNA anticodon of choice.
  • a tRNA slop anticodon is selected.
  • a stop codon/anticodon pair selects for full length transcripts.
  • a mRNA not having a stop codon may also be used and that any codon or nucleic acid triplet may be used.
  • a tRNA having an anticodon which is not naturally occurring can be synthesized according to methods known in the art (e.g. Figure 3).
  • the terms "protein,” “peptide,” and “polypeptide” are defined herein to mean a polymeric molecule of two or more units comprised of amino acids in any form (e.g., D- or L- amino acids, synthetic or modified amino acids capable of polymerizing via peptide bonds, etc.), and these terms may be used interchangeably herein.
  • pseudo stop codon is defined herein to mean a codon which, while not naturally a nonsense codon, prevents a message from being further translated.
  • a pseudo stop codon may be created by using a "stable aminoacyl tRNA analog" or SATA, as described below. In this manner, a pseudo stop codon is a codon which is recognized by and binds to a SATA.
  • Another method by which to create a pseudo stop codon is to create an artificial system in which the necessary tRNA having an anticodon complementary to the pseudocodon is substantially depleted. Accordingly, translation will stop when the absent tRNA is required, i.e. at the pseudo stop codon.
  • One skilled in the art will appreciate that are numerous ways to create a pseudo stop codon as defined herein.
  • tRNA or tRNA analog with certain characteristics.
  • the tRNA or tRNA analog will have a stable peptide acceptor. This modification changes the tRNA or tRNA analog such that after it accepts the nascent peptide chain by the action of the ribosomal peptidyl transferase, it holds the chain in a stable manner such that the peptidyl transferase cannot detach it. This may be accomplished by using a bond such as a 2' ester on a 3' deoxy adenosine or an amino "acyl tRNA ox .
  • an amino acid or amino acid analog is attached to the 3' end of the tRNA or tRNA analog by a stable bond. This stable bond contrasts the labile, high energy ester bond that connects these two in the native structure.
  • the stable bond not only protects the bond from the action of the peptidyl transferase, but also preserves the structure during subsequent steps.
  • this modified tRNA or tRNA analog will be referred to as a "stable aminoacyl tRNA analog" or SATA.
  • SATA is an entity which can recognize a selected codon such that it can accept a peptide chain by the action of the ribosomal peptidyl transferase when the cognate codon is in the reading position of the ribosome.
  • the peptide chain will be bound in such a way that the peptide is bound stably and cannot be unattached by the peptidyl transferase.
  • the selected codon is recognized by hydrogen bonding.
  • Psoralen cross links are preferentially made between sequences that contain complementary 5' pyrimidine-purine 3' sequences especially UA or TA sequences (Cimino et al., Ann. Rev. Biochem. 54:1151 (1985), herein incorporated by reference).
  • the codon coding for the SATA, or the linking codon can be PYR-PUR-X or X-PYR-PUR, so that several codons may be used for the linking codon. Conveniently, the stop or nonsense codons have this configuration. Using a codon that codes for an amino acid may require minor adjustments to the genetic code, which could complicate some applications.
  • a stop codon is used as the linking codon and the SATA functions as a nonsense suppressor in that it recognizes the linking codon.
  • SATA functions as a nonsense suppressor in that it recognizes the linking codon.
  • acceptor stem modifications suitable for use in the tRNAs and analogs can be produced by various methods known in the art. Such methods are found in, for example, SRocl and Cramer, Prog. Nuc. Acid Res.
  • transcriptional tRNA i.e. the sequence of the tRNA as it would be transcribed rather than after the post-transcriptional processing, leads to the atypical and modified bases that are common in tRNAs. These transcriptional tRNAs are capable of functioning as tRNAs (Dabrowski et al., EMBO J. 14: 4872, 1995; and Harrington et al., Biochem. 32: 7617,
  • Transcriptional tRNA can be produced by transcription or can be made by connecting commercial RNA sequences together, piece- wise as in Figure 3, or in some combination of established methods. For instance, the 5' phosphate and 3' puromycin are commercially available attached to oligoribonucleotides. Commercial RNA sequences are available from Dharmacon Research Inc., La Fayette, CO.
  • This company can also provide modified native tRNA, such as sequences in which thymine is substituted for uricil and pseudouridinc) These pieces can be connected together using T4 DNA ligase, as is well-known in the art (Moore and Sharp, Science 256: 992, 1992, herein incorporated by reference). Alternatively, in a preferred embodiment, T4 RNA ligase is used (Romaniuk and Uhlenbeck, Methods in Enzymology 100:52 (1983), herein incorporated by reference).
  • psoralen is monoadducted to the SATA by construction of a tRNA from pieces including a psoralen linked ohgonucleotide (Fig. 3) or by monoadduction to a native or modified tRNA or analog (Fig. 4).
  • psoralen is first monoadducted to an ohgonucleotide containing part of the anticodon loop as described below and this product is then ligated to the remaining fragments of the SATA.
  • translation will stop when the nascent protein is attached to the SATA by the peptidyl transferase.
  • the SATA and the mRNA will be connected with UN light.
  • this will be accomplished by having a psoralen crosslink formed.
  • Psoralens have a furan side and a pyrone side, and they readily intercalate between complementary base pairs in double stranded DNA, RNA, and DNA-RNA hybrids (Cimino et al., Ann. Rev. Biochem. 54:1151 (1985), herein incorporated by reference).
  • furan sided monoadducts will be created using visible light, preferably in the range of approximately 400 nm - 420 nm, according to the methods described in U.S. Patent No. 5,462,733 and Gasparro et al., Photochem. Photobiol. 57:1007 (1993), both herein incorporated by reference.
  • a SATA with a furan sided monoadduct or monoadducted oligonucleotides for placement on the 3' end of mRNAs, along with a nonadducted SATA are provided as the basis of a kit.
  • the formation and reversal of monoadducts and crosslinks are performed according to the methods of Bachellerie et al. (Nuc Acids Res 9:2207 (1981)), herein incorporated by reference.
