EP1692155A2 - Systemes et procedes pour la selection d'acide nucleique et de polypeptide - Google Patents
Systemes et procedes pour la selection d'acide nucleique et de polypeptideInfo
- Publication number
- EP1692155A2 EP1692155A2 EP04821258A EP04821258A EP1692155A2 EP 1692155 A2 EP1692155 A2 EP 1692155A2 EP 04821258 A EP04821258 A EP 04821258A EP 04821258 A EP04821258 A EP 04821258A EP 1692155 A2 EP1692155 A2 EP 1692155A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- molecule
- protein
- mrna
- trna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1062—Isolating an individual clone by screening libraries mRNA-Display, e.g. polypeptide and encoding template are connected covalently
Definitions
- the present invention relates generally to compositions and methods for the identification and selection of nucleic acids and polypeptides.
- Ligand-receptor interactions are of interest for many reasons, from elucidating basic biological site recognition mechanisms to drug screening and rational drag design. It has been possible for many years to drive in vitro evolution of nucleic acids by selecting molecules out of large populations that preferentially bind to a selected target, then amplifying and mutating them for subsequent re-selection (Tuerk and Gold, Science 249:505 (1990), herein incorporated by reference). The ability to perform such a selection process with proteins would be extremely useful.
- proteins that bind specifically to chosen ligands.
- the use of proteins, as compared to nucleic acids, is particularly advantageous because the twenty diverse amino acid side chains in proteins have far more binding possibilities than the four similar chains in nucleic acid side. Further, many biologically and medically relevant ligands bind proteins. Both nucleic acid and protein evolution methods require access to a large and highly varied population of test molecules, a way to select members of the population that exhibit the desired properties, and the ability to reproduce the selected molecules with mutated variations to obtain another large population for subsequent selection.
- Embodiments of present invention provides compositions and methods to select and evolve desired properties of proteins and nucleic acids.
- the current invention provides modified tRNA's and tRNA analogs.
- Other embodiments include methods for generating polypeptides, assays enabling selection of individual members of the population of polypeptides having desired characteristics, methods for amplifying the nucleic acids encoding such selected polypeptides, and methods for generating new variants to screen for enhanced properties.
- the present invention permits the attachment of a protein to its message without requiring modification of native mRNA, although modified mRNA may still be used.
- the specificity of the methods embodied in various aspects of the cunent invention are determined by the specificity of the codon- anticodon interaction.
- the invention permits the selection of nucleic acids by selecting the proteins for which they code. This may be accomplished by connecting the protein to its cognate mRNA at the end of translation, which in turn is done by connecting both the protein and mRNA to a tRNA or tRNA analog.
- a prefened embodiment of the invention includes a tRNA molecule capable of covalently linking a nucleic acid encoding a polypeptide and the polypeptide to the tRNA, wherein the linkage of the nucleic acid occurs on a portion of the tRNA other than the linkage to the polypeptide and wherein the tRNA comprises a linking molecule associated with the anticodon of the tRNA.
- This anticodon of the tRNA is capable of forming a crosslink to the mRNA under inadiation with light of a required wavelength, preferably a furan-sided psoralen monoadduct on the anticodon inadiated with UVA, preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
- a required wavelength preferably a furan-sided psoralen monoadduct on the anticodon inadiated with UVA
- an amino acid or amino acid analog is attached to the 3' end of a tRNA molecule by a stable bond to generate a stable aminoacyl tRNA analog (SAT A).
- RNA comprising a psoralen, preferably located in the 3' region of the reading frame, more preferably at the most 3' codon of the reading frame, most preferably at the 3' stop codon of the reading frame.
- linkage between the tRNA and the mRNA is a cross-linked psoralen molecule, more preferably a furan-sided psoralen monoadduct.
- a further embodiment of the invention provides a method of forming a monoadduct.
- a target oligonucleotide with at least one uridine and at least one modified uridine is contacted with psoralen, and the target olignucleotide and psoralen are coupled to form a monoadduct.
- the modified uridine according to this embodiment may be modified to avoid coupling with psoralen, and preferably the modified uridine is pseudouridine.
- the target oligonucleotide may be a tRNA molecule, such as tRNA, modified tRNA and tRNA analogs or a mRNA molecule, such as mRNA, modified mRNA and mRNA analogs.
- the psoralen is coupled to the target oligonucleotide by one or more cross-links.
- a second oligonucleotide with a nucleotide sequence complementary to the target oligonucleotide sequence may be present.
- This second oligonucleotide may contain no uridine or may contain uridine residues that are modified to avoid cross-linking with the target oligonucleotide.
- the modified uridine is pseudouridine.
- RNA-polypeptide complex a method of stably linking a nucleic acid, a tRNA, and a polypeptide encoded by the nucleic acid together to form a linked nucleotide-polypeptide complex.
- the nucleic acid is an mRNA and the linked nucleotide-polypeptide complex is a mRNA- polypeptide complex.
- the method can further comprise providing a plurality of distinct nucleic acid-polypeptide complexes, providing a ligand with a desired binding characteristic, contacting the complexes with the ligand, removing unbound complexes, and recovering complexes bound to the ligand.
- this invention comprises amplifying the nucleic acid component of the recovered complexes and introducing variation to the sequence of the nucleic acids.
- the method further comprises translating polypeptides from the amplified and varied nucleic acids, linking them together using tRNA, and contacting them with the ligand to select another new population of bound complexes.
- Several embodiments of the present invention use selected protein-mRNA complexes in a process of in vitro evolution, in particular the iterative process in which the selected mRNA is reproduced with variation, translated and again connected to cognate protein for selection. In one embodiment, a strategy for selection is provided.
- this strategy comprises the production of mRNA libraries.
- RNA ligation is used.
- RNA ligation using T4 RNA ligase is used.
- a diagnostic test for Severe Acute Respiratory Syndrome (SARS) is provided.
- SARS Severe Acute Respiratory Syndrome
- nucleic acid sequence linked to a disease is known
- several embodiments of this invention can be used to quickly and accurately identify and select the conesponding protein. This protein can be then be mass-produced and used as diagnostic or therapeutic agents.
- an protein linked to a disease is known
- several embodiments of this invention can permit the rapid identification of the conesponding nucleic acid. The nucleic acid can then be used as a diagnostic or therapeutic agent.
- Another advantage of several embodiments of the present invention is the ability to overcome the inability of the proteins to reproduce themselves and the inability to link mRNA encoding a polypeptide with the translated product.
- the peptides are exposed to a selected ligand. Selection or binding of the peptide by the ligand also selects the attached coding sequence, which can then be reproduced by standard means.
- Both Roberts and Szostak and Nemoto et al. used the technique of attaching a puromycin molecule to the 3' end of a coding sequence by a DNA linker or other non-translatable chain.
- Puromycin is a tRNA acceptor stem analog which accepts the nascent peptide chain under the action of the ribosomal peptidyl fransferase and binds it stably and ineversibly, thereby halting translation.
- coding sequence encoding each peptide must be known and be modified both initially and between each selection; (2) selection of native unknown mRNAs only; (3) the modification of the coding sequence adds several steps to the process; and (4) the attached puromycin on the linker molecules may compete in the translation reaction with the native tRNAs for the A site on the ribosome reading its coding sequence or a nearby ribosome, and could thus "poison" the translation process, just as would unattached puromycin in the translation reaction solution.
- the cunent invention provides tRNA molecules, which include modified tRNAs and tRNA analogs.
- tRNA molecules include native or unmodified tRNAs.
- Other embodiments include methods for generating polypeptides, assays enabling selection of individual members of a population of polypeptides having desired characteristics, methods for amplifying the nucleic acids encoding such selected polypeptides, and methods for generating new variants to screen for enhanced properties.
- the present invention permits the attachment of a protein to its respective mRNA without requiring modification of native mRNA.
- a vaccine for SARS, and a method for making same are provided. Only minimal modification is needed.
- extensively modified mRNA can be used.
- the specificity of the methods embodied in some embodiments are determined by the specificity of the codon-anticodon interaction.
- the invention permits the selection of nucleic acids by selecting the proteins for which they code. This, in one embodiment, this is accomplished by connecting the protein to its cognate mRNA at the end of translation, which in turn is done by connecting both the protein and mRNA to a tRNA molecule.
- a method for identifying a desired protein or nucleic acid molecule is provided.
- at least two mRNA molecules are provided. At least one of the mRNA molecules comprises a stop codon and/or a pseudo stop codon. The mRNA molecules is franslated to generate at least one franslated protein.
- the mRNA molecules is linked, coupled or associated to its conesponding franslated protein using a tRNA molecule to form at least one cognate pair. At least one of the mRNA molecules is connected to the tRNA molecule by a crosslinker.
- the cognate pairs is identified using a property of the franslated protein or the mRNA molecule.
- An mRNA molecule of the selected cognate pair, a nucleic acid molecule complementary to the mRNA molecule and/or a nucleic acid molecule homologous to the mRNA molecule is identified, thereby identifying the desired protein or the desired nucleic acid molecule.
- the tRNA molecule is a stable aminoacyl tRNA analog (SAT A).
- a SATA is an entity which can recognize a selected codon such that it can accept a peptide chain by the action of the ribosomal peptidyl fransferase, preferably when the cognate codon is in the reading position of the ribosome.
- the SATA comprises a puromycin and a crosslinker that are both located on the SATA.
- the term "located on” as used herein shall be given its ordinary meaning and shall also meaning positioned on, incorporated in, attached to, coupled to, bound to, or integral to.
- the SATA comprises a puromycin, but the crosslinker is located on the mRNA molecule.
- the crosslinker is located only on the mRNA and not on the tRNA.
- the tRNA molecule is a Linking tRNA Analog.
- a crosslinker is located on the Linking tRNA Analog, and no puromycin is present.
- the tRNA molecule is a Nonsense Suppressor tRNA.
- a crosslinker is located not on the tRNA, but on the mRNA, and no puromycin is present.
- the crosslinker is located only on the mRNA and not on the tRNA.
- the Nonsense Suppressor tRNA is a substantially unmodified native tRNA.
- the crosslinker is an agent that chemically or mechanically links two molecules together.
- the crosslinker is an agent that can be activated to form one or more covalent bonds with tRNA and/or mRNA.
- the crosslinker is a sulfur-substituted nucleotide.
- the crosslinker is a halogen-substituted nucleotide. Examples of crosslinkers include, but are not limited to, 2-thiocytosine, 2-thiouridine, 4-thiouridine, 5-iodocytosine, 5-iodouridine, 5-bromouridine and 2-chloroadenosine, aryl azides, and modifications or analogues thereof.
- the crosslinker is psoralen or a psoralen analog.
- One or more crosslinkers can be used, and the locations of these crosslinkers can be varied.
- the crosslinker is located on the mRNA.
- the crosslinker is located on the tRNA molecule.
- the crosslinker is located on or near a codon.
- the crosslinker is located on or near a stop or pseudo stop codon.
- the crosslinker is located on or near an anticodon of the RNA molecule.
- the crosslinker is located on or near a stop or pseudo stop anticodon of the RNA molecule.
- the crosslinker forms a bond or coupling between the tRNA molecule and the mRNA molecule.
- the tRNA molecule is connected to its franslated protein by ribosomal peptidyl fransferase.
- the tRNA molecule is connected to the mRNA through an ultraviolet-induced crosslink between the anticodon of the tRNA molecule and the codon of the mRNA.
- the tRNA molecule has a stable peptide acceptor.
- the stable peptide acceptor in one embodiment, is a puromycin or puromycin analog.
- the tRNA molecule is operable to accept a peptide chain and hold the chain in a stable manner such that ribosomal peptidyl fransferase cannot detach it.
- the tRNA molecule comprises a moiety which binds to the ribosome, accepts the peptide chain, and then does not act as a donor in the next transpeptidation.
- the moiety can be located on the tRNA.
- the moiety includes, but is not limited to, a 2' ester on a 3' deoxy adenosine, an amino acyl tRNAox-red and a puromycin.
- One or more moieties may be located on the tRNA molecule.
- the mRNA molecule is unfranslatable beyond a linking codon.
- the tRNA molecule accepts a peptide chain and holds the chain in a manner such that ribosomal peptidyl fransferase cannot detach it because the message in subsequent codons is untranslatable.
- the tRNA molecule accepts a peptide chain and holds the chain in a manner such that ribosomal peptidyl fransferase cannot detach it because the message is unfranslatable.
- the message can be unfranslatable because it is at the end of the message or because the tRNAs that recognize the appropriate codons have been depleted.
- translation is performed in vitro. In another embodiment, translation is performed in situ. In yet another embodiment, in vivo translation is provided. In another embodiment of the invention, the method further comprises selecting a desired nucleic acid or protein by providing a plurality of cognate pairs, binding at least one of these cognate pairs with one or more binding agents, and selecting the desired protein or nucleic acid molecule based upon a reaction to the binding agents. Section can also be performed based on a lack of reaction to a binding agent.
- the step of providing a plurality of cognate pairs comprises providing one or more cognate pairs on or in a medium selected from the group consisted from one or more of the following: a matrix, in solution, on beads, and on an anay.
- cognate pairs can be placed in any medium suitable for further binding or selection.
- the cognate pair is selected based upon ligand binding.
- Ligands include, but are not limited to, proteins, nucleic acids, chemical compounds, polymers and metals.
- the reaction is selected from the group consisting of one or more of the following: ligand binding, immunoprecipitation, and enzymatic reactions.
- any reaction that serves to distinguish the target molecule can be used.
- the method further comprises selecting a desired nucleic acid molecule.
- the method comprises providing an anay of nucleic acids, wherein the nucleic acids are placed in a predetermined position, hybridizing at least one of the cognate pairs onto the anay, reacting the cognate pairs with one or more binding agents, and selecting the desired nucleic acid molecule based upon a reaction or lack of a reaction to the binding agent.
- Binding agents include, but are not limited to ligands, described above. One skilled in the art will understand that any reaction that serves to distinguish the desired nucleic acid molecule can be used.
- the method further comprises determining the DNA sequence of the translated protein.
- the method comprises providing an anay of two or more DNA sequences, wherein the DNA sequences are placed in a predetermined position, exposing the anay to one or more cognate pairs, wherein one or more cognate pairs comprises an mRNA portion and a protein portion, hybridizing the mRNA portion of the cognate pairs onto the anay, exposing the protein portion of one or more cognate pairs to a binding agent, thereby producing a reaction or a non-reaction, and selecting the desired protein based upon the reaction or non- reaction to the binding agent, such as a ligand, thereby determining the DNA sequence of the translated protein.
- a modified mRNA molecule operable to crosslink to a tRNA molecule comprises a crosslinker located on or near a stop codon. In one embodiment, the modified mRNA molecule comprises a crosslinker located on or near a pseudo stop codon. In one embodiment, the crosslinker is an agent that can be activated to form one or more covalent bonds with the tRNA. In one embodiment, the crosslinker is an agent that is activated to form one or more covalent bonds with the tRNA using light. In another embodiment, the crosslinker is a modified base that is incorporated directly into the mRNA.
- crosslinker is selected from the group consisting of one or more of the following 2-thiocytosine, 2-thiouridine, 4-thiouridine, 5- iodocytosine, 5-iodouridine, 5-bromouridine and 2-chloroadenosine, aryl azides, and modifications or analogues thereof.
- the crosslinker is psoralen.
- a kit to generate cognate pairs is provided.
- the kit is a compilation, collection, system or group of items that comprise at least one psoralen monoadduct attached to a nonadducted stable aminoacyl tRNA analog.
- the kit comprises at least one psoralen monoadduct attached to an oligonucleotide.
- the kit comprises instructions regarding the generation of cognate pairs.
- the kit comprises additional chemicals, agents or equipment that would be useful to generate cognate pairs.
- a method for evolving desired sequences is provided.