  • efficient production of monoadducts, resulting in high yield of the end-product is accomplished using the methods of Kobertz and Essigmann, J. A. Chem. Soc. 1997, 119, 5960-5961 and Kobertz and
  • a SATA fragment and complementary RNA or DNA is used in which all of the uridines, except the target, are replaced by pseudouridine.
  • Figure 5 compares the chemical structures for uridine and pseudouridine. Pseudouridine is a naturally occurring base found in tRNA that forms hydrogen bonds just as uridine does. This embodiment is particularly advantageous because the pseudouridine forms the same
  • Watson-Crick hydrogen-bonds as the native uridine but lacks the 5-6 double bond that is the target for interacting with either the furan or pyrone side of the psoralen molecule.
  • This permits the same base-pairing characteristics as an ohgonucleotide with uridine, but provides only one target for the psoralen.
  • the pyrone side linkage is usually formed after the furan side has reacted, this removal of a staggered target allows the monoadduct to be formed with high efficiency irradiation without forming crosslinks and with minimal formation of pyrone sided monoadduct (MaP).
  • Irradiation is preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
  • a pseudouridine on the SATA permits: 1) the use of SATA sequences that contain uridines which are potential targets for the psoralen and 2) on the cRNA or cDNA, eliminate the formation of crosslinks, leaving the process stopped at furan sided monoadduct (MaF) formation when using UNA wavelengths which are much more efficient than visible light.
  • Use of the SATA and the monoadduct in several embodiments of the current invention is particularly advantageous for in vitro translation systems. However, one skilled in the art will appreciate that in situ systems can also be used.
  • Various embodiments of the current invention will be applicable to any in vitro translation system, including, but not limited to, rabbit reticulocyte lysate (RLL), wheat germ, E. coli, and yeast lysate systems. Many embodiments of the current invention are also well-suited for use in hybrid systems where components of different systems are combined.
  • RLL rabbit reticulocyte lysate
  • Many embodiments of the current invention are also well-suited for use in hybrid systems where components of different systems are combined.
  • tR ⁇ As aminoacylated on a 3' amide bond are reported not to combine with the elongation factor ⁇ F-TU which assists in binding to the A site (SRocl and Cramer, Prog. ⁇ uc. Acid Res. 22:1 (1979), herein incorporated by reference). Such modified tR ⁇ As do, however, bind to the A site.
  • This binding of 3' modified tR ⁇ As can be increased by changing the Mg ++ concentration (Chinali et al., Biochem. 13:3001 (1974), herein incorporated by reference).
  • concentrations and/or molar ratios of SATA and Mg" can be determined empirically. If the concentration or A site avidity of SATA is too high, the SATA could compete with native tRNAs for non-cognate codons i.e., could function much like puromycin and stall translation. If the concentration or A site avidity of SATA is too low, the SATA might not effectively compete with the release factors, i.e., it would not act as an effective nonsense suppressor tRNA. The balance between these can be determined empirically.
  • the elongation factor aids in proofreading the codon- anticodon recognition.
  • the error rate in the absence of elongation factor and the associated GTP hydrolysis is estimated to be 1 in 100 for codons one nucleotide away (Voet and Noet, Biochemistry 2 nd ed. pp. 1000-1002 (1995), John Wiley and Sons, herein incorporated by reference).
  • UAA is used as the linking codon.
  • For UAA as the linking codon there are 7 non stop codons which differ by one amino acid. This is 7/61 or about 11.5% of the non stop codons.
  • UAGor UGA is used as the linking codon.
  • appropriate concentrations of SATA and Mg ++ are used in the in vitro translation system, e.g. RRL, in the presence of the mR ⁇ A molecules in the pool, causing translation to cease when the ribosome reaches the codon which permits the SATA to accept the peptide chain (the linking codon described above). Within a short time, most of the linking codons will be occupied by SATAs within ribosomes.
  • the system then will be irradiated with UN light, preferably at approximately 320 nm to 400 nm. Nucleic acids are typically transparent to, i.e. do not absorb, this wavelength range. Upon irradiation, the psoralen monoadduct will convert to a crosslink connecting the anticodon and the codon by a stable covalent bond.
  • the target mRNA is pre-selected.
  • the target mRNA is artificially produced.
  • the target consists of messages native to the system under investigation, which may be unknown and/or unidentified. The ability to use unknown and/or unidentified mRNAs is a particular advantage of several embodiments of the current invention.
  • the ribosomes are released or denatured. Preferably, this is accomplished by the depletion of Mg ++ through dialysis, simple dilution, or chelation.
  • Mg ++ adenosine-containing ribosomes
  • chelation adenosine-containing ribosomes
  • the selection of cognate pairs will be based upon affinity binding of proteins according to any of a variety of established methods, including, but not limited to, affinity columns, immunoprecipitation, and many high throughput screening procedures.
  • a variety of ligands may also be used, including, but not limited to, proteins, nucleic acids, chemical compounds, polymers and metals.
  • cell membranes or receptors, or even entire cells may be used to bind the cognate pairs.
  • the selection can be positive or negative. That is, the selected cognate pairs can be those that do bind well to a ligand or those that do not.
  • a protein For instance, for a protein to accelerate a thermodynamically favorable reaction, i.e., act as an enzyme for that reaction, it should bind both the substrate and a transition state analog. However, the transition state analog should be bound much more tightly than the substrate. This is described by the equation
  • the ratio of the rate of the reaction with the enzyme, k emyme , to the rate without, k ⁇ emyme. is equal to the ratio of the binding of the transition state to the enzyme K trms over the binding of the substrate to the enzyme K subsl (Noet and Voet, Biochemistry 2 nd ed. p.380, (1995), John Wiley and Sons, herein incorporated by reference).
  • proteins which compete poorly for binding to the substrate but compete well for binding to the transition state analog are selected.
  • this may be accomplished by taking the proteins that are easily eluted from a matrix with substrate or substrate analog bound to it and are the most difficult to remove from matrix with transition state analog bound to it.
  • an improved enzyme should evolve. Affinity to one entity and lack of affinity to another in the same selection process is used in several embodiments of the current invention. Selection can also be done by R ⁇ A in many embodiments.
  • RNA-dependent RNA polymerases can be reproduced in many ways including, but not limited to, by RNA-dependent RNA polymerases or by reverse transcription and PCR. This can take place using mRNAs separated from the cognate pairs, e.g., using poly T or poly U to hybridize to the poly A tails of, for instance, native unknown messages or by leaving the cognate pairs intact and using ohgonucleotide primers that hybridize partially into the reading frame for known messages.
  • commercial kits for rapid amplification of cDNA ends may be used. When this is used to evolve proteins and not just to select them, it would be preferable to sample at least one amino acid substitution at each position in the protein.
  • a nominal minimum number of replications for efficient evolution may be estimated using the following formulae. If there is a sequence which is n sequences in length, with a selective improvement r mutations away with a mutation rate of p, the probability of generating the selective improvement on replication may be determined as follows:
  • a poisson approximation for large n and small p for a given ⁇ can be calculated so that we can compute the general term when n is, say, of the order 10 9 andp is of the order 10 "9 .
  • the general term of the approximation is:
  • the total concentrations can be expressed as follows:
  • the above factor is termed the "Enrichment Factor”.
  • the ratio of the total components is multiplied by this factor to calculate the ratio of the bound components, or the enrichment of B over C.
  • the maximum enrichment factor is k k B , when the [A] is significantly smaller than k c or k B .
  • the enrichment is limited by the ratio of binding constants. To enrich a scarce protein that is bound 100 times as strongly as its competitors, the ratio of that protein to its competitors is increased by 1 million with 3 enrichments. To enrich a protein that only binds twice as strongly than its competitors, 10 enrichment cycles would gain only an enrichment of -1000.
  • [C] k c [C] ⁇ ([A] + k B )
  • the enrichment here is maximal at [A]>k A or k B .
  • SATA can be produced in a number of different ways.
  • three fragments (Fig. 1) were purchased from a commercial source (i.e. Dharmacon Research Inc., Boulder, CO).
  • Modified bases and a fragment 3 with a pre-attached puromycin on its 3' end and a PO 4 on its 3' end were included, all of which were available commercially. Three fragments were used to facilitate manipulation of the fragment 2 in forming the monoadduct.
  • Yeast tRNAAla or yeast tRNAPhe were used; however, sequences can be chosen from widely known tRNA's or by selecting sequences that will form into a tRNA-like structure. Preferably, sequences with only a limited number of U's in the portion that corresponds to the fragment 2 are used. Using a sequence with only a few U's is not necessary because psoralen preferentially binds 5'UA3' sequences (Thompson J.F., et al Biochemistry 21:1363, herein incorporated by reference). However, there would be less doubly adducted product to purify out if such a sequence was used.
  • Fragment 2 was preferably used in a helical conformation to induce the psoralen to intercalate. Accordingly, a complementary strand was required. RNA or DNA was used, and a sequence, such as poly C to one or both ends, was added to facilitate separation and removal after monoadduct formation was accomplished. Fragment 2 and the cRNA were combined in buffered 50 mM NaCl solution. The
  • Tm was measured by hyperchromicity changes.
  • the two molecules were re-annealed and incubated for 1 hour with the selected psoralen at a temperature ⁇ 10°C less than the Tm.
  • the psoralen was selected based upon the sequence used.
  • a relatively insoluble psoralen such as 8 MOP, could be selected which has a higher sequence stringency but may need to be replenished.
  • a more soluble psoralen such as AMT, has less stringency but will fill most sites.
  • HMT is used. If a fragment 2 is chosen that contains more non- target U's, a greater stringency is desired. Decreasing the temperature or increasing ionic strength by adding Mg ++ was also used to increase the stringency. In a preferred embodiment, MG ++ was omitted and -400 mM NaCl solution was used.
  • psoralen was irradiated at a wavelength greater than approximately 400 nm. The irradiation depends on the wavelength chosen and the psoralen used. For instance, approximately 419 nm 20-150 J/cm2 was preferably used for HMT. This process results in an almost entirely furan sided monoadduct.
  • the monoadduct was then purified by HPLC as described in Sastry et al, J.
  • the fragment 2 was ligated to the fragment 3 using T4 RNA ligase.
  • the puromycin on the 3' end acted as a protecting group. This is done as per Romaniuk and Uhlenbeck, Methods in Enzymology 100:52-59 (1983), herein incorporated by reference.
  • Joining of fragment 2+3 to the 3' end of fragment 1 was done according to the methods described in Uhlenbeck, Biochemistry 24:2705-2712 (1985), herein incorporated by reference.
  • Fragment 2+3 was 5' phosphorylated by polynucleotide kinase and the two half molecules were annealed.
  • significant quantities of furan sided monoadducted U were formed by hybridizing poly UA to itself and irradiating as above.
  • the poly UA was then enzymatically digested to yield furan sided U which was protected and incorporated into a tRNA analog by nucleoside phosphoramidite methods.
  • Other methods of forming the psoralen monoadducts include the methods described in Gamper et al., J. Mol. Biol. 197: 349 (1987); Gamper et al., Photochem. Photobiol. 40:29, 1984; Sastry et al, J. Photochem.
  • Equal volumes of 3 ng/ml RNAxRNA hybrid segments and of 10 ⁇ g/ml HMT both comprised of 50mM NaCl were transferred into a new 1.5 ml capped polypropylene microcentrifuge tube and incubated at 37°C for 30 minutes in the dark. This was then transferred onto a new clean culture dish. This was positioned in a photochemical reactor (419 nm peak Southern New England Ultaviolet Co.) at a distance of about 12.5 cm so that irradiance was -6.5 mW/cm2 and irradiated for 60-120 minutes.