- the method comprises: providing at least two candidate mRNA molecules, wherein the mRNA molecule contains a stop codon and/or a pseudo stop codon; translating at least two of the mRNA molecules to generate at least one franslated protein, linking at least one of the mRNA molecules to its conesponding franslated protein via a tRNA molecule to form at least one cognate pair, wherein at least one of the candidate mRNA molecules is connected to the tRNA molecule by a crosslinker, identifying one or more of the cognate pairs based upon the properties of the franslated protein or the mRNA molecule, identifying a molecule selected from the group consisting of one or more of the following: an mRNA molecule of the selected cognate pair, a nucleic acid molecule complementary to the mRNA molecule and a nucleic acid molecule homologous to the mRNA molecule, thereby identifying the desired protein or the desired nucleic acid molecule.
- the method further comprises providing a plurality of cognate pairs, binding at least of the plurality of cognate pairs with one or more binding agents, selecting the desired or protein nucleic acid molecule based upon a reaction or lack of a reaction to the one or more binding agents, thereby selecting a first desired cognate pair.
- the method further comprises recovering the first desired cognate pair to generate a recovered cognate pair, amplifying a first nucleic acid component of the recovered cognate pair, producing a second nucleic acid component, wherein the second nucleic acid component comprises the first nucleic acid component with one or more variations, producing a second protein by translating the second nucleic acid component, linking the second protein with the second nucleic acid component to generate a second desired cognate pair, and obtaining the desired protein sequence by re-selecting the second desired cognate pair based upon at least one desired property.
- the desired sequence is a sequence for is one or more sequences for the SARS virus.
- the desired property is selected from the group consisting of one or more of the following: binding properties, enzymatic reactions and chemical modifications. In one embodiment, the desired property is a lack of a reaction (or an ability to resist binding, enzymatic reaction or chemical modification).
- the step of selecting the first desired cognate pair comprises: providing a first ligand with a desired binding characteristic, contacting one or more of the first cognate pairs with the first ligand to generate unbound complexes and bound complexes, recovering either the bound complexes or the unbound complexes, amplifying at least one nucleic acid component of the recovered complexes, infroducing variation to a sequence of the nucleic acid component of the recovered complexes, translating one or more second proteins from the nucleic acid components, linking at least one of the second proteins with at least one of the second nucleic acid components to generate one or more second cognate pairs, and obtaining the desired protein sequence by contacting the at least one of the second cognate pairs with at least one second ligand to select one or more of the second cognate pairs, wherein the second ligand is the same or different than the first ligand.
- One embodiment of the invention is directed to a method of forming a monoadduct which includes the steps of providing a target oligonucleotide including at least one uridine and at least one modified uridine,contacting said target oligonucleotide with psoralen, andcoupling said psoralen to said target oligonucleotide to form a monoadduct.
- One embodiment of the invention is directed to a method for identifying and selecting a desired protein or nucleic acid molecule including the steps of providing at least two candidate mRNA molecules, wherein at least one of said mRNA molecules contains at least one codon which is a stop codon or a pseudo stop codon; translating at least two of said candidate mRNA molecules to generate at least one franslated protein; linking at least one of said candidate mRNA molecules to its conesponding translated protein via a tRNA molecule to form at least one cognate pair, wherein at least one of said candidate mRNA molecules is connected to said tRNA molecule by a crosslinker; identifying one or more of said cognate pairs based upon the properties of said translated protein or said mRNA molecule; identifying a molecule which is one or more of the following: an mRNA molecule of said selected cognate pair, a nucleic acid molecule complementary to said mRNA molecule and a nucleic acid molecule homologous to said mRNA molecule, thereby identifying said
- the invention comprises a method of forming a psoralen monoadduct on a nucleic acid.
- the method comprises providing a first nucleic acid and a second nucleic acid, wherein the first nucleic acid and the second nucleic acid are substantially complementary to each other, wherein the first nucleic acid comprises one or more uridine monoadduct targets, and wherein the second nucleic acid comprises at least one pseudouridine.
- the method further comprises hybridizing at least a portion of the first nucleic acid and the second nucleic acid in the presence of psoralen to form a hybrid, inadiating the hybrid with ultraviolet light, thereby forming the psoralen monoadduct on the first nucleic acid.
- one or more uridine monoadduct targets comprises a uridine located adjacent to an adenosine, preferably 3' from the adenosine.
- a method of producing a psoralen monoadduct or a crosslink is provided.
- the method comprises providing a first nucleic acid and a second nucleic acid, wherein the first nucleic acid and the second nucleic acid are substantially complementary to each other, wherein the first nucleic acid comprises one or more uridine monoadduct targets or crosslink targets and one or more uridine monoadduct non-targets or crosslink non-targets, and wherein the uridine monoadduct non-targets or crosslink non-targets are operable to be replaced with one or more pseudouridines.
- the method further comprises replacing one or more of the uridine monoadduct non-targets or crosslink non-targets with pseudouridine, hybridizing at least a portion of the first nucleic acid and the second nucleic acid in the presence of psoralen to form a hybrid; and inadiating the hybrid, thereby forming the psoralen monoadduct or the crosslink on the first nucleic acid on the targets, while protecting the nontargets.
- visible light is used to form the adduct or crosslink.
- ultraviolet light is used.
- One embodiment of the invention is directed to a method for evolving a desired protein sequence which includes the steps of providing at least two candidate mRNA molecules, wherein at least one of said mRNA molecules contains at least one codon which is a stop codon or a pseudo stop codon; translating at least two of said candidate mRNA molecules to generate at least one translated protein; linking at least one of said candidate mRNA molecules to its conesponding translated protein via a tRNA molecule to form at least one cognate pair, wherein at least one of said candidate mRNA molecules is connected to said tRNA molecule by a crosslinker; identifying one or more of said cognate pairs based upon the properties of said franslated protein or said mRNA molecule; identifying a molecule selected from one or more of the following: an mRNA molecule of said selected cognate pair, a nucleic acid molecule complementary to said mRNA molecule and a nucleic acid molecule homologous to said mRNA molecule, thereby identifying said desired protein or said desired nucleic
- the step of selecting said first desired cognate pair includes the steps of providing a first ligand with a desired binding characteristic; contacting one or more of said first cognate pairs with said first ligand to generate unbound complexes and bound complexes; recovering either the bound complexes or the unbound complexes; amplifying at least one nucleic acid component of the recovered complexes; infroducing variation to a sequence of said nucleic acid component of said recovered complexes; translating one or more second proteins from said nucleic acid components, linking at least one of said second proteins with at least one of said second nucleic acid components to generate one or more second cognate pairs; and obtaining the desired protein sequence by contacting said at least one of said second cognate pairs with at least one second ligand to select one or more of said second cognate pairs, wherein said second ligand is the same or different than said first ligand.
- Some embodiments are directed to a method of forming a psoralen monoadduct on a nucleic acid, including the steps of providing a first nucleic acid and a second nucleic acid, wherein said first nucleic acid and said second nucleic acid are substantially complementary to each other, wherein said first nucleic acid comprises one or more uridine monoadduct targets, and wherein said second nucleic acid comprises at least one pseudoridine hybridizing said first nucleic acid and said second nucleic acid in the presence of psoralen to form a hybrid; inadiating said hybrid with ultraviolet light, thereby forming said psoralen monoadduct on said first nucleic acid.
- Some embodiments are directed to a method of producing a psoralen monoadduct or a crosslink, including the steps of providing a first nucleic acid and a second nucleic acid; wherein said first nucleic acid and said second nucleic acid are substantially complementary to each other; wherein said first nucleic acid includes one or more uridine monadduct targets or crosslink targets and one or more uridine monoadduct non-targets or crosslink non-targets; wherein said uridine monoadduct non-targets or crosslink non-targets are operable to be replaced with one or more pseudouridines; replacing one or more of said uridine monoadduct non-targets or crosslink non-targets with pseudouridine; hybridizing said first nucleic acid and said second nucleic acid in the presence of psoralen to form a hybrid; inadiating said hybrid, thereby forming said psoralen monoadduct or said crosslink on said first nucleic acid on said targets, while protecting said nontargets
- Several embodiments of the present invention are direct to vaccine production.
- a less stringent selection is used so as to have a high number of different sequences and use multiple rounds of mutation with gradual increase in the stringency to evolve a large population of proteins with a high binding affinity.
- Such proteins are of value for making vaccines.
- the logic is similar to an anti-idiotype vaccine except that there will be one and only one surface epitope that can react with the immune system. The aggregate concenfration of the desired protein presented to the immune system by the family of proteins will be sufficiently high to reach the threshold level required to stimulate a T-cell and B-cell response.
- the vaccine will stimulate antibody production only against the desired epitope and not against any of the other epitopes present on the family of proteins. This will prevent production of antibodies that could inactivate the vaccine.
- the vaccine will be synthesized such that it will stimulate antibody production against the desired epitope and one or more other epitopes that have either a neutral or synergistic effect with activation of the desired epitope.
- Figure 1 illustrates schematically one example of the complex formed by the mRNA and its protein product when linked by a modified tRNA or analog.
- a codon of the mRNA pairs with the anticodon of a modified tRNA and is covalently crosslinked to a psoralen monoadduct, or a non-psoralen crosslinker or aryl azidesby UV inadiation.
- the translated polypeptide is linked to the modified tRNA via the ribosomal peptidyl fransferase. Both linkages occur while the mRNA and nascent protein are held in place by the ribosome.
- Figure 2 illustrates schematically an example of the in vitro selection and evolution process, wherein the starting nucleic acids and their protein products are linked (e.g., according to Figure 1) and are selected by a particular characteristic exhibited by the protein.
- Proteins not exhibiting the particular characteristic are discarded and those having the characteristic are amplified with variation, preferably via amplification with variation of the mRNA, to form a new population.
- nonbinding proteins will be selected.
- the new population is franslated and linked via a modified tRNA or analog, and the selection process is repeated. As many selection and amplification/mutation rounds as desired can be performed to optimize the protein product.
- Figure 3 illustrates one method of construction of a tRNA molecule of the invention.
- tRNA a nucleic acid encoding an anticodon loop and having a molecule capable of stably linking to mRNA (such as psoralen, as used in this example), and the 3' end of tRNA modified with a terminal puromycin molecule are ligated to form a complete modified tRNA for use in the in vitro evolution methods of the invention.
- mRNA such as psoralen, as used in this example
- tRNA modified with a terminal puromycin molecule are ligated to form a complete modified tRNA for use in the in vitro evolution methods of the invention.
- Other embodiments do not include puromycin.
- Figure 4 describes two alternative embodiments by which the crosslinking molecule psoralen can be positioned such that it is capable of linking the mRNA with the tRNA in the methods of the invention.
- a first embodiment includes linking the crosslinker (e.g., psoralen monoadduct) to the mRNA
- a second embodiment includes linking the crosslinker to the anticodon of the tRNA molecule.
- the crosslinker can either be monoadducted to the anticodon or the 3' terminal codon of the reading frame for known or partially known messages. This can be done in a separate procedure from translation, e.g., before translation occurs.
- Figure 5 illustrates the chemical structures for uridine and pseudouridine. Pseudouridine is a naturally occuning base found in tRNA that forms hydrogen bonds just as uridine does, but lacks the 5-6 double bond that is the target for psoralen.
- Figure 6 illustrates some embodiments of the present invention.
- Figure 7 shows the probablity of obtaining a nucleotide of a given length.
- Figure 8 shows a reaction scheme for producing an mRNA for a protein of 128 amino acids.
- Figure 10 shows concenfration vs. log k
- Figure 11 shows Lancet's empiric distribution vs. a Poisson with the same mean.
- Figure 12 shows family of curves that would be bound by different [T] values.
- Figure 14 shows comparison of normal protein synthesis and non-limiting embodiments of methods for protein synthesis.
- Prefened embodiment (A) shows the prefened linker is on a SATA linking reagent and, after in vifro franslation, the mRNA and the protein are linked by the SATA linker.
- Prefened embodiment (B) shows the prefened linker is on the mRNA and, after in vifro translation, the mRNA and the protein are connected by the linker located on the mRNA.
- Figure 15 shows an illustration of how one non-limiting embodiment of the linker technology, coupled with one embodiment of its proprietary method for making a starting mRNA library, and one embodiment of its proprietary selection procedure, enables one to rapidly isolate the mRNA from a protein of interest and then use it to generate production scale amounts of that protein or to accelerate the creation, and then selection of, proteins with enhanced properties.
- Figure 16 shows a random library linked with a SARS "S" protein or other target "T" protein (henceforth "ST”) protein coated Surface Plasmon Resonance (SPR) membrane to generate the distribution of binding constants for the protein library..
- Figure 17 shows "S" or "T” protein on SPR membrane shown with all of the Pfrap binding domains saturated with trapping protein (Pfrap) and showing signaling protein (Psig) bound to a different domain.
- Figure 18 shows polyacrylamide magnetic bead coated with trapping probe .
- Figure 19 shows gold particle coated with psig protein and with bar code oligonucleotides.
- Figure 20 shows assay for SARS virus.
- Figure 21 shows Protein-SATA-mRNA library captured on SPR membrane by anti-S antibody.
- Figure 22 shows cancer treatment.
- RNA mechanism that links messenger RNA (mRNA) to its translated protein product, forming a "cognate pair.”
- mRNA messenger RNA
- an mRNA whose sequence is not known, can be expressed, its protein characterized through a selection process against a ligand with desired or selected properties, and nucleic acid evolution — resulting in protein evolution — can be performed in vitro to arrive at molecules with enhanced properties.
- the cognate pairs are preferably attached via a tRNA molecule.
- tRNA molecule shall be given it ordinary meaning and shall also mean a stable aminoacyl tRNA analog (SATA), a Linking tRNA Analog, and a Nonsense Suppressor Analog, all of which are described herein.
- a tRNA molecule includes native tRNA, synthetic tRNA, a combination of native and synthetic tRNA, and any modifications thereof.
- the tRNA is connected to the nascent peptide by the ribosomal peptidyl fransferase and to the mRNA through an ulfraviolet induced crosslink between the anticodon of the tRNA molecule and the codon of the RNA message.
- the linker is a psoralen crosslink made from a psoralen monoadduct, a non-psoralen crosslinker, or analogs or modifications thereof, pre-placed on either the mRNA's last translatable codon or preferably on the tRNA anticodon of choice.
- a tRNA stop anticodon is selected.
- a stop codon/anticodon pair selects for full length transcripts.
- an mRNA not having a stop codon may also be used and, further, that any codon or nucleic acid triplet may be used in accordance with several embodiments of the cunent invention.
- a tRNA having an anticodon which is not naturally occurring can be synthesized according to methods known in the art (e.g. Figure 3).
- the anticodon of the tRNA is capable of forming a crosslink to the mRNA, where the cross-link is selected from the group consisting of one or more of the following: 2-thiocytosine, 2-thiouridine, 4-thiouridine 5-iodocytosine, 5- iodouridine, 5-bromouridine and 2-chloroadenosine, aryl azides, and modifications or analogues thereof.
- crosslinkers are available commercially from Ambion, Inc. (Austin, TX), Dharmacon, Inc.
- protein protein
- peptide polypeptide
- polypeptide polypeptide
- protein polymeric molecule of two or more units comprised of amino acids in any form (e.g., D- or L- amino acids, synthetic or modified amino acids capable of polymerizing via peptide bonds, etc.), and these terms may be used interchangeably herein.
- pseudo stop codon is defined herein to mean a codon which, while not naturally a nonsense codon, prevents a message from being further franslated.
- a pseudo stop codon may be created by using a "stable aminoacyl tRNA analog" or SATA, as described below.
- a pseudo stop codon is a codon which is recognized by and binds to a SATA.
- Another method by which to create a pseudo stop codon is to create an artificial system in which the necessary tRNA having an anticodon complementary to the pseudocodon is substantially depleted. Accordingly, franslation will stop when the absent tRNA is required, e.g., at the pseudo stop codon.
- the selected codon is located on, or placed at, the end of the translatable reading frame by one or more of the following methods (1) having it be the 3' end; (2) providing or having modifications to the moieties 3' to the linking codon, thereby rendering them unfranslatable and incapable of activating release factors; and (3) by having codons 3' to the linking codon whose conesponding tRNAs have been depleted.
- One skilled in the art will appreciate that are several ways to create a pseudo stop codon that can be used in accordance with several embodiments of the present invention.
- the formation of connections between mRNA and its protein product generally requires a tRNA, tRNA analog, or an mRNA with certain characteristics.