  • a photochemical reactor (419 nm peak Southern New England Ultaviolet Co.) at a distance of about 12.5 cm so that irradiance was -6.5 mW/cm2 and irradiated for 60-120 minutes.
  • RNA+8-MOP Two volumes (-1000 ⁇ l) ice cold absolute ethanol was added to the mixture. The tube was centrifuged for 15 minutes at 15,000xg in a microcentrifuge. The supernatant was decanted and discarded and the precipitated RNA was redissolved in lOO ⁇ l DEPC treated water then re-exposed to the RNA+8-MOP.
  • fractions were stored at 4°C in new, RNAase free snapped microcentrifuge tubes and stored at -20°C if more than four weeks of storage were required.
  • the electrophoresis unit was set up in a 4°C refrigerator. A gel was selected with a 2 mm spacer. Each 5 ⁇ l of HPLC fraction was diluted to 10 ⁇ l with Loading Buffer. 10 ⁇ l of each diluted fraction was loaded into appropriately labeled sample wells. The tracking dye was loaded in a separate lane and electrophoresis was run as described in the following section entitled "Polyacrylamide Gel Electrophoresis (PAGE) of Psoralenated RNA Fragments.” After the electrophoresis run was complete, the electrophoresis was stopped when the tracking dye reached the edge of the gel. The apparatus was disassembled. The gel-glass panel unit was placed on the UV light box. UV lights were turned on. The RNA bands were identified. The bands appeared as denser shadows under UV lighting conditions.
  • RNAase free scalpel blade was excised with a new sterile and RNAase free scalpel blade and transferred into a new 1.5 ml snap capped microcentrifuge tube. Each gel was crushed against the walls of the microcentrifuge tubes with the side of the scalpel blade. A new blade was used for each sample. 1.0 ml of 0.3M sodium acetate was added to each tube and eluted for at least 24 hours at 4°C. The eluate was transferred to a new 0.5 ml snap capped polypropylene microcentrifuge tube with a micropipet. A new RNAase free pipette tip was used for each tube and the RNA with ethanol was precipitated out.
  • RNA ohgonucleotide fragments were precipitated, and all glassware was cleaned to remove any traces of RNase as described in the following section entitled "Inactivation of RNases on Equipment, Supplies, and in Solutions.” All solutions were stored in RNAase free glassware and introduction of nucleases was prevented. Absolute ethanol was stored at 0°C until used. Micropipetors were used to add two volumes of ice cold ethanol to nucleic acids that were to be precipitated in microcentrifuge tubes. Capped microcentrifuge tubes were placed into the micro fuge and spun at 15,000 xg for 15 minutes. The supernatant was discarded and precipitated RNA was re-dissolved in DEPC treated Dl-water. RNA was stored at 4°C in microcentrifuge tubes until ready to use.
  • RNA Fragments The following was the order of rate of migration for each fragment in order from fastest to slowest:
  • RNA RNase free Dl-water QS to lOO.OOml
  • the RNA was gently mixed then melted by heating the mixture to 70°C for 5 minutes in a heating block. The mixture was cooled to room temperature over a two hour period and the RNA was allowed to anneal in a tRNA configuration. The RNA was precipitated out of the solution.
  • RNA Ligation The following was added to a new 1.5ml polypropylene snap capped microcentrifuge tube. A 100-1000 ⁇ l pipet and new tip was used for each solution:
  • RNA T4 ligase (44 ⁇ g/ml) 22 ⁇ g
  • the mixture was incubated at 17°C in a temperature controlled refrigerator for 4.1 hours. Immediately after the incubation the tRNA was precipitated out as described in step 6.2 above and the tRNA was isolated by electrophoresis as described in the following section entitled "Polyacrylamide Gel Electrophoresis (PAGE) of Psoralenated RNA Fragments.” The tRNA was pooled in a small volume of RNase free water and stored at
  • the mixture was degassed with vacuum pressure for one minute.
  • the appropriate amount of TEMED was added, mixed gently, and then the gel mixture was poured between the glass plates to within 0.5 cm of the top.
  • the comb was immediately inserted between the glass sheets and into the gel mixture.
  • An RNAase free gel comb was used.
  • the comb produced wells for a 5 mm wide dye lane and 135 mm sample lanes.
  • the gel was allowed to polymerize for about 30-40 minutes then the comb was carefully removed.
  • the sample wells were rinsed out with a running buffer using a micropipet with a new pipet tip. The wells were then filled with running buffer.
  • RNA/loading buffer solution was loaded into the 135 mm sample wells and the appropriate volume of tracking dye in 5 mm tracking lane.
  • the samples were electrophoresed in a 5°C refrigerator. The electrophoresis was stopped when the tracking dye reached the edge of the gel.
  • the apparatus was then disassembled. Glass panels were not removed from the gel.
  • the gel-glass panel unit was placed on a UV light box. With UV filtering goggles in place, the UV lights were turned on. The RNA bands were identified. They appeared as denser shadows under UV lighting conditions.
  • RNA oligonucleotides HPLC purification of the RNA oligonucleotides was performed using anion exchange chromatography. Either the 2'-protected or 2'-deprotected forms may be chromatographed. The 2'-protected form offered the advantage of minimizing secondary structure effects and providing resistance to nucleases. If the RNA was fully deprotected, sterile conditions were required during purification.
  • Example 2 may be modified in order to purify the RNA oligonucleotides. Modification of the HPLC purification methods of Example 2, including HPLC gradient, temperature, and other parameters, may be necessary. One of skill in the art would also recognize that a one- step HPLC purification method may also be used in accordance with several embodiments of the current invention.
  • Glassware was treated by baking at 180°C for at least 8 hours.
  • Plasticware was treated by rinsing with chloroform. Alternatively, all items were soaked in 0.1% DEPC.
  • All glass and plasticware was submerged in 0.1% DEPC for two hours at 37°C.
  • the glassware was rinsed at least 5X with sterile DI water.
  • the glassware was heated to 100°C for 15 minutes or autoclaved for 15 minutes at 15 psi on a liquid cycle.
  • Tanks were washed with detergent, rinsed with water then ethanol and air dried.
  • the tank was filled with 3% (v/v) hydrogen peroxide (30ml/L) and left standing for 10 minutes at room temperature.
  • the tank was rinsed at least 5 times with DEPC treated water.
  • GIP gastroinhibitory peptide
  • SATA was added to the experimental tubes. Control tubes which did not contain SATA were also prepared.
  • the quantity of SATA used was approximately between OJ ⁇ g to 500 ⁇ g, preferably between 0.5 ⁇ g to 50 ⁇ g. 1 ⁇ l of Rnasin at 40 units/ml was added. Nuclease free water was added to make a total volume of 50 ⁇ l.
  • the amount of tRNA may need to be supplemented. For example, approximately 10 - 200 ⁇ g of tRNA may be added.
  • the quantity of the SATA should be high enough to effectively suppress stop or pseudo stop codons.
  • the quantity of the native tRNA must be high enough to out compete the SATA which does not undergo dynamic proofreading under the action of elongation factors.
  • each tube was immediately capped, parafilmed and incubated for the translation reactions at 30°C for 90 minutes.
  • the contents of each reaction tube was transferred into a 50 ⁇ l quartz capillary tube by capillary action.
  • the SATA was crosslinked with mRNA by illuminating the contents of each tube with 2-10 J/cm2 -350 nm wavelength light, as per
  • RNA for a translation was determined prior to performing definitive experiments. Serial dilutions may be required to find the optimal concentration of mRNA between 5-20 ⁇ g/ml.
  • the SATA was produced in a manner similar to the above methodology, except that uridines were substituted with pseudouridines. This technique is discussed below in Example 2.
  • Figure 5 shows the chemical structures for uridine and pseudouridine.
  • Pseudouridine is a naturally occurring base found in tRNA that forms hydrogen bonds just as uridine does, but lacks the 5-6 double bond that is the target for psoralen.
  • the SATA was produced using pseudouridine.
  • three fragments (Fig. 1) were purchased from a commercial source (Dharmacon Research Inc., Boulder, CO). Modified bases and a fragment 3 ("Fragment 3") with a pre-attached puromycin on its 3' end and a PO 4 on its 3' end were included, all of which are available commercially. The three fragments were used to facilitate manipulation of a fragment 2 ("Fragment 2") in forming the monoadduct.
  • Preferred sequences of the three fragments are as follows:
  • Fragment J 5 'PO 4 GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACOH3 ' (SEQ ID NO: 10)
  • Yeast tRNAAla or yeast tRNAPhe was preferably used. However, one skilled in the art will understand that sequences can be chosen widely from known tRNAs or by selecting sequences that will form into a tRNA-like structure. Using pseudouridine instead of uridine in Fragment 2 avoids psoralen labeling of the nontarget U's.
  • Fragment 2 was preferably used in a helical conformation to induce the psoralen to intercalate. Accordingly, a complementary strand was required. RNA or DNA was used, and a sequence, such as poly C to one or both ends, was added to facilitate separation and removal after monoadduct formation was accomplished.
  • Use of pseudouridine instead of uridines in the complement means that a high efficiency wave length, such as 365 nm, can be used with out fear of crosslinking the product. Irradiation was preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm. Further, use of pseudouridine left the furan sided monoadduct in place on Fragment 2 because the Maf is the predominate first step in the crosslink formation.
  • Step 1 Furan sided monoadduction of psoralen to fragment 2
  • the formation of a furan sided psoralen monoadduct with the target uridine of Fragment 2 was performed as follows:
  • reaction buffer was prepared as follows:
  • HMT 4'hydroxy methyl-4,5',8'-triethyl psoralen
  • UV lamp lmW/cm 2 multi-wavelength UV lamp ( ⁇ >300nm) (UV L21 model ⁇ 365 nm).
  • Steps 1 and 2 above were repeated 4 times to re-intercalate and irradiate HMT. After the second irradiation additional 10 ⁇ l of 1.6 mM HMT was added in total lOO ⁇ l reaction volume. After 4 cycles of irradiation, the free psoralens were extracted with chloroform and all oligos (labeled and unlabeled) were precipitated with ethanol overnight
  • Step 2 Purification of HMT conjugated fragment 2 (2MA) oligo by reverse-phase HPLC
  • H 2 0 RNAase free 950 ml pH adjusted to 7.0 with acetic acid and water added to 1L 2
  • the sample was loaded onto a Waters Xterra MS C18, 2.5 ⁇ m, 4.5x50 mm reverse-phase column pre-equilibrated with buffer A (5% wt/wt acetonitrile in OJM TEAA, pH 7.0)
  • the sample was eluted with a gradient of 0-55% buffer B (15% wt/wt acetonitrile in OJM TEAA, pH 7.0) to buffer A over a 35 minute time frame at a flow rate of 1 ml/minute.
  • the column temperature was 60°C and the detection wave length, set by a narrow band filter, was 340 nm.
  • Furan sided psoralen monoadduct absorbs at 340 nm but the RNA, and any pyrone sided monoadduct does not.
  • the buffer solutions were filtered and degassed before use.
  • the 2MA eluted at around 25-28 minutes at a buffer B concentration of 40%.
  • Unpsoralenated fragment 2 eluted before 8 minutes based on subsequent gel electrophoresis analysis on collected fractions.
  • the column was washed with 100% acetonitrile for 5 minutes and was re- equilibrated with buffer A for 15 minutes. All fractions were dried with speed vacuum overnight.
  • the fractions containing the 2MA were identified by the level of absorbance at 260 nm (RNA) and 330 nm (furan sided psoralen monoadducted RNA). This was done by redissolving the dried fractions with 120 ⁇ l of Rnase-free distilled water and the absorbance was measured with a spectrophotometer at 260 nm and 330 nm. The fractions with high absorbance at both wavelengths were pooled then dried with speed vacuum. A small aliquot from each was saved for gel analysis.
  • the cross-linked products were analyzed on a denaturing 20% TBE-urea gel and visualized by gel silver staining.
  • Step 3 Purification of HMT conjugated fragment 2 oligo from cRNA by anion exchange
  • the oligos were eluted at a flow rate of 1 ml/min. with a concave gradient from 4% to 55% buffer D for 15 minutes followed by a convex gradient from 55 % to 80% with buffer D for the next 15 minutes.