- the tRNA or tRNA analog will have a stable peptide acceptor. This modification changes the tRNA or tRNA analog such that after it accepts the nascent peptide chain by the action of the ribosomal peptidyl fransferase, it holds the chain in a stable manner such that the peptidyl fransferase cannot detach it.
- a selected codon is located on, or placed at, the end of the translatable reading frame by having it be the 3' end or by providing modifications to the more 3' moieties rendering them unfranslatable and incapable of recognizing release factors.
- an amino acid or amino acid analog is attached to the 3' end of the tRNA or tRNA analog by a stable bond. This stable bond contrasts the labile, high energy ester bond that connects these two in the native structure. The stable bond not only protects the bond from the action of the peptidyl fransferase, but also preserves the sfructure during subsequent steps.
- this modified tRNA or tRNA analog will be referred to as a "stable aminoacyl tRNA analog" or SATA.
- a SATA is an entity which can recognize a selected codon such that it can accept a peptide chain by the action of the ribosomal peptidyl fransferase when the cognate codon is preferably in the reading position of the ribosome.
- the peptide chain will be bound in such a way that the peptide is bound stably and cannot be unattached by the peptidyl fransferase.
- the selected codon is recognized by hydrogen bonding.
- Psoralen cross links are preferentially made between sequences that contain complementary 5' pyrimidine- purine 3' sequences especially UA or TA sequences (Cimino et al., Ann. Rev. Biochem. 54:1151 (1985), herein incorporated by reference).
- the codon coding for the SATA, or the linking codon can be PYR-PUR-X or X-PYR-PUR, so that several codons may be used for the linking codon. Conveniently, the stop or nonsense codons have this configuration. Using a codon that codes for an amino acid may require minor adjustments to the genetic code, which could complicate some applications.
- a stop codon is used as the linking codon and the SATA functions as a nonsense suppressor in that it recognizes the linking codon.
- any codon can be used. Fraser and Rich did their work in E. coli, but the most effective in vifro franslation systems are in eukaryotes The use of prokaryotic suppressors in eukaryotic franslation systems appears to be feasible (Geller and Rich Nature 283:41 (1980); Edwards et al PNAS 88:1153 (1991); Hou and Schimmel Biochem 28:6800 (1989), all herein incorporated by reference).
- tRNA or analog can be charged in the prokaryotic system and then purified according to established methods (Lucas-Lenard and Haenni, PNAS 63:93 (1969), herein incorporated by reference).
- acceptor stem modifications suitable for use in the tRNAs and analogs can be produced by various methods known in the art. Such methods are found in, for example, SRocl and Cramer, Prog. Nuc. Acid Res. 22:1 (1979), herein incorporated by reference.
- "transcriptional tRNA" i.e.
- Transcriptional tRNA can be produced by transcription or can be made by connecting commercial RNA sequences together, piece-wise as in Figure 3, or in some combination of established methods. For mstance, the 5' phosphate and 3' puromycin are commercially available attached to oligoribonucleotides.
- RNA sequences are available from Dharmacon Research Inc., La Fayette, CO. This company can also provide modified native tRNA, such as sequences in which thymine is substituted for uricil and pseudouridine.) These pieces can be connected together using T4 DNA ligase, as is well-known in the art (Moore and Sharp, Science 256: 992, 1992, herein incorporated by reference). Alternatively, in a prefened embodiment, T4 RNA ligase is used (Romaniuk and Uhlenbeck, Methods in Enzymology 100:52 (1983), herein incorporated by reference).
- psoralen is monoadducted to the SATA by construction of a tRNA from pieces including a psoralen linked oligonucleotide (Fig. 3) or by monoadduction to a native or modified tRNA or analog (Fig. 4).
- psoralen is first monoadducted to an oligonucleotide containing part of the anticodon loop as described below and this product is then ligated to the remaining fragments of the SATA.
- franslation will stop when the nascent protein is attached to the SATA by the peptidyl fransferase.
- monoadducts By either forming crosslinks and photo reversing them or by using selected wavelengths, it is possible to form monoadducts, described more fully below. These will be either pyrone sided or furan sided monoadducts. Upon further inadiation, the furan sided monoadducts can be covalently crosslinked to complementary base pairs. The pyrone sided monoadducts cannot be further crosslinked.
- the fonnation of the furan sided psoralen monoadduct (MAf) is also done according to established methods. In a prefened method, the psoralen is attached to the anticodon of the SATA. However, psoralen can also be attached at the end of the reading frame of the message, as depicted in Figure 4.
- furan sided monoadducts will be created using visible light, preferably in the range of approximately 400 nm - 420 nm, according to the methods described in U.S. Patent No. 5,462,733 and Gaspano et al., Photochem. Photobiol. 57:1007 (1993), both herein incorporated by reference.
- a SATA with a furan sided monoadduct or monoadducted oligonucleotides for placement on the 3' end of mRNAs, along with a nonadducted SATA are provided as the basis of a kit.
- the formation and reversal of monoadducts and crosslinks are performed according to the methods of Bachellerie et al. (Nuc Acids Res 9:2207 (1981)), herein incorporated by reference.
- efficient production of monoadducts, resulting in high yield of the end-product is accomplished using the methods of Kobertz and Essigmann, J. A. Chem. Soc. 1997, 119, 5960-5961 and Kobertz and Essigmann, J. Org. Chem. 1997, 62, 2630-2632, both herein incorporated by reference.
- a SATA fragment and complementary RNA or DNA is used in which all of the uridines, except the target, are replaced by pseudouridine.
- Figure 5 compares the chemical structures for uridine and pseudouridine.
- Pseudouridine is a naturally occurring base found in tRNA that forms hydrogen bonds just as uridine does.
- This embodiment is particularly advantageous because the pseudouridine forms the same Watson-Crick hydrogen-bonds as the native uridine but lacks the 5-6 double bond that is the target for interacting with either the furan or pyrone side of the psoralen molecule. This permits the same base-pairing characteristics as an oligonucleotide with uridine, but provides only one target for the psoralen.
- Inadiation is preferably in the range of about 300- 450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
- a pseudouridine on the SATA permits: 1) the use of SATA sequences that contain uridines which are potential targets for the psoralen and 2) on the cRNA or cDNA, eliminate the formation of crosslinks, leaving the process stopped at furan sided monoadduct (MaF) formation when using UVA wavelengths which are much more efficient than visible light.
- non-psoralen crosslinkers or modifications and analogues thereof, are used in several embodiments.
- One advantage of non-psoralen crosslinkers is that they are easier to work with in some instances because they can be incorporated into the tRNA or mRNA by commercially available means.
- aryl azide is demonsfrated in Demeshkina, N, et al RNA 6:1727-1736, 2000, herein incorporated by reference.
- Use of the SATA and the monoadduct in several embodiments of the cunent invention is particularly advantageous for in vitro franslation systems.
- in situ systems can also be used.
- Various embodiments of the cunent invention will be applicable to any in vitro franslation system, including, but not limited to, rabbit reticulocyte lysate (RLL), wheat germ, E. coli, and yeast lysate systems.
- RLL rabbit reticulocyte lysate
- Many embodiments of the cunent invention are also well-suited for use in hybrid systems where components of different systems are combined.
- tRNAs aminoacylated on a 3' amide bond are reported not to combine with the elongation factor EF-TU which assists in binding to the A site (SRocl and Cramer, Prog. Nuc. Acid Res. 22:1 (1979), herein incorporated by reference).
- modified tRNAs do, however, bind to the A site.
- This binding of 3' modified tRNAs can be increased by changing the Mg++ concenfration (Chinali et al., Biochem. 13:3001 (1974), herein incorporated by reference).
- concentrations and/or molar ratios of SATA and Mg++ can be determined empirically.
- the SATA could compete with native tRNAs for non- cognate codons i.e., could function much like puromycin and stall translation. If the concenfration or A site avidity of SATA is too low, the SATA might not effectively compete with the release factors, i.e., it would not act as an effective nonsense suppressor tRNA. The balance between these can be determined empirically. It is also believed that the elongation factor aids in proofreading the codon- anticodon recognition.
- the enor rate in the absence of elongation factor and the associated GTP hydrolysis is estimated to be 1 in 100 for codons one nucleotide away (Voet and Voet, Biochemistry 2nd ed. pp. 1000-1002 (1995), John Wiley and Sons, herein incorporated by reference).
- UAA is used as the linking codon.
- For UAA as the linking codon there are 7 non stop codons which differ by one amino acid. This is 7/61 or about 11.5% of the non stop codons.
- One can estimate the probability of miscoding a given codon as (0.01)(0.115) 1.15 x 10-3 miscodes per codon.
- UAGor UGA is used as the linking codon.
- use of the mRNA with the selected codon at the end of the translatable reading frame would obviate this issue, e.g., by having it be the 3' end or having modifications to the more 3' moieties rendering them untranslatable and incapable of recognizing release factors, or by depleting the tRNAs cognate to any codons 3' of the linking codon.
- UAG or UGA is used as the linking codon.
- appropriate concentrations of SATA and Mg++ are used in the in vifro franslation system, e.g. RRL, in the presence of the mRNA molecules in the pool, causing franslation to cease when the ribosome reaches the codon which permits the SATA to accept the peptide chain (the linking codon described above).
- most of the linking codons will be occupied by SATAs within ribosomesi
- the system then will be inadiated with UV light, preferably at approximately 320 nm to 400 nm.
- Nucleic acids are typically transparent to, i.e. do not absorb, this wavelength range.
- the psoralen monoadduct Upon inadiation, the psoralen monoadduct will convert to a crosslink connecting the anticodon and the codon by a stable covalent bond.
- the target mRNA is pre-selected.
- the target mRNA is artificially produced.
- the target consists of messages native to the system under investigation, which may be unknown and/or unidentified. The ability to use unknown and/or unidentified mRNAs is a particular advantage of several embodiments of the cunent invention.
- a Method for Producing Random or Quasi-random mRNA Libraries A Method for Producing Random or Quasi-random mRNA Libraries.
- RNA ligation is used. In one embodiment, RNA ligation using T4 RNA ligase is used.
- the method first acquires a library of codons, that is, it assembles highly pure triplets conesponding to the 61 sense codons but not including the three nonsense codons. These will be produced with an accuracy of 0.99 per nucleotide. Only 18 of the 61 codons can become stop codons by a single mutation. Of these, 5 have a 0.22 chance of becoming a stop codon in one mutation and 13 have a 0.11 chance of becoming a stop codon in one mutation.
- the acceptor will have no 5' or 3' phosphates and the donor will be treated to have both 5' and 3' phosphates.
- the acceptors will have the 3' phosphate removed as by T4 polynucleotide kinase with a buffer favoring its 3' phosphatase acivity.
- the donors will have the 5' phosphate added by using the mutant T4 polynucleotide kinase lacking a 3 'phosphatase activity and the appropriate buffer.
- all 61 acceptors and 61 donors will be combined to form the substrate for T4 RNA ligase. The proportion of each can be varied to change the bias of the resulting RNA constructs.
- the 3' end of the acceptor will become attached to the 5' end of the donor.
- the result will be a 6 mer with a phosphorylated 3' end.
- One reason to have the 3' phosphorylation on the donor is to have no species that can be both a donor and an acceptor since this can lead to spontaneous circles of various sizes.
- the 6 mers can be purified by size again by using anion exchange HPLC.
- anion exchange HPLC One of skill in the art will understand that the 3' phosphorylation can be located in other locations in accordance with several embodiments of the cunent invention. These 6 mers will be divided into two samples, one dephosphorylated to form an acceptor and the other biphosphorylated to form a donor.
- the ligation step above is repeated and the resulting 12 mers purified by size. This can be repeated for a total of 4 or 5 cycles. At this point the anion exchange HPLC will lose its ability to discriminate by size and the length purification step will be omitted.
- the total number of steps, forming donors and acceptors and ligation, will go to 7 which will yield reading frames with an average of 2 7 or 128 codons. It is reasonable to expect 80% yields at each round yielding 0.8 7 or .2% yield. Since the triplets are commercially available in micromolar amounts, this will yield roughly 10 17 different random constructs. These will then be attached to 5' acceptor with a ribosome binding sequence and an AUG start codon.
- the SATA has a puromycin on the 3' end and a crosslinker (such as psoralen) on the anticodon loop.
- the SATA has a puromycin on the 3' end and the crosslinker is located on the mRNA.
- the crosslinker is positioned at a stop codon on the mRNA.
- the crosslinker is located near a stop codon, preferably between about 1-20 nucleotides away, more preferably 1-10 nucleotides away, and most preferably 1-3 nucleotides away.
- the crosslinker can also be designed to be placed more than 20 nucleotides away from the stop codon.
- psoralen is one example of a crosslinker.
- Other crosslinkers are described herein.
- a Linking tRNA Analog is used to connect the mRNA to its cognate peptide.
- the Linking tRNA Analog is a native or a synthetic tRNA (or a combination of native-synthetic hybrid) that has a crosslinker positioned on the anticodon loop.
- the crosslinker is bound to the anticodon loop through covalent bonding.
- the Linking tRNA Analog accepts the nascent peptide onto its 3 ' aminoacyl moiety through the action of ribosomal peptidyl fransferase.
- the 3' aminoacyl moiety can be native to the tRNA or can be synthetically introduced.
- the ester bond between the peptide and the tRNA is protected from ribosomal peptidyl fransferase because the message is untranslatable beyond the codon bound by the tRNA (the linking codon). Thus, the ribosomal peptidyl fransferase will be unable to release the peptide from the tRNA.
- the ester bond between the tRNA and a peptide chain is ragged enough to obviate the need for puromycin.
- the connection between the Linking tRNA Analog and the peptide, when linked through an ester bond, is protected from dissolution by ribosomal peptidyl fransferase by making the translated message "untranslatable" beyond the linking codon.
- the message then will be stably attached to its peptide for further identification, selection and evolution.
- Another advantage is that synthetic or modified tRNAs need not be used in some embodiments employing the Linking tRNA Analog.
- the tRNA is unmodified in the sense that it is unmodified on the 3' end, and may or may not have minor modifications on the anticodon loop.
- unmodified native tRNA particularly unmodified on the 3' end
- the inventors believe that absence of puromycin (or similar linkers) results, in some cases, in low yield because puromycin obstructs the interaction of the elongation factor with tRNA thus affecting yield.
- a Nonsense Suppressor tRNA is used.
- the Nonsense Suppressor tRNA recognizes a stop codon or a pseudo stop codon.
- the Nonsense Suppressor tRNA is used to connect the mRNA to its cognate peptide.
- the Nonsense Suppressor tRNA is a native or a synthetic tRNA (or a combination of native-synthetic hybrid).
- the Nonsense Suppressor tRNA has an anticodon triplet that hydrogen bonds to a stop or pseudo stop codon.
- the Nonsense Suppressor tRNA has 3' modifications and sequences that conform to the Yams extended anticodon rales (Yarus, Science 218:646-652, 1982, herein incorporated by reference).
- the Nonsense Suppressor tRNA Analog accepts the nascent peptide onto its 3' aminoacyl moiety through the action of ribosomal peptidyl fransferase.
- the 3' aminoacyl moiety can be native to the tRNA or can be synthetically introduced.
- the ester bond between the peptide and the tRNA is protected from ribosomal peptidyl fransferase because the message is unfranslatable beyond the codon bound by the tRNA (the linking codon). Thus, the ribosomal peptidyl fransferase will be unable to release the peptide from the tRNA.
- the Nonsense Suppressor tRNA does not have any type of crosslinker: the crosslinker is instead located on the mRNA. In some embodiments, where the crosslinker is on the mRNA, the crosslinker is positioned at or near a stop codon on the mRNA. Therefore, several embodiments of the present invention offer several advantages.
- the surprisingly ragged ester bond between the Nonsense Suppressor tRNA and the means that a puromycin, a puromycin analog, or other amide linker is not needed.
- Another advantage is that the linkage between the Nonsense Suppressor tRNA and the peptide, when linked through an ester bond, is protected from dissolution by ribosomal peptidyl fransferase by making the franslated message "untranslatable" beyond the linking codon.
- the message then will be stably attached to its peptide for further identification, selection and evolution.