  • the oligos were washed with 100% buffer D for 5 min and 100% buffer C for another 5 min at a flow rate of 1.5 ml/min; Fractions were collected that absorbed 260 nm light. 2MA had a retention time (RT) of 16.2 minutes and was eluted by 57% buffer D, and free fragment 2 had RT less than 16.6 minutes, and was eluted by 55% buffer D and free cRNA had RT greater than 19.2 minutes.
  • RT retention time
  • the fractions were collected that absorbed at 254 or 260 nm. The collected fractions were dried with speed vacuum overnight. All solutions were filtered and degassed before use. The solution used comprised the following: D: 250mM NaClO4 in 25mM Tris pH 8.0 buffer.
  • Step 4 Desalting, precipitation and collection of the purified 2MA oligo
  • the samples were then brought to 4° C and centrifuged at maximum speed in a microcentrifuge for 15 minutes. The position of the pellet was noted and the supernatant was decanted or removed by pipette. Care was taken not to disturb pellet. If the pellet still contained salt, this step was repeated. The pellet was then washed with 70% pre-cooled ethanol twice. The wet pellet was dried with speed vacuum for 15 min.
  • Step 5 Ligation of2MA oligo to Fragment 3 oligo:
  • Nuclease-free water was added to final Volume of 40 ⁇ l. The mixture was incubate at 16° C overnight(16hr). The mixture was centrifuged briefly and then was placed on ice.
  • RNA was stored in ethanol at -20C. Care was taken not to store the RNA in DEPC water.
  • Step 6 Purification of the ligated fragment 3 oligo complex The dried sample was redesolved with 0.5X TE buffer and was loaded onto a
  • DNAPac PA- 100 column which was equilibrated with buffer C.
  • the column temperature was 85°C and the detector operated at 254 nm to identify fractions with RNA and at 340 nm to identify fractions with 2MaF.
  • the oligos were eluted with a convex gradient from 30% to 70% with buffer D for the first 20 minutes at a flow rate of 0.8ml/min and followed with a linear gradient from 70 % to 98% D for another 20 min at the same flow rate. The elution was completed by washing with 100% D for 7 min and 100% C for another 10 min at 1.0 ml/min flow ratef
  • the fractions were detected with 254 or 260 nm wavelength light.
  • the ligated oligos (2MA- fragment 3) were eluted after 34 min, by more than 90% buffer B. Fractions with 254 nm absorbance (A254nm>0.01) were collected and dried with speed vacuum overnight.
  • Step 7 Purified 2MA-fragment 3 desalting and precipitation: The dried fractions were re-dissolved with lOO ⁇ l Rnase free distilled water,_500 ⁇ l cool 100% ethanol with 0.5M (NH4)2CO3 was added and the mixture was vortexed briefly. The mixture was then frozen on dry ice for 60 minutes or stored at -20C overnight.
  • the samples were brought to 4° C and centrifuged at maximum speed in a microcentrifuge for 15 minutes. The position of the pellet was noted and the supernatant decanted or removed by pipette. Care was taken not to disturb pellet. If still containing salt, this step was repeated. The pellet was then washed with 70% pre-cooled ethanol twice. The wet pellet was dried with speed vacuum for 15 min.
  • Step 8 Preparation of SATA A. RNA Oligo 5'phosphorylation 1. Reagent and instrument: • Nuclease-Free Water (Cat.# P 1193 Promega)
  • Pheno 1 chloro form Sterile microcentrifuge tubes 100% ethanol • 70% ethanol
  • Polynucleotide Kinase exhibits 100% activity in this buffer. Fresh buffer is required for optimal activity (in older buffers, loss of DTT due to oxidation lowers activity.
  • Fragment 3 molar ratio should be 1 :1.1 to avoid fragment 1 self-ligation.
  • MgCl 2 was added to T4 ligase buffer (50mM Tris-HCl.-(pH 7.8), 10 mM MgCl 2 , 10 mM DTT and ImM ATP) to final 20 mM concentration.
  • Add Rnase free albumin to final 5 ⁇ g/ml.
  • the final volume should be no more than lOO ⁇ l.
  • the solution was heated to 70° C for 5 min, then was cooled from 70° C to 26° C over 2 hours and cooled from 26°C to 0°C over 40 minutes. Incubate at 16°C for 16 to 17 hours using PCR instrument.
  • the samples were brought to 4°C and centrifuged at maximum speed in a microcentrifuge for 15 minutes. The position of the pellet was noted and the supernatant decanted or removed by pipette. Care was taken not to disturb pellet.
  • the pellet was then washed with 70% pre-cooled ethanol twice. After removing the ethanol, the wet pellet was dried with a speed vacuum for 15 min. The dried pellet was stored at -20°C, until the next step.
  • a luciferase mRNA which was modified to have the stop codon corresponding to that recognized by the anticodon of the SATA ( in the present case UAG) was used in a standard Promega in vitro translation kit in the recommended 1 ⁇ l of concentration 1 ⁇ g/ ⁇ l.
  • SATA in the present case UAG
  • SATA was added to the experimental tubes. Control tubes which did not contain SATA were also prepared. The quantity of SATA used was approximately between OJ ⁇ g to 500 ⁇ g, preferably between 0.5 ⁇ g to 50 ⁇ g. 1 ⁇ l of Rnasin at 40 units/ml was added. Nuclease free water was added to make a total volume of 50 ⁇ l.
  • the amount of tRNA may need to be supplemented. For example, approximately 10 - 200 ⁇ g of tRNA may be added.
  • the quantity of the SATA should be high enough to effectively suppress stop or pseudo stop codons.
  • the quantity of the native tRNA must be high enough to out compete the SATA which does not undergo dynamic proofreading under the action of elongation factors.
  • Each tube was immediately capped, parafilmed and incubated for the translation reactions at 30°C for 90 minutes. The contents of each reaction tube was transferred into a 50 ⁇ l quartz capillary tube by capillary action.
  • the SATA was crosslinked with mRNA by illuminating the contents of each tube with 2-10 J/cm2 -350 nm wavelength light, as per Gasparro et al. (Photochem. Photobiol. 57:1007 (1993), herein incorporated by reference). Following photocrosslinking, the contents of each tube were transferred into a new snapcap microfuge tube. The ribosomes were dissociated by chelating the calcium cations by adding 2 ⁇ l of 10 mM EDTA to each tube. Between each step, each tube was gently mixed by stirring each component with a pipette tip upon addition.
  • RNA for a translation was determined prior to performing definitive experiments. Serial dilutions may be required to find the optimal concentration of mRNA between 5-20 ⁇ g/ml.
  • Fragments 1, 2 and 3, described above in Example 1 have the following alternate sequences:
  • Fragment 1 (SEQ ID NO: 13): 5' PO4 GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGA N3-Methyl-U 3'
  • Fragment 2 (SEQ ID NO: 14): 5' UCUAAG ⁇ C ⁇ GGAGG 3' Fragment 3

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés et des réactifs permettant de sélectionner une protéine ou une molécule d'acide nucléique recherchée par liaison de ARNm, à séquences connues ou inconnues, à sa protéine traduite afin de former une paire d'isoaccepteurs. Cette paire d'isoaccepteurs est sélectionnée en fonction des propriétés recherchées de la protéine ou de l'acide nucléique. Le procédé comprend également l'évolution d'une protéine ou d'un acide nucléique recherché par amplification de la partie d'acide nucléique de la paire d'isoaccepteurs sélectionnée, introduction d'une variation dans cet acide nucléique, traduction de cet acide nucléique, attachement de cet acide nucléique à sa protéine pour former une seconde paire d'isoaccepteurs, et nouvelle sélection de cette paire d'isoaccepteurs en fonction des propriétés recherchées.
PCT/US2002/037103 2000-05-19 2002-11-18 Selection et evolution d'acides nucleiques et de polypeptides WO2003044194A1 (fr)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2002356984A AU2002356984A1 (en) 2001-11-16 2002-11-18 Selection and evolution of nucleic acids and polypeptides
US10/847,484 US20040229271A1 (en) 2000-05-19 2004-05-17 Compositions and methods for the identification and selection of nucleic acids and polypeptides
US10/847,087 US7410761B2 (en) 2000-05-19 2004-05-17 System for rapid identification and selection of nucleic acids and polypeptides, and method thereof
US10/960,453 US7488600B2 (en) 2000-05-19 2004-10-07 Compositions and methods for the identification and selection of nucleic acids and polypeptides
US11/415,844 US20070015181A1 (en) 2000-05-19 2006-05-02 System and methods for nucleic acid and polypeptide selection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US34696501P 2001-11-16 2001-11-16
US60/346,965 2001-11-16