- the Nonsense Suppressor tRNA does not need a puromycin nor a crosslinker positioned on the tRNA itself.
- the tRNA is unmodified in the sense that it is unmodified on the 3' end, and may or may not have minor modifications on the anticodon loop.
- unmodified native tRNA particularly unmodified on the 3' end
- the inventors believe that absence of puromycin (or similar linkers) results, in some cases, in low yield because puromycin obstructs the interaction of the elongation factor with tRNA thus affecting yield.
- a prefened embodiment of the invention comprises a tRNA molecule capable of covalently linking a nucleic acid encoding a polypeptide and the polypeptide to the tRNA.
- the linkage of the nucleic acid occurs on a portion of the tRNA other than the linkage to the polypeptide and the tRNA comprises a linking molecule associated with the anticodon of the tRNA.
- This anticodon of the tRNA is capable of forming a crosslink to the mRNA under inadiation with light of a required wavelength, preferably a furan-sided psoralen monoadduct on the anticodon inadiated with UVA, preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
- an amino acid or amino acid analog is attached to the 3 ' end of a tRNA molecule by a stable bond to generate a SATA.
- the anticodon of the tRNA is capable of forming a crosslink to the mRNA, where the cross-link is a non-psoralen crosslinker molecule or moiety.
- the term "non-psoralen crosslinker” shall be given its ordinary meaning and shall include one or more of the following compounds: 2-thiocytosine, 2- thiouridine, 4-thiouridine 5-iodocytosine, 5-iodouridine, 5-bromouridine, 2- chloroadenosine, aryl azides, and modifications or analogues thereof.
- an mRNA comprising a psoralen, or a non-psoralen crosslinker, preferably located in the 3' region of the reading frame, more preferably at the most 3' codon of the reading frame, most preferably at the 3' stop codon of the reading frame.
- the linkage between the tRNA and the mRNA is a cross-linked psoralen, or a non-psoralen crosslinker molecule.
- the linkage between the tRNA and the mRNA is a furan-sided psoralen monoadduct.
- the present invention permits the attachment of a protein to its respective mRNA without requiring any or substantial modification of native tRNA.
- modified tRNA is used.
- One embodiment of the invention comprises an mRNA molecule capable of covalently linking a tRNA that is covalently linked to a polypeptide encoded by the mRNA wherein the tRNA comprises a linking molecule associated with the codon of the mRNA. This codon of the mRNA is capable of forming a crosslink to the tRNA under inadiation with light of a required wavelength.
- the moiety, which is driven to crosslink is preferably a furan-sided psoralen monoadduct, or a non-psoralen crosslinker on the codon inadiated with UVA, preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm.
- this codon is the last (3' most) translatable codon of the reading frame and hence stops franslation and is a stop or pseudo stop codon.
- the message is made unfranslatable by one or more of the following techniques: (1) making the codon the physical end; (2) by using modified nucleotides; (3) by using moieties that can not be processed by the ribosome; and (4) by depleting the tRNAs recognizing the message beyond the selected codon.
- One of skill in the art will understand that other methods that render the message unfranslatable can also be used in accordance with several embodiments of the invention.
- a target oligonucleotide with at least one uridine and at least one modified uridine is contacted with psoralen, and the target oligonucleotide and psoralen are coupled to form a monoadduct.
- the modified uridine according to this embodiment may be modified to avoid coupling with psoralen.
- the modified uridine is pseudouridine.
- the target oligonucleotide may be a tRNA molecule, such as tRNA, modified tRNA and tRNA analogs or a mRNA molecule, such as mRNA, modified mRNA and mRNA analogs.
- the psoralen is coupled to the target oligonucleotide by one or more cross-links.
- a second oligonucleotide with a nucleotide sequence complementary to the target oligonucleotide sequence may be present.
- This second oligonucleotide may contain no uridine or may contain uridine residues that are modified to avoid cross-linking with the target oligonucleotide.
- the modified uridine is pseudouridine.
- the invention comprises a method of forming a psoralen monoadduct on a nucleic acid.
- the method comprises providing a first nucleic acid and a second nucleic acid that are at least substantially complementary to each other.
- the first nucleic acid comprises one or more uridine monoadduct targets, and the second nucleic acid comprises at least one pseudouridine.
- the method further comprises hybridizing at least a portion of the first nucleic acid and the second nucleic acid in the presence of psoralen, or psoralen- like agent, to form a hybrid, inadiating the hybrid with ulfraviolet light, thereby forming the psoralen monoadduct on the first nucleic acid.
- one or more uridine monoadduct targets comprises a uridine located adjacent to an adenosine, preferably 3' from the adenosine.
- a method of producing a psoralen monoadduct or a crosslink comprises providing a first nucleic acid and a second nucleic acid that are at least substantially complementary to each other.
- the first nucleic acid comprises one or more uridine monoadduct targets or crosslink targets and one or more uridine monoadduct non-targets or crosslink non-targets.
- the uridine monoadduct non-targets or crosslink non-targets are operable to be replaced or substituted with one or more pseudouridines.
- the method further comprises replacing one or more of the uridine monoadduct non-targets or crosslink non-targets with pseudouridine, hybridizing at least a portion of the first and second nucleic acids in the presence of psoralen, forming at least a partial hybrid; and inadiating, or otherwise activating, the hybrid, thereby forming the psoralen monoadduct or the crosslink on the first nucleic acid on the targets, while protecting the nontargets.
- visible light is used to fonn the adduct or crosslink.
- ultraviolet light is used.
- RNA-polypeptide complex a method of stably linking a nucleic acid, a tRNA, and a polypeptide encoded by the nucleic acid together to form a linked nucleotide-polypeptide complex.
- the nucleic acid is an mRNA and the linked nucleotide-polypeptide complex is a mRNA- polypeptide complex.
- the method can further comprise providing a plurality of distinct nucleic acid-polypeptide complexes, on, for example, an anay, providing a ligand with a desired binding characteristic, contacting the complexes with the ligand, removing unbound complexes, and recovering complexes bound to the ligand.
- this invention comprises amplifying the nucleic acid component of the recovered complexes and introducing variation to the sequence of the nucleic acids.
- the method further comprises franslating polypeptides from the amplified and varied nucleic acids, linking them together using tRNA, and contacting them with the ligand to select another new population of bound complexes.
- Several embodiments of the present invention use selected protein-mRNA complexes in a process of in vitro evolution, in particular the iterative process in which the selected mRNA is reproduced with variation, franslated and again connected to cognate protein for selection.
- the selected codon is located on, or placed at, the end of the franslatable reading frame by having it be the 3' end or having modifications to the more 3' moieties rendering them untranslatable and incapable of recognizing release factors.
- One advantage of this embodiment is that the amide bonded amino acid analog on the 3' end of the tRNA is not needed to stall franslation. Further, this permits efficient production of peptide tRNA complexes. These complexes are quite robust in spite of the high energy content of their ester bond ( Figure 6).
- the SATA or peptidyl-tRNA will be attached to the franslated message by a psoralen, or one of the group 2-thio cytosine, 2-thio uridine, 4- thio uridine 5-iodocytosine, 5-iodouridine, 5-bromouridine, 2-chloroadenosine, or aryl azides cross link between the codon and anticodon.
- Psoralen cross links are, in some embodiments, preferentially made between sequences that contain complementary 5' pyrimidine-purine 3' sequences, especially UA or TA sequences (Cimino et al, Ann. Rev. Biochem. 54:1151 (1985), herein incorporated by reference).
- non-psoralen crosslinkers or aryl azides are used and in certain embodiments, are particularly advantageous because they are less stringent in their requirements and therefore increase the possible codon-anticodon pairs.
- the codon coding for the SATA or the Linking tRNA Analog may be refened to as the linking codon.
- the linking codon can be PYR-PUR-X or X-PYR-PUR, so that several codons may be used for the linking codon. "X" in this case, may be any nucleotide. Conveniently, the stop or nonsense codons have this configuration.
- a stop codon is used as the linking codon and the SATA or linking tRNA functions as a nonsense suppressor in that it recognizes the linking codon.
- any codon can be used.
- the ribosomes are released or denatured. Preferably, this is accomplished by the depletion of Mg ++ through dialysis, simple dilution, or chelation.
- cognate pairs will be based upon affinity binding of proteins according to any of a variety of established methods, including, but not limited to, anays, affinity columns, immunoprecipitation, and many high throughput screening procedures.
- a variety of ligands may also be used, including, but not limited to, proteins, nucleic acids, chemical compounds, polymers and metals.
- cell membranes or receptors, or even entire cells may be used to bind the cognate pairs. The selection can be positive or negative.
- the selected cognate pairs can be those that do bind well to a ligand or those that do not.
- a protein to accelerate a thermodynamically favorable reaction, e.g., act as an enzyme for that reaction, it should bind both the subsfrate and a transition state analog.
- the fransition state analog should be bound much more tightly than the subsfrate. This is described by the equation
- K ⁇ enzyme JS-subst where the ratio of the rate of the reaction with the enzyme, k enzyme , to the rate without, k ⁇ enz y m e, is equal to the ratio of the binding of the fransition state to the enzyme K-tr ans over the binding of the subsfrate to the enzyme Ksubst (Voet and Voet, Biochemistry 2nd ed. p.380, (1995), John Wiley and Sons, herein incorporated by reference).
- proteins which compete poorly for binding to the subsfrate but compete well for binding to the transition state analog are selected.
- this may be accomplished by taking the proteins that are easily eluted from a matrix with subsfrate or subsfrate analog bound to it and are the most difficult to remove from matrix with transition state analog bound to it.
- an improved enzyme should evolve. Affinity to one entity and lack of affinity to another in the same selection process is used in several embodiments of the cunent invention. Selection can also be done by RNA in many embodiments. Once the selection has identified a population of cognate pairs it may be convenient to detach the mRNA strand from the tRNA molecule to reproduce it.
- psoralen as the connecting photolinker and inadiating the pairs with UV, preferably at approximately 313 nm or just below. This has been identified as a wave length that will photoreverse the psoralen crosslink to MAf and damage the nucleic acid minimally. The ratio of photoreversal to nucleic acid damage is estimated to be 1 photoreversal for damage to 1 in 600 bases (Cimino et al, Biochem 25:3013 (1986), herein incorporated by reference).
- mRNAs can be reproduced in many ways including, but not limited to, by RNA-dependent RNA polymerases or by reverse transcription and PCR.
- RNAs separated from the cognate pairs e.g., using poly T or poly U to hybridize to the poly A tails of, for instance, native unknown messages or by leaving the cognate pairs intact and using oligonucleotide primers that hybridize partially into the reading frame for known messages.
- commercial kits for rapid amplification of cDNA ends may be used.
- the methods described above for placement of photoactivatable moieties on oligonucleotides can be used to create modified oligoribonucleotides which can then be attached to the 3' ends of the message using T4 RNA ligase.
- the oligonucleotides attached would contain the linking codon with its photoactivatable moiety.
- At least one amino acid substitution at each position in the protein is sampled. This is particularly advantageous for the evolution of proteins.
- the above factor is termed the "Enrichment Factor".
- the ratio of the total components is multiplied by this factor to calculate the ratio of the bound components, or the enrichment of B over C.
- the maximum enrichment factor is k c /k B , when the [A] is significantly smaller than k c or k ⁇ -
- the enrichment is 1, that is, there is no enrichment of one over the other.
- the enrichment is limited by the ratio of binding constants.
- the ratio of that protein to its competitors is increased by 1 million with 3 enrichments.
- 10 enrichment cycles would gain only an enrichment of ⁇ 1000.
- the enrichment here is maximal at [A]>kA or kB.
- Dissociation constant is used instead of binding constant because it conveniently has the same units as the concenfration. If one expresses the total amount of Ai present as the sum of the bound and the unbound Ai, the equation can be expressed as follows:
- the [T] is the free T that we select and the ⁇ [TAj] is the amount under the curve computed by knowing the original distribution as above. In many cases the area under the curve is small compared to the selected [T] and the total T can be closely approximated by the free or unbound T. Now consider a more realistic distribution. If one produces proteins that are more or less random in sequence as by translating mRNA's that are more or less random in sequence, and then exposes the resulting proteins to a ligand, what would the affinity distribution of the population of proteins to that ligand look like? In other words, if one plots the concentration vs. the association constant, what sort of curve would result?
- the protocols described below in the following examples can be used for SATAs that have both a puromycin and a crosslinker on the tRNA, or that have a puromycin on the tRNA and a crosslinker on the mRNA. Where the crosslinker is on the mRNA, Example 4, below, provides guidance.
- the following protocol is also instractive for Linking tRNA Analogs, in the sense that Linking tRNA Analogs also, in a prefened embodiments, have a crosslinker on the tRNA.
- three fragments (Fig. 1) were purchased from a commercial source (e.g., Dharmacon Research Inc., Boulder, CO).
- Modified bases and a fragment 3 with a pre-attached puromycin on its 3' end and a PO4 on its 3' end were included, all of which were available commercially.
- Three fragments were used to facilitate manipulation of the fragment 2 in forming the monoadduct.
- Yeast tRNAAla or yeast tRNAPhe werewere used; however, sequences can be chosen from widely known tRNAs or by selecting sequences that will form into a tRNA-like structure. Preferably, sequences with only a limited number of U's in the portion that conesponds to the fragment 2 are used.
- Fragment 2 was preferably used in a helical conformation to induce the psoralen to intercalate. Accordingly, a complementary strand was required.
- RNA or DNA was used, and a sequence, such as poly C to one or both ends, was added to facilitate separation and removal after monoadduct formation was accomplished. Fragment 2 and the cRNA were combined in buffered 50 mM NaCl solution.
- the Tm was measured by hyperchromicity changes.
- the two molecules were re- annealed and incubated for 1 hour with the selected psoralen at a temperature ⁇ 10°C less than the Tm.
- the psoralen was selected based upon the sequence used.
- a relatively insoluble psoralen such as 8 MOP, could be selected which has a higher sequence stringency but may need to be replenished.
- a more soluble psoralen, such as AMT has less stringency but will fill most sites.
- HMT is used. If a fragment 2 is chosen that contains more non-target U's, a greater stringency is desired. Decreasing the temperature or increasing ionic strength by adding Mg++ was also used to increase the stringency.
- MG++ wa was omitted and ⁇ 400 mM NaCl solution was used.
- psoralen was inadiated at a wavelength greater than approximately 400 nm. The inadiation depends on the wavelength chosen and the psoralen used. For instance, approximately 419 nm 20-150 J/cm2 was preferably used for HMT. This process results in an almost entirely furan sided monoadduct. PURIFICATION OF A MONOADDUCT The monoadduct wawas then purified by HPLC as described in Sastry et al, J. Photochem. Photobiol. B BioL 14:65-79, herein incorporated by reference.
- fragment 2 was separate from fragment 3 facilitated the purification step because, generally, purification of monoadducts >25 mer is difficult (Seemann et al. PNAS 89: 4514-4518, herein incorporated by reference).
- LIGATION OF FRAGMENT 2 AND 3 The fragment 2 was ligated to the fragment 3 using T4 RNA ligase. The puromycin on the 3' end edacted as a protecting group. This is done as per Romaniuk and Uhlenbeck, Methods in Enzymology 100:52-59 (1983), herein incorporated by reference. Joining of fragment 2+3 to the 3' end of fragment 1 wawas done according to the methods described in Uhlenbeck, Biochemistry 24:2705-2712 (1985), herein incorporated by reference.
- Fragment 2+3 was 5' phosphorylated by polynucleotide kinase and the two half molecules wewere annealed.
- significant quantities of furan sided monoadducted U were formed by hybridizing poly UA to itself and inadiating as above. The poly UA was then enzymatically digested to yield furan sided U which was protected and incorporated into a tRNA analog by nucleoside phosphoramidite methods.
- Other methods of forming the psoralen monoadducts include the methods described in Gamper et al, J. Mol. BioL 197: 349 (1987); Gamper et al, Photochem. Photobiol. 40:29, 1984; Sastry et al, J.
- RNAxRNA hybrid segments and of 10 ⁇ g/ml HMT both comprised of 50mM NaCl were transfened into a new 1.5 ml capped polypropylene microcentrifuge tube and incubated at 37°C for 30 minutes in the dark. This was then transfened onto a new clean culture dish. This was positioned in a photochemical reactor (419 nm peak Southern New England Ultraviolet Co.) at a distance of about 12.5 cm so that inadiance wawas -6.5 mW/cm2 and inadiated for 60- 120 minutes.
- a photochemical reactor (419 nm peak Southern New England Ultraviolet Co.) at a distance of about 12.5 cm so that inadiance wawas -6.5 mW/cm2 and inadiated for 60- 120 minutes.
- RNAase free snapped microcentrifuge tubes were used as described in the following section entitled "Oligonucleotide Analysis by HPLC.”
- the collected fractions represented: • 5'CUAGA ⁇ CUGGAGG3'5'CUAGA ⁇ CUGGAGG3', where ⁇ is pseudouridine (SEQ ID NO: 1) • Furan sided 5'CUPsoralenAGA ⁇ CUGGAGG3' monoadducts (SEQ ID NO: 2) • 5'XXXXXCCUCCAGAUCUAGXXXXX3' (SEQ ID NO: 3) • 5'XXXXXCCUCCAGAUCUPsoralenAGXXXXX3' (SEQ ID NO: 4)
- the fractions were stored at 4°C in new, RNAase free snapped microcentrifuge tubes and stored at -20°C if more than four weeks of storage were required.
- RNA Fragments Represented by Each Peak Fraction Collected by HPLC Using Polyacrylamide Gel Elecfrophoresis The elecfrophoresis unit was set up in a 4°C refrigerator. A gel was selected with a 2 mm spacer. Each 5 ⁇ l of HPLC fraction was diluted to 10 ⁇ l with Loading Buffer. 10 ⁇ l of each diluted fraction was loaded into appropriately labeled sample wells.
- the tracking dye was loaded in a separate lane and elecfrophoresis was ran as described in the following section entitled "Polyacrylamide Gel Elecfrophoresis (PAGE) of Psoralenated RNA Fragments.” After the elecfrophoresis run was complete, the elecfrophoresis was stopped when the tracking dye reached the edge of the gel.
- the apparatus was disassembled. The gel-glass panel unit was placed on the UV light box. UV lights were turned on. The RNA bands were identified. The bands appeared as denser shadows under UV lighting conditions.
- RNAase free scalpel blade was excised with a new sterile and RNAase free scalpel blade and transfened into a new 1.5 ml snap capped microcentrifuge tube. Each gel was crashed against the walls of the microcentrifuge tubes with the side of the scalpel blade. A new blade was used for each sample. 1.0 ml of 0.3M sodium acetate was added to each tube and eluted for at least 24 hours at 4°C. The eluate was transferred to a new 0.5 ml snap capped polypropylene microcentrifuge tube with a micropipette. A new RNAase free pipette tip was used for each tube and the RNA with ethanol was precipitated out.
- RNA oligonucleotide fragments were precipitated, and all glassware was cleaned to remove any traces of RNase as described in the following section entitled "Inactivation of RNases on Equipment, Supplies, and in Solutions.” All solutions were stored in RNAase free glassware and introduction of nucleases was prevented. Absolute ethanol was stored at 0°C until used. Micropipettes were used to add two volumes of ice cold ethanol to nucleic acids that were to be precipitated in microcentrifuge tubes. Capped microcentrifuge tubes were placed into the microfuge and spun at 15,000 xg for 15 minutes. The supernatant was discarded and precipitated RNA was re-dissolved in DEPC treated Dl-water. RNA was stored at 4°C in microcentrifuge tubes until ready to use. LIGATION OF RNA FRAGMENTS 2 AND 3
- RNA T4 ligase (44 ⁇ g/ml) 22 ⁇ g The mixture was incubated at 17°C in a temperature controlled refrigerator for 4.7 hours.
- tRNA was precipitated out as described in step 6.2 above and the tRNA was isolated by electrophoresis as described in the following section entitled "Polyacrylamide Gel Electrophoresis (PAGE) of Psoralenated RNA Fragments.”
- PAGE Polyacrylamide Gel Electrophoresis
- the comb produced wells for a 5 mm wide dye lane and 135 mm sample lanes.
- the gel was allowed to polymerize for about 30-40 minutes then the comb was carefully removed.
- the sample wells were rinsed out with a ranning buffer using a micropipette with a new pipette tip.
- the wells were then filled with running buffer.
- Sample Preparation An aliquot of the sample wawas suspended in loading buffer in a snap capped microcentrifuge tube and vortex mixed. Indicator dye was not added to the sample.
- Each band was excised with a new sterile and RNAase free scalpel blade and each band was transfened into a new 1.5 ml snap capped microcentrifuge tube. Each gel was crushed against the walls of the microcentrifuge tubes with the side of the scalpel blade. A new blade was used for each sample. 1.0 ml of 0.3M sodium acetate was added to each tube and eluted for at least 24 hours at 4°C. The eluate was transferred to a new 0.5 ml snap capped polypropylene microcentrifuge tubes with a micropipette with a new RNAase free pipette tip for each tube.
- RNA oligonucleotides Two volumes of ice cold ethanol was added to each eluate, then centrifuged at 15,000 xg for 15 minutes in a microcentrifuge. The supernatants were discarded and the precipitated RNA was redissolved in 100 ⁇ l of DEPC treated Dl water. The RNA wawas stored in the microcentrifuge tubes at 4°C until needed.
- OLIGONUCLEOTDDE ANALYSIS BY HPLC HPLC purification of the RNA oligonucleotides was performed using anion exchange chromatography. Either the 2'-protected or 2'-deprotected forms may be chromatographed. The 2'-protected form offered the advantage of minimizing secondary structure effects and providing resistance to nucleases.
- Example 2 may be modified in order to purify the RNA oligonucleotides. Modification of the HPLC purification methods of Example 2, including HPLC gradient, temperature, and other parameters, may be necessary. One of skill in the art would also recognize that a one-step HPLC purification method may also be used in accordance with several embodiments of the cunent invention.
- Electrophoresis Tanks Used for Electrophoresis of RNA Tanks were washed with detergent, rinsed with water then ethanol and air dried. The tank was filled with 3% (v/v) hydrogen peroxide (30ml/L) and left standing for 10 minutes at room temperature. The tank was rinsed at least 5 times with DEPC freated water. Solutions All solutions were made using Rnase free glassware, plastic ware, autoclaved water, chemicals reserved for work with RNA and RNase free spatulas. Disposable gloves were used.
- RNA TRANSLATION 2 ⁇ l of gastiOinhibitory peptide (GIP) mRNA at a concentration of 20 ⁇ l/ml was placed in a 250 ⁇ l snapcap polypropylene microcentrifuge tube.
- GIP gastiOinhibitory peptide
- luciferase was added to some tubes to serve as a control.
- luciferase was used instead of GIP mRNA.
- SATA was added to the experimental tubes. Control tubes which did not contain SATA were also prepared. The quantity of SATA used was approximately between 0.1 ⁇ g to 500 ⁇ g, preferably between 0.5 ⁇ g to 50 ⁇ g. 1 ⁇ l of Rnasin at 40 units/ml was added.
- Nuclease free water was added to make a total volume of 50 ⁇ l.
- the amount of tRNA may need to be supplemented. For example, approximately 10 - 200 ⁇ g of tRNA may be added.
- the quantity of the SATA should be high enough to effectively suppress stop or pseudo stop codons.
- the quantity of the native tRNA must be high enough to out compete the SATA which does not undergo dynamic proofreading under the action of elongation factors.
- Each tube was immediately capped, parafilmed and incubated for the franslation reactions at 30°C for 90 minutes. The contents of each reaction tube was transfened into a 50 ⁇ l quartz capillary tube by capillary action.
- the SATA was crosslinked with mRNA by illuminating the contents of each tube with 2-10 J/cm2 -350 nm wavelength light, as per Gaspano et al. (Photochem. Photobiol. 57:1007 (1993), herein incorporated by reference). Following photocrosslinking, the contents of each tube were transfened into a new snapcap microfuge tube. The ribosomes were dissociated by chelating the calcium cations by adding 2 ⁇ l of 10 mM EDTA to each tube. Between each step, each tube was gently mixed by stining each component with a pipette tip upon addition. The optimal RNA for a translation was determined prior to performing definitive experiments. Serial dilutions may be required to find the optimal concentration of mRNA between 5-20 ⁇ g/ml.
- SDS-Page electrophoresis was performed on each sample, as described above. Autoradiography on the gel was performed, as described by Sambrook et. al., Molecular Cloning, A Laboratory Manual, 2 nd ed., Coldspring Harbor Press (1989), herein incorporated by reference.
- the above example teaches the production and use of SATA (e.g., puromycin on tRNA plus crosslinker on the tRNA) and the production and use of Linking tRNA Analog (e.g., no puromycin, but has crosslinker on tRNA).
- SATA was produced in a manner similar to the above methodology, except that uridines were substituted with pseudouridines.
- Pseudouridine shall include the naturally occurring base and any synthetic analogs or modifications.
- the SATA was produced using pseudouridine.
- Linking tRNA Analog can also be produced using pseudouridine.
- three fragments (Fig. 1) were purchased from a commercial source (Dharmacon Research Inc., Boulder, CO). Modified bases and a fragment 3 ("Fragment 3") with a pre-attached puromycin on its 3' end and a PO 4 on its 3' end were included, all of which are available commercially. The three fragments were used to facilitate manipulation of a fragment 2 ("Fragment 2") in forming the monoadduct.
- Sequences of the three fragments are as follows (2 example sequences are provided for each fragment): Fragment 1 5'PO 4 GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACOH3' (SEQ ID NO: 10) 5'PO 4 GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACOH3' (SEQ ID NO: 16)
- sequences listed in Fragment 3 are applicable for SATA.
- Linking tRNA Analogs the sequences would be similar, except the puromycin would be replaced by adenosine.
- Modified yeast tRNAAla or yeast tRNAPhe was used according to one embodiment of the invention.
- sequences can be chosen widely from known tRNAs or by selecting sequences that will form into a tRNA-like structure.
- pseudouridine in some embodiments is that the pseudouridine in Fragment 2 avoids psoralen labeling of the nontarget U's.
- RNA or DNA was used, and a sequence, such as poly C or poly G when C interacts with the psoralen to one or both ends, was added to facilitate separation and removal after monoadduct formation was accomplished.
- Use of pseudouridine instead of uridines in the complement permitted the use of a high efficiency wave length, such as about 365 nm, without fear of crosslinking the product. Inadiation was preferably in the range of about 300-450 nm, more preferably in the range of about 320 to 400 nm, and most preferably about 365 nm. Further, use of pseudouridine left the furan-sided monoadduct in place on Fragment 2 because the Maf is the predominate first step in the crosslink formation.
- the sequence can also be 5'XXXXXXGA ⁇ AGAXXXXXX3'(SEQ ID NO: 30): CCC ⁇ CCAGAG ⁇ AGACCC (SEQ ID NO: 13) 5'CCCCCCGA ⁇ AGACCCCCCC3' (SEQ ID NO: 19)
- Step 1 Furan Sided Monoadduction Of Psoralen To Fragment 2
- a reaction buffer was prepared as follows: Tris HCL 25 mM NaCl 100 mM EDTA 0.32 mM pH 7.0 4'hydroxy methyl-4,5',8'-triethyl psoralen (HMT) was then added to a final concenfration of 0.32 mM and equimolar amounts of fragment 2 and cRNA were added to a final molar ratio of fragment 2: cRNA :
- a total volume of lOO ⁇ l was inadiated at a time.
- the mixture of complementary oligos, HMT, psoralen was processed as follows: 1) Heated to 85° C for 60 sec followed by cooling to 4° C over 15 min, using PCR thermocycler. 2) Irradiated for 20 min at 4° C, in Eppendorf UVette plastic cuvette, covered top with parafilm, laid on the top of UV lamp (lmW/cm 2 multi- wavelength UV lamp ( ⁇ >300nm) (UV L21 model ⁇ 365 nm). Steps 1 and 2 above were repeated 4 times to re-intercalate and inadiate HMT.
- the column temperature was 60°C and the detection wave length, set by a nanow band filter, was 340 nm.
- Furan sided psoralen monoadduct absorbs at 340 nm but the RNA, and any pyrone sided monoadduct does not.
- the buffer solutions were filtered and degassed before use.
- the 2MA eluted at around 25-28 minutes at a buffer B concentration of 40%.
- Unpsoralenated fragment 2 eluted before 8 minutes based on subsequent gel electrophoresis analysis on collected fractions.
- the column was washed with 100% acetonitrile for 5 minutes and was re- equilibrated with buffer A for 15 minutes. All fractions were dried with speed vacuum overnight.
- the fractions containing the 2MA were identified by the level of absorbance at 260 nm (RNA) and 330 nm (furan sided psoralen monoadducted RNA). This was done by redissolving the dried fractions with 120 ⁇ l of Rnase-free distilled water and the absorbance was measured with a spectrophotometer at 260 nm and 330 nm. The fractions with high absorbance at both wavelengths were pooled then dried with speed vacuum. A small aliquot from each was saved for gel analysis. The cross-linked products were analyzed on a denaturing 20% TBE-urea gel and visualized by gel silver staining.
- Step 3 Purification Of HMT Conjugated Fragment 2 Oligo From cRNA By HPLC
- the dried samples were pooled and then were dissolved with 0.5X TE buffer.
- a sample of about 0.4 absorbance unit was loaded onto a Dionex DNAPac PA-100 (4x250mm) column which was pre-equilibrated with buffer C (25 mM Tris-HCl, pH 8.0) and the column temperature was 85°C (anion exchange HPLC).
- the oligos were eluted at a flow rate of 1 ml/min. with a concave gradient from 4%to 55%buffer D for 15 minutes followed by a convex gradient from 55 % to 80% with buffer D for the next 15 minutes.
- the oligos were washed with 100% buffer D for 5 min and 100%) buffer C for another 5 min at a flow rate of 1.5 ml/min; Fractions were collected that absorbed 260 nm light. 2MA had a retention time (RT) of 16.2 minutes and was eluted by 57% buffer D, and free fragment 2 had RT less than 16.6 minutes, and was eluted by 55% buffer D and free cRNA had RT greater than 19.2 minutes. The fractions were collected that absorbed at 254 or 260 nm. The collected fractions were dried with speed vacuum overnight. All solutions were filtered and degassed before use.
- the solution used comprised the following: C: 25mM Tris-HCl pH 8.0; D: 250mM NaClO4 in 25mM Tris pH 8.0 buffer. TE: lOmM Tris-HCl pH 8.0 with ImM EDTA Step 4: Desalting. Precipitation And Collection Of The Purified 2MA Oligo
- the dried fractions were redesolved with lOO ⁇ l Rnase free distilled water. 500 ⁇ l cool 100% ethanol with 0.5M (NH4)2CO3 was added and the mixture was vortexed briefly. The mixture was then frozen on dry ice for 60 minutes or stored at - 20°C overnight. The samples were then brought to 4° C and centrifuged at maximum speed in a microcentrifuge for 15 minutes.
- reaction mixture was assembled in a sterile microcentrifuge tube: Fragment 3 (Donor) l ⁇ l (6 ⁇ g) (Purified, when necessary, before using as a donor) 2MA (Acceptor) l ⁇ l (1.5 ⁇ g). After adding 8 ⁇ l Rnase free dH2O 8 ⁇ l, the reactions were incubated at 85° C for 1 minute to relax the oligo secondary structure, then slowly cooled to 4° C, using a PCR machine thermocycler.
- the preheated tube was placed on ice to keep cool and centrifuged briefly, then the following was added: 10X Ligase Buffer 4 ⁇ l lOmM ATP 4 ⁇ l Rnase Out or Rnasin(40u/ ⁇ l) Promega 0.5 ⁇ l PEG, 40 % (Sigma) 20 ⁇ l T4 RNA Ligase (lOu/ ⁇ l) (NEB) 1 ⁇ l Nuclease-free water was added to final Volume of 40 ⁇ l. The mixture was incubate at 16° C overnight(16hr). The mixture was centrifuged briefly and then was placed on ice. D.
- the dried fractions were redissolved with lOO ⁇ l Rnase-free distilled water, 500 ⁇ l cool 100% ethanol with 0.5M (NH4)2CO3 was added and vortexed briefly. This was then frozen on dry ice for 60 minutes or stored at -20C overnight. The samples were then brought to 4° C and centrifuged at maximum speed in a microcentrifuge for 15 minutes and supernatant removed by pipette. Care was taken not to disturb pellet. If the pellet still contained salt, this step was repeated once. The pellet was then washed with 70% pre- cooled ethanol several times. This was then centrifuged at maximum speed in a microcentrifuge for 5 minutes at 4C. The ethanol was carefully removed using a pipette.
- Step 6 Purification Of The Ligated Fragment 3 Oligo Complex The dried sample was redesolved with 0.5X TE buffer and was loaded onto a DNAPac PA-100 column which was equilibrated with buffer C. The column temperature was 85°C and the detector operated at 254 nm to identify fractions with RNA and at 340 nm to identify fractions with 2MaF.
- the oligos were eluted with a convex gradient from 30%to 70% with buffer D for the first 20 minutes at a flow rate of 0.8ml/min and followed with a linear gradient from 70 % to 98% D for another 20 min at the same flow rate. The elution was completed by washing with 100% D for 7 min and 100% C for another 10 min at 1.0 ml/min flow rate. The fractions were detected with 254 or 260 nm wavelength light. The ligated oligos (2MA-fragment 3) were eluted after 34 min, by more than 90% buffer B. Fractions with 254 nm absorbance (A254nm>0.01) were collected and dried with speed vacuum overnight.
- Step 7 Purified 2MA-Fragment 3 Desalting And Precipitation
- the dried fractions were re-dissolved with lOO ⁇ l Rnase free distilled water, 500 ⁇ l cool 100% ethanol with 0.5M (NH4)2CO3 was added and the mixture was vortexed briefly. The mixture was then frozen on dry ice for 60 minutes or stored at - 20C overnight. The samples were brought to 4° C and centrifuged at maximum speed in a microcentrifuge for 15 minutes. The position of the pellet was noted and the supernatant decanted or removed by pipette. Care was taken not to disturb pellet. If still containing salt, this step was repeated. The pellet was then washed with 70% pre- cooled ethanol twice.
- Step 8 Preparation Of SATA (Or Other tRNA Molecule) A. RNA Oligo 5 'phosphoi ⁇ lation
- Reagents and instruments • PCR thermocycler instrument or water bath • lOO ⁇ g/ml nuclease-free albumin • 100mM MgC12
- RNA should preferably not be stored in DEPC water, but in ethanol, at -20° C.
- the samples were brought to 4°C and centrifuged at maximum speed in a microcentrifuge for 15 minutes. The position of the pellet was noted and the supernatant decanted or removed by pipette. Care was taken not to disturb pellet.
- the pellet was then washed with 70% pre-cooled ethanol twice. After removing the ethanol, the wet pellet was dried with a speed vacuum for 15 min. The dried pellet was stored at -20°C, until the next step.
- RNA Translation A luciferase mRNA which was modified to have the stop codon conesponding to that recognized by the anticodon of the SATA ( in the present case UAG) was used in a standard Promega in vitro translation kit in the recommended l ⁇ l of concentration l ⁇ g/ ⁇ l.
- SATA wawas added to the experimental tubes. Control tubes which did not contain SATA were also prepared.
- the quantity of SATA used was approximately between 0.1 ⁇ g to 500 ⁇ g, preferably between 0.5 ⁇ g to 50 ⁇ g. 1 ⁇ l of Rnasin at 40 units/ml was added.
- Nuclease free water was added to make a total volume of 50 ⁇ l.
- the amount of tRNA may need to be supplemented. For example, approximately 10 - 200 ⁇ g of tRNA may be added.
- the quantity of the SATA should be high enough to effectively suppress stop or pseudo stop codons.
- the quantity of the native tRNA must be high enough to out compete the SATA which does not undergo dynamic proofreading under the action of elongation factors.
- Each tube was immediately capped, parafilmed and incubated for the franslation reactions at 30°C for 90 minutes. The contents of each reaction tube was transfened into a 50 ⁇ l quartz capillary tube by capillary action.
- the SATA was crosslinked with mRNA by illuminating the contents of each tube with 2-10 J/cm2 -350 nm wavelength light, as per Gaspano et al. (Photochem. Photobiol. 57:1007 (1993), herein incorporated by reference). Following photocrosslinking, the contents of each tube werewere transfened into a new snapcap microfuge tube. The ribosomes were dissociated by chelating the calcium cations by adding 2 ⁇ l of 10 mM EDTA to each tube. Between each step, each tube was gently mixed by stining each component with a pipette tip upon addition. The optimal RNA for a franslation was determined prior to performing definitive experiments.
- Serial dilutions may be required to find the optimal concenfration of mRNA between 5-20 ⁇ g/ml.
- SDS-Page elecfrophoresis wa was performed on each sample, as described above. Autoradiography on the gel wawas performed, as described by Sambrook et al, Molecular Cloning, A Laboratory Manual, 2 nd ed., Coldspring Harbor Press (1989), herein incorporated by reference. The above example is instructive for the production and use of SATA
- Linking tRNA Analog (no puromycin, with crosslinker on tRNA).
- EXAMPLE 3 PRODUCTION OF LINKING tRNA ANALOG USING RIBONUCLEOTIDES MODIFEED TO FORM CROSSLINKERS: USE OF PSORALEN AND NON-PSORALEN CROSSLINKERS.
- pseudouridine can be used in some embodiments to minimize the formation of unwanted monoadducts and crosslinks.
- a crosslinker modified mononucleotide is formed and used.
- One advantage of the crosslinker modified mononucleotide is that it minimizes the formation of undesirable monoadducts and crosslinks.
- SATA Linking tRNA Analog
- Nonsense Suppressor Analog can be produced in a number of different ways.
- psoralenated uridine 5' mononucleotide, 2-thiocytosine, 2-thiouridine, 4-thiouridine 5-iodocytosine, 5-iodouridine, 5- bromouridine or 2-chloroadenosine can be produced or purchased and enzymatically ligated to an oligonucleotide to be incorporated into a tRNA analog.
- Aryl azides, and analogues of aryl azides, and any modifications thereto, can also be used in several embodiments, as a linking moiety or agent.
- the following protocol can be employed for crosslinkers that are located on the tRNA.
- This protocol can also be used for crosslinkers located on the mRNA.
- the following example is instractive on the production and use of SATA, Linking tRNA Analog, and Nonsense Suppressor Analog.
- Production Of Modified Nucleotide 4-thioU, 5-iodo and 5 -bromo U with and without puromycin can be purchased already incorporated into a custom nucleotide up to 80 basepairs in length (Dharmacon, Inc).
- the SATA, and the Linking tRNA Analog with these crosslinkers already in place, and similar crosslinkers, can be purchased directly from Dharmacon, Inc.
- Nonsense Suppressor Analog can also be purchased from Dharmacon, Inc.
- 2-thiocytosine, 2-thiouridine, 4thiouridine 5-iodocytosine, 5-iodouridine, 5- bromouridine or 2-chloroadenosine can all be purchased for crosslinking from Ambion, Inc. for the use in the Ambion MODIscript kit for incorporation into RNA.
- the SATA and the Linking tRNA Analog along with these crosslinkers, and similar crosslinkers, can be purchased directly from Ambion, Inc
- the PO U ps0 raien can be produced as follows: AUAUAUAUAUAUAUAUAUAUAUAUAUGGGGGG (seq Al) (SEQ ID NO: 20) (available from Dharmacon, Inc.) CCCCCCATATATATATATATATATAT (seq A2) (SEQ ID NO: 21) (available from University of Southern California services).
- the formation of a furan-sided psoralen monoadduct with the target uridine is performed as follows: A reaction buffer is prepared.
- the reaction buffer contains 25 mM Tris HCL, 100 mM NaCl, and 0.32 mM EDTA.
- a total volume of lOO ⁇ l is inadiated at a time.
- the mixture of complementary oligos ⁇ HMT, trimethylpsoralen is processed as follows: 1) Heat to 85° C for 60 sec followed by cooling to 4° C over 15 min, using PCR thermocycler; and 2) Irradiate for 20 to 60 min at 4° C, in Eppendorf UVette plastic cuvette, covered top with parafilm, in an RPR-200 Rayonet Chamber Reactor equipped with a cooling fan and 419 nm wave. This is either placed on an ice water bath or in a -20° C freezer. Steps 1 and 2 above are repeated 4 times to re-intercalate and inadiate HMT.
- the molar ratio of BI to psoralenated mononucleotides is preferably kept at 10:1 to 50: 1 so that the modified U's will be greatly out-numbered, thereby preventing the formation of CUC(U cr ossiin k e r )N- This makes one of the prefened reactions: L U L + p U psoralen U L/ U psoralen
- the product is purified by sequential anion exchange and ' reversed phase HPLC to ensure that the psoralenated U and the longer psoralenated 7 mer are separated.
- the following are used in two different 5' ends: 5' OHGCGGAUUUAGCUCAGUUGGGAGAGCGCCAGA 3' seq IB (SEQ ID NO: 22) (to be used with the tRNA analog with the stable puromycin acceptor) and 5' OHGGGGCUUUAGCUCAGUUGGGAGAGCGCCAGA 3' seq lBi (SEQ ID NO: 23) (to be used with the native esterified acceptor).
- the ligation is performed again with T4 RNA ligase and purified by length.
- sequence IB is as follows: 5' OHGCGGAUUUAGCUCAGUUGGGAGAGCGCCAGA 3' + CUCU crosslinker AP0 4 3' (SEQ ID NO: 22) ⁇ 5' OHGCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUCUCU crossIinker AP0 4 3' (SEQ ID NO: 24)
- sequence lBi 5' OHGGGGCUUUAGCUCAGUUGGGAGAGCGCCAGA + CUCU cross ⁇ inker AP0 4 3' (SEQ ID NO: 23) ⁇ 5 ' OHGGGGCUUUAGCUC AGUUGGGAGAGCGCCAGACUCU cr ⁇ ss iiggi ker AP0 4 3'(SEQ ID NO: 25) Ligation Of The Two Half-Molecules Of The tRNA Analog
- the above product is freated with T4 polynucleotide kinase in two separate steps to remove the 3' phosphate and add
- the latter is recognizable by the aminoacyl tRNA synthetase for alanine in E. coli.
- the example described above can be used to make and use the SATA, Linking tRNA, and the Nonsense Suppressor tRNA.
- EXAMPLE 4 PLACEMENT OF CROSSLINKERS ON THE mRNA FOR SATA AND NONSENSE SUPPRESSOR tRNA
- the crosslinker (such as psoralen or a non-psoralen crosslinker) is not placed on the tRNA, but rather located on the mRNA.
- the SATA comprises a puromycin located on the tRNA, while the crosslinker is on the mRNA.
- the Nonsense Suppressor tRNA is used, and this comprises a tRNA with no puromycin, with the crosslinker being on the mRNA. Placement of the crosslinker on the message (the mRNA) can be accomplished as set forth below.
- GGGUUAACUUUAGAAGGAGGUCGCCACCAUG GUU AAA AUG AAA AUG AAA AUG U cross iink er AG (SEQ ID NO: 26)
- a message with both Kozak and Shine Dalgarno sequences that has a large number of methionine codons for 35 S labeling is used.
- 4-thiouridine, 5-bromouridine and 5-iodouridine the message can be purchased fully-made from Dharmacon, Inc.
- aryl azides the method recited in Demeshkina, N, ⁇ t al, RNA 6:1727-1736, 2000, herein incorporated by reference, can be used.
- the modified bases can be purchased as the 5' monophosphate nucleotide from Ambion, Inc.
- the modified 5' monophosphate nucleotide is made as above.
- the modified 5' monophosphate nucleotides are first incorporated into hexamers to facilitate purification.
- uridine containing crosslinkers The construction of uridine containing crosslinkers is shown but in several embodiments, the other bases can be incorporated into both stop and pseudo stop codons using similar techniques:
- AUG + pUcrosslinker ⁇ AUGUcrosslinker was accomplished using a similar protocol described above, except a preponderance of AUG was used because of the absence of a 3' protection of the pNcrosshnker.
- the product was purified by anion exchange HPLC from the excess of AUG. Then 5' pAGbiotin 3 'was added with T4 RNA ligase. The 3' biotin was simply a convenient 3' blocking group available form Dharmacon.
- EXAMPLE 5 USING tRNA SYSTEMS THAT DO NO NEED PUROMYCIN
- Linking tRNA Analogs and Nonsense Suppressor tRNAs do not require puromycin and can be made and used according to the following example.
- a translation system to aminoacylate the tRNA can be used.
- aminoacylation can be accomplished chemically.
- One skilled in the art will understand how to chemically aminoacylate tRNA.
- any type of franslation system for aminoacylation can be employed, such as in vitro, in vivo and in situ.
- am e-coli translation system is used.
- An E. coli translation system is used for systems with a tRNA modified to be recognized by the aaRS Al . In one embodiment, this is preferable for systems without the stable acceptor (e.g. the puromycin) 3 meg of each of the following mRNA's are translated in 40 microliters each of Promega S30 E.
- coli franslation mixture a) GGGUUAACUUUAGAAGGAGGUCGCCACCAUG GUU AAA AUG AAA AUG AAA AUG AAA AUGUcrosslinkerAGbiotin (SEQ ID NO: 28) and b) GGGUUAACUUUAGAAGGAGGUCGCCACCAUG GUU AAA AUG AAA AUG AAA AUG AAA AUGUAG (SEQ ID NO: 29) 3 meg of amber suppressor tRNA manufactured as above are added to the first. 3mcg of suppressor with crosslinker on the anticodon are added to the second. 35S- methionine is added to both and the mixtures are then incubated at 37° C for 30 minutes.
- the reactions are then rapidly cooled by placement in an ice bath, transfened to a flat Petri dish and floated in an ice bath so that the mixture is 1.5 cm below a -350 nm light source. They are exposed at -20 J/cm for 15 min. After inadiation, the mixtures are phenol extracted and ethanol precipitated.
- systems such as the Linking tRNA Analogs and Nonsense Suppressor tRNAs are aminoacylated and used to connect the message (mRNA) to its coded peptide in accordance with several embodiments of the present invention.
- EXAMPLE 6 ALTERNATIVE SEQUENCES
- Fragments 1, 2 and 3, described above in Example 1 have the following alternate sequences: Fragment 1 fSEO ID NO: 13): 5' PO4 GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGA N3-Methyl-U 3' Fragment 2 fSEO ID NO: 14): 5' UCUAAG ⁇ C ⁇ GGAGG 3' Fragment 3 — Unchanged from the sequence listed above (SEQ ID NO: 6): 5' PO4 UCCUGUGT ⁇ CGAUCCACAGAAUUCGCACC Puromycin 3' Using the methods described above, the sequence of alternative Fragments 1+2+3 was fSEO ID NO: 15): EXAMPLE 7: APPLICATION TO SARS Diagnostic Test for SARS Virus In one embodiment a diagnostic test for the SARS virus is provided.
- SARS genome sequence is known and the position of associated structural proteins spike (S), membrane (M), nucleocapsid (N) and envelope (E) on the genome are known (Mana, et al, Sciencexpress/ www.. sciencexpress.org / 1 May 2003 / Page 1/ 10.1126/ science.1085953 and Rota, et al, Sciencexpress/ www.. sciencexpress.org / , 1 May 2003 / Page 1/ 10.1126/science.1085952), all herein incorporated by reference).
- S structural proteins spike
- M membrane
- N nucleocapsid
- E envelope
- the "S” protein is present in all of the SARS-CoV strains (tor2, Urbani, TW-1, HKU-39849, and CUHK-W1).
- One diagnostic test available today is the Nanoparticle-Based Bio-Bar Codes technology (Nam, et al, Science 301:1884-1886 (2003)), herein incorporated by reference. This method appears to have extreme sensitivity, which should enable one to detect the low levels of viral particles found in sputum in the early stages of SARS disease. There are other, faster to perform methods which can occur in real time, however they are less sensitive in some cases.
- Several embodiments of the present invention facilitate the development of the reagents needed for the assay in a matter of several days instead of weeks or months.
- the protocol will be performed as follows: Preparation of Test Reagents
- the reagents will prepared in the following manner: A. Preparation of purified "S" protein 1.
- the SARS-CoV genome sequence will be obtained from Genebank (Accession #AY274119-3) from which the portion of the sequence that codes for "S" protein will be obtained.
- the cunent invention solves this bottleneck problem by linking the exact mRNA message with its cognate protein during the translation process, thereby providing the user with the ready blueprint for making more of that protein, and obviating the need for N-terminus analysis.
- one method for using binding proteins as probes for "S" protein can be performed as follows: 1. The initial mRNA library will be created by codon iteration. a) A proprietary method of constructing a set of messages from random codons that do not include a stop codon will be used to create a reading frame. b) An appropriate stop codon will be added. 3' and 5' untranslated regions will also be added to each oligo.
- PCR will be used to prepare enough cDNA to insert into E. coli.
- the newly generated "S” protein will be harvested from E. coli using established methods (Doonan, ed., Vol. 59, New Jersy: Humana Press (1996), herein incorporated by reference to enhance desirable properties or to eliminate undesirable ones, the protein's mRNA code must first be known.
- Further embodiments of the present invention comprise the "Linker System", a revolutionary system of novel compounds and methods which enable scientists to quickly and easily chemically link proteins to the mRNAs that encode them (see Figure 14). Novel Proteins
- novel proteins for specific purposes can be made quickly by translating embodiments of the mRNA library in vitro as shown in Figure 14 (B) above using embodiments of the linking system.
- the resultant library of protein-Linker- mRNA complexes will number in the trillions (10 ! ) of protein variants from which the ones with the desired properties can be selected.
- the mRNA from the selected protein-Linker-mRNA complexes can then be chemically cleaved off of the complex and used to produce large amounts of the protein either in Bioreactor cultures, or by large scale in vitro translation.
- the mRNA can then be subjected to established accelerated protein evolution techniques, and the resultant mRNA library can then be franslated again in the Linker System to rapidly evolve huge libraries of protein variants.
- the proteins with enhanced characteristics may then be selected from the rest.
- the process can then be repeated multiple times to strengthen the desired trait or to add additional traits to the protein, since all of the mRNAs to the best candidate proteins are attached to their respective proteins and, therefore, can be easily harvested for repeat cycles (Figure 15).
- Prefened embodiments thereby, preferably obviate costly, time consuming conventional procedures cunently used by the industry to first identify the exact mRNA sequences that code for proteins of interest.
- Native Proteins In one embodiment native proteins can also be linked with their cognate mRNAs and easily selected in the same way as for novel proteins, described above.
- mRNAs collected from any organism or of unknown origin are translated in vitro using the SATA reagent and linking system as shown in Figure 14 (A) above.
- the proteins of interest are then selected out of the resultant library of protein-Linker-mRNA complexes.
- this approach is particularly useful for identifying the genes responsible for specific proteins because the mRNA message for a particular protein reflects the genes that created the mRNA code for that protein. Therefore, the mRNA message can be used as a probe to go back and identify the exact gene or gene sequences and their location in the genome that encode for that particular mRNA, and therefore for that specific protein.
- this allows one to quickly derive gene activity profiles characteristic for specific disease states. Gene activity profiles have already been used successfully to establish accurate diagnosis for specific types of cancer.
- the mRNA can be used to quickly generate more of the protein, or can be modified by infroducing mutations in vitro to produce desired variants of the protein.
- novel proteins can therefore be produced in weeks, rather than months or years required by the cunent method.
- Ability to optimize new protein development In one embodiment, the invention enables one to rapidly optimize development of proteins with desired properties by creating huge mRNA libraries from which rare proteins can be selected that are linked with their mRNAs, using in vitro franslation.
- manufacturing of protein based human therapeutics and vaccines using in vitro franslation procedures and translation formulations do not include reagents derived from animals and, therefore, greatly lowers the overall manufacturing costs.
- Manufacturing human therapeutics cunently requires animal products such as blood serum for production. This is expensive and creates additional costs to assure that the animal products used do not contaminate the therapeutic products with prions, viruses, or other animal borne contaminants.
- the applications for some embodiments of the invention extend to virtually every area in which proteins are involved. The following areas provide additional non- limiting examples of these applications, and potential products.
- binding proteins can be made quickly and easily that bind any reliable cell surface marker, including those found on diseased cells such as malignant cells, which when bound induces cell death.
- binding proteins can also be made to key biochemical targets such as Macrophage Migration Inhibitory Factor that, when inactivated by protein binding, prevents onset of Type I diabetes.
- prefened binding proteins can be used as therapeutic cell growth factors, for example ulcerative colitis can be effectively freated with Epidermal Growth Factor like proteins which stimulate re-growth and healing of the gut epithelium.
- binding proteins can also easily be made that bind established surface markers on disease causing organisms, thereby effectively inactivating them.
- prefened binding proteins can be used in diagnostic tests for detecting these organisms.
- Targets for such binding proteins include, but are not limited to, the viruses that cause HIV, Hepatitis, Herpes, smallpox, West Nile virus, SARS, viral pneumonia, genital warts and any other well characterized virus.
- prefened binding proteins can target the bacteria that cause Anthrax, bubonic plague, botulism, drag resistant staphylococcus, cholera, bacterial pneumonia and any other bacteria.
- Fungi such as pathogenic yeast can also be inactivated by successfully targeting them with prefened binding proteins.
- proteins can also be easily selected that block the binding sites on the host's cells which the infecting organisms target, or that their toxic metabolic products target.
- Diagnostics One embodiment of the invention is ideally suited for making highly accurate and stable diagnostic tests. Prefened embodiments can be used to identify the best target reflective of a disease state or any condition of interest, and subsequently, to generate novel binding proteins for use as trapping and/or signaling reagents. Prefened binding proteins can be selected with sensitivity, specificity and/or stability properties that are superior to monoclonal antibodies without the cost, time and effort associated with producing monoclonal antibodies for this purpose. In one embodiment, prefened proteins bind to the well characterized cancer targets CD-22 for fluid cancers or CD-33 for solid tumors.
- Prefened binding proteins may also be created that are substantially free of the immunogenicity and/or manufacturing problems associated with mAbs to these antigens, yet preferably still retain the same or better binding, specificity and/or sensitivity properties as the commercially available mAb products on the market.
- Food and Drug Administration (FDA) Overall, the FDA is trying to expedite the approval process for mAb based healthcare products. They find, however, that there are problems with mAbs such as: the inadequate characterization of the mAb and its target, changes in mAbs during scale up production, and immunogenicity of the mAb. Immunogenic reactions, while lower than with murine mAbs, still remain around 8% for the chimaric mAbs.
- the solution to this problem is to use prefened methods to generate production sized amounts of the prefened binding protein with an in vitro franslation system that uses synthetically formulated translation mixtures that do not involve animal products.
- binding proteins would only need to be safe and efficacious when compared to approved mAbs for the same targets.
- prefened embodiments of the mAb substitute products may receive strong interest from cunent mAb users and manufacturers.
- surface plasmon resonance technology may be used in combination with prefened methods for isolating and enriching rare proteins out of mRNA libraries which exhibit chosen properties.
- artificial franslation mixtures are used to replace cunently used animal reticulocyte based translation mixtures.
- Prefened embodiments may be adapted to large scale translation systems for production of large amounts of prefened protein products.
- CHO cells may be cultured in a Bioreactor.
- the mRNA for the selected proteins will be incorporated into the genome of the CHO cells.
- the CHO cells grown in the Bioreactor culture will be selected that express the protein coded for by the inserted mRNA.
- the prefened target protein may be isolated from the CHO cells or culture medium and further purified.
- prefened methods produce an initial binding protein that binds to well characterized cancer targets such as CD-22 or CD-33 Proteins may be selected that preferably do not have the same negative side effects associated with cunently marketed monoclonal antibody products that target these binding sites.
- Cellulase Enzymes in another embodiment, prefened methods produce an enzyme that substantially breaks down cellulose to glucose. Food and beverage producers convert edible com starch, from com kernels, to glucose with the enzyme amylase. Glucose is used as a sweetener in food and soft drinks and is used in the fermentation process to make alcoholic beverages or ethyl alcohol for use as a gasoline additive.
- the non-edible part of the plant is composed primarily of cellulose and is cunently not used for glucose production. Chemically, cellulose is a long chain of glucose molecules. Therefore, in one embodiment cellulase enzymes that digest the cellulose part of the plant to glucose would allow one to use substantially the entire plant for the production of glucose, instead of just the com starch component. With such prefened enzymes, considerably more glucose could be produced from the same amount of biomass. Further, with these prefened enzymes, virtually any plant material could be used to make glucose. This would translate into more cost effective end products and, therefore, these prefened enzymes should be of great interest to food and alcohol producers.
- Cellulase is cunently produced for research purposes by the Danish firm Novozyme Co ⁇ oration. They isolate the enzyme from two microbes, Aspergillus niger and Trichoderma reesei, in a bioreactor process called submerged fermentation. Novozyme has attempted, but has not been successful, in isolating a cellulase from these organisms that effectively breaks down non-edible parts of plants on a large scale.
- the invention may be used to rapidly create a family of cellulases that will digest any cellulose to glucose.
- the gene sequences for prefened enzymes can then be inserted into any convenient organism for large scale production.
- the invention can be carried out completely in vitro and may also provide huge mRNA libraries.
- Prefened embodiments use a linker which acts as a protein acceptor and the linkage takes place only after the protein has been completely synthesized. Therefore, in prefened embodiments the conect mRNA message is attached to the right protein, and because synthesis stops only after the entire mRNA message is franslated, it is virtually impossible to end up with shorter than normal proteins or with the message on the wrong protein.
- the invention preferably does not suffer from the same problems that limit the utility of competitor's technology and therefore, has much greater and wider-ranging application.
- Prefened embodiments are a much more powerful technology for creating and selecting proteins for commercialization, in addition to its potential use in microanays.
- a binding protein approach provides significant advantages over traditional mAbs.
- the invention can make vaccines safer and/or more effective, which would preferably result in less exposure to product liability.
- prefened methods produce mRNA libraries for use with, for example, companies that use microanays to establish seram protein profiles that reflect disease states such as cancer, or to identify gene or biochemical targets for therapeutic intervention.
- major companies which produce diagnostic tests are also included, but not limited to, which produce diagnostic tests.
- Prefened embodiments of the invention can also be used to create binding proteins that preferably result in diagnostic assays with higher sensitivity, specificity and/or accuracy for various items, including, but not limited to, cancer markers, for infectious diseases such as hepatitis, AIDS, SARS, H. pylori, and genital herpes, as well as for other disorders such as colitis and autoimmune disorders.
- Prefened biowarfare embodiments provide opportunities covering a wide- ranging spectrum of firms that range from start-ups to large established companies, as well as the Federal Government. These institutions are developers of diagnostic tests, anti-toxin therapeutics, neutralizing agents and vaccines which can be used with prefened embodiments.
- prefened embodiments include, but are not limited to, animal therapeutics and diagnostics, and treatment for plant pathogens.
- Industrial users of prefened embodiments of the invention include, but are not limited to, companies that design and/or produce enzymes for use in industry, companies that are following the cunent trend of adapting enzymes to reduce production costs in the food and petroleum additive business, and the paper, lumber and pefroleum industries for managing and controlling their environmental waste.
- EXAMPLE 8 - APPROACH DIAGNOSTICS Target Identification In the broadest sense, prefened embodiments could be used to identify a target that is over expressed in a single patient or more broadly by all or most patients with a specific disease.
- Prefened embodiments preferably take advantage of the ability to link mRNAs with the proteins they code for. For example, to identify a target, all mRNAs isolated from the serum of a patient or patients with a specific cancer, can be translated in vitro using standard eukaryotic or prokaryotic in vifro translation systems plus the SATA linker system. A protein profile of the resultant mRNA-SATA-Protein complexes can identify proteins that are over expressed as compared to normal patients. Establishing such protein profiles is a well established technique used in therapeutic proteomics today.
- One advantage of the approach of prefened embodiments is that the mRNAs are attached to the proteins and therefore, they can be harvested off of the selected proteins for further development of an assay.
- Scaled up amounts of the selected mRNAs can be made by reverse transcription of the mRNAs and PCR of the resultant cDNAs.
- the cDNA can be transfected into a host organism (e.g., E. coli, yeast, CHO cells, etc.) from which the proteins would be harvested. These proteins are the targets from which the one that best identifies the disease is chosen empirically and used for standards in the assay. Trapping and signaling binding proteins In one embodiment, the task is to identify two binding proteins that are highly specific for two separate binding sites on the target protein (T) and not on other seram proteins and that are also highly stable under test system conditions. The following protocol illustrates several embodiments of how these binding proteins can be produced: 1.
- An initial mRNA library can be constructed in one of two ways.
- A. First Method Initiation sequence An RNA oligo that includes a 5'UTR region leading to an AUG start codon can be constructed by commercial means. This would be used as a reagent that is later ligated to an mRNA library constructed from a random assembly of RNA triplets. This oligo sequence is necessary to initiate translation.
- Random mRNA library • A series of up to 61 RNA triplets that make up all of the sense codons can be commercially synthesized for the company. The synthesis would include OH groups on both the 5' and 3' ends of all of the triplets. • All of the oligos would be highly purified to exclude potential reading frame shifts.
- a portion of these triplet oligos would be 3' protected with any of the commercially available 3' protective groups. • A portion of the protected oligos would be ligated in a random fashion to a portion of the unprotected oligos with T4 RNA ligase. o This first ligation would form an oligo that includes the first two- codon sequences. Then one half of this material would be 5'phosphorylated and the other half would be 3' deprotected. The two pools would then be ligated to each other with T4 RNA ligase as before. o This second ligation forms an oligo that includes 4 codon sequences. Repeating this procedure 7X results in an mRNA library that includes up to 128 random codons.
- Random DNA library This method involves using highly purified phosphoramidite trimers to construct a randomized DNA library. • Available trimers are: AAA, AAC, ACT, ATC, ATG, CAG, CAT, CCG, CGT, CTG, GAA, GAC, GCT, GGT, GTT, TAC, TCT, TGC, TGG, TTC. • Highly purified phosphoramidite trimers can be purchased from a company such as Glen Research Corporation, Sterling, Virginia. • The randomized library can be constructed using the same principles as described above, and the reading frames can be inserted between 5' and 3' UTR's as above as well, using T4 DNA ligase
- Linking mRNA with its cognate protein with the SATA linker a) The library will be translated in vitro using commercially available prokaryotic or eukaryotic translation systems. b) The mRNAs will be connected to their peptide sequences using the SATA linker technology and UV inadiation at about 320-400 nm system.
- the SARS "S” protein produced above will be attached to avidin coated membranes through a biotin linker attached to the "S" protein, or by an anti-"S” antibody attached to the membranes, or by some other convenient means.
- the protein-SATA-mRNA complexes from the random library will be reacted with "S" protein coated surface plasmon resonance (SPR) membranes.
- SPR surface plasmon resonance
- the above distribution will be used to calculate the total amount of "ST" protein needed to select the proteins with the highest affinity required for use as trapping (Pt rap ) and signaling (P s i g ) probes for the assay as well as the number of rounds of selection necessary to attain the required affinity (see Appendix 2 for more detail).
- the amount of "ST” protein determined by the above will be bound to membranes a stationary phase as before and will be allowed to react with the protein-SATA-mRNA library.
- the resultant "ST"-protein-SATA- mRNA complexes will be recovered and inadiated briefly with 313 nm light to disassociate the mRNAs from the complexes.
- the mRNAs will then be reverse transcribed and amplified with enor prone PCR. This process will be repeated until proteins with optimal binding properties are evolved. Preparation of the p t , ap and the p s ; g probes.
- the Intrinsic sensitivity will depend on a high affinity for "ST" protein and specificity will depend on a low affinity for proteins other than "ST” protein.
- a) The mRNAs from the selected high affinity binding proteins will be reverse transcribed and amplified with PCR and will be inserted into E. coli for large scale production of each protein. The proteins will be harvested using established methods (Doonan, ed., Vol.
- the p trap probe will be functionalized by applying the trapping protein to 1 ⁇ m polyamine micro particles that have magnetic iron oxide cores (Nam, et al, Science 301:1884-1886 (2003), herein incorporated by reference, e.g., Figure 18).
- the reagents can then be adapted to any test format and testing device that is formatted to use all or any combination of the reagents.
- the p s i g probe will be functionalized by applying the signaling protein and bar code oligonucleotides to 30 nm gold beads as shown in Figure 19.
- the assay will involve the following steps: • The frapping probe, the patient sample, and the signaling probe will all be reacted together in a reaction well. • If the SARS viras is present, a complex will form consisting of the SARS viras sandwiched between the frapping and signaling probes via the exposed "S" protein. • The complex will be isolated magnetically from the non-binding components. The non-binding components will be washed away with 0.1 M phosphate buffered saline. • The hybridized DNA oligonucleotides will be dehybridized with NANOpure water to release the single stranded DNA bar code sequences.
- the concentration of the bar code sequences will be measured with a Scanometric DNA reader.
- Viral titer will be quantified by extrapolation from an "S" protein standard curve.
- the assay will be adapted to large scale testing using automated testing devices designed around magnetic beads.
- This test system has been used by others to detect PSA at concentrations as low as 300fM to 3aM in a lO ⁇ l test volume. The extreme sensitivity and specificity associated with this assay will make it possible to detect the low virus levels found in sputum of SARS infected patients in the early stages of disease.
- B. The assay's reactions are shown graphically in Figure 20
- C Test to determine if diagnostic is successful. 1.
- the SATA based assay will be compared with the R-PCR assay on the same samples to establish added value and efficacy. 2.
- the test will be used on sputum from patients with common respiratory viras infections such as influenza type A and B, adenoviras respiratory syncytial viras and parainfluenza virus types 1, 2, and 3 to determine specificity in a clinical setting. 3.
- the assay will then be used on sputum from SARS patients to establish sensitivity, specificity, accuracy values for the assay, and to determine its usefulness for early detection and management in a "real world" clinical setting.
- a vaccine to the SARS viras is provided.
- Methods for producing vaccines described herein are prophetic.
- one can use a less stringent selection so as to have a high number of different sequences and use multiple rounds of mutation with gradual increase in the stringency to evolve a large population of proteins with a high binding affinity.
- Such proteins are of value for making vaccines.
- the logic is similar to an anti idiotype vaccine except that there will be one and only one surface epitope that can react with the immune system.
- the aggregate concentration of the "S" protein presented to the immune system by the family of proteins will be sufficiently high to reach the threshold level required to stimulate a T-cell and B-cell response. However, the concenfration of any single protein within the family will be below the threshold required to stimulate a response to that protein. Therefore, the vaccine will stimulate antibody production only against the "S" epitope and not against any of the other epitopes present on the family of proteins. This will prevent production of antibodies that could inactivate the vaccine. In another embodiment, the vaccine will be synthesized such that it will stimulate antibody production against the "S" epitope and one or more other epitopes that have either a neutral or synergistic effect with activation of the "S" epitope.
- one method for making a vaccine to the SARS viras using such de-selected proteins can be performed as follows: 1. Preparation a) The sequence for the major histocompatibility complex class II (MHC- II) will be added to all of the cDNAs of a random mRNA library. The MHC II-binding sequence will permit the appropriate T-cell and ultimately, B cell response. b) The library will be transcribed and translated in vitro using prokaryotic or eukaryotic franslation systems and the SATA linker to link the proteins to their cognate mRNAs. c) The proteins will be selected from the library with a probe specific for the "S" epitope. The probe will be chemically linked to SPR membranes. i.
- MHC- II major histocompatibility complex class II
- the probe is an antibody
- antibodies will be used with random idiotypes as the blank for deselection as shown in Figure 21.
- the probe is another type of aptamer
- the aptamer will be saturated with S.
- Proteins that have high affinity for the anti-S antibody will be selected.
- the mRNAs will be dissociated from the complexes with 313 nm UV light and will be reverse transcribed and mutations will be introduced into the cDNA using enor prone PCR.
- the mutated cDNA library will be transcribed and translated as described in 1.b above and the proteins with highest affinity will be selected as before. This process will be repeated until a population of proteins is achieved that has maximum affinity for the anti S antibody.
- mRNAs will be dissociated from the complexes with 313 nm UV light. Then the mRNAs will be reverse transcribed for each mRNA. f) PCR will be used to make enough cRNA to insert the sequence into a vector to insert into either E. coli or yeast for bioreactor culture or alternatively for direct franslation in a scale-up in vifro translation system or for insertion into animal genomes such as goats for selection of product out of the goat milk.
- Fig. 22 illustrates B-cells with "S" receptors that become activated by the MHC-II on the proteins and in one embodiment, production sized lots of each of the reagents can be produced in bioreactor culture or in any host organism of choice. Because of the rapidity of the reactions involved, prefened reagents can be produced in weeks rather than many months or years and at considerably lower costs than required for making hybridomas for monoclonal antibodies.
- the task of developing an assay when the target is already known, such as any of the cunently used tumor markers would be expected to be much easier and faster since the task would only involve selection of the best binding proteins for use as trapping and signaling reagents.
- in vitro protein evolution is used to develop novel proteins.
- the methods used are based on selection by binding affinity. In some embodiments, this depends on the competition between protein molecules for binding to a target ligand: the proteins that are bound most tightly are selected and reproduced. The stringency of this in vifro selection is determined by the concenfration of the unbound target ligand:
- T is the target ligand
- ki is the dissociation constant of Ai
- [AiT] is the concenfration of that protein that is bound to the target
- [Ai]tot is the sum of the concentration of the bound and the unbound or total protein Ai.
- the ratio of the bound proteins differs from the ratio of the starting or total protein by the factor *.
- This can be called the enrichment factor because it is the amount of enrichment that can be achieved by binding to the target.
- the value of this factor is determined by the relation between the concenfration of the free target ligand [T] and the k values. If the k values are much smaller than [T]] the factor is 1 and there is no enrichment. If the k values are much bigger than [T] the enrichment is maximized at the ratio of the k values. Note that there are two ways to control the magnitude of the [T].
- the selection of the [T] value to use will depend on the end result desired. For some purposes a very stringent selection (low [T] value), with or without mutation, may be most useful. This would find a rare number of proteins when a small number of tightly binding proteins are desired. The other extreme would be to use much less stringent selection coupled to mutation in an iterative fashion.
- the -common epitope will -be -present in • eight- times the concentration of any- of the- background epitopes.
- the result would be a vaccine that reproduced a similar antibody in the vaccinated organism.
- the logic of this is much like that of an anti-idiotype vaccine. If the SCEPP were bred to complement a cellular viral receptor the produced antibody would resemble the receptor.
- one advantage gained by this technique would be that it allows the selection of the particular epitope on the protein that the antibody will bind to. It does not require a native protein within the liposome but using one permits affinity maturation to take place.
- binding proteins can also be made that neutralize toxins used as biowarfare agents, both those produced by infectious organisms or as weaponized biowarfare agents. Such agents may include, but are not limited to, botulinum toxin, ricin, and anthrax toxin.
- Enzymatic proteins can also be created that neutralize nerve agents which include, but are not limited to, Soman, NX, and Serin.
- Prefened neutralizing proteins can be incorporated into articles such as clothing to inactivate the agents before they contact the body, and can be used as aerosols to inactivate the agents on surfaces and/or while still airborne. Agriculture In another embodiment, as in human therapeutics, proteins can be created that bind to established surface markers on organisms that cause disease in food crops and livestock. Prefened embodiments can be used, for example, to make inexpensive diagnostic tests, therapeutic treatments and vaccines to such diseases including, but not limited to, anthrax, hoof and mouth disease and mad cow disease for cattle, and Newcastle disease in poultry .
- prefened protein products can be created inexpensively for use in broad spectrum applications that will decontaminate various surfaces, such as barns, conals, food troughs, feed lots and transportation equipment, thereby preferably preventing the onset of the disease or its spread to other animals or sites.
- Industrial enzymatic proteins can also be created that provide maximum production efficiency by preferably functioning at temperature, pressure and/or chemical conditions that are optimum for specific industrial reactions. Cunently industry is often forced to use enzymes that function at less than optimum production conditions for lack of better enzyme choices. Novozyme, for example, has been attempting to develop an enzyme that digests all forms of cellulose.
- Binding Protein Substitutes for Monoclonal Antibodies result in novel binding proteins useful as cancer therapeutics that are preferably superior to existing monoclonal antibodies cunently in use in clinical medicine. These protein embodiments will preferably demonstrate superior binding and/or specificity properties over traditional antibodies and preferably will not have the allergic and/or toxic properties associated with cunently used humanized mouse monoclonal antibodies. Rationale for Monoclonal Antibody Based Products Use of monoclonal antibodies (mAbs) as magic bullets fell out of favor about ten years ago because the early mAbs were entirely murine and therefore, they created problems when infused into humans (high fevers, allergic reactions, liver and kidney toxicity).
- mAbs monoclonal antibodies
- epitopes expressed on the surface of malignant cells There are at least eight well-characterized epitopes that are most targeted on fluid tumors.
- stable cell surface antigen epitopes e.g. CD-20, 22
- the cunent well studied strategy of choice is to use naked mAbs or mAbs labeled with isotopes (e.g. Yttrium, Iodine or Bismuth).
- the naked mAbs can trigger apoptosis and the isotope kills the target cell as well as sunounding cells.
- the surface epitopes e.g. CD-19, 33
- Clones of B-cells will form which will produce and release the antibodies to the "S" protein on the viras thereby inactivating itniAb.
- labeling the mAbs with toxin is the strategy of choice.
- This class of epitope is internalized upon binding with the mAb, and as such, the toxin is also drawn into the cell thereby killing the cell while sparing the sunounding cells.
- the vaccine will be injected with uric acid crystals or some similar adjuvant to induce immunogenicty.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pulmonology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US52933103P | 2003-12-12 | 2003-12-12 | |
US10/847,087 US7410761B2 (en) | 2000-05-19 | 2004-05-17 | System for rapid identification and selection of nucleic acids and polypeptides, and method thereof |
US10/847,484 US20040229271A1 (en) | 2000-05-19 | 2004-05-17 | Compositions and methods for the identification and selection of nucleic acids and polypeptides |
US62570704P | 2004-11-05 | 2004-11-05 | |
PCT/US2004/041380 WO2005072087A2 (fr) | 2003-12-12 | 2004-12-10 | Systemes et procedes pour la selection d'acide nucleique et de polypeptide |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1692155A2 true EP1692155A2 (fr) | 2006-08-23 |
EP1692155A4 EP1692155A4 (fr) | 2008-08-06 |
Family
ID=34831414
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP04821258A Withdrawn EP1692155A4 (fr) | 2003-12-12 | 2004-12-10 | Systemes et procedes pour la selection d'acide nucleique et de polypeptide |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1692155A4 (fr) |
JP (1) | JP2007513631A (fr) |
AU (1) | AU2004314705A1 (fr) |
CA (1) | CA2548465A1 (fr) |
WO (1) | WO2005072087A2 (fr) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
SI3611266T1 (sl) * | 2005-08-23 | 2023-02-28 | The Trustees Of The University Of Pennsylvania | Modificirani nukleozidi, ki vsebujejo RNA, in postopki za njihovo uporabo |
JP5084012B2 (ja) * | 2007-01-17 | 2012-11-28 | 国立大学法人福井大学 | イディオタイプ抗原用担体およびそれを用いたイディオタイプワクチン |
AU2008216303A1 (en) * | 2007-02-12 | 2008-08-21 | Proteonova, Inc. | Generation of library of soluble random polypeptides linked to mRNA |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001007657A1 (fr) * | 1999-07-27 | 2001-02-01 | Phylos, Inc. | Methodes de ligature d'un accepteur de peptide |
WO2003044194A1 (fr) * | 2001-11-16 | 2003-05-30 | Proteonova, Inc. | Selection et evolution d'acides nucleiques et de polypeptides |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5843701A (en) * | 1990-08-02 | 1998-12-01 | Nexstar Pharmaceticals, Inc. | Systematic polypeptide evolution by reverse translation |
US5688670A (en) * | 1994-09-01 | 1997-11-18 | The General Hospital Corporation | Self-modifying RNA molecules and methods of making |
US6440695B1 (en) * | 1998-04-17 | 2002-08-27 | Whitehead Institute For Biomedical Research | Method for producing diverse libraries of encoded polypeptides |
DE60129809T2 (de) * | 2000-05-19 | 2008-04-30 | Richard B. South Pasadena Williams | In vitro evolution von nukleinsäuren und kodierten polypeptiden |
-
2004
- 2004-12-10 CA CA002548465A patent/CA2548465A1/fr not_active Abandoned
- 2004-12-10 WO PCT/US2004/041380 patent/WO2005072087A2/fr active Application Filing
- 2004-12-10 JP JP2006544008A patent/JP2007513631A/ja active Pending
- 2004-12-10 AU AU2004314705A patent/AU2004314705A1/en not_active Abandoned
- 2004-12-10 EP EP04821258A patent/EP1692155A4/fr not_active Withdrawn
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001007657A1 (fr) * | 1999-07-27 | 2001-02-01 | Phylos, Inc. | Methodes de ligature d'un accepteur de peptide |
WO2003044194A1 (fr) * | 2001-11-16 | 2003-05-30 | Proteonova, Inc. | Selection et evolution d'acides nucleiques et de polypeptides |
Non-Patent Citations (1)
Title |
---|
See also references of WO2005072087A2 * |
Also Published As
Publication number | Publication date |
---|---|
WO2005072087A2 (fr) | 2005-08-11 |
EP1692155A4 (fr) | 2008-08-06 |
JP2007513631A (ja) | 2007-05-31 |
AU2004314705A1 (en) | 2005-08-11 |
CA2548465A1 (fr) | 2005-08-11 |
WO2005072087A3 (fr) | 2005-11-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6194550B1 (en) | Systematic polypeptide evolution by reverse translation | |
US7488600B2 (en) | Compositions and methods for the identification and selection of nucleic acids and polypeptides | |
JP2021063132A (ja) | 標的治療薬を作製する方法 | |
JP2023551072A (ja) | Rnaおよびdna修飾の多重プロファイリング | |
KR20100044787A (ko) | 개선된 오프―레이트를 갖는 압타머를 생성하는 방법 | |
US20070015181A1 (en) | System and methods for nucleic acid and polypeptide selection | |
US7351812B2 (en) | In vitro evolution of nucleic acids and encoded polypeptide | |
EP1290222B1 (fr) | Evolution in vitro d'acides nucleiques et de polypeptides codes | |
AU2001261771A1 (en) | In vitro evolution of nucleic acids and encoded polypeptide | |
EP1692155A2 (fr) | Systemes et procedes pour la selection d'acide nucleique et de polypeptide | |
US7410761B2 (en) | System for rapid identification and selection of nucleic acids and polypeptides, and method thereof | |
JP2004097213A (ja) | 核酸および/またはタンパク質の選択方法 | |
WO2003044194A1 (fr) | Selection et evolution d'acides nucleiques et de polypeptides | |
US20240016927A1 (en) | Modular targeted therapeutic agents and methods of making same | |
CN114410640B (zh) | 一种用于检测麻疹病毒的核酸适配体、试剂盒及应用 | |
Al-Ashtal et al. | Rustbelt RNA Meeting 2016 | |
Jiang | In vitro selection of aptamers and protein | |
US20140227724A1 (en) | Nucleic acid construct for use in screening for peptide antibody, and screening method using same |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20060529 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR |
|
DAX | Request for extension of the european patent (deleted) | ||
A4 | Supplementary search report drawn up and despatched |
Effective date: 20080707 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12Q 1/68 20060101ALI20060613BHEP Ipc: C12N 15/10 20060101AFI20080702BHEP |
|
17Q | First examination report despatched |
Effective date: 20081031 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20090512 |