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US09/859,809 Continuation-In-Part US6962781B1 (en) 2000-05-19 2001-05-17 In vitro evolution of nucleic acids and encoded polypeptide

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US10/847,087 Continuation-In-Part US7410761B2 (en) 2000-05-19 2004-05-17 System for rapid identification and selection of nucleic acids and polypeptides, and method thereof
US10/847,484 Continuation-In-Part US20040229271A1 (en) 2000-05-19 2004-05-17 Compositions and methods for the identification and selection of nucleic acids and polypeptides

Publications (1)

Publication Number Publication Date
WO2003044194A1 true WO2003044194A1 (fr) 2003-05-30

Family

ID=23361771

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2002/037103 WO2003044194A1 (fr) 2000-05-19 2002-11-18 Selection et evolution d'acides nucleiques et de polypeptides

Country Status (2)

Country Link
AU (1) AU2002356984A1 (fr)
WO (1) WO2003044194A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1692155A2 (fr) * 2003-12-12 2006-08-23 Proteonova, Inc. Systemes et procedes pour la selection d'acide nucleique et de polypeptide
JP2008526973A (ja) * 2005-01-12 2008-07-24 プロテオノヴァ、 インコーポレイテッド 標的治療薬を作製する方法
US7488600B2 (en) 2000-05-19 2009-02-10 Proteonova, Inc. Compositions and methods for the identification and selection of nucleic acids and polypeptides
EP2118344A2 (fr) * 2007-02-12 2009-11-18 Proteonova, Inc. Generation d'une bibliotheque de polypeptides aleatoires solubles lies a l'arnm
US10206998B2 (en) 2005-01-12 2019-02-19 Proteonova, Inc. Modular targeted therapeutic agents and methods of making same
EP4174179A3 (fr) * 2005-08-23 2023-09-27 The Trustees of the University of Pennsylvania Arn contenant des nucléosides modifiées et leurs procédés d'utilisation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6261804B1 (en) * 1997-01-21 2001-07-17 The General Hospital Corporation Selection of proteins using RNA-protein fusions
US20020031762A1 (en) * 1998-04-17 2002-03-14 Charles Everett Merryman Method for producing diverse libraries of encoded polypeptides
US6429300B1 (en) * 1999-07-27 2002-08-06 Phylos, Inc. Peptide acceptor ligation methods

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6261804B1 (en) * 1997-01-21 2001-07-17 The General Hospital Corporation Selection of proteins using RNA-protein fusions
US20020031762A1 (en) * 1998-04-17 2002-03-14 Charles Everett Merryman Method for producing diverse libraries of encoded polypeptides
US6429300B1 (en) * 1999-07-27 2002-08-06 Phylos, Inc. Peptide acceptor ligation methods

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7488600B2 (en) 2000-05-19 2009-02-10 Proteonova, Inc. Compositions and methods for the identification and selection of nucleic acids and polypeptides
JP2007513631A (ja) * 2003-12-12 2007-05-31 プロテオノヴァ、 インコーポレイテッド 核酸およびポリペプチドを選択する系ならびに方法
EP1692155A2 (fr) * 2003-12-12 2006-08-23 Proteonova, Inc. Systemes et procedes pour la selection d'acide nucleique et de polypeptide
EP1692155A4 (fr) * 2003-12-12 2008-08-06 Proteonova Inc Systemes et procedes pour la selection d'acide nucleique et de polypeptide
JP2015091871A (ja) * 2005-01-12 2015-05-14 プロテオノヴァ、 インコーポレイテッドＰｒｏｔｅｏｎｏｖａ， Ｉｎｃ． 標的治療薬を作製する方法
JP2013138674A (ja) * 2005-01-12 2013-07-18 Proteonova Inc 標的治療薬を作製する方法
JP2008526973A (ja) * 2005-01-12 2008-07-24 プロテオノヴァ、 インコーポレイテッド 標的治療薬を作製する方法
US9193795B2 (en) 2005-01-12 2015-11-24 Proteonova, Inc. Method for making targeted therapeutic agents
US10206998B2 (en) 2005-01-12 2019-02-19 Proteonova, Inc. Modular targeted therapeutic agents and methods of making same
US11633474B2 (en) 2005-01-12 2023-04-25 Proteonova, Inc. Modular targeted therapeutic agents and methods of making same
EP4174179A3 (fr) * 2005-08-23 2023-09-27 The Trustees of the University of Pennsylvania Arn contenant des nucléosides modifiées et leurs procédés d'utilisation
US11801314B2 (en) 2005-08-23 2023-10-31 The Trustees Of The University Of Pennsylvania RNA containing modified nucleosides and methods of use thereof
EP2118344A2 (fr) * 2007-02-12 2009-11-18 Proteonova, Inc. Generation d'une bibliotheque de polypeptides aleatoires solubles lies a l'arnm
EP2118344A4 (fr) * 2007-02-12 2011-08-03 Proteonova Inc Generation d'une bibliotheque de polypeptides aleatoires solubles lies a l'arnm
US9080256B2 (en) 2007-02-12 2015-07-14 Proteonova, Inc. Generation of library of soluble random polypeptides linked to mRNA
US9920453B2 (en) 2007-02-12 2018-03-20 Proteonova, Inc. Generation of library of soluble random polypeptides linked to mRNA

Also Published As

Publication number Publication date
AU2002356984A1 (en) 2003-06-10

Similar Documents

Publication Publication Date Title
US7488600B2 (en) Compositions and methods for the identification and selection of nucleic acids and polypeptides
US11773441B2 (en) High throughput multiomics sample analysis
US7351812B2 (en) In vitro evolution of nucleic acids and encoded polypeptide
Lamla et al. Searching sequence space for high-affinity binding peptides using ribosome display
CA2409305C (fr) Evolution in vitro d'acides nucleiques et de polypeptides codes
AU2001261771A1 (en) In vitro evolution of nucleic acids and encoded polypeptide
JP2021063132A (ja) 標的治療薬を作製する方法
AU2014365162A1 (en) Production of encoded chemical libraries
CN110637086A (zh) Rna分子与肽的复合体的制造方法及其利用
WO2005003778A2 (fr) Procede d'identification d'une molecule synthetique ayant une affinite pour une cible
US20070015181A1 (en) System and methods for nucleic acid and polypeptide selection
WO2003044194A1 (fr) Selection et evolution d'acides nucleiques et de polypeptides
Valencia et al. In vitro selection of proteins with desired characteristics using mRNA-display
US7410761B2 (en) System for rapid identification and selection of nucleic acids and polypeptides, and method thereof
JP2004097213A (ja) 核酸および／またはタンパク質の選択方法
JPWO2005024018A1 (ja) 核酸構築物およびその製造方法
AU2004314705A1 (en) System and methods for nucleic acid and polypeptide selection
US20240016927A1 (en) Modular targeted therapeutic agents and methods of making same

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SC SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP