WO2003038057A2 - Genetic vaccine against human immunodeficiency virus - Google Patents
Genetic vaccine against human immunodeficiency virus Download PDFInfo
- Publication number
- WO2003038057A2 WO2003038057A2 PCT/US2002/035112 US0235112W WO03038057A2 WO 2003038057 A2 WO2003038057 A2 WO 2003038057A2 US 0235112 W US0235112 W US 0235112W WO 03038057 A2 WO03038057 A2 WO 03038057A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- hiv
- recombinant adenovirus
- antigen
- virus
- host
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/21—Retroviridae, e.g. equine infectious anemia virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/29—Hepatitis virus
- A61K39/292—Serum hepatitis virus, hepatitis B virus, e.g. Australia antigen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55522—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55522—Cytokines; Lymphokines; Interferons
- A61K2039/55527—Interleukins
- A61K2039/55533—IL-2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
- C12N2740/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
- C12N2740/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/14011—Filoviridae
- C12N2760/14111—Ebolavirus, e.g. Zaire ebolavirus
- C12N2760/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/14011—Filoviridae
- C12N2760/14111—Ebolavirus, e.g. Zaire ebolavirus
- C12N2760/14134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- This invention relates to vaccines for stimulating immune responses in human and other hosts, and, in particular, relates to recombinant viruses that express heterologous antigens of human immunodeficiency virus (HIV) in a host and elicit immune response to HIV infection.
- HIV human immunodeficiency virus
- GPs membrane glycoproteins
- the Ebola virus and the HIV virus use of denatured virus or purified viral proteins often does not work satisfactorily. There may be several reasons for this.
- the GPs of these viruses are sensitive to the denaturing procedures so that the epitopes of the proteins are altered by the denaturing process.
- the sugar moieties of the GPs are important antigenic determinants for neutralizing antibodies.
- proteins made in bacteria are not properly glycosylated and can fold into somewhat different structures that can have antigenecities different from those of the natural viral proteins.
- many vaccines that are based on attenuated or denatured virus provide a weak immune response to poorly immunogenic antigens.
- the vaccine preparations frequently offer only limited protection, not life-long immunity as desired.
- DNA vaccines express antigens by plasmids directly injected into the body, the so-called naked DNA or DNA vaccine technology. These methods involve the deliberate introduction of a DNA plasmid carrying an antigen-coding gene by transfecting cells with the plasmid in vivo. The plasmid expresses the antigen that causes an immune response. The immune response stimulated by DNA vaccine can be very inefficient, presumably due to low levels of uptake of the plasmid and low levels of antigen expression in the cells. DNA vaccines are also characterized by an extremely short antigen expression period due to vector degradation. In addition, DNA vaccines are difficult and costly to produce in large amounts.
- Replication-competent, live vaccinia viruses have also been modified for expression of the genes for hepatitis B (HBV), human immunodeficiency virus (HIV), influenza and malaria antigens.
- HBV hepatitis B
- HAV human immunodeficiency virus
- influenza influenza
- malaria antigens malaria antigens.
- the immune response of recombinant vaccines is often of limited nature and magnitude.
- peripheral immunization with vaccinia influenza recombinants provides good protection against lower respiratory tract infections, it fails to induce immunity in the upper respiratory tract.
- peripheral immunization with recombinant vaccines may prove ineffective when local rather than systemic immunity is required, as in, for example, the gastro-intestinal tract.
- Vaccination with recombinant vaccinia virus expressing Ebola virus GP has been attempted to confer partial protection in guinea pigs. Gilligan, K.J., et al., Vaccines, 97:87-92 (1997).
- Vaccination with DNA constructs expressing either GP or nucleocapsid protein (NP) protects mice from lethal challenge with Ebola virus. Vanderzanden, L, et al., Virology, 246(1): 134-44 (1998).
- Genetic viral vaccines are provided. These vaccines are designed to mimic natural infection of pathogenic viruses without causing diseases that are naturally associated with the pathogenic viruses in a host to be immunized, such as human, domestic animals and other mammals.
- the vaccines are recombinant benign viruses that are replication deficient or incompetent.
- the benign viruses may be designed to express antigens from a wide variety of pathogens such as viruses, bacteria and parasites, and thus may be used to treat this wide variety of viruses, bacteria, and parasites that natively express these antigens.
- Infection of the benign virus causes host cells to express the antigens of the pathogenic virus and presents the antigen in its natural conformation and pathway as if the cell were infected by the pathogenic virus, and induces a strong and long-lasting immune response in the host.
- a recombinant benign virus for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: an antigen sequence heterologous to the benign virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the pathogenic virus and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus; and an immuno-stimulator sequence heterologous to the benign virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the recombinant virus is replication-incompetent and does not cause disease that is associated with the pathogenic virus in the host
- the recombinant benign virus may be a replication-incompetent virus such as adenovirus, adeno-associated virus, SV40 virus, retrovims, herpes simplex virus or vaccinia virus.
- the benign virus does not have the pathologic regions of the native progenitor of the benign virus but retains its infectivity.
- the benign virus is a replication- incompetent adenovirus, more preferably adenovirus type 5.
- the heterologous antigen sequence may be positioned in the E1, E3 or E4 region of the adenovirus.
- the immuno-stimulator sequence may be positioned in the E4, E3 or E1 region of the adenovirus.
- the heterologous antigen sequence and the immuno-stimulator sequence are positioned in the E1 , E3 or E4 region of the adenovirus, where the heterologous antigen sequence and the immuno-stimulator sequence are expressed from a promoter bicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- Expression of the viral antigen or the immuno-stimulator may be controlled by a promoter homologous to the native progenitor of the recombinant virus.
- expression of the viral antigen may be controlled by a promoter heterologous to the native progenitor of the recombinant virus.
- the promoter heterologous to the native progenitor of the recombinant virus may be a eukaryotic promoter such as insulin promoter, human cytomegalovirus (CMV) promoter and its early promoter, simian virus SV40 promoter, Rous sarcoma virus LTR promoter/enhancer, the chicken cytoplasmic ⁇ -actin promoter, and inducible promoters such as the tetracycline-inducible promoter.
- CMV human cytomegalovirus
- simian virus SV40 promoter simian virus SV40 promoter
- Rous sarcoma virus LTR promoter/enhancer Rous sarcoma virus LTR promoter/enhancer
- inducible promoters such as the tetracycline-inducible promoter.
- the pathogenic virus may be any pathogenic virus that causes pathogenic effects or disease in human or other animals.
- the recombinant benign virus can be used as a vaccine for protecting the host from infection of the pathogenic virus.
- the pathogenic virus may be various strains of human immunodeficiency virus (HIV), such as HIV-1 and HIV-2.
- HIV human immunodeficiency virus
- the viral antigen may be an HIV glycoprotein (or surface antigen) such as HIV GP120 and GP41 , or a capsid protein (or structural protein) such as HIV P24 protein.
- the pathogenic virus may be Ebola virus.
- the viral antigen may be an Ebola glycoprotein or surface antigen such as Ebola GP1 or GP2 protein.
- the pathogenic virus may be hepatitis virus such as hepatitis A, B, C, D or E virus.
- the viral antigen may be a surface antigen or core protein of hepatitis B virus such as the small hepatitis B surface antigen (SHBsAg) (also referred to as the Australia antigen), the middle hepatitis B surface antigen (MHBsAg) and the large hepatitis B surface antigen (LHBsAg).
- the viral antigen may be a surface antigen or core protein of hepatitis C virus such as NS3, NS4 and NS5 antigens.
- the pathogenic virus may be a respiratory syncytial virus (RSV).
- RSV viral antigen may be the glycoprotein (G-protein) or the fusion protein (F-protein) of RSV, for which the sequences are available from GenBank.
- the pathogenic virus may be a herpes simplex virus (HSV) such as HSV-1 and HSV-2.
- HSV viral antigen may be the glycoprotein D from HSV-2.
- the viral antigen may be a tumor antigen, such as Her 2 of breast cancer cells and CD20 on lymphoma cells, a viral oncogene such as E6 and E7 of human papilloma virus, or a cellular oncogene such as mutated ras. It is noted that, other virus-associated proteins or antigens are readily available to those of skill in the art. Selection of the pathogenic virus and the viral antigen associated with the pathogenic virus is not a limiting factor in this invention.
- the recombinant virus also expresses an immuno-stimulator to mimic cytokine-releasing response of a host cell upon viral infection and further augments the immune response to the viral antigen co-expressed from the recombinant virus.
- the immuno-stimulator may preferably be a cytokine.
- cytokine examples include, but are not limited to, interleukin-2, interleukin-8, interleukin-12, ⁇ - interferon, ⁇ -interferon, ⁇ -interferon, granulocyte colony stimulating factor (G-CSF), and granulocyte-macrophage colony stimulating factor (GM-CSF).
- G-CSF granulocyte colony stimulating factor
- GM-CSF granulocyte-macrophage colony stimulating factor
- the viral antigen may be a full-length antigenic viral protein or a portion of the antigenic viral protein that contains the predominant antigen, neutralizing antigen, or epitope of the pathogenic virus.
- the viral antigen contains the constant region of glycoproteins of at least two strains of the pathogenic virus.
- the viral antigen may be a modified antigen that is mutated from a glycoprotein of the pathogenic virus such that the viral antigen is rendered non-functional as a viral component but retains its antigenicity.
- modification of the viral antigen includes deletions in the proteolytic cleavage site of the glycoprotein, and duplications and rearrangement of immunosuppressive peptide regions of the glycoprotein.
- a recombinant adenovirus for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: an antigen sequence heterologous to adenovirus and encoding a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen upon infection of the host by the recombinant adenovirus.
- the recombinant virus is a replication-incompetent adenovirus.
- the pathogenic virus is HIV, including various types (e.g., HIV-1 and HIV-2), strains (e.g, strain BH10 and pNL4-3 of HIV-1), isolates, clades within a group of isolates (e.g., clade A, B, C, D, E, F, and G of group M of HIV-1 isolates) of HIV.
- the viral antigen may be a 1) HIV glycoprotein (or surface antigen) such as HIV envelope protein Env, either full length wild type (gp160), truncated (e.g, gp120 and gp41), or modified with insertions, deletions or substitutions; 2) HIV structural protein
- HIV antigen is an HIV envelop protein encoded by a polynucleotide selected from the group consisting of SEQ ID NOs: 14, 16, 20, 21 , 22, 23, and 24.
- the polynucleotide may further encode HIV regulatory proteins such as Tat, Vif, Nef, and Rev.
- the HIV antigen is a modified HIV envelope protein that includes multiclade variable loops.
- the multiclade variable loops are V3 loops from various clades such as clade A, B, C, D, E, F, and G of group M of HIV-1 isolates.
- the modified HIV envelope protein that includes multiclade variable loops may include two or more V3 loops from different HIV clades, preferably V3 loops encoded by polynucleotides selected from the group consisting of SEQ ID NOs: 25, 26, 27,
- the modified HIV envelope protein that includes multiclade variable loops is encoded by a polynucleotide selected from the group consisting of SEQ ID NOs: 32, 52, and 54.
- the HIV antigen is an HIV structural protein.
- the HIV structural protein may be a full length wild type Gag encoded by SEQ ID NO: 17, or a proteolytic fragment of Gag such as p17/24, p17 and p24.
- the fragment p17/24 may be in natural form and encoded by SEQ ID NO: 34, in secreted form and encoded by SEQ ID NO: 34, or in membrane bound form and encoded by SEQ ID NO: 36.
- the fragment p17 may be in natural form and encoded by SEQ ID NO: 40, in secreted form and encoded by
- SEQ ID NO: 41 or in membrane bound form and encoded by SEQ ID NO: 42.
- p24 may be in natural form and encoded by SEQ ID NO: 46, in secreted form and encoded by SEQ ID NO: 47, or in membrane bound form and encoded by SEQ ID NO: 48.
- the recombinant virus may further comprise a polynucleotide encoding an HIV protease PI such as SEQ ID NO: 56, expression of which facilitates proteolytic processing of Gag expressed from the same recombinant virus or from another vector.
- PI may be expressed as a fusion protein with Gag, or separately from a different promoter or from the same promoter for Gag via an IRES or splicing donor/acceptor mechanism.
- the recombinant virus may further comprise a polynucleotide encoding a fusion protein of HIV protease PI and HIV reverse transcriptase RT, PI-RT.
- PI may be expressed as a fusion protein with Gag, or separately from a different promoter or from the same promoter for Gag via an IRES or splicing donor/acceptor mechanism.
- the recombinant virus may further comprise a polynucleotide which is an HIV Pol gene and encodes the HIV enzyme proteins: HIV protease PI, reverse transcriptase RT, and integrase IN.
- Pol may be expressed as a fusion protein with Gag, or separately from a different promoter or from the same promoter for Gag via an IRES or splicing donor/acceptor mechanism.
- the recombinant virus may further comprise an immuno- stimulator sequence heterologous to the recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the present invention also provides viral vaccines that present multiple antigens to the host to further mimic natural infection of a native pathogenic virus and induce strong and long-lasting immune response to various strains or types of the pathogenic virus in the host.
- a recombinant virus is provided as a viral vaccine for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a viral antigen from a same pathogenic virus, different strains of a pathogenic virus, or different kinds of pathogenic viruses, expression of the plurality of the antigen sequences eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause malignancy in the host naturally associated with pathogenic virus.
- the recombinant virus may be any virus, preferably replication-incompetent adenovirus, adeno-associated virus, SV40 virus, retrovims, herpes simplex virus or vaccinia virus.
- the benign virus may also preferably have the pathologic regions of the native progenitor of the benign virus deleted but retain its infectivity.
- the plurality of the antigen sequences may be multiple copies of the same antigen sequence or multiple antigen sequences that differ from each another.
- At least two of the plurality of the antigen sequences are expressed from a promoter bicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- At least two of the plurality of the antigen sequences are expressed from a promoter to produce a fusion protein.
- the viral genome further comprises at least one promoter heterologous to the native progenitor of the recombinant virus that controls the expression of at least two of the plurality of the antigen sequences.
- promoter heterologous to the native progenitor of the recombinant virus include, but are not limited to, insulin promoter, CMV promoter and its early promoter, SV40 promoter, retrovims LTR promoter/enhancer, the chicken cytoplasmic ⁇ -actin promoter, and inducible promoters such as tetracycline-inducible promoter.
- the plurality of antigen sequences may be a combination of antigens from at least two strains of the pathogenic virus.
- the plurality of antigen sequences may be a combination of antigens from at least two different pathogenic viruses.
- the plurality of antigen sequences may be a combination of antigens from HIV-1 , HIV-2, herpes simplex virus type 1 , herpes simplex virus type 2, Ebola virus,
- Marburg virus Arbovirus (a group of viruses carried by mosquitoes that cause encephalitis, yellow fever, and dengue), and hepatitis A, B, C, D, and E viruses.
- the recombinant virus may further comprise one or more immuno-stimulator sequences that are heterologous to the benign virus and encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the immuno-stimulator may be a cytokine.
- the cytokine include, but are not limited to, interleukin-2, interleukin-4, interleukin-12, ⁇ - interferon, ⁇ - interferon, ⁇ -interferon, G-CSF, and GM-CSF.
- the one or more immuno-stimulator sequences may be multiple copies of the same immuno-stimulator sequence or multiple immuno-stimulator sequences that differ from each other.
- At least two of the immuno-stimulator sequences may be expressed from a promoter multicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- at least two of the immuno-stimulator sequences may be expressed from a promoter to form a fusion protein.
- a recombinant virus is provided as a genetic bacteria vaccine for eliciting an immune response in a host infected by the recombinant virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a bacterial antigen from a pathogenic bacteria, expression of the plurality of the bacterial antigen sequences eliciting an immune response directed against the bacterial antigen and cells expressing the bacterial antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication- incompetent and not cause malignancy naturally associated with the pathogenic bacteria in the host.
- the pathogenic bacteria may be any pathogenic bacteria that causes pathogenic effects or diseases in a host, such as bacillus tuberculoses, bacillus anthracis (causing vegetative anthrax), and spirochete Borrelia burgdorferi . hat causes the Lyme disease in animals.
- the plurality of antigen sequences may encode lethal factors, protective antigen, edema factors of the pathogenic bacteria, or combinations thereof.
- a recombinant virus is provided as a parasite vaccine for eliciting an immune response in a host infected by the recombinant virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the benign virus, each encoding a parasitic antigen from a pathogenic parasite, expression of the plurality of the parasitic antigen sequences eliciting an immune response directed against the parasitic antigen and cells expressing the parasitic antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause a malignancy naturally associated with the pathogenic parasite in the host.
- the pathogenic parasite may be any pathogenic parasites that cause pathogenic effects or diseases in a host, such as malaria and protozoa such as Cryptosporidium, Eimeria, Histomonas, Leucocytozoon, Plasmodium, Toxoplasma, Trichomonas, Leishmania, Trypanosoma, Giardia, Babesia, and
- the plurality of antigen sequences may encode coat proteins, attachment proteins of the pathogenic parasites, or combinations thereof.
- the present invention also provides pharmaceutical compositions that include the viral vaccines of the present invention.
- the pharmaceutical composition may include any of the recombinant viruses described above and a pharmaceutically acceptable carrier or diluent.
- the pharmaceutical composition may also include an adjuvant for augmenting the immune response to the viral antigen expressed from the recombinant virus.
- an adjuvant for augmenting the immune response to the viral antigen expressed from the recombinant virus.
- the adjuvant include, but are not limited to, bacillus Calmette-Guerin, endotoxin lipopolysaccharide, keyhole limpet hemocyanin, interleukin-2, GM-CSF, and cytoxan.
- kits may include any one or more vaccines according to the present invention in combination with a composition for delivering the vaccine to a host and/or a device, such as a syringe, for delivering the vaccine to a host.
- the present invention also provides methods for enhancing the immunity of a host with the recombinant viruses described above.
- the method comprises: administering to the host a recombinant virus in an amount effective to induce an immune response.
- the in the recombinant virus comprises: an antigen sequence heterologous to the recombinant virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus; and an immuno-stimulator sequence heterologous to the benign virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the recombinant virus may preferably be replication-incompetent and not cause malignancy naturally associated with the pathogenic virus in the host.
- the recombinant virus may be administered to the host via any pharmaceutically acceptable route of administration.
- the recombinant virus may be administered to the host via a route of intramuscular, intratracheal, subcutaneous, intranasal, intradermal, intramucosally, rectal, oral and parental administration.
- a method for enhancing the immunity of a host to a pathogenic virus with multiple antigens.
- the method comprises: administering to the host a recombinant virus in an amount effective to induce an immune response.
- the recombinant virus comprises: a plurality of antigen sequences heterologousto the benign virus, each encoding a viral antigen from a pathogenic virus, expression of the plurality of the antigen sequences eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause malignancy naturally associated with the pathogenic virus in the host.
- the recombinant virus may further comprise one or more immuno-stimulator sequences heterologous to the recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- a method for enhancing the immunity of a host to a pathogenic virus by using multiple recombinant viral vaccines (or viruses).
- Multiple recombinant viruses may carry different antigens in each recombinant virus.
- the multiple recombinant viruses may be administered simultaneously or step-wise to the host.
- the method comprises: administering to a host a first and second recombinant viruses in an amount effective to induce an immune response.
- the first recombinant virus comprises: an antigen sequence heterologous to the first recombinant virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the second recombinant virus comprises: an immuno-stimulator sequence heterologous to the recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the first and second recombinant viruses may preferably be replication-incompetent and not cause a malignancy naturally associated with the pathogenic virus in the host.
- the first and second recombinant virus may be any benign virus, such as replication-incompetent adenovirus, adeno- associated virus (AAV), SV40 virus, retrovims, herpes simplex virus, Alpha virus, Venezuelan Equine Encephalitis (VEE) virus and vaccinia virus.
- AAV adeno-associated virus
- VEE Venezuelan Equine Encephalitis
- both the first and second recombinant viruses may be replication-incompetent adenovirus.
- one of the first and second recombinant viruses may be recombinant adenovirus and the other may be recombinant AAV, SV40 virus, retrovims, herpes simplex virus, Alpha virus, Venezuelan Equine Encephalitis (VEE) virus or vaccinia virus.
- VEE Venezuelan Equine Encephalitis
- a method for enhancing the immunity of a host to a pathogen.
- the method comprises: administering to the host a recombinant virus and one or more immuno-stimulators.
- the recombinant virus may be any of the recombinant viruses described above.
- the recombinant virus comprises one or more antigen sequences heterologous to the recombinant virus that encode one or more antigens from the pathogen. Expression of the antigen elicits an immune response directed against the antigen and cells expressing the antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus is preferably replication-incompetent and does not cause a malignancy naturally associated with the pathogen in the host.
- the pathogen may be a pathogenic virus such as HIV, hepatitis virus and Ebola virus, a pathogenic bacteria or parasite.
- the immuno-stimulator may be any molecule that enhances the immunogenicity of the antigen expressed by the cell infected by the recombinant virus.
- the immuno-stimulator is a cytokine, including, but not limited to interleukin-2, interleukin-8, interleukin-12, ⁇ -interferon, ⁇ -interferon, ⁇ -interferon, granulocyte colony stimulating factor, granulocyte-macrophage colony stimulating factor, and combinations thereof.
- the cytokine may be administered into the host in a form of purified protein alone or formulated with one or more pharmaceutically acceptable excipients.
- the cytokine may be administered in a form of expression vector that expresses the coding sequence of the cytokine upon transfecting or transducing the cells of the host.
- the method may further comprise: administering to the host the recombinant virus again to boost the immune response.
- a booster inoculation with the recombinant virus is preferably conducted several weeks to several months after the primary inoculation.
- the recombinant virus administered in the booster immunization may be the same as or different from the recombinant virus administered in the primary immunization.
- the method may further comprise: administering to the host a plasmid vector that encodes the same or different antigen(s) as that (or those) encoded by the recombinant virus.
- the plasmid vector is preferably a eukaryotic plasmid expression vector that expresses the antigen(s) upon transfection of the cells in the host.
- the method may further comprise: administering to the host a second recombinant virus to boost the immune response and/or to minimize neutralizing effects of the host's immune system on the recombinant viruses.
- the second recombinant virus comprises a second antigen sequence from a second pathgen that is different from the first antigen sequence comprised in the first recombinant virus administered in the primary immunization.
- the second antigen sequence encodes the same type of antigen as that encoded by the first antigen sequence but from a different strain, serotype, or subtype/clade of the same pathogen.
- the second antigen may be a different type of antigen compared to the first antigen, for example, the first antigen being a surface protein and second antigen being a core protein of the same or different pathogen.
- the method may further comprise: administering to the host a viral vector prior to, concurrently, or post the administration of any of the above embodiment of the recombinant virus to minimize neutralizing effects of the host's immune system on the recombinant virus.
- the viral vector is administered post the administration of the recombinant virus.
- the viral vector may be the native progeny of the recombinant virus.
- the viral vector may be the wildtype adenovirus type 5 (Ad5) whereas the recombinant virus is a genetically modified Ad5.
- the viral vector may be the wildtype of or a genetically modified virus that is a different serotype of the recombinant virus.
- the recombinant virus may be a genetically modified Ad5 whereas the viral vector is the wildtype of or a genetically modified adenoviral vector serotype other than Ad5, for example, serotype 1-4 or 6-51. It is noted that other serotypes discovered and/or classified later also fall within the scope of the invention.
- the viral vector may be a different virus from the recombinant virus.
- the recombinant virus may be a genetically modified Ad5 whereas the viral vector is a genetically modified AAV, SV40 virus, retrovims, herpes simplex virus, Alpha virus, Venezuelan Equine Encephalitis (VEE) virus or vaccinia virus.
- the viral vector may or may not comprise a heterologou antigen sequence.
- the viral vector may comprise another antigen sequence which is the same or different from the antigen sequence carried by the recombinant virus.
- the viral vector may be a chimeric vector modified based on the native progenitor of the recombinant virus.
- the native progenitor of the recombinant virus is adenovirus type 5
- the viral vector may be a chimeric adenovirus type 5 with certain regions of the backbone changed from type 5 to the corresponding regions from other adenovirus serotypes.
- the fiber knob, shaft, and/or penton base in the backbone of adenovirus type 5 can be replaced by the corresponding region(s) of the backbone from adenovirus serotype 1-4, and 6-51.
- the viral vector also comprises one or more heterologous antigen sequence and/or immuno-stimulator sequence which are the same or different from those in the recombinant virus.
- the methods described above may be used for prevention or treatment of diseases.
- the administration of the recombinant viruses of the present invention may be for either "prophylactic" or "therapeutic" purpose.
- the recombinant virus is provided in advance of any symptom.
- the prophylactic administration of the recombinant virus serves to prevent or ameliorate any subsequent infection or disease.
- the recombinant virus is provided at (or after) the onset of a symptom of infection or disease.
- the present invention may be provided either prior to the anticipated exposure to a disease-causing agent or after the initiation and/or progression of the infection or disease.
- sequences encoding tumor-specific antigens may substitute the antigen sequence encoding viral antigen in any of the above embodiments of the recombinant virus and methods of using the same.
- Expression of tumor-specific antigens in the host should elicit specific immune response for prevention in patients with an increased risk of cancer development (i.e., preventive immunization) or to enhance the treatment of cancer with other therapeutics, prevention of disease recurrence after primary surgery (anti-metastatic vaccination), or as a tool to expand the number of CTL in vivo, thus improving their effectiveness in eradication of diffuse tumors (treatment of established disease).
- the methods of the present invention may elicit an immune response in a patient that is enhanced ex vivo prior to being transferred back to the tumor bearer (i.e., the adoptive immunotherapy).
- the method may further comprise: harvesting serum from the host after the administration of the recombinant virus.
- the harvested serum should contain antibodies against the antigen(s) encoded by the recombinant virus.
- the method may further comprise: isolating antibody or antibodies against the pathogen from the host after the administration of the recombinant virus.
- the harvested serum or isolated antibody can be stored for certain periods of time for further uses. For example, a healthy human volunteer can serve as the host and the serum or antibody collected from him/her may be administered back to him/herself or a different person later to in anticipation or in the event of infection of the pathogen as prophylactic or therapeutic agent by eliciting passive immunity against the pathogen.
- the host may be a non-human animal and the serum harvested or antibody isolated from the animal immunized by the recombinant virus may be used as a prophylactic or therapeutic agent to treat a human or non-human animal in anticipation or in the event of infection of the pathogen such as in the outbreak of biological warfare.
- wildtype codons for the above- described antigens can be replaced with codons that are preferred by the host to be immunized, e.g., a human.
- the resulting mutants fall within the scope of the present invention.
- Figures 1A-1C illustrate an example of how to construct a genetic vaccine of the present invention.
- Figure 1A illustrates an example of a shuttle vector pLAd.Antigen carrying multiple antigen genes such as Antigen 1 and Antigen 2 which can be expressed from a CMV ie promoter bicistronically via a splicing donor-acceptor mechanism at the SD and SA sites.
- Figure 1 B illustrates an example of a shuttle vector pRAd. Cytokines carrying multiple cytokine genes such as IL-2, INF, and IL-8 genes which can be expressed from a CMVj e promoter bicistronically via an internal ribosomal entry site IRES and a splicing donor-acceptor mechanism at the SD and SA sites.
- Figure 1C illustrates an example of constructing a genetic vaccine by ligating with an adenoviral backbon with a fragment that is derived from the shuttle vector pLAd.Antigen and contains multiple antigen genes and a fragment that is derived from the shuttle vector pRAd. Cytokines and contains multiple cytokine genes.
- Figure 2 illustrates the wild-type GP gene, which encodes the two forms of glycoproteins (sGP and GP), contains a RNA editing signal that results in un-edited and edited mRNAs. The sGP is synthesized from an unedited mRNA and the GP is synthesized from an edited mRNA (having an insertion in one of the seven uridines).
- Figure 2 also depicts the modifications made to the RNA to prevent the synthesis of sGP.
- the RNA editing site is modified from UUU UUU U to UUC UUC UU. This modification removes the editing signal and results in the mRNA coding only for the GP.
- Figure 3 illustrates the modification of the immunosuppressive peptide (IS) located in GP2.
- Figure 3A shows the wild type GP.
- Figure 3B shows GP with the 10 amino acid deletion of the IS peptide.
- Figure 3C shows the IS peptide, which is split, reversed and duplicated.
- Figures 4A and 4B illustrate a procedure used to create a recombinant adenoviral vector as a genetic vaccine against Ebola virus.
- Figures 4A illustrates a shuttle vector pLAd/EBO-GP carrying the GP gene of Ebola virus an antigen, and a shuttle vector pRAdlL2,4 carrying the IL- 2 and IL-4 gene.
- Figure 4B illustrates the construction of a recombinant adenoviral vector by ligating an adenoviral backbone with a fragment that is derived from the shuttle vector pLAd/EBO-GP and contains the GP gene and a fragment that is derived from the shuttle vector pRAdlL2,4 and contains IL-2 and IL-4 genes.
- FIG. 5 illustrates a complex adenoviral vector as an example of the genetic vaccine of the present invention.
- the Ebola viral GP gene is expressed by a CMVie promoter in the E1 region.
- the GP gene is followed by
- INF- ⁇ and GM-CSF which are expressed by two IRES sequences. This configuration allows for the expression of three proteins from a single mRNA. Expression of IL-2 and IL-4 is controlled by a second CMVie promoter as a bi- cistronic cassette, and followed by a second bi-cistronic cassette that expressed the two subunits of IL12 in the E4 region by a SV40 early promoter.
- Figure 6 shows relative titers of antibody against HIV antigens in a group of mice.
- Figure 7 shows relative titers of antibody against HIV antigens in another group of mice.
- Figure 8A-C show INF- ⁇ secretion from activated splenocytes harvested from mice inoculated with adenoviral vectors in response to target cell stimulation.
- Figure 9 shows granzyme A secretion from activated splenocytes harvested from mice inoculated with adenoviral vectors in response to target cell stimulation.
- Figure 10A shows relative titers of antibody against HBV surface antigen in a group of mice.
- Figure 10B shows relative titers of antibody against HBV surface antigen in another group of mice.
- Figure 11 A shows relative titers of antibody against HBV core antigen in a group of mice.
- Figure 11 B shows relative titers of antibody against HBV core antigen in another group of mice.
- Figure 12A shows relative titers of antibody against HIV Gag in mice in week 10 post-immunization with Ad-3C/E m ⁇ C ⁇ T 300 -G.
- Figure 12B shows relative titers of antibody against HIV Gag in mice in week 14 post-immunization/week 3 post-boost with Ad-3C/E m ⁇ C ⁇ T 300 -G.
- Figure 13A shows relative titers of antibody against HIV Gag in mice in week 10 post-immunization with Ad-3C/E m ⁇ C ⁇ T 99 -G.
- Figure 13B shows relative titers of antibody against HIV Gag in mice in week 14 post-immunization/week 3 post-boost with Ad-3C/E m ⁇ C ⁇ T 99 -G.
- Figure 14A shows results of the granzyme A assays for memorizing a single granzyme A assays for memorizing a single granzyme A assays for memorizing a single granzyme A assay for a single granzyme A assay for a single granzyme A assay for a single granzyme A assay for a single granzyme A assay for a single granzyme A assay for week 4, 6, 8 post-immunization and week 12/1 , 13/2, 14/3 (prime/boost) post- secondary inoculation with Ad.3C.env.gag.
- Figure 14B shows the results of the granzyme A assays for memorize 2 mice at week 2, 4, 6, 8 post-immunization with Ad.3C.env.gag.
- Figure 15A shows the ELISPOT results for the four mice in memorize 1 at week 13/2 post-prime/boost with Ad.3C.env.gag.
- Figure 15B shows the ELISPOT results for the four mice in memorize 1 at week 13/2 post-prime/boost with Ad.3C.env.rev.gag.
- Figure 16A illustrates a shuttle vector pLAd-E.T.R.
- Figure 16B illustrates a shuttle vector pRAd-ORF6-IL2.
- Figure 17A illustrates a shuttle vector pRAd-ORF6-cmv- E m ⁇ C ⁇ T 300 -G.
- Figure 17B illustrates a shuttle vector pLAd-3C.
- Figure 18 illustrates a shuttle vector pRAd-E m ⁇ C ⁇ T 99 .T.R-G
- Figure 19A illustrates a shuttle vector pLAd- E ⁇ V 1?2 ⁇ C ⁇ T.T.R-IL2.
- Figure 19B illustrates a shuttle vector pRAd-ORF6-G.IL2.
- Figure 20 illustrates a shuttle vector pLAd-E m ⁇ C.T.R.N.
- Figure 21 illustrates a shuttle vector pLAd-E m ⁇ C.N.
- Figure 22 illustrates a shuttle vector pLAd-E m ⁇ C ⁇ T 300 .T.
- Figure 23A illustrates a shuttle vector pLAd-E m ⁇ C.
- Figure 23B illustrates a shuttle vector pRAd-ORF6-E m ⁇ C.
- Figure 24 illustrates a process for constructing a multi-clade insert by PCR.
- Figure 25 illustrates a shuttle vector pLAd-E m .V3.
- Figure 26 illustrates a shuttle vector pLAd-E m .2xV3.
- Figure 27A illustrates a shuttle vector pRAd-ORF6-p17/p24.
- Figure 27B illustrates a shuttle vector pRAd-ORF6-p17/p24sec.
- Figure 27C illustrates a shuttle vector pRAd-ORF6-p17/p24MB.
- Figure 28A illustrates a shuttle vector pRAd-ORF6-p17.
- Figure 28B illustrates a shuttle vector pRAd-ORF6-p17sec.
- Figure 28C illustrates a shuttle vector pRAd-ORF6-p17MB.
- Figure 29A illustrates a shuttle vector pRAd-ORF6-p24.
- Figure 29B illustrates a shuttle vector pRAd-ORF6-p24sec.
- Figure 29C illustrates a shuttle vector pRAd-ORF6-p24MB.
- Figure 30A-B illustrate a process of construction of Ad- E m .2xV3 m /p17/p24MB.
- Figure 31A-B illustrate a process of construction of Ad- E m .2xV3 m /p17MB.
- Figure 32A-B illustrate a process of construction of Ad- E m .2xV3 m /p24MB.
- Figure 33 illustrates a shuttle vector pLAd-E m ⁇ C ⁇ T 300 .2xV3 m .T.
- Figure 34 illustrates a shuttle vector pLAd-E m ⁇ C ⁇ T 99 .2xV3 m .T.R.
- Figure 35 illustrates a shuttle vector pRAd-ORF6-G.PI.
- Figure 36 illustrates a shuttle vector pRAd-ORF6-G-PI.
- Figure 37 illustrates a cloning vector SD/SA1.2.3
- Figure 38 shows DNA sequence encoding Env/Tat/Rev from HIV-1 strain BH10.
- Figure 39 shows DNA sequence encoding a mutated IL-2 (IL-2 ⁇ X).
- Figure 40 shows DNA sequence encoding a modified Env (E m ⁇ C ⁇ T (BH10).
- Figure 41 A shows DNA sequence encoding the full length HIV Gag.
- Figure 41 B shows amino acid sequence of the full length HIV Gag.
- Figure 42 shows DNA sequence encoding Env, and full length Tat and Rev.
- Figure 43 shows DNA sequence encoding E ⁇ V,, 2 ⁇ C ⁇ T.T.R.
- Figure 44 shows DNA sequence encoding E m ⁇ C.T.R.N.
- Figure 45 shows DNA sequence encoding E m ⁇ C.N.
- Figure 46 shows DNA sequence encoding E m ⁇ C ⁇ T 3Q0 .T.
- Figure 47 shows DNA sequence encoding E m / E m .
- Figure 48 shows DNA sequences of V3 loops of clade B, A, C, D, E, F, and G.
- Figure 49A shows DNA sequence encoding a modified Env including multi-clade V3 loops.
- Figure 49B shows amino acid sequence encoding a modified Env including multi-clade V3 loops.
- Figure 50A shows DNA sequence encoding p17/p24 in natural form, secreted form, and membrane bound form, respectively.
- Figure 50B shows amino acid sequence of p17/p24 in natural form, secreted form, and membrane bound form, respectively.
- Figure 51 A shows DNA sequence encoding p17 in natural form, secreted form, and membrane bound form, respectively.
- Figure 51 B shows amino acid sequence of p17 in natural form, secreted form, and membrane bound form, respectively.
- Figure 52A shows DNA sequence encoding p24 in natural form, secreted form, and membrane bound form, respectively.
- Figure 52B shows amino acid sequence of p24 in natural form, secreted form, and membrane bound form, respectively.
- Figure 53A shows DNA sequence encoding a modified Env including multi-clade V3 loops, and Tat.
- Figure 53B shows amino acid sequence of a modified Env including multi-clade V3 loops, and Tat.
- Figure 54A shows DNA sequence encoding a modified Env including multi-clade V3 loops, Tat, and Rev.
- Figure 54B shows amino acid sequence of a modified Env including multi-clade V3 loops, Tat, and Rev.
- Figure 55A shows DNA sequence encoding an HIV protease PI.
- Figure 55B shows amino acid sequence of an HIV protease PI.
- Figure 56A shows DNA sequence encoding HIV Gag-PI.
- Figure 56B shows amino acid sequence of HIV Gag-PI.
- Figure 57 shows PCR primers for cloning V3 loops from multiple HIV clades.
- Figure 58 illustrates a shuttle vector pRAd-ORF6-Gag/PI-RT.
- Figure 59 illustrates a shuttle vector pRAd-ORF6-Gag-PI-RT.
- Figure 60 illustrates a shuttle vectorpRAd-ORF6-Gag/Pol.
- Figure 61 illustrates a shuttle vectorpRAd-ORF6-Gag-Pol.
- Figure 62 illustrates a right shuttle vector pR-Ad.5/35-6m.
- Figure 63 shows various embodiments of chimeric vectors having the individual domains of the Ad5 fiber regions substituted with the corresponding domains of Ad35 fiber region.
- the present invention provides genetic vaccines, pharmaceutical compositions including the vaccines and methods of immunizing a host against infection of a wide range of pathogenic viruses, bacteria and parasites.
- the genetic vaccines are recombinant benign viruses that are replication deficient and do not cause malignancy in the host to be immunized.
- Vaccination using the genetic vaccines of the present invention mimics natural viral infection in that the antigen(s) expressed by the cell infected by the genetic vaccine is presented to the host immune system in its natural conformation and by a "inside-out” mechanism, as compared with the conventional "outside-in” approach of vaccination using denatured protein or virus as a vaccine.
- the recombinant virus is capable of expressing multiple pathogenic antigens, mimicking natural pathogen infection.
- multiple pathogenic antigens such as a combination of an HIV envelop protein
- Env and structural protein Gag can be expressed by the recombinant virus to elicit not only humoral immune response (i.e., production of antibody from B cells, helper T cells, and suppressor T cells), but also cellular response by producing cytotoxic T lymphocytes (CTL) directed specifically to these antigens.
- CTL cytotoxic T lymphocytes
- the pathogenic antigen that is naturally expressed as an intracellular protein can be modified to be secretable and rendered bound to the cell surface, thus better presenting the antigen to the body's immune system.
- the cell infected by the genetic vaccine may also release high levels of cytokine, thereby further mimicking the natural response of the cell under stress induced by viral infection and yet not causing pathogenic effects on the cells.
- the host immune system mounts a strong immune defense against the antigen presented by the infected cell. Therefore, in a sense, the genetic vaccine of the present invention behaves like a "sheep in wolfs clothing", presenting the viral antigen to induce a strong immune response and yet not causing the detrimental effects that the pathogens would cause on the host.
- the recombinant viruses of the present invention can not only be used as a vaccine to prevent infection of the pathogen but also as a therapeutic agent to treat diseases associated with the infection of the pathogen.
- a recombinant virus is provided for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: an antigen sequence heterologous to the recombinant virus and encoding a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus; and an immuno-stimulator sequence heterologous to the recombinant virus and encoding an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the recombinant virus is replication-incompetent and does not cause the malignancy naturally associated with the pathogenic virus in the host.
- a recombinant virus is provided as a viral vaccine for eliciting an immune response against multiple antigens in a host infected by the virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the benign virus, each encoding a different viral antigen from one or more pathogenic viruses, expression of the plurality of the antigen sequences eliciting an immune response directed against the viral antigens and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause the malignancy that is naturally associated with the pathogenic virus(es) in the host.
- the vaccines of the present invention can be used to immunize the host against a wide variety and different strains of pathogenic viruses such as HIV-1 , HIV-2, herpes simplex virus type 1 , herpessimplex virus type 2, Ebola virus, Ebola virus, and hepatitis A, B, C, D, and E viruses, or pathogenic bacteria such as bacillus tumerculoses and bacillus anthracis.
- pathogenic viruses such as HIV-1 , HIV-2, herpes simplex virus type 1 , herpessimplex virus type 2, Ebola virus, Ebola virus, and hepatitis A, B, C, D, and E viruses, or pathogenic bacteria such as bacillus tumerculoses and bacillus anthracis.
- the recombinant vaccine of the present invention is a recombinant virus that contains nucleic acid sequences encoding one or more viral antigens in the viral genome.
- a host is immunized by the recombinant vaccine, i.e., infected by the recombinant virus
- the infection of the virus in a host cell results in expression of the viral antigen which is present on the surface of the infected cell. Since expression of the viral antigen is driven by a strong promoter, expession can be maintained at a high level.
- the host immune system mounts a strong defense against the viral antigen, thereby achieving long-lasting immunity against the pathogenic virus from which the viral antigen is derived.
- the viral antigen expressed from the recombinant virus of the present invention better mimics the natural viral antigen in its structure and function.
- Isolated protein vaccine may not adopt the native conformation of the natural viral antigen and may not be properly glycosylated in the bacteria, yeast or insect cells.
- This antigen is presented from the outside of the host cell.
- This conventional "outside-in” approach often does not generate strong, long-lasting immune response, presumably due to the altered antigenicity of the vaccine and quick clearance of the protein vaccine by the immune scavenging cells.
- the genetic vaccine of the present invention i.e., the recombinant virus, presents the viral antigen by an "inside-out" mechanism.
- the viral antigen is expressed after infection of the recombinant virus in the host cells. This better mimics the natural production and presentation of the viral antigen by the pathogenic virus.
- the present invention dramatically reduces the risk of side effects that may potentially be generated by using replication- competent, live virus.
- vaccines based on live vaccinia virus can replicate in the host cells, which can impose a high level of stress on the host cell and eventually lead to cell death.
- the process of making the genetic vaccine of the present invention is much safer.
- Vaccination of a large population of people or animals demand large amounts of vaccines.
- virulent viruses such as Ebola virus and HIV
- large-scale production of attenuated or inactive virus from the live virus can pose a great danger to the environment and people who handle the live virus.
- the recombinant virus of the present invention can be used to express multiple antigen sequences simultaneously from the same viral vector.
- the recombinant virus may encode multiple antigens from the same strain of pathogenic virus, from different strains of the same pathogenic viruses, or from different antigens from different kind of viruses, bacteria or parasites. This enables the vaccines of the present invention to be utilized to immunize against a broad-spectrum of viruses and other infectious agents. Since these multiple antigen sequences are rearranged in the recombinant viral genome, the risk of potential recombination of these viral sequences to generate a pathogenic virus is virtually eliminated.
- the genetic vaccine of the present invention also preferably express large amount of immunuo-stimulator, such as cytokine.
- immunuo-stimulator such as cytokine.
- virus-infected cells display viral antigens on their surface in the context of the MHC-I receptor, while viral particles are digested by the professional antigen-presenting cells which display antigens in association with MHC-II receptors.
- cytokines and interferons are produced, resulting in a strong humoral and cellular response to the viral antigens.
- large numbers of memory cells remain to defeat any new infection.
- vaccinations using isolated protein vaccines the protein is quickly cleared by the immune scavenging cells.
- the vaccine itself is a benign virus that does not have the detrimental effects of the pathogenic virus.
- infection of a pathogenic virus such as HIV, influenza virus and Ebola virus has profound immuno-suppressing effects on the host, presumably due to the immuno-suppressing functions of the glycoproteins of the virus.
- the viral antigen sequence carried by the genetic vaccine is preferred to have its pathogenic or immuno- suppressing regions deleted.
- the genetic vaccine of the present invention behaves like a "sheep in wolf's clothing", presenting the viral antigen to induce strong immune response and yet not causing detrimental effects on the host.
- the present invention is directed to vaccines that mimic the features of a native pathogenic virus, but without eliciting immuno-suppression and pathogenicity, thus causing the host to mount an effective defense, while not being in any actual danger of infection.
- the genetic vaccines are replication incompetent or defective viruses into which one or more DNA sequences encoding one or more viral antigens are inserted into the regions of the viral genome non-essential to its infectivity.
- the recombinant virus expresses the viral antigens and elicits a cell-mediated immune response in vivo directed against the antigens and cells expressing the antigens.
- a recombinant virus for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: an antigen sequence heterologous to the recombinant virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viralantigen in the host upon infection of the host by the recombinant virus; and an immuno-stimulator sequence heterologous to the recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the recombinant virus is replication-incompetent and does not cause a malignancy naturally associated with the pathogenic virus in the host.
- the recombinant virus may be constructed from any virus as long as the native progenitor is rendered replication incompetent.
- replication-incompetent adenovirus, adeno-associated virus, SV40 virus, retrovims, herpes simplex virus or vaccinia virus may be used to generate the recombinant virus by inserting the viral antigen into the region non-essential to the infectivity of the recombinant virus. Therefore, it is preferred that the recombinant virus does not have the pathologic regions of the native progenitor of the benign virus but retains its infectivity to the host.
- the recombinant virus is a replication- incompetent adenovirus.
- the recombinant adenovirus of the present invention can direct high levels of antigen expression that provide strong stimulation of the immune system.
- the antigen expressed by cells infected by adenovirus is processed and displayed in the infected cells in a way that mimics pathogen-infected cells. This phase is believed to be very important in inducing cellular immunity against infected cells, and is completely lacking when conventional vaccination approaches are used.
- the recombinant adenovirus may infect dendritic cells which are very potent antigen-presenting cells.
- the recombinant adenovirus may also carry genes encoding immuno- enhancing cytokines to further boost immunity.
- the recombinant adenovirus may naturally infect airway and gut epithelial cells in humans, and therefore the vaccine may be delivered through nasal spray or oral ingestion.
- the recombinant adenovirus of the present invention should be safe because it is replication-incompetent.
- the heterologous antigen sequence may be positioned in the E1 , E3 or E4 region of the adenovirus.
- the immuno-stimulator sequence may be positioned in the E1 , E3 or E4 region of the adenovirus.
- the heterologous antigen sequence and the immuno-stimulator sequence are positioned in the E1 , E3 or E4 region of the adenovirus, where the heterologous antigen sequence and the immuno-stimulator sequence are expressed from a promoter bicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- the expression of the viral antigen or the immuno-stimulator may be controlled by a promoter homologous to the native progenitor of the recombinant virus.
- the expression of the viral antigen may be controlled by a promoter heterologous to the native progenitor of the recombinant virus.
- the promoter heterologous to the native progenitor of the recombinant virus may be a eukaryotic promoter such as insulin promoter, human cytomegalovirus (CMV) promoter and its early promoter, simian virus SV40 promoter, Rous sarcoma virus LTR promoter/enhancer, the chicken cytoplasmic ⁇ -actin promoter, and inducible promoters such as the tetracycline-inducible promoter.
- the pathogenic virus may be any pathogenic virus that causes pathogenic effects or disease in a host such as human, domestic animals or other mammals.
- the recombinant virus can be used as a vaccine for protecting the host from infection of the pathogenic virus.
- the pathogenic virus may be various strains of human immunodeficiency virus (HIV), such as HIV-1 and HIV-2.
- the viral antigen may be a HIV glycoprotein (or surface antigen) such as HIV GP120 and GP41 , a capsid protein (or structural protein) such as HIV P24 protein, or other HIV regulatory proteins such as Tat, Vif and Rev proteins.
- the pathogenic virus may be influenza virus.
- the viral antigen may be an influenza glycoprotein such as influenza HA1 , HA2 and NA.
- the pathogenic virus may be Ebola virus.
- the viral antigen may be an Ebola glycoprotein or surface antigen such as Ebola GP1 and GP2 protein.
- the pathogenic virus may be hepatitis virus such as hepatitis A, B, C, D or E virus.
- the viral antigen may be a surface antigen or core protein of hepatitis A, B, C, D or E virus.
- the viral antigen may be a surface antigen or core protein of hepatitis B virus such as the small hepatitis B surface antigen (SHBsAg) (also referred to as the
- the viral antigen may also be a surface antigen or core protein of hepatitis C virus such as NS3, NS4 and NS5 antigens.
- the pathogenic virus may be a respiratory syncytial virus (RSV).
- RSV viral antigen may be the glycoprotein (G-protein) or the fusion protein (F-protein) of RSV, for which the sequences are available from GenBank.
- the pathogenic virus may be a herpes simplex virus (HSV) such as HSV-1 and HSV-2.
- HSV viral antigen may be the glycoprotein D from HSV-2.
- the viral antigen may be a tumor antigen or viral oncogene such as E6 and E7 of human papilloma virus, or cellular oncogenes such as mutated ras or p53. It is noted that, other virus-associated proteins or antigens are readily available to those of skill in the art. Selection of the pathogenic virus and the viral antigen is not a limiting factor in this invention.
- the viral antigen may be a full-length antigenic viral protein or a portion of the antigenic viral protein that contains the predominant antigen, neutralizing antigen, or epitope of the pathogenic virus.
- the viral antigen contains the conserved region of glycoproteins between at least two strains of the same pathogenic virus.
- the viral antigen may be a modified antigen that is mutated from a glycoprotein of the pathogenic virus such that the viral antigen is rendered non-functional as a viral component but retains its antigenicity.
- modification of the viral antigen includes deletions in the proteolytic cleavage site of the glycoprotein, and duplications and rearrangement of immunosuppressive peptide regions of the glycoprotein.
- the recombinant virus also expresses an immuno-stimulator to mimic cytokine-releasing response of a host cell upon viral infection and further augments immune response to the viral antigen co-expressed from the recombinant virus.
- the immuno-stimulator may preferably be a cytokine.
- a recombinant virus for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: an antigen sequence heterologous to the recombinant virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus is preferably be replication-incompetent adeno-associated virus, SV40 virus, retrovirus, herpes simplex virus or vaccinia virus.
- the benign virus may preferably have the pathologic regions of the native progenitor of the benign virus deleted but retains its infectivity to the host.
- the recombinant virus includes an immuno-stimulator sequence heterologous to the recombinant virus that encodes an immuno- stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the present invention also provides genetic vaccines that elicit strong and long-lasting immune response to pathogenic bacteria.
- a recombinant virus is provided as a genetic bacteria vaccine for eliciting an immune response in a host infected by the recombinant virus.
- the viral genome of the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a bacterial antigen from a pathogenic bacteria, expression of the plurality of the bacterial antigen sequences eliciting an immune response directed against the bacterial antigen and cells expressing the bacterial antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause a malignancy naturally associated with the pathogenic bacteria in the host.
- the pathogenic bacteria may be any pathogenic bacteria that causes pathogenic effects or diseases in a host, such as bacillus tuberculoses, bacillus anthracis, and spirochete Borrelia burgdorferi that causes the Lyme disease in animals.
- the plurality of antigen sequences may encode lethal factors, protective antigen, edema factors of the pathogenic bacteria, or combination thereof.
- a recombinant virus is provided as a parasite vaccine for eliciting an immune response in a host infected by the benign virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a parasitic antigen from a pathogenic parasite, expression of the plurality of the parasitic antigen sequences eliciting an immune response directed against the parasitic antigen and cells expressing the parasitic antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication- incompetent and not a cause malignancy naturally associated with the pathogenic parasite in the host.
- the pathogenic parasite may be any pathogenic parasite that causes pathogenic effects or diseases in a host, such as malaria and protozoa such as Cryptosporidium, Eimeria, Histomonas, Leucocytozoon, Plasmodium, Toxoplasma, Trichomonas, Leishmania, Trypanosoma, Giardia, Babesia, and Theileria.
- the plurality of antigen sequences may encode coat proteins, attachment proteins of the pathogenic parasites, or combinations thereof.
- the present invention also provides viral vaccines that present multiple antigens to the host to further mimic natural infection of a native pathogenic virus and induce strong and long-lasting immune response to various strains or types of the pathogenic virus in the host.
- a recombinant virus is provided as a viral vaccine for eliciting an immune response in a host infected by the virus.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a viral antigen from a pathogenic virus, expression of the plurality of the antigen sequences eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause a malignancy naturally associated with the pathogenic virus in the host.
- the recombinant virus may be any virus, preferably replication-incompetent adenovirus, adeno-associated virus, SV40 virus, retrovirus, herpes simplex virus or vaccinia virus.
- the recombinant virus may also preferably have the pathologic regions of the native progenitor of the benign virus deleted but retain its infectivity to the host.
- the plurality of the antigen sequences may be multiple copies of the same antigen sequence or multiple antigen sequences that differ from each another.
- At least two of the plurality of the antigen sequences are expressed from a promoter bicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- At least two of the plurality of the antigen sequences are expressed from a promoter to form a fusion protein.
- the recombinant virus further comprises at least one promoter heterologous to the native progenitor of the recombinant virus that controls the expression of at least two of the plurality of the antigen sequences.
- the promoter heterologous to the native progenitor of the recombinant virus include, but are not limited to, insulin promoter, CMV promoter and its early promoter, SV40 promoter, Rous sarcoma virus LTR promoter/enhancer, the chicken cytoplasmic ⁇ -actin promoter, and inducible promoters such as tetracycline-inducible promoter.
- the plurality of antigen sequences may be a combination of antigens from at least two strains of the pathogenic virus.
- the plurality of antigen sequences may be a combination of antigens from at least two different pathogenic viruses.
- the plurality of antigen sequences may be a combination of antigens from HIV-1 , HIV-2, herpes simplex virus type 1 , herpes simplexvirus type 2, influenza virus, Marburg virus, Ebola virus, Arbovirus (a group of viruses carried by mosquitoes that cause encephalitis, yellow fever, and dengue), and hepatitis A, B, C, D, and E viruses.
- the viral genome of the recombinant virus may further comprise one or more immuno-stimulator sequences that is heterologous to the recombinant virus and encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the immuno-stimulator may be a cytokine.
- the cytokine include, but are not limited to, interleukin-2, interleukin-4, interleukin-12, ⁇ -interferon, ⁇ -interferon, ⁇ -interferon, G-CSF, and GM-CSF.
- the one or more immuno-stimulator sequences may be multiple copies of the same immuno-stimulator sequence or multiple immuno-stimulator sequences that differ from each other.
- At least two of the immuno-stimulator sequences may be expressed from a promoter bicistronically via an internal ribosomal entry site or via a splicing donor-acceptor mechanism.
- at least two of the immuno-stimulator sequences may be expressed from a promoter to form a fusion protein.
- the DNA sequence encoding viral antigen(s) is inserted into any non- essential region of the replication defective virus.
- the nucleic acid is preferably inserted into the E1 , E3 and/or E4 region of the adenovirus and most preferably into the E4 region. Because the E1 , E3 and E4 regions are available as insertion sites, the present invention also contemplates separate insertion of more than one encoding sequence.
- the selected nucleotide sequences of the viral antigens are operably linked to control elements that direct transcription or expression thereof in the subject in vivo. Either homologous or heterologous viral control sequences can be employed.
- Useful heterologous control sequences generally include those derived from sequences encoding hostian or viral genes. Examples include, but are not limited to a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMV ie ), SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (AdMLP), a herpes simplex virus promoter,and a retrovirus LTR promoter.
- CMV cytomegalovirus
- CMV ie CMV immediate early promoter region
- AdMLP adenovirus major late promoter
- AdMLP adenovirus major late promoter
- any strong constitutive promoter may be operatively linked to viral antigens or cytokines. More preferably the viral promoter is CMV immediate early promoter (CMVi e ).
- Figures 1A-1C illustrate a method for constructing a recombinant adenoviral vector as a genetic vaccine of the present invention.
- the recombinant adenoviral vector of the present invention is constructed by using shuttle plasmids or vectors carrying multiple antigen genes and multiple cytokine genes.
- Figure 1A illustrates a shuttle plasmid (pLAd.Antigen) containing two antigen genes, Antigen 1 and Antigen 2.
- the shuttle plasmid pLAd.Antigen contains the left end of the adenoviral genome including the left long terminal repeats L-TR, and an adenoviral packaging signal ( ⁇ ).
- the E1 region of the adenovirus is replaced by a multiple gene expression cassette and CMV ie promoter.
- Antigen 1 and Antigen 2 are placed under the transcriptional control of the CMV ie promoter by a splicing mechanism at the SD and SA sites.
- the plasmid pLAd.Antigen also contains a SV40 polyadenylation site, as well as prokaryotic replication origin and ampicillin- resistance gene for DNA propagation in bacteria.
- FIG. 1B illustrates another shuttle plasmid (pRAd. Cytokines) containing multiple cytokine genes such as IL-2, INF, and IL-8.
- the shuttle plasmid pRAd. Cytokines contains the right end of the adenoviral genome including the right long terminal repeats R-TR. Most of the E4 region (except orf ⁇ ) is replaced by the cytokine genes. Expression of cytokine genes is under the transcriptional control of the CMV ie promoter via an internal ribosomal entry site (IRES) and by a splicing mechanism at the SD and SA sites.
- the plasmid pRAd. Cytokines also contains a bovine growth hormone (BGH) polyadenylation site, as well as a prokaryotic replication origin and ampicillin-resistance gene for DNA propagation in bacteria.
- BGH bovine growth hormone
- the recombinant adenoviral genome is assembled from the two shuttle plasmids, pLAd.Antigen and pRAd.Cytokines, which carries the left and right end of the adenoviral genome, respectively.
- the shuttle plasmids pLAd.Antigen and pRAd.Cytokines are digested with restriction enzymes such as Xbal and EcoRI, respectively.
- the fragments corresponding to the left end and right end of adenovirus from these two shuttle plasmids, pLAd.Antigen and pRAd.Cytokines are isolated and ligated to the middle section of the adenoviral genome (the adenovirus backbone).
- the ligated vector genome DNA is then transfected into 293HK cells that express the E1 proteins of adenovirus.
- the vector genome in which the E1 has been deleted can replicate and be packaged into viral particle, i.e. producing the recombinant adenoviral vector that can be used as a genetic vaccine of the present invention.
- the E1 region which is preserved in a native adenoviral genome but deleted from the recombinant viral genome is an example of the pathologic region native to the native progenitor of the recombinant virus: the wild type adenovirus.
- Figure 5 illustrates an example of a genetic vaccine constructed by using the method described above.
- IL5 is the vector backbone into which viral antigen and cytokines are inserted in the E1 region.
- the viral antigens are expressed using the CMVie promoter.
- the gene for the viral antigen is followed by the gene encoding INF- ⁇ and GM- CSF, utilizing 2 IRES sequences to achieve expression of the three proteins from a single mRNA.
- IL2 and IL4 are controlled by a second CMV ie promoter as a bi-cistronic cassette, followed by a second bi-cistronic cassette that express the two subunits of IL12 in the E4 region.
- cytokines may be used alone or in combination with these and/or other cytokines. The detailed information about of these cytokines are described in the following section.
- the recombinant virus of the present invention may also express an immuno-stimulator to mimic cytokine-releasing response of a host cell upon viral infection and further augment immune response to the viral antigen co- expressed from the recombinant virus.
- the immuno-stimulator may be an immunoenhancing cytokine to further stimulate the immune system.
- the recombinant virus may encode one or multiple cytokines in any combination.
- multiple cytokines may be expressed by more than one recombinant virus or delivered to the host by using other techniques such as delivery via naked DNA plasmids or injection of cytokine proteins.
- cytokine examples include, but are not limited to, interleukin-2, interleukin-4, interleukin-8, interleukin-12, ⁇ - interferon, ⁇ -interferon, ⁇ - interferon, granulocyte colony stimulating factor (G-CSF), and granulocyte- macrophage colony stimulating factor (GM-CSF).
- Cytokines are immunodmodulatory molecules particularly useful in the vaccines of the invention as they are pleitropic mediators that modulate and shape the quality and intensity of the immune response. Cytokines are occasionally autocrines or endocrines, but are largely paracrine hormones produced in nature by lymphocytes and monocytes.
- cytokine refers to a member of the class of proteins or peptides that are produced by cells of the immune system and that regulate or modulate an immune response. Such regulation can occur within the humoral or the cell mediated immune response and includes modulation of the effector function of T cells, B cells, NK cells, macrophages, antigen- presenting cells or other immune system cells.
- Cytokines are typically small proteins or glycoproteins having a molecular mass of less than about 30 kDa.
- cytokine encompasses those cytokines secreted by lyphocytes and other cell types (often designated as lymphokines) as well as cytokines secreted by monocytes and macrophages and other cell types (often designated as monokines).
- lymphokines those cytokines secreted by lymphocytes and other cell types
- monocytes and macrophages and other cell types of cells and other cell types
- cytokine encompasses those cytokines secreted by lymphocytes and other cell types as well as cyotkines secreted by monocytes and macrophages and other cell types.
- cytokine includes the interleukins, such as IL-2, IL-4, IL-5, IL-8, IL-10, IL-11. IL-12, IL- 15, and IL-18, which are molecules secreted by leukocytes that primarily affect the growth and differentiation of hematopoietic and immune system cells, and human proinflammatory cytokines such as IL-1 a, TNF-a and TNF-b).
- the term cytokine also includes hematopoietic growth factors and, in particular, colony stimulating factors such as colony stimulating factor-1 , granulocyte colony stimulating factor and granulocyte macrophage colony stimulating factor.
- the cytokines can have the sequence of a naturally occurring cytokine or can have an amino acid sequence with substantial amino acid sequence similarity, e.g., 60-95% amino acid sequence similarity, preferably 70-98% amino acid sequence, and most preferably 75-95% amino acid sequence similarity to the sequence of a naturally occurring cytokine.
- amino acid sequence similarity e.g. 60-95% amino acid sequence similarity, preferably 70-98% amino acid sequence, and most preferably 75-95% amino acid sequence similarity to the sequence of a naturally occurring cytokine.
- limited modifications to a naturally occurring sequence can be made without destroying the biological function of the cytokine.
- minor modifications of gamma interferon that do not destroy its function fall within the definition of gamma interferon. These modifications can be deliberate, as through site-directed mutagenesis, or can be accidental such as through mutation.
- the preferred cytokines are IL-2, IL-
- IL-12 or ⁇ - interferon, ⁇ -interferon, ⁇ -interferon, GM-CSF; or G-CSF or a combination thereof.
- Interleukin-2 is a lymphokine produced by helper T cells and is active in controlling the magnitude and type of the immune response. Smith, K. A., Ann. Rev. Immunol. 2, 319-333 (1984). Other functions have also been ascribed to IL-2 including the activation of NK cells (Minato, N. et al., J. Exp. Med. 154, 750 (1983)) and the stimulation of cell division in large granular lymphocytes and B cells. Tsudo, M. et al.. J. Exp. Med. 160, 612-616 (1984). Studies in mice and humans have demonstrated that deficient immune responsiveness both in vivo and in vitro can be augmented by IL-2.
- exogenous IL-2 can restore the immune response in cyclophosphamide-induced immunosuppressed mice (Merluzzi, V. J. et al. Cancer Res. 41 , 850-853 (1981 )) and athymic (nude) mice. Wagner, H. et al. Nature 284, 278-80 (1982). Furthermore, IL-2 can restore responsiveness of lymphocytes from patients with various immunodeficiency states such as leprosy and cancer. Vose, B. M. et al. Cancer Immuno. 13, 105-111 (1984). The genes for murine (Yokota, T. et al. Proc. Natl. Acad. Sci.
- IL-2 have been cloned and sequenced.
- lnterleukin-4 is a T cell derived factor that acts as an induction factor on resting B cells, as a B cell differentiation factor and as a B cell growth factors. Sevenusar, E. Eur. J. Immunol. 17, 67-72 (1987). The gene for human IL-4 has been isolated and sequenced. Lee, F. et al. Proc. Natl. Acad. Sci. USA 83, 2061-2065 (1986).
- IL-12 is a recently characterized heterodimeric cytokine that has a molecular weight of 75 kDa and is composed of disulfide-bonded 40 kDa and 35 kDa subunits. It is produced by antigen presenting cells such as macrophages, and binds to receptors on activated T, B and NK cells (Desai, B. B., et al., J. Immunol., 148:3125-3132 (1992); Vogel, L. A., et al., Int. Immunol., 8:1955-1962 (1996)).
- IL-12 has been shown to be an important costimulator of proliferation in Th1 clones (Kennedy et al., Eur. J. Immunol.
- IL-12 can also temporarily decrease production of lgG1 antibodies (Morris, S. C, et al., J. Immunol. 152:1047-1056 (1994); McKnight, A. J., J. Immunol. 152:2172-2179 (1994); Buchanan, J. M., et al., Int. Immunol., 7:1519-1528 (1995)), indicating suppression of the Th2 response.
- the purification and cloning of IL-12 are disclosed in WO 92/05256and WO
- Interferons are relatively small, species-specific, single chain polypeptides, produced by hostian cells in response to exposure to a variety of inducers such as viruses, polypeptides, mitogens and the like. They exhibit antiviral, antiproliferative and immunoregulatory properties and are, therefore, of great interest as therapeutic agents in the control of cancer and various other antiviral diseases (J. Desmyter et al., Lancet 11 , 645-647 (1976); R. Derynck et al., Nature 287, 193 (1980)). Human interferons are grouped into three classes based on their cellular origin and antigenicity: ⁇ -interferon
- ⁇ -interferon is also a T cell derived molecule which has profound effects on the immune response. The molecule promotes the production of immunoglobulin by activated B cells stimulated with interleukin-2. ⁇ -interferon also increases the expression of histocompatability antigens on cells which associated with viral antigens to stimulate cytotoxic T cells. The gene for human ⁇ -interferon has been isolated and sequenced. Gray, P. W. et al., Nature 295, 503-508 (1982).
- Human alpha interferons also known as Leukocyte interferons
- Leukocyte interferons comprise a family of about 30 protein species, encoded by at least 14 different genes and about 16 alleles. Some of these alpha interferon protein species have been shown to have antiviral, antigrowth and immunoregulatory activities. See, e.g., Pestka et al., Ann. Rev. Biochem., 56:727 (1987). The therapeutic efficacy of human alpha interferons has been established for human cancers and viral diseases.
- interferons IFN alpha-2a, IFN alpha-2b, IFN alpha-2c
- cell-line derived interferon IFN alpha-n1
- IFN alpha-n3 interferon derived from leukocytes
- ⁇ -interferon has been shown to be a glycoprotein by chemical measurement of its carbohydrate content. It has one N-glycosidyl attachment site (E. Knight, Jr., Proc. Natl. Acad. Sci., 73, 520 (1976); E. Knight, Jr., and
- Beta-interferon can be induced in fibroblasts by viral challenge and contains about 165 amino acids.
- the sequence of D-interferon is known.
- GM-CSF is a cytokine important in the maturation and function of dendritic cells. It binds receptors on dendritic cells and stimulates these cells to mature, present antigen, and prime naive T cells. Dendritic cells form a system of highly efficient antigen-presenting cells.
- dendritic cells migrate to lymphoid organs and present antigens to T cells. These potent antigen-presenting cells are unique in their ability to interact with active naive T cells. The potent antigen-presenting capacity of dendritic cells may be due in part to their unique life cycle and high level expression of major histocompatibility complex class I and II molecules and co-stimulatory molecules.
- the sequence of human GM-CSF is known. Wong et al., Science 228:810-815 (1985).
- G-CSF Granulocyte colony stimulating factor
- G- CSF increases the number of circulating granulocytes and has been reported to ameliorate infection in sepsis models.
- G-CSF administration also inhibits the release of tumor necrosis factor (TNF), a cytokine important to tissue injury during sepsis and rejection. See, e.g., Wendel et al., J. Immunol., 149:918- 924 (1992).
- TNF tumor necrosis factor
- G-CSF The cDNAs for human (Nagata et al., Nature 319;415, 1986) and mouse G-CSF (Tsuchiya et al., PNAS 83, 7633, 1986) have been isolated, permitting further structural and biological characterization of G-CSF. In humans, endogenous G-CSF is detectable in blood plasma. Jones et al., Bailliere's Clinical Hematology 2 (1 ): 83-111 (1989). G-CSF is produced by fibroblasts, macrophages, T cells trophoblasts, endothelial cells and epithelial cells and is the expression product of a single copy gene comprised of four exons and five introns located on chromosome seventeen.
- G-CSF is species cross-reactive, such that when human G-CSF is administered to another host such as a mouse, Canine or monkey, sustained monrophil leukocytosis is elicited. Moore et at. PNAS-USA 84: 7134-7138 (1987).
- the present invention provides an effective means for enhancing the immune response to the specific foreign antigenic polypeptides of recombinant viruses.
- any foreign antigenic polypeptide can be used in the vaccine of the present invention, the vaccine is particularly useful in vaccines against the HIV virus and the Ebola virus, since these viruses have a negative effect on the host's immune system.
- the vaccine is also very useful for immunization against hepatitis B and C virus.
- the genetic vaccine of the present invention also addresses the need for an efficient vaccine against the HIV virus.
- the genetic vaccine may be a recombinant benign virus in which the viral genome carries one or more antigens from HIV, such as HIV glycoproteins (e.g. GP120 and GP41) or capsid proteins (e.g. P24). Sequences of these HIV antigens may be modified such as deletion of the immunosuppressive regions of the HIV glycoproteins.
- AIDS Acquired Immune Deficiency Syndrome
- AIDS has been described as a modern plague since its first description in 1981 , it has claimed over 60,000 victims, and accounted for over 32,000 deaths in the United States alone.
- the disease is characterized by a long aysmptomatic period followed by a progressive degeneration of the immune systemand the central nervous system.
- the virus may remain latent in infected individuals for five or more years before symptoms appear, and thus, the true impact of the disease has yet to be felt.
- Many Americans may unknowingly be infected and capable of infecting others who might come into contact with their body fluids. Thus, if unchecked, the personal, social and economic impact of AIDS will be enormous.
- the HIV virus is a retrovirus.
- RNA which encodes the information for viral replication.
- the RNA Upon infection of a host cell, the RNA acts as a template for the transcription to DNA, which is catalyzed by an enzyme called reverse transcriptase.
- the DNA so produced enters the cell nucleus where it is integrated into the host DNA as a provirus.
- the retroviral-derived DNA is transcribed and translated to produce RNA containing virions, which are then released from the cell by a budding process.
- T4 lymphocytes which are characterized by the presence of a cell surface marker termed CD4.
- the intact HIV virion is roughly spherical and is approximately110 nm in diameter.
- the virion has an outer membrane covered with spike-like structures made up of glycoprotein, gp160/120.
- gp41 a transmembrane protein termed gp41.
- gp41 a transmembrane protein termed inside the virion.
- the viral RNA is present inside the core along with two copies of the reverse transcriptase enzyme, p66/51 , which is necessary for the synthesis of viral DNA from the RNA template.
- the HIV RNA genome encodes three major structural genes: gag, pol and env, which are flanked at either end by long terminal repeat (LTR) sequences.
- the gag gene codes for the group-specific core proteins, p55, p39, p24, p17 and p15.
- the pol genes code for the reverse transcriptase, p66/p51 , and the protease, p31.
- the env genes encode the outer envelope glycoprotein, gp120, and its precursor, gp160, and the transmembrane glycoprotein, gp41. Some of the genes tend to be highly variable, particularly the env genes.
- the HIV envelope protein has been extensively described, and the amino acid and RNA sequences encoding HIV envelope from a number of HIV strains are known. See Myers, G. et al., Human Retrovimses and AIDS: A compilation and analysis of nucleic acid and amino acid sequences, Los Alamos National Laboratory, Los Alamos, N.M. (1992).
- the env genes of various strains of HIV are predicted to encode proteins of 850 to 880 amino acids.
- Extensive glycosylation of the Env precursor polyprotein during synthesis produces gp160 (about 160 kilodaltons) which is also the major form of the env gene product detected in infected cells. Gp160 forms a homotrimers and undergoes glycosylation with the Golgi apparatus.
- the functional domains of gp160 includes, starting from N-terminus, Signal peptide, Variable regions 1 through 5 which encompass CD4 binding sites (e.g., Thr 257 , Trp 427 , Asp 368 /Glu 370 , and Asp 457 ), Proteolytic processing site (also called the cleavage site between gp120 and gp41 ), Fusion domain,
- Leucine zipper motif, transmembrane domain, and Lentivirus lytic peptides (LLP) 1 and 2.
- LLP Lentivirus lytic peptides
- the signal peptide at the N-terminus of the Env precursor gp160 directs ribosomes translating the nascent protein to the endoplasmic reticulum; an intracellular proteinase removes this signal peptide during Env gp biogenesis.
- the Env precursor gp160 is cleaved at the processing site by a cellular protease to produce gp120 (designated SU subunit) and gp41 (designated TM subunit).
- Gp120 contains most of the external, surface- exposed, domains of the envelope glycoprotein complex.
- Gp41 contains a transmembrane domain and remains in a trimeric configuration, and it interacts with gp120 in a non-covalent manner.
- the subunits of gp41 include: Fusion peptide, Leucine zipper-like region, transmembrane domain (TM), LLP1 and LLP2.
- the gp120 subunit contains five variable regions and six conserved regions.
- the variable (V) domains and conserved (C) domains of gp120 are specified according to the nomenclature of Modrow et al. (1987) "Computer- assisted analysis of envelope protein sequences of seven human immunodeficiency virus isolates: predictions of antigenic epitopes in conserved and variable regions", J. Virol. 61:570-578.
- the gp120 molecule consists of a polypeptide core of 60,000 daltons, which is extensively modified by N-linked glycosylation to increase the apparent molecular weight of the molecule to 120,000 daltons.
- the positions of the 18 cysteine residues in the gp120 primary sequence, and the positions of 13 of the approximately 24 N-linked glycosylation sites in the gp120 sequence are common to all gp120 sequences.
- the hypervariable domains contain extensive amino acid substitutions, insertions and deletions.
- Sequence variations in these domains result in up to 30% overall sequence variability between gp120 molecules from the various viral isolates. Despite this variation, all gp120 sequences preserve the virus's ability to bind to the viral receptor CD4 and to interact with gp41 to induce fusion of the viral and host cell membranes.
- the HIV virus attaches to host cells by an interaction of the envelope glycoproteins with a cell surface receptor. It appears that when HIV makes contact with a T4 cell, gp120 interacts with the CD4 receptor. Recently, the crystal structure of the core domain of HIV-1 gp120 (strain HXB-2, a clade B virus) has been solved by complexing the protein with a fragment of human CD and an antigen-binding fragment from a virus-neutralizing antibody that blocks chemokine-receptor binding. Kwong et al. (1998) "Structure of an HIV gp120 envelope glycoprotein in complex with the CD4 receptor and a neutralizing human antibody", Nature 393:648-659.
- the gp120 core has a unique molecular structure that comprises two domains — an "inner domain” (which faces gp41) and an “outer” domain (which is mostly exposed on the surface of the oligomeric envelope glycoprotein complex).
- the two gp120 domains are separated by a "bridging sheet” that is not part of either domain. Binding to CD4 causes a conformational change in gp120 which exposes the bridging sheet and may move the inner and outer domains relative to each other. It was also found that most of the carbohydrate molecules which are added to gp120 are added to the outer domain. This is consistent with the idea that that virus uses carbohydrate molecules to mask external antigenic epitopes on gp120.
- Gp120 not only binds to the cellular CD4 receptor but also to HIV coreceptors such as the cellular chemokine receptors (e.g. CCR5).
- the viral envelope Upon binding to the receptor and/or coreceptor, the viral envelope is then fused with the cell membrane and the inner core of the virus enters the infected cell where the transcription of RNA into a DNA provirus is catalyzed by reverse transcriptase.
- the provirus may remain in the cell in a latent form for some months or years, during which time the infected individual is asymptomatic. However, if the virus is later activated causing viral replication and immuno- suppression the individual will than be susceptible to the opportunistic infections associated with AIDS.
- a recombinant virus for eliciting strong immune response against infection of HIV.
- the recombinant virus comprises: an antigen sequence heterologous to the recombinant virus that encodes an antigen from human immunodeficiency virus (HIV), expression of the HIV antigen eliciting an immune response directed against the HIV antigen and cells expressing the HIV virus.
- HIV human immunodeficiency virus
- the recombinant virus is replication-incompetent and does not cause a malignancy naturally associated with HIV in the host.
- the recombinant virus is used as a genetic vaccine to be administered to a host to induce or elicit strong and long-lasting immunity against HIV infection.
- the approach of the present invention should be safer and more efficient in eliciting strong immune response but not creating risks of reactivation of HIV, probably through recombination with the wild type HIV infecting the host.
- the HIV antigen expressed by the genetic vaccine may be any antigen derived from a HIV virus, such as HIV surface, core/capsid, regulatory, enzyme and accessory proteins.
- HIV surface protein include, but are limited to the products of the env gene such as gp120 and gp41.
- HIV capsid protein include, but are limited to the products of the gag gene such as the cleavage products of the Pr55 ga9 by the viral encoded protease PR: the mature capsid proteins MA
- viral regulatory proteins include, but are not limited to the products of the tat and rev genes: Tat and Rev.
- viral enzyme proteins include, but are not limited to the products of the pol gene: p11 (protease or PR), p51 (reverse transcriptase or RT), and p32
- viral accessory proteins include, but are not limited to the products of the vif, vpr, vpx, vpu and nefgenes: Vif, Vpr, Vpx, Vpu and Nef.
- HIV Nef protein may serve as the HIV antigen expressed by the recombinant virus of the present invention.
- sequence encoding Nef e.g., the nefsequence at position 8152-8523 for BH10 strain of HIV and at position 8787-9407 for pNL4-3 strain of HIV
- sequence encoding Nef may be inserted into the vector.
- HIV Rev protein may serve as the HIV antigen expressed by the recombinant virus of the present invention.
- sequence encoding Rev e.g., the revl sequence at position 5969-6044 and the rev2 sequence at position 8369-8643 for pNL4-3 strain of HIV
- Rev may be inserted into the vector.
- full length HIV Gag protein may serve as the HIV antigen expressed by the recombinant virus of the present invention.
- sequence encoding full length Gag e.g., the gag sequence at position 112-1650 for BH10 strain of HIV and at position 790-2292 for pNL4-3 strain of HIV may be inserted into the vector.
- capsid protein from HIV Gag protein may serve as the HIV antigen expressed by the recombinant virus of the present invention.
- sequence encoding p24CA e.g., the sequence at position 1186-1878 for BH10 strain of HIV and at position 508-1200 for pNL4- 3 strain of HIV
- the HIV antigen expressed by the recombinant virus is derived from the env gene products.
- the antigen is derived from the Env protein.
- modifications or mutagenesis may be used to delete or mutate in certain region(s) of Env to render it non-functional and yet still contains neutralizing epitopes for its natural genicity.
- the proteolytic processing site of Env may be deleted or mutated to render it resistant to cleavage by cellular protease to produce gp120 and gp41 fragments. Deletion or mutation may also be carried out on the transmembrane and cytoplasmic domains of gp41 such as the TM, LLP-1 and
- the mutated Env protein should have a reduced risk of being incorporated into a wild type HIV that infects the host and being exploited by HIV in its furtherance of the goal: destruction the host's immune system.
- wildtype HIV Env can be modified in the following ways.
- Wildtype gp120 sequence from BH10 strain of HIV and containing Env, Tat, and Rev coding sequences can be digested with restriction enzymes EcoR I and Xho I to produce a fragment starting from nucleotide 5101 and ending at nucleotide 8252.
- the cytosolic domain of Env can be removed by deleting nucleotides from the coding sequence at position 7848-8150 for BH10 strain, and 8610-8785 for pNL4-3 strain of HIV.
- the cleavage site of Env can be removed by deleting 12 nucleotides encoding amino acid sequence REKR at position 7101-7112 for BH10 strain, and 7736-7747 for pNL4-3 strain of HIV.
- the modified Env protein may contain deletions in the regions that do not contain neutralizing epitopes.
- the V1 and V5 domains of gp120 may be deleted without sacrificing the natural antigenicity of gp120.
- Portions of the V2 and V3 domains of gp120 that do not contain neutralizing epitopes may also be deleted.
- the principle neutralizing domain (PND) has been found in the V3 domain
- V2 and C4 domains of gp120 have also been found to contain neutralizing epitopes.
- the amino acid sequences of the neutralizing epitopes may be variable. However, it has been found that the amount of variation is highly constrained.
- sequence encoding V1 region of Env can be deleted at position 5961-6032 for BH10 strain, and 6602-6673 for pNL4-3 strain of HIV.
- Sequence encoding V2 region of Env can be deleted at position 6060-6161 for BH10 strain, and 6700-6796 for pNL4-3 strain of HIV.
- sequence encoding both V1 and V2 regions of Env can be deleted at position
- the HIV antigen expressed by the recombinant virus may be a subunit of gp120 which contains one or more selected variable (V) and/or conserved (C) domains.
- the HIV antigen may be a gp120 subunit containing V2, V3 and C4 domains, or V3 and C4 domains.
- the location of neutralizing epitopes in the V3 domain is well known. It has been found that neutralizing epitopes in the V2 and C4 domains are located between residues 163 and 200 and between about 420 and 440, respectively.
- residues for antibody binding also include residues 171, 174, 177, 181 , 183, 187, 188 in the V2 domain and residues 429 and 432 in the C4 domains.
- the HIV antigen expressed by the recombinant virus of the present invention may be a modified Env protein that contains deletions and/or mutations in the glycosylation sites.
- the gp120 of HIV-1 contains 24 potential sites for N-linked glycosylation (Asn-X-Ser/Thr); about 13 of the 24 glycosylation motifs are conserved in the different viral isolates.
- Analysis of HIV-1 Env gp proteins has demonstrated that 17 of 24 potential glycosylation sites are modified with carbohydrate side chains. Mizuochi et al. (1990) J. Biol. Chem. 265:8519-8524; and Leonard et al. (1990) J. Biol.
- the different HIV antigens may be expressed by the same recombinant virus of the present invention.
- both Env, Tat and Rev proteins may be expressed from the same promoter such as a CMV early promoter via a retroviral splicing donor-acceptor mechanism.
- HIV Gag protein either in full length or a truncated or modified form (e.g., capsid protein p24), may also be expressed together with other HIV antigens such as Env, Tat and Rev.
- these HIV antigens may be expressed together with the immuno-stimulator(s) (e.g., IL-2, IL-12, INF- ⁇ , and
- GMCSF in single or multiple copies by the same recombinant viral vector.
- sequences encoding the HIV antigens may be inserted into E1 region of an adenoviral vector and expressed from a CMV early promoter via a retroviral splicing donor-acceptor mechanism or an IRES mechanism.
- sequences encoding the immuno-stimulators may be inserted into E4 region of the same adenoviral vector and expressed from another CMV early promoter via a retroviral splicing donor-acceptor mechanism or an IRES mechanism.
- the sequence encoding the HIV antigen in the recombinant virus of the present invention is a mosaic antigen that contains sequences from different strains, isolates and/or clades of HIV viruses.
- a strain of HIV is the HIV isolated from an individual (an isolate), characterized and given a strain name (e.g., MN, LAI). Because of the heterogenecity of HIV, not two isolates are exactly the same.
- a group of related HIV isolates are classified according to their degree of genetic similarity such as of their envelop proteins.
- M and O There are currently two groups of HIV-1 isolates, M and O.
- the M group consists of at least 9 clades (also called subtypes), A through I.
- the O group may consist of a similar number of clades.
- Clades are genetically distinct but are all infectious. It is believed that by using a mosaic HIV antigen in the design of the genetic vaccine of the present invention the vaccine produced should have an enhanced ability to stimulate the production of anti-HIV antibodies and HIV-specific cytotoxic T lymphocytes (CTLs) against a wider spectrum of "wild type" HIV strains.
- CTLs cytotoxic T lymphocytes
- the mosaic HIV antigen in the recombinant virus contains antigens from multiple clades of HIV-1 , including clade A (Accession No: HIV-1 92UG037WHO.0108HED), B (Accession No: pNL4-3), C (Accession No: HIV-1 92BR025WHO.109HED), D (Accession No: HIV-1 92UG024.2), E (Accession No: HIV-1 93TH976.17), F (Accession No: HIV-1 93BR020.17), and G (Accession No: HIV-1 92RU131.9).
- multiple repeats of restriction fragments of HIV antigen e.g., Ava I fragments
- Ava I fragments may be linked head-to-tail to generate an even more complex mosaic HIV antigen.
- an adenoviral vector may be constructed to the V3 loops of multiple clades as the mosaic HIV antigen.
- HIV antigens with gp41 deletion from multiple clades may serve as the mosaic HIV antigen.
- HIV antigens from multiple clades with V1 and V2 loops deleted from clade B may serve as the mosaic HIV antigen.
- a human gene Thy-1 GPA anchor sequence encoding amino acid sequence SWLLLLLLSLSLLQATDFMSL [SEQ ID NO: 9] may be added to the recombinant viral construct.
- the mosaic HIV antigen contains an Env protein which comprises variable and constant domains of gp120 derived from different strains, isolates and/or clades of HIV viruses.
- V2 domain from clade B of the M group may be mixed with V3 and C4 domains from clade C of the O group to generate a mosaic HIV antigen.
- Vaccination of individuals with such a mosaic antigen may stimulate CTLs with cross-clade activity. In another word, these CTLs can recognize and kill target cells infected HIV from different clades.
- the recombinant virus may express a plurality of HIV antigens, each of which is an antigen from a different strain, isolate or clade of
- HIV HIV.
- env genes from different clades of HIV can be cloned into the recombinant virus and expressed in tandem to produces various Env proteins from these clades in the host cells. It is believed that expressing various Env proteins from different strains, isolates or clades of HIV in the host cells should enhance the ability of the genetic vaccine of the present invention to stimulate the production of anti-HIV antibodies and HIV-specific cytotoxic T lymphocytes (CTLs) against a wider spectrum of "wild type" HIV strains. The host vaccinated with such a vaccine would be able to be immunized from infection of various strains of HIV. By using the genetic vaccine of the present invention, individuals not infected by HIV may be immunized against HIV.
- CTLs cytotoxic T lymphocytes
- the vaccine may also be used boost their immune response and help fight against this virulent virus.
- the genetic vaccine can express high level of antigens and/or a variety of HIV glycoproteins and capsid proteins simultaneously, the vaccinated individuals should be immunized against various strains of HIV, such as HIV-1 and HIV-2. Additionally, since the genetic vaccine can express high levels of cytokines to mimic the body's response to natural viral infection, the body's immune response to such a genetic vaccine against HIV should be strong and long-lasting, thereby achieving a life-long immunity against this deadly virus.
- the genetic vaccine of the present invention also addresses the need for an efficient vaccine against hepatitis viruses such as hepatitis A, B, C, D, and E viruses.
- the genetic vaccine may be a recombinant benign virus in which the viral genome carries one or more antigens from a hepatitis virus, such as glycoproteins and core proteins of the hepatitis virus. Sequences of these HIV antigens may be modified such as deletion of the pathogenic regions of the hepatitis glycoproteins or coreproteins.
- the recombinant virus of the present invention can be used as a vaccine to immunize individuals against Hepatitis B infections.
- Viral hepatitis B is caused by the Hepatitis B virus (HBV).
- HBV is estimated to have infected 400 million people throughout the world, making HBV one of the most common humanpathogens.
- Hepatocellular carcinomas (HCC) one of the most common cancers afflicting humans, is primarily caused by chronic HBV infection.
- HBV is a mostly double-stranded DNA virus in the Hepadnaviridae family.
- the HBV genome is unique in the world of viruses due to its compact form, use of overlapping reading frames, and dependence on a reverse- transcriptase step, though the virion contains primarily DNA.
- the HBV genome has four genes: pol, env, pre-core and X that respectively encode the viral DNA polymerase, envelope protein, pre-core protein (which is processed to viral capsid) and protein X.
- the function of protein X is not clear but it may be involved in the activation of host cell genes and the development of cancer.
- HBV infection is generally made on the basis of serology. Virtually all individuals infected with HBV will have detectable serum hepatitis surface antigens (HBsAg). Despite notable successes of vaccines against HBV infection, it is still an on-going task. A review on modern hepatitis vaccines, including a number of key references, may be found in the Eddleston, The Lancet, p. 1142, May 12, 1990. See also Viral Hepatitis and Liver Disease, Vyas, B. N., Dienstag, J. L., and Hoofnagle, J. H., eds., Grune and Stratton, Inc.
- the viral antigen may be a surface antigen or core protein of hepatitis B virus such as the small hepatitis B surface antigen (SHBsAg) (also referred to as the Australia antigen), the middle hepatitis B surface antigen (MHBsAg) and the large hepatitis B surface antigen (LHBsAg).
- SHBsAg small hepatitis B surface antigen
- MHBsAg middle hepatitis B surface antigen
- LHBsAg large hepatitis B surface antigen
- Antigens of different types of HBV may be expressed by the recombinant virus to elicit immune response to these types of HBV.
- the HBV surface antigen (HBsAg) or the core antigen (HBcAg) may be expressed by the recombinant virus of the present invention, separately or in combination (HBsAg + HBcAg).
- sequences encoding multiple HBV antigens may be inserted into E1 or E4 region of an adenoviral vector and expressed from a CMV early promoter via a retroviral splicing donor-acceptor mechanism or an IRES mechanism. Further, these HBV antigens may be expressed in combination with one or more immuno-stimulators such as IL-2, lFN- ⁇ and GMCSF in single or multiple copies. Sequences encoding these cytokines may be inserted into E4 or E1 region that is not occupied by the antigen sequences and expressed from another CMV early promoter via a retroviral splicing donor-acceptor mechanism or an IRES mechanism. Specific combinations of inserts include, but are not limited to, HBsAg
- HBcAg + HBcAg
- the sequences encoding the immuno-stimulators may be inserted into E4 region of the same adenoviral vector and expressed from another CMV early promoter via a retroviral splicing donor-acceptor mechanism or an IRES mechanism.
- the viral antigen may be a surface antigen or core protein of hepatitis C virus such as NS3, NS4 and NS5 antigens.
- sequence(s) encoding the HCV antigen(s) may be inserted into E1 or E4 region of an adenoviral vector and expressed separately or in combination with one or more immuno-stimulators such as IL- 2, IL-12, IFN- ⁇ and GMCSF in single or multiple copies.
- immuno-stimulators such as IL- 2, IL-12, IFN- ⁇ and GMCSF in single or multiple copies. Specific combinations include, but are not limited to,
- multi copies of hypervariable regions (HVR) of HCV E1 and E2 may serve as the viral antigen in the recombinant virus, and may be expressed alone or in combination with one or more immuno-stimulators such as IL-2, IL-12, IFN- ⁇ and GMCSF in single or multiple copies.
- HVR hypervariable regions
- non-hepatitis- infected individuals may be immunized against hepatitis virus.
- the vaccine may also be used boost their immune response and help fight against the hepatitis virus. Since the genetic vaccine can express high level of antigens and/or a variety of hepatitis glycoproteins and coreproteins simultaneously, the vaccinated individuals should be immunized against various strains and/or types of hepatitis virus, such as hepatitis A, B, C, D, and E virus.
- the genetic vaccine can express high levels of cytokines to mimic the body's response to natural viral infection, the body's immune response to such a genetic vaccine against hepatitis should be strong and long-lasting, thereby achieving a life-long immunity against the hepatitis virus.
- the genetic vaccine of the present invention also addresses the need for an efficient vaccine against the deadly virus, Ebola virus.
- the genetic vaccine may be a recombinant benign virus in which the viral genome carries one or more antigens from Ebola hepatitis, such as glycoproteins (e.g. GP1 and GP2) of Ebola virus. Sequences of these Ebola antigens may be modified such as deletion of the immunosuppressive regions and/or other pathogenic regions of the Ebola virus.
- Ebola virus is one of the most lethal viruses known to civilization with a mortality rate of up to 90%. Johnson, K.M., Ann Intern Med 91(1 ): 117-9 (1979). Victims of Ebola virus infection are subjected to a threatened hemorrhagic diseases which kills in a matter of days. The natural reservoir of the virus remains unknown, as do the specifics of pathogenesis of the infection. The virus has a very specific tropism for liver cells and cells of the reticuloendothelial system, such as macrophages. Massive destruction of the liver is hallmark feature of the disease.
- Ebola virus infection is rare, there is concern by public health officials about the potential for the disease to become an international epidemic as the Ebola virus is easily transmitted through human contact and is extremely contagious. Outbreaks like those that have recently occurred in Africa could happen in industrialized countries due to the rapid and extensive nature of modern travel. Recent cases of Ebola virus infection in Africa send strong warnings to be prepared for the outbreaks of this extremely dangerous infectious disease. In addition, Ebola virus has a notable potential if used as a biological weapon by terrorist nations or organizations. As in most cases of viral infection, the best approach to prevent an outbreak of Ebola virus is through vaccination. However, currently there is no effective vaccine nor treatment available against Ebola virus infection.
- Ebola viruses are enveloped, negative strand RNA viruses, which belong to the family Filoviridae. There are three strains of filoviruses: Ebola, Marburg and Reston.
- the Ebola virus can enter the body a number of different ways such as an opening through which air is taken in because the virus can travel on airborne particles and it can also enter the body through any opening in the skin, such as cuts.
- the Ebola virus has a non-segmented RNA genome that encodes all the viral structural proteins (nucleoprotein, matrix proteins VP24 and VP40), non-structural proteins (VP30, VP35) and viral polymerase. Peters, C.J., West J Med 64(1 ):36-8 (1996).
- the envelope glycoproteins (GP) exist in two forms, a secreted glycoprotein (50-70 kDa) and a transmembrane glycoprotein (130- 70 kDa) generated by transcriptional editing.
- Sanchez A. et al., Proc Natl Acad Sci U.S.A., 93(8):3602-7 (1996).
- sGP secreted glycoprotein
- the secreted glycoprotein (sGP) is the predominant form synthesized and secreted by the infected cells. It may play a role in suppressing the host immune system (Yang,Z., et al., Science 279(5353): 1034-7 (1998)) and may serve as a decoy to allow the virus particle to escape from neutralizing antibodies, since the two forms of GPs partly share their antigenicity.
- Analysis of monoclonal antibodies from the human survivors of Ebola virus Zaire infection has revealed that the vast majority of them were specific to the sGP, and only a few bound weakly to GP.
- This protein may also act to over-activate many types of immune cells which can lead to massive intravascular apoptosis - essentially a shut-down of the immune system.
- the importance of the sGP to the Ebola virus life-cycle is also suggested by the fact it is present in all Ebola virus strains examined to date. Feldmann, H., et al., Arch Virol Suppl, 15:159-69 (1999).
- the membrane glycoproteins are responsible for the attachment and penetration of the virions into target cells by mediating receptor binding and viral-cellular membrane fusion. Wool-Lewis, et al., J. Virol, 72(4):3155-60 (1998), Ito H., et al., J. Virol, 73(10):8907-12 (1999). They are synthesized as a single peptide precursor and cleaved by cellular enzymes (furin or cathepsin B) into the two mature forms, GP1 and GP2. The two GPs remain associated through a disulfide bond linkage and remain anchored in the viral membrane by a transmembrane (TM) domain. Ito H., et al., J. Virol, 73(10):8907-12
- the proteolytic cleavage site is composed of 4-5 basic amino acid residues that are similar to those found in the GPs of retrovirus, influenza, and paramyxoviruses.
- the cleavage event is essential for viral infectivity and is likely carried out by the same enzymes that cleave GPs of retrovirus or influenza viruses.
- Ebola virus GP may share a common mechanism of mediating viral infection with retroviral and influenza glycoproteins. Weissenhorn, W., et al., Mol Membr Biol, 16(1 ):3-9 (1999).
- membrane-bound GPs play critical roles in initiating virus infection and are also the predominant proteins exposed on the surface of the virions, they are the primary targets for neutralizing antibodies against the virus.
- One of the properties of Ebola viruses that make them lethal to the host is their ability to suppress the host immune system. Serologic analysis of patients who died of the Ebola virus infection showed no signs of humoral or cellular immune responses. Baize, S., et al., Nat Med, 5(4):423-6 (1999). In contrast, antibodies against viral proteins and virus-specific T-cell activities were detected in a few survivors. Baize, S., et al., Nat Med, 5(4):423-6 (1999). Although the immunosuppressive mechanisms are yet to be understood, it is probable that the high levels of sGP and the immunosuppressive peptide in the GP are to blame for the absence of humoral and cellular immune responses in Ebola virus-infected patients.
- Ebola virus The proteins that are responsible for the initial inflection of Ebola virus are the viral glycoproteins. Therefore, they are the target for neutralizing antibodies.
- Ebola virus has evolved "tricks" to prevent or delay the host immune response until it is too late to recover from the infection.
- Conventional approaches in producing vaccines against Ebola virus are likely to be ineffective for the following reasons: (1 ) viral glycoproteins produced in bacteria, yeast or insect cells are not properly glycosylated and therefore do not have the true antigenicity of the viral proteins; (2) Ebola virus is too dangerous to be produced in large amounts as an inactivated-virus vaccine; and (3) procedures of inactivating the virus often destroy the conformation of the proteins, and therefore alter their antigenicity.
- a preferred embodiment of the present invention is a recombinant viral vaccine having nucleic acids encoding one or more antigens of Ebola virus. Restriction maps and full sequence information of the Ebola virus, including the Zaire strain, is available through GenBank.
- the genetic vaccine is a recombinant benign virus which is replication defective or incompetent and therefore is incapable of spreading beyond initially infected cells.
- a recombinant adenoviral vaccine of the , present invention mediates high levels of Ebola viral antigen expression for a period of two or more weeks, even though Ebola viral proteins have no functional relevance to recombinant virus function.
- the recombinant virus expresses one or more modified Ebola virus antigens.
- the modified Ebola virus antigens are preferably Ebola virus envelope glycoproteins and/or immunogically active parts thereof.
- the glycoproteins are modified GP and sGP glycoproteins.
- the Ebola virus GP and sGP glycoproteins are modified to destroy their pathogenic and immunosuppressive functions, but retain most of their natural antigenicity, since they are expressed, folded, glycosylated, and targeted to the cellular membrane inside the cells that can be productively infected by the Ebola virus.
- the modifications are carried out using standard molecular genetic manipulation techniques such as restriction digests and polymerase chain reaction.
- a preferred modification of the Ebola virus envelope glycoprotein destroys the infective function of the Ebola virus GP.
- Any modification that destroys the infective function of Ebola vims can be used, but preferably the modification is a five amino acid deletion in the cleavage site of the GP. See Example 1. This cleavage site is composed of five basic amino acid residues,
- RRTRR at position 501 from the start of the open reading frame.
- This deletion may be introduced into the Ebola virus GP cDNA using PCR amplification, which is performed by methods well known in the art.
- Another preferred modification of the Ebola virus viral genome prevents synthesis of the sGP. Any modification that prevents synthesis may be employed. Preferably the modification is directed to altering the RNA editing site from UUUUUUU to UUCUUCUU. See example 1.
- IS immunosuppressive
- the IS peptide motif is located at amino acids 585-609. A ten amino acid deletion between amino acide 590-600 removes its function. Second, each half of the IS peptide motif is reversed and duplicated. See Figure 2. This further ensures that its function has been destroyed and also increases its antigenicity. Further it is readily apparent to those skilled in the art that variations or derivatives of the nucleotide sequences encoding Ebola virus antigen(s) of the present invention can be produced, which alter the amino acid sequence of the encoded protein.
- the altered expressed antigen(s) may have an altered amino acid sequence, yet still elicit immuneresponses that react with Ebola virus antigen(s), and are considered functional equivalents.
- fragments of the full-length genes that encode portions of the full-length protein may also be constructed. These fragments may encode a protein or peptide which elicits antibodies which react with Ebola virus antigen(s), and are considered functional equivalents.
- Vaccination of an individual with the vaccines of the present invention results in entrance of adenoviral particles into cells and expression of Ebola virus antigen(s), such as the envelope glycoproteins, and the immune- stimulating cytokines.
- Ebola virus antigen(s) in cells induces strong and persistent immune responses as if an infection has occurred.
- the genetic vaccine has all of the immunogenicity of a natural infection, including expression of the natural viral proteins and long-lasting antigen stimulation, but does not have the pathogenicity of a true viral infection.
- the immunosuppressive mechanisms of Ebola virus are disabled, the antigens occur in their natural forms and are associated with the cell membrane, and immune stimulation lasts for weeks.
- the effects of this novel vaccine are long lasting and provide high rates of protection against Ebola virus infection.
- the present invention is also directed to a method of immunizing a human against Ebola virus infection comprising administering the vaccines described above.
- the techniques for administering these vaccines to humans are known to those skilled in the health fields.
- individuals may be immunized against Ebola virus. Since the genetic vaccine can express high levels of antigens and/or a variety of glycoproteins simultaneously, the vaccinated individuals should be immunized against various strains Ebola virus. Additionally, since the genetic vaccine can express high levels of cytokines to mimic the body's response to natural viral infection, the body's immune response to such a geneticl vaccine against Ebola virus should be strong and long-lasting, thereby achieving a life-long immunity against the
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising the vaccine(s) described above, and a pharmaceutically acceptable diluent, carrier, or excipient carrier.
- the vaccine may also contain an aqueous medium or a water containing suspension, often mixed with other constituents in order to increase the activity and/or the shelf life.
- constituents may be salt, pH buffers, stabilizers (such as skimmed milk or casein hydrolysate), emulsifiers, and preservatives.
- An adjuvant may be included in the pharmaceutical composition to augment the immune response to the viral antigen expressed from the recombinant virus.
- the adjuvant include, but are not limited to, muramyl dipeptide, aluminum hydroxide, saponin, polyanions, anamphipatic substances, bacillus Calmette-Guerin (BCG), endotoxin lipopolysaccharides, keyhole limpet hemocyanin (GKLH), interleukin-2 (IL-2), granulocyte- macrophage colony-stimulating factor (GM-CSF) and cytoxan, a chemotherapeutic agent which is believed to reduce tumor-induced suppression when given in low doses.
- kits for enhancing the immunity of a host to a pathogen may include any one ore more vaccines according to the present invention in combination with a composition for delivering the vaccine to a host and/or a device, such as a syringe, for delivering the vaccine to a host.
- the vaccine according to the invention can be administered in a conventional active immunization scheme: single or repeated administration in a manner compatible with the dosage formulation, and in such amount as will be prophylactically effective, i.e.
- the vaccine of the present invention i.e. the recombinant virus, may be administered to a host, preferably a human subject, via any pharmaceutically acceptable routes of administration.
- routes of administration include, but are not limited to, intramuscular, intratracheal, subcutaneous, intranasal, intradermal, rectal, intramucusally, oral and parental route of administration. Routes of administration may be combined, if desired, or adjusted depending upon the type of the pathogenic virus to be immunized against and the desired body site of protection.
- the route of administration can be particularly important in influencing the nature of induced immunity, and the degree of protection.
- parenteral administration may only activate a systemic immune response
- the oral route provides, in addition, mucosal immune response.
- the ability of the recombinant viruses of the present invention to elicit a mucosal immunity renders its application important in mucosally and sexually transmitted infection.
- Doses or effective amounts of the recombinant virus may depend on factors such as the condition, the selected viral or bacterial antigen, the age, weight and health of the host, and may vary among hosts. In general, one skilled in the art understands that the amount of virus particles to be administered depends, for example, on the number of times the vaccine is administered and the level of response desired.
- the appropriate titer of the recombinant virus of the present invention to be administered to an individual is the titer that can modulate an immune response against the viral or bacterial antigen and elicits antibodies against the pathogenic virus or bacteria from which the antigen is derived.
- An effective titer can be determined using an assay for determining the activity of immunoeffector cells following administration of the vaccine to the individual or by monitoring the effectiveness of the therapy using well known in vivo diagnostic assays.
- a prophylactically effective amount or dose of a recombinant adenovirus of the present invention may be in the range of from about 100 ⁇ l to about 10 ml of saline solution containing concentrations of from about 1x10 4 to 1x10 8 plaque forming units (pfu) virus/ml.
- pfu plaque forming units
- 1-1000 ⁇ g per administration is the preferred dose range.
- the dose may be the same for priming and boosting immunizations or it may be desired to alter quantity of recombinant viruses provided in the boosting phase as compared to the initial priming dose.
- an inoculum of the recombinant virus of the present invention is dictated by and dependent upon the unique characteristics of the particular recombinant virus and the particular immunologic effect to be achieved, as is well-recognized by the skilled artisan.
- the present invention also provides methods for enhancing the immunity of a host to pathogens with the recombinant viruses described above.
- the method is provided for enhancing the immunity of a host to a pathogenic virus. The method comprises: administering to the host a recombinant virus in an amount effective to induce an immune response.
- the recombinant virus comprises: an antigen sequence heterologous to the benign virus and encoding a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus; and an immuno-stimulator sequence heterologous to the benign virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the recombinant virus may preferably be replication-incompetent and not cause a malignancy naturally associated with the pathogenic virus in the host.
- the recombinant virus may be administered to the host via any pharmaceutically acceptable route of administration.
- the recombinant virus may be administered to the host via a route of intramuscular, intratracheal, subcutaneous, intranasal, intradermal, intramucosally, rectal, oral and parental administration.
- a method for immunizing a host against a pathogenic virus with multiple antigens that elicit strong and long- lasting immune response to the multiple antigens.
- the method comprises: administering to the host a recombinant virus in an amount effective to induce an immune response.
- the recombinant virus comprises: a plurality of antigen sequences heterologous to the recombinant virus, each encoding a different viral antigen from one or more pathogenic viruses, expression of the plurality of the antigen sequences eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus may preferably be replication-incompetent and not cause malignancy that is naturally associated with the pathogenic virus(es) in the host.
- the recombinant virus may also comprise one or more immuno-stimulator sequences heterologous to the recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- a method for immunizing a host against a pathogenic vims by using multiple genetic vaccines or viruses.
- Multiple recombinant viruses may carry different antigens in each recombinant virus.
- the multiple recombinant viruses may be administered simultaneously or step-wise to the host.
- the method comprises: administering to a host a first and second recombinant viruses in an amount effective to induce an immune response, wherein antibodies are produced.
- the first recombinant benign virus comprises: an antigen sequence heterologous to the first recombinant virus that encodes a viral antigen from a pathogenic virus, expression of the viral antigen eliciting an immune response directed against the viral antigen and cells expressing the viral antigen in the host upon infection of the host by the recombinant virus.
- the second recombinant virus comprises: an immuno- stimulator sequence heterologous to the second recombinant virus that encodes an immuno-stimulator whose expression in the host enhances the immunogenicity of the viral antigen.
- the first and second recombinant viruses may preferably be replication-incompetent and not cause malignancy naturally associated with the pathogenic virus in the host.
- the first and second recombinant vims may be any of a benign virus, such as replication-incompetent adenovirus, adeno-associated virus, SV40 virus, retrovirus, herpes simplex virus, Alpha virus, Venezuelan Equine Encephalitis (VEE) virus and vaccinia virus.
- both the first and second recombinant viruses may be replication- incompetent adenovirus.
- one of the first and second recombinant viruses may be recombinant adenovirus and the other may be recombinant vaccinia virus.
- a method for enhancing the immunity of a host to a pathogen.
- the method comprises: administering to the host a recombinant virus and one or more immuno-stimulators.
- the recombinant virus may be any of the recombinant viruses described above.
- the recombinant virus comprises one or more antigen sequences heterologous to the recombinant virus that encode one or more antigens from the pathogen. Expression of the antigen elicits an immune response directed against the antigen and cells expressing the antigen in the host upon infection of the host by the recombinant virus.
- the recombinant virus is preferably replication-incompetent and does not cause a malignancy naturally associated with the pathogen in the host.
- the pathogen may be a pathogenic virus such as HIV, hepatitis virus and Ebola virus, a pathogenic bacteria or parasite.
- the immuno-stimulator may be any molecule that enhances the immunogenicity of the antigen expressed by the cell infected by the recombinant virus.
- the immuno-stimulator is a cytokine, including, but not limited to interleukin-2, interleukin-8, interleukin-12, ⁇ - interferon, ⁇ -interferon, ⁇ -interferon, granulocyte colony stimulating factor, granulocyte-macrophage colony stimulating factor, and combinations thereof.
- the cytokine may be administered into the host in a form of purified protein.
- the cytokine may be administered in a form of expression vector that expresses the coding sequence of the cytokine upon transfecting or transducing the cells of the host.
- the method may further comprise: administering to the host the recombinant virus again to boost the immune response.
- a booster inoculation with the recombinant virus is preferably conducted several weeks to several months after the primary inoculation.
- the recombinant virus administered in the booster immunization may be the same as or different from the recombinant virus administered in the primary immunization.
- the method may further comprise: administering to the host a plasmid vector that encodes the same or different antigen(s) as that (or those) encoded by the recombinant virus.
- the plasmid vector is preferably a eukaryotic plasmid expression vector that expresses the antigen(s) upon transfection of the cells in the host.
- the method may further comprise: administering to the host a second recombinant virus to boost the immune response and/or to minimize neutralizing effects of the host's immune system on the recombinant viruses.
- the second recombinant vims comprises a second antigen sequence from a second pathogen that is different from the first antigen sequence comprised in the first recombinant virus administered in the primary immunization.
- the second antigen sequence encodes the same type of antigen as that encoded by the first antigen sequence but from a different strain, serotype, or subtype/clade of the same pathogen.
- the second antigen may be a different type of antigen compared to the first antigen, for example, the first antigen being a surface protein and second antigen being a core protein of the same or different pathogen.
- the method may further comprise: administering to the host a viral vector prior to, concurrently, or post the administration of any of the above embodiment of the recombinant virus to minimize neutralizing effects of the host's immune system on the recombinant virus.
- the viral vector is administered post the administration of the recombinant virus.
- the viral vector may be the native progenitor of the recombinant virus.
- the viral vector may be the wildtype adenovirus type 5 (Ad5) whereas the recombinant virus is a genetically modified Ad5.
- the viral vector may be the wildtype of or a genetically modified virus that is a different serotype of the recombinant virus.
- the recombinant virus may be a genetically modified Ad5 whereas the viral vector is the wildtype of or a genetically modified adenoviral vector serotype other than Ad5, for example, serotype 1-4 or 6-51. It is noted that other serotypes discovered and/or classified later also fall within the scope of the invention.
- the recombinant virus is a recombinant Ad5 encoding one or more heterologous antigens and/or an immunostimulator while the viral vector may also be a recombinant adenovirus encoding the same or different antigens and/or the immunostimulator but of different serotype (e.g., Ad2, Ad4, Ad9, Ad12, Ad35 and Ad40).
- serotype e.g., Ad2, Ad4, Ad9, Ad12, Ad35 and Ad40.
- a serotype rotation is believed to enhance expression of the transgenes and increase immunogenicity of the vaccines.
- a wildtype non-Ad5 vector can be administered to mice first and the levels of anti-adenovirus antibody are measured by ELISA 3 weeks after the injection.
- the recombinant Ad5 encoding a heterologous antigen e.g., HBV core protein
- the levels of antibody against the heterologous antigen can be measured 4-5 weeks after the secondary injection.
- the viral vector may be a different virus from the recombinant virus.
- the recombinant virus may be a genetically modified Ad5 whereas the viral vector is a genetically modified AAV, SV40 virus, retrovirus, herpes simplex virus, Alpha virus, Venezuelan Equine Encephalitis (VEE) virus or vaccinia virus.
- the viral vector may or may not comprise a heterologou antigen sequence.
- the viral vector may comprise another antigen sequence which is the same or different from the antigen sequence carried by the recombinant virus.
- the viral vector may be a chimeric vector modified based on the native progenitor of the recombinant virus.
- the native progenitor of the recombinant virus is adenovirus type 5
- the viral vector may be a chimeric adenovirus type 5 with certain regions of the backbone changed from type 5 to the corresponding regions from other adenovirus serotypes. This approach is believed to be advantageous because of the ease of cloning when only a portion of the backbone with the corresponding one of another serotype. This may be accomplished by constructing a shuttle vector by including Ad5 fiber DNA and switching the Ad5 fiber DNA partially or completely with that from another serotype of adenovirus.
- a right shuttle vector pR-Ad.5/35-6m is constructed to the replace the fiber region of Ad5 with that of Ad35.
- This right shuttle vector can be combined with a left shuttle vector and the Ad5 backbone to generate a chimeric Ad5 vector.
- adenovirus entry into the cells is a two- step process consisting of virus attachment to the membrane via the Ad fiber knob, followed by intemalization upon binding of the penton base RGD motifs to ⁇ v ⁇ 3 and ⁇ v ⁇ 5 integrins on the cell surface.
- adenovirus fiber is considered to be a crucial mediator for high efficiency binding to target cells.
- Subgroup C Ad5 fiber uses the coxsackievirus and adenovirus receptor (CAR) to mediate the high affinity binding. Nemerow (1999) Mol. Biol. Rev. 63:725-734.
- Ad5 attachment occurs at much lower efficiency through alternative pathways involving interactions between the fiber and the MHC class I heavy chain ⁇ 2 domain or between the penton and cellular integrins. Bergelson et al. (1997) Science 275:1320-1323.
- the adenovirus fiber can be divided into three domains.
- the conserved N-terminal tail contains the sequences responsible for association with the penton base. De Long et al. (1999) J. Clin. Microbiol. 37:3940.
- the rod-like fiber shafts contains number of repeats ranging from 6 to 23 form the ⁇ sheets. Davison et al. (1999) J. Virol. 73:4513.
- the C-terminal contains globular knob domains, which both fiber shaft and knob are involved in the primary receptor interaction. Huang et al. (1996) J. Virol. 70:4502.
- the fiber knob (i.e., the head), shaft, and/or penton base (i.e., the tail) in the backbone of adenovirus type 5 can be replaced by the corresponding region(s) of the backbone from adenovirus serotype 1-4, and 6-51.
- Figure 63 shows various embodiments of the chimeric vectors having the individual domains of the Ad5 fiber regions substituted with the corresponding domains of Ad35 fiber region.
- the knob domain of the fiber region of Ad5 is swapped with the corresponding one from another serotype of adenovirus since the knob domain is believed to determine the receptor-ligand interaction.
- the recombinant virus is a recombinant Ad5 encoding one or more heterologous antigens and/or an immunostimulator while the chimeric viral vector may also be a recombinant Ad5 encoding the same or different antigens and/or the immunostimulator but having a fiber region from adenovirus of different serotype (e.g., Ad2, Ad4, Ad9, Ad12, Ad35 and Ad40).
- a serotype rotation is believed to enhance expression of the transgenes and increase immunogenicity of the vaccines.
- an Ad5 vector carrying GFP can be administered to mice first and the levels of anti- GFP antibody are measured by ELISA 4 weeks after the injection.
- Another recombinant Ad5 also carrying GFP but having a fiber region from different serotype adenovirus is then administered to the mice 4-5 weeks after the primary injection.
- the levels of antibody against GFP can be measured 4-5 weeks after the secondary injection.
- the methods described above may be used for prevention or treatment of diseases.
- the administration of the recombinant viruses of the present invention may be for either "prophylactic" or "therapeutic" purpose.
- the recombinant virus is provided in advance of any symptom.
- the prophylactic administration of the recombinant virus serves to prevent or ameliorate any subsequent infection or disease.
- the recombinant virus is provided at (or after) the onset of a symptom of infection or disease.
- the present invention may be provided either prior to the anticipated exposure to a disease-causing agent or after the initiation and/or progression of the infection or disease.
- sequences encoding tumor-specific antigens may substitute the antigen sequence encoding viral antigen in any of the above embodiments of the recombinant virus and methods of using the same.
- Expression of tumor- specific antigens in the host should elicit specific immune response for prevention in patients with an increased risk of cancer development (i.e., preventive immunization) or to enhance the treatment of cancer with other therapeutics, prevention of disease recurrence after primary surgery (anti- metastatic vaccination), or as a tool to expand the number of CTL in vivo, thus improving their effectiveness in eradication of diffuse tumors (treatment of established disease).
- the methods of the present invention may elicit an immune response in a patient that is enhanced ex vivo prior to being transferred back to the tumor bearer (i.e., the adoptive immunotherapy).
- the method may further comprise: harvesting serum from the host after the administration of the recombinant virus.
- the harvested serum should contain antibodies against the antigen(s) encoded by the recombinant virus.
- the method may further comprise: isolating antibody or antibodies against the pathogen from the host after the administration of the recombinant virus.
- the harvested serum or isolated antibody can be stored for certain periods of time for further uses.
- a healthy human volunteer can serve as the host and the serum or antibody collected from him/her may be administered back to him/herself or a different person later to in anticipation or in the event of infection of the pathogen as prophylactic or therapeutic agent by eliciting passive immunity against the pathogen.
- the host may be a non-human animal and the serum harvested or antibody isolated from the animal immunized by the recombinant virus may be used as a prophylactic or therapeutic agent to treat a human or non-human animal in anticipation or in the event of infection of the pathogen such as in the outbreak of biological warfare.
- Standard procedures for endonuclease digestion, ligation and electrophoresis are carried out in accordance with the manufacturer's or supplier's instructions. Standard techniques are not described in detail and will be well understood by persons skilled in the art. Practicing the present invention employs, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See e.g. Sambrook, et al. Molecular Cloning: A laboratory Manual; DNA Cloning: A Practical Approach, vol I & II (D. Glover ed.); Oligonucleotide Synthesis (N. Giat, ed.); Nucleic Acid Hybridization (B.
- the following procedures are described to illustrate how to make a genetic vaccine of the present invention against various pathogenic viruses.
- the genetic vaccine is based on an adenoviral vector with modified antigens derived from the pathogenic virus (e.g., Ebola virus, Hepatitis B virus and HIV) inserted into the adenoviral backbone. Additionally, the recombinant adenovirus also carries multiple genes encoding various cytokines. The recombinant adenovirus is replication-incompetent but still retains adenoviral infectivity.
- the pathogenic virus e.g., Ebola virus, Hepatitis B virus and HIV
- Embodiments of the genetic vaccine against Ebola virus and methods of their construction are described in detail as follows.
- the modifications are carried out using standard molecular genetic manipulation techniques, such as restriction enzyme digests and polymerase chain reaction (PCR).
- the glycoproteins of Ebola virus are modified to produce the optimal antigen for Ebola virus vaccine.
- Two modified forms of the GP proteins are constructed to have inactivated immunosuppressive and infectious mechanisms, but retain full natural antigenicity of the wild-type glycoproteins.
- the mRNA editing signal is deleted to prevent the production of the secreted glycoprotein (sGP), which is immunosuppressive; and (2) the proteolytic cleavage site of the glycoprotein precursor is deleted to prevent the formation of the functional glycoproteins (GP1 and GP2).
- sGP secreted glycoprotein
- the proteolytic cleavage site of the glycoprotein precursor is deleted to prevent the formation of the functional glycoproteins (GP1 and GP2).
- the envelope glycoproteins (GP) of the Ebola virus are synthesized as a single precursor protein and cleaved into the two subunits (GP1 and GP2) by a cellular enzyme (furin) during transport.
- the glycoproteins of Ebola virus are the major proteins exposed on the viral membrane surface, and are responsible for initiating virus entry into host cells. Therefore, they are a primary target for neutralizing antibodies.
- the glycoprotein cleavage site is composed of five basic amino acid residues (RRTRR [SEQ ID NO: 10]) at position 501 from the start site of the open reading frame.
- RRTRR basic amino acid residues
- the Ebola virus glycoprotein cleavage site is similar to the conserved sequences found in glycoproteins of other viruses, such as in the envelope protein of RSV or MuLV. We have previously shown that deletions or point mutations at these basic amino acid residues can block cleavage and render the glycoproteins non-functional in RSV. Dong, J.Y, et al., J. Virol 66(2): 865-74 (1992).
- the five basic amino acid residues in the cleavage site are deleted. This deletion is introduced into the Ebola virus GP cDNA using PCR amplification.
- the cleavage site can be altered, such as by site specific mutation resulting in elimination of cleavage.
- Ebola virus Another important feature of the Ebola virus is that two forms of glycoproteins are synthesized from a single gene, a secreted from (sGP) and a membrane-bound form (GP). The two forms are generated as a result of an alternative RNA editing event at a sequence of seven uridines (at location 1020-1028 from the start site), which is highly conserved among all four Ebola virus subtypes.
- the sGP is synthesized from un-edited mRNA and likely has immunosuppressive functions.
- the GP is synthesized from an edited mRNA and likely has immunosuppressive functions.
- the GP is synthesized from an edited mRNA with insertion in one of the seven uridines. This RNA editing causes a frame-shift and results in a translation of the second reading frame that encodes the complete transmembrane glycoprotein (GP2). To prevent the synthesis of sGP, the RNA editing site is modified from
- the equivalent sequence is AAAAAAA [SEQ ID NO: 4] and AAGAAGAA [SEQ ID NO: 5], respectively.
- This modification accomplishes two things: (1) all mRNAs encode only the GP (equivalent to the edited form with -1 frame shift); and (2) UUUUUU [SEQ ID NO: 6] encodes the same animo acid residues as
- a third modification may be introduced into the Ebola virus glycoprotein relating to a deletion of the immunosuppressive (IS) peptide located in GP2.
- the IS peptide motif (amino acid 585-609, form the start site) is highly conserved in filoviruses and has a high degree of homologywith a motif in the glycoproteins of oncogenic retrovimses that has been shown to be immunosuppressive. Volchkov, V.E., et al., FEBS eft 305(3): 181-4 (1992);
- FIG. 3A-3C modification of the immunosuppressive peptide (IS) is made on the GP2 gene.
- Figure 3A illustrates the wild type GP.
- Figure 3B illustrates GP with the 10 amino acid deletion of the IS peptide.
- Figure 3C illustrates the IS peptide, which is split, reversed and duplicated.
- Ebola virus glycoproteins are generated that are non-functional, not immunosuppressive, yet they retain the natural antigenicity of GP.
- These modified GP sequences are used to generate antigens in the vaccines of the present invention against Ebola virus. DNA sequences of the resulting altered GP genes are confirmed by sequence analysis.
- the modified GP sequences are then cloned intoplasmid vectors containing DNA elements necessary for efficient expression of these GPs in hostian cells. Expression and correct localization to the cellular membrane is determined by transient transfections of HeLa or 293 cells and analyzed by Western blot and FACS, using polyclonal antibodies from hyperimmunized equine serum and anti-horse secondary antibodies labeled with horse radish peroxidase (HRP) or fluorescent tags, respectively.
- HRP horse radish peroxidase
- the vaccines of the present invention utilize a recombinant benign virus to carry modified antigens of Ebola virus to trick the host into mounting a robust immune defense against the Ebola virus.
- the preferred benign virus is a replication-defective adenovirus.
- adenoviral vectors direct high levels of antigen expression that provides strong stimulation of the immune system.
- the antigen that they express is processed and displayed in the transduced cells in a way that mimics pathogen-infected cells. This phase is believed to be very important in inducing cellular immunity against infected cells, and is completely lacking when conventional vaccination approaches are used.
- adenoviral vectors infect dendritic cells which are very potent antigen-presenting cells.
- adenovimses naturally infect airway and gut epithelial cells in humans, and therefore the vaccine may be delivered through nasal spray or oral ingestion.
- the adenoviral vectors of this invention are safe because they are replication-defective andhave been used in high doses (10 9 to 10 12 i.p./dose) in clinical trials for gene therapy studies. Gahery-Segard, H., et al., J.
- This vector-construction system is also used to establish complex vectors that express multiple genes or regulatory mechanisms.
- the vector construct is used to express multiple cytokines along with Ebola GP antigens in a single complex vector to further enhance the immune induction.
- antigens and cytokines are placed in separate vectors. This enables the manipulation of different combinations of cytokines and antigens by co-transduction (infection) with two or three vectors.
- adenoviral vectors Construction of the adenoviral vectors is diagramed in Figure 4.
- the cDNA encoding a modified GP(s) is cloned into the left-end (E1 region) of the adenovirus genome using a shuttle vector pLAd ( Figure 4A left side), resulting in a shuttle vector pLAd/EBO-GP.
- the pLAd/EBO-GP vector contains the left end of the adenoviral genome including the left long terminal repeats L-TR and the adenoviral packaging signal ⁇ .
- cytokines such as IL-2 and IL-4 are inserted into E4 region of the adenovirus vector using the shuttle vector pRAd ( Figure 4A, right side), resulting in a shuttle vector pRAdlL2,4.
- the pRAdlL2,4 contains the right end of the adenoviral genome including the right long terminal repeats R-TR.
- the shuttle vector pLAd/EBO-GP is digested with appropriate restriction enzymes such as Xba l.
- the fragment containing the GP gene is ligated to an adenoviral backbone and pRAd vector.
- both pLAd/EBO-GP and pRAdlL2, 4 are linearized and ligated to the backbone of the adenovirus ( Figure 4B).
- the ligated vector genome is transfected into 293 cells, in which only the correctly ligated genome with the two adenoviral terminal repeats can replicate and generate infectious viral particles.
- Human 293 cells (Graham et al., J. Gen.
- the 293 cells supplement the essential E1 gene of adenovirus that has been deleted from the vector backbone.
- the final vector has E1 , E3 and partial E4 deleted and can only replicate in 293 cells, but not in target cells.
- the adenoviral vectors are amplified in 293 cells and purified by ultracentrifugation in cesium chloride gradients. Titers of vectors are determined by serial dilutions and counting of the infectious particle (ip) after infection of 293 cells.
- An in vitro assay is used to quantitate the amount of neutralizing antibodies developed in response to the vaccine.
- the assay is based on a retroviral vector system which is based on a Moloney Murine Leukemia virus system.
- Vectors and packaging cells expressing GAG and POL proteins have been extensively characterized and are commercially available.
- a packaging vector construct that carries a ⁇ -galactosidase gene as a reporter is used.
- a novel vector construct expressing the membrane form of the Ebola virus GP is co-transfected with the ⁇ -Gal reporter vector resulting in a GAG-POL packaging cell line, which generates retroviral vector particles with the Ebola virus GP instead of its original envelope protein.
- the adenoviral vaccine vectors carrying the two GP variants are tested for their ability to induce an immune response to the Ebola virus GP in CD-1 mice (Charles River Laboratories; outbred stock of Swiss mice from Rockefeller Institute). Specifically, the neutralizing antibody titers and cytolytic T-lymphocyte (CTL) activities to the Ebola virus GP antigens induced by the GP variants with and without the IS motif are compared. Three groups of 30 8-week old mice are injected subcutaneously with 10 5 ip of adenoviral vectors expressing GP variant 1 (with IS peptide deleted), GP variant 2 (with IS peptide split and inverted) and ⁇ -Galactosidase (control vector), respectively.
- CTL cytolytic T-lymphocyte
- mice from each group are sacrificed (by C0 2 asphyxiation and cervical dislocation) at 1 , 2, 4, 8 and 16 weeks post-vaccination, and their blood and spleens are harvested.
- 6 mice are mock-vaccinated with saline and sacrificed 2 days later to provide preimmunization controls.
- tissue sections from the sites of the vector injection are taken, fixed, and stained with the X-gal solution to determine the number and type of vector-transduced cells at various time-points post-infection.
- hemolysin staining isperformed to determine the degree of infiltration of various immune cells (neutrophils, macrophages, monocytes, etc.) at the site of the vector delivery.
- Sera from vaccinated animals is assayed for total GP-binding antibodies using a standard 96-well plate ELISA protocol, as has been described. Van Ginkel, F.W., et al., Hum Gene Ther 6(7): 895-903 (1995); Van Ginkel, F.W., et al., J Immunol 159(2):685-93 (1997). Neutralizing activity of the sera is analyzed by monitoring the infectious activity of the Ebola virus GP-pseudotyped retroviral vector (Wool-Lewis, et al., J. Virol, 72(4):3155-60 (1998)) on HeLa cells after the vector has been incubated with various serum concentrations.
- Expression of ⁇ -galactosidase in infected cell lysates serves as an indicator of the neutralizing activity of the serum (the lower the ⁇ -gal activity, the more EBO- ⁇ -Gal vectors have been neutralized) and is measured using a very sensitive fluorogenic substrate (Galacto-Light kit J) and a fluorescence plate reader.
- Anti-GP serum-neutralized infection rates are compared to infection rates in the absence of serum and in the presence of non-GP activated serum.
- Cytotoxic lymphocytes are extracted from mouse spleen as previously described. Van Ginkel, F.W., et al., Hum Gene Ther 1995; 6(7):895-903; Dong, J.Y., et al., Hum Gene 7 " t ⁇ er 1996;7(3):319-31. They are mixed with a constant number of detached LnCaP cells (prostate carcinoma cells of epithelial origin) transduced with an adenoviral vector carrying an unmodified Ebola virus GP protein. Ratios of effector: target cells of 10:1 , 3:1 , and 1:1 are used.
- the cells are seeded into 96-well plates, and 24 hour later all unattached cells (which include all of the effector CTLs and dead or dying LnCaP cells) are removed, and the remaining viable (adherent) cells are quantitated by the MTT (3-(4,5-dimethylthiazol-20-yl) 2,5-diphenyl tetrazolium bromide) cleavage assay.
- MTT 3-(4,5-dimethylthiazol-20-yl) 2,5-diphenyl tetrazolium bromide
- a vector-mediated gene transfer to express the imm ⁇ noenhancing cytokines such as IL2, IL4, IL12, INF- ⁇ , and GM-CSF is used.
- cytokines such as IL2, IL4, IL12, INF- ⁇ , and GM-CSF.
- each cytokine is separately cloned or the cytokines are cloned in various combinations into adenoviral vectors separate from the vectors encoding viral antigens.
- the immunoenhancing effects of individual cytokines or their combinations are studied by co-infecting with a vector encoding the cytokine and the vector carrying the antigens.
- the titers of serum antibodies are compared, as well as the time it takes to reach effective titers in animals inoculated with vaccines in combination with different cytokine-expressing vectors. These experiments allow the determination of whether immunoenhancing cytokines induce higher levels of antibodies, shorten the induction time, and prolong the immunity against the Ebola virus. After determining the best-performing modified GP variant, the extent that the immune response elicited by it is enhanced by co-delivery to the immunization site of vectors carrying various cytokines is analyzed. Interleukin-2, either by itself or in combination with IL-4 or IL-12, has been demonstrated to strongly enhance the activation and proliferation of cytotoxic T-cells, natural killer (NK) cells and B-cells.
- NK natural killer
- INF- ⁇ stimulates the humoral immune response and increases the permeability of the blood vessel walls at the site of its secretion (Chensue, S.W., et al., J Immunol 154(11 ):5969-76 (1995); Szente, B.E., et al., Biochem Biophys Res Commun 203(3): 1645-54 (1994); Adams, R.B., et al., J. Immunol 150(6):2356-63(1993)), while Gm-CSF activates and attracts macrophages and other professional APCs to the site of the infection.
- mice Six groups of 30 8-week old mice are injected subcutaneously with a mixture of 5x10 4 ip of the selected GP variant vector and 5x10 4 ip of one of the following vectors: Ad- ⁇ -Gal, Ad-IL2, Ad-IL2/IL4, Ad-IL2/IL12, Ad-IFN- ⁇ and Ad-GM-CSF.
- mice from each group are sacrificed and analyzed at 1 , 2, 4, 8 and 16 weeks as described in Example 4. Analysis of total IgG is peformed using
- ELISA neutralizing activity is assayed as interference with the ability of EBO- GP pseudotyped retroviral vector to infect HeLa cells, and anti-GP CTL activity is performed by mixing spleen-extracted CTLs with target LnCaP cells transduced with Ad-EBO-GP construct as described in Example 4.
- Levels of various cytokines in the serum are also quantitated by ELISA using available commercial assays. In some cases, these assays can distinguish between human and murine versions of the same cytokine, providing direct information on the expression levels of cytokines delivered using Adenovirus vectors and how they correlate with the development of the immune response. After the individual cytokines are analyzed, those that performed best are tested in combinations.
- mice Four groups of 30 8-week old mice are injected subcutaneously with a mixture of 5x10 4 i.p. of the selected GP variant vector and 5x10 4 i.p. of up to 3 selected cytokine-expressing vectors (if fewer than 3 cytokine vectors are used, i.p. counts are made up with Ad- ⁇ -Gal vector).
- 5x10 4 i.p. of the selected GP variant vector and 5x10 4 i.p. of up to 3 selected cytokine-expressing vectors (if fewer than 3 cytokine vectors are used, i.p. counts are made up with Ad- ⁇ -Gal vector).
- Six mice from each group are sacrificed at weeks 1 , 2, 4, 8 and 16, and analyzed as described above.
- the experiment as described above is reproduced in rabbits.
- Five groups of six white New Zealand rabbits are injected into the thigh muscle with one of the following vector combinations: the Ad- ⁇ -Gal vector (10 6 ip), the selected GP vector (2.5 x 10 5 ip plus 7.5x10 5 ip of Ad- ⁇ -Gal), and three cytokine vector combinations (2.5x10 5 of each cytokine vector) plus the GP vector (2.5x10 5 ip), as described above.
- the animals are bled 2 days prior to vaccination (pre-immune bleed) and then according to the schedule described above. 5 to 10 ml of blood will be extracted per session. Analysis is performed in a similar fashion to that of mice (see above).
- genes coding for human cytokines are used in mouse and rabbit models, it is possible that their immune systems will have a non- identical (to human) response to those proteins.
- a high degree of homology exists between human and mouse cytokines and their receptors, and published reports, on experiments using human or other hostian cytokines in mice indicate a high level of equivalency. If necessary, species-specific versions of these cytokines can be obtained and cloned into the adenoviral vectors of the present invention for species-targeted cytokine activity studies.
- the final version of the vaccine vectors are constructed.
- These complex recombinant adenoviral vectors deliver combinations of cytokines and antigens into target cells using a single vector.
- Dose-titer analysis in mice and rabbits are conducted to identify the lowest dose required to generate maximallevels of immune responses. Different routes of vaccine administration, such as intramuscular and intravenous injection, oral ingestion and nasal sprays are compared.
- dose escalation experiments in mice and rabbits are conducted until toxicity is observed or until levels ten times the effective dose have been reached. Finally, additional safety and pathogen challenge experiments are conducted in primates.
- Ad-E.TR/IL2 An adenoviral vector, Ad-E.T.R/IL2, was constructed to carry coding sequences for multiple HIV antigens including Env, Tat, and Rev proteins, and interleukin-2 (IL-2) in the same vector. Expression of the HIV antigens and IL- 2 is separately controlled by promoters located in different regions of the adenoviral vector. This design is believed to be able to ensure high level expression of both the viral antigens and the immuno-stimulator IL-2 and to enhance immunogenicity of the adenoviral vaccine. As shown by experimental data presented in the next section, this adenoviral vector is capable of eliciting strong humoral immune response in animals against HIV antigens.
- the adenoviral vector, Ad-E.T.R/IL2 was constructed using strategies similar to those for constructing the adenoviral vaccines against Ebola virus as described in detail above. Briefly, EcoRI/Xhol restriction fragment from HIV-1 strain BH10 (HIV-1 or HTLV-IIIB, clade B, Accession No: M15654), which encodes wildtype envelope gp160 (full length gp 120 and gp41), full length wildtype Tat and full length wild type Rev, was inserted into the left end (E1 region) of the adenoviral genome using a shuttle vector, resulting in a shuttle vector pLAd-E.T.R ( Figure 16A).
- DNA sequence of this EcoRI/Xhol restriction fragment [SEQ ID NO: 14] is shown in Figure 38.
- the sequence encoding IL-2 (with a silent mutation CTA to CTT at amino acid position 79 to delete the Xbal site) was inserted into E4 region of the adenoviral genome using a shuttle vector, resulting in a shuttle vector pRAd-ORF6-IL2 ( Figure 16B).
- DNA sequence encoding this mutated IL-2 (IL- 2 ⁇ X) [SEQ ID NO: 15] is shown in Figure 39.
- Both pLAd-E.T.R and pRAd-OFR6-IL2 were linearized using appropriate restriction enzymes such as Xba I and EcoRI and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector Ad-E.T.R/IL2.
- Ad-3C/E m ⁇ C ⁇ T 300 -G Another adenoviral vector, Ad-3C/E m ⁇ C ⁇ T 300 -G, was constructed to carry coding sequences for multiple HIV antigens including a modified Env (gp160) with deletion of the cleavage site between gp120 and gp41 and the cytosolic domain and Gag proteins, and three different cytokines (IL-2 with silent mutation CTA to CTT at amino acid position 79 to delete the Xbal site, INF- ⁇ , and GMCSF) in the same vector. Expression of the HIV antigens and the cytokines is separately controlled by promoters located in different regions of the adenoviral vector.
- a modified Env gp160
- cytokines IL-2 with silent mutation CTA to CTT at amino acid position 79 to delete the Xbal site, INF- ⁇ , and GMCSF
- this design is believed to be able to ensure high level expression of both the viral antigens and the immuno-stimulators and to enhance immunogenicity of the adenoviral vaccine.
- this adenoviral vector is capable of eliciting strong humoral immune response in animals against HIV antigens.
- the adenoviral vector, Ad-3C/E m ⁇ C ⁇ T 300 -G, was constructed using strategies similar to those for constructing the adenoviral vaccines against
- Ebola virus as described in detail above. Briefly, the sequence from HIV-1 strain BH10 that encodes Env/gp160 (nucleotide position 5580-7850) was modified to delete the sequences encoding the cleavage site (REKR [SEQ ID NO: 11] encoded by nucleotide at position 7101-7112) and the cytosolic domain of 100 amino acids in length (encoded by nucleotide at position 7850-
- a cloning vector SD/SA1.2.3 was constructed to include a retroviral SD site and multiple retroviral SA sites, SA-i, SA 2 , SA 3 and
- SD and SA sites were derived from Moloney murine leukemia virus (MMLV) and their sequences are shown below:
- SD site (MMLV nt 204-210): AGGTAAG [SEQ ID NO: 72]; and SA M site (MMLV nt 560-568): CTGCTGCAG [SEQ ID NO: 73].
- SA- M SA- M sites which share the same sequence was inserted into the multiple cloning site of a cloning vector pSP73 by using standard PCR mutagenesis. As illustrated in Figure 37, SAi was inserted immediately downstream from SD site, followed by SA 2 , SA 3 and SA 4 .
- the GFP (green fluorescence protein) gene was inserted between SD/SAi and SA 2 , SA 2 and SA 3 , SA 3 and S ⁇ , and after SA The ratio of expression levels in these four sites is 10:1 :5:4.
- DNA sequences encoding E m ⁇ C ⁇ T and Gag were inserted into the cloning vector SD/SA1.2.3 after SD/SA ⁇ and SA 2 , respectively.
- the resulting vector was digested with EcoRV and Xhol and the fragment containing
- E m ⁇ C ⁇ T and Gag was inserted into an adenoviral shuttle vector, resulting in pRAd-ORF6-cmv- E m ⁇ C ⁇ T 300 -G ( Figure 17A).
- Shuttle vectors capable of expressing other proteins (as shown below) via the retroviral SD/SA mechanism were constructed using the same strategy. Sequences encoding multiple immuno-stimulators, including IL-2 (with a silent mutation caused by deletion of Xba I site), INF- ⁇ , and GMCSF, were inserted into E1 region of the adenoviral genome using a shuttle vector.
- the shuttle vector produced is designated pLAd-3C ( Figure 17B).
- Both pRAd-ORF6-cmv- E m ⁇ C ⁇ T 300 -G and pLAd-3C were linearized using appropriate restriction enzymes such as Xba I and EcoRI and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector Ad-3C/E m ⁇ C ⁇ T 300 -G.
- Ad-3C/E m ⁇ C ⁇ T 99 .T.R-G was constructed to carry coding sequences for multiple HIV antigens from strain pNL4-3 (Accession No: M19921) including a modified Env (gp160 with deletion of the cleavage site and the cytoplasmic domain of 33 amino acids in length), full length Rev and Gag proteins, and three different cytokines (IL-2 with silent mutation CTA to CTT at amino acid position 79 to delete the Xbal site, INF- ⁇ , and GMCSF) in the same vector. Expression of the HIV antigens and the cytokines is separately controlled by promoters located in different regions of the adenoviral vector.
- this design is believed to be able to ensure high level expression of both the viral antigens and the immuno-stimulators and to enhance immunogenicity of the adenoviral vaccine.
- this adenoviral vector is capable of eliciting strong humoral immune response in animals against HIV antigens.
- the adenoviral vector, Ad-3C/E m ⁇ C ⁇ T 99 .T.R-G was constructed using strategies similar to those for constructing the adenoviral vaccines against Ebola virus as described in detail above. Briefly, the sequence from HIV-1 strain pNL4-3 that encodes Env/gp160 (nucleotide position 6221-8686) was modified to delete the sequences encoding the cleavage site (encoded by nucleotide at position 7736-7747) and the cytosolic domain (encoded by nucleotide at position 8687-8785) in length, and then, along with sequences encoding full length Tat, Rev, and Gag (from HIV strain BH10), inserted into the right end (E4 region) of the adenoviral genome using a shuttle vector.
- the shuttle vector produced is designated pRAd-E m ⁇ C ⁇ T 99 .T.R-G ( Figure 18).
- DNA sequence encoding the modified Env, and full length Tat and Rev [SEQ ID NO: 19] is shown in Figure 42.
- DNA and amino acid sequences of the full length Gag from HIV strain BH10 [SEQ ID NO: 17] are shown in Figures 41 A and 41 B, respectively.
- the shuttle vectors, pRAd-E m ⁇ C ⁇ T 99 .T.R.-G and pLAd-3C Figure 18
- Ad-E m ⁇ V 1
- Ad-E m ⁇ V 1
- This HIV Env/gp160 was also modified to delete the cleavage site encoded by nucleotide at position 7736-7747 ( ⁇ C) and the 33-aa cytosolic domain encoded by nucleotide at position 8687-8785 ( ⁇ T 99 ).
- the modified env was inserted into the left end (E1 region) of the adenoviral genome using a shuttle vector.
- DNA sequence encoding the insert (E m ⁇ V ⁇ >2 ⁇ C ⁇ T.T.R) [SEQ ID NO: 20] is shown in Figure 43.
- IL-2 (with a silent mutation caused by deletion of Xba I site, DNA SEQ ID NO: 15) was inserted downstream from the modified env. Both the modified Env and IL-2 are expressed separately from a CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SA-i and SA 2 /SA 3 .
- SD retroviral splicing donor
- SA acceptor
- the shuttle vector produced is designated pLAd- E m ⁇ V ⁇ , 2 ⁇ C ⁇ T.T.R-IL2 ( Figure 19A).
- IL-2 (with a silent mutation caused by deletion of Xba I site, DNA SEQ ID NO: 15) and Gag from HIV-1 strain BH10 (nt 112- 1650, DNA SEQ ID NO: 17) were inserted into E4 region of the adenoviral genome using a shuttle vector. These two proteins are expressed separately from a CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SA-i and SA 2 .
- SD retroviral splicing donor
- SA acceptor
- the shuttle vector produced is designated pRAd-ORF6-G.IL2 ( Figure 19B).
- Ad-E m ⁇ C.T.R.N/G.IL2 was constructed to carry coding sequences for multiple HIV antigens from HIV-1 strain BH10.
- Ad-E m ⁇ C.N /G.IL2 Yet another adenoviral vector, Ad-E m ⁇ C.N/G.IL2, was constructed to carry coding sequences for multiple HIV antigens from HIV-1 strain BH10.
- Ad-E m ⁇ C ⁇ T 3 ⁇ .T/G.lL2 Yet another adenoviral vector, Ad-E m ⁇ C ⁇ T 300 .T/G.IL2, was constructed to carry coding sequences for multiple HIV antigens from HIV-1 strain BH10.
- the sequence from HIV-1 strain BH10 that encodes full length Env/gp160 (nucleotide position 5580-8150) was modified by deleting the sequence encoding the cleavage site and a 300 nt sequence encoding the cytosolic domain, but still including sequence for full length Tat (T).
- Ad-E m ⁇ C/E m ⁇ C Yet another adenoviral vector, Ad-E m ⁇ C/ E m ⁇ C, was constructed to carry coding sequences for two copies of a modified Env from HIV-1 strain BH10.
- Both pLAd-E m ⁇ C and pRAd-ORF6-E ⁇ C were linearized using appropriate restriction enzymes and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector Ad-E ⁇ C/ E m ⁇ C.
- Ad-E m .V3 m /G.IL-2 Yet another adenoviral vector, Ad-E m .V3 m /G.IL-2, was constructed to carry coding sequences for modified HIV-1 Env having multi-clade V3 loops and Gag, and IL-2. Sequences encoding V3 loop from clade B, A, C, D, E, F, and G within Group M of HIV-1 are shown in Figure 48. As shown in Figure
- clade G HBV-1 strain 192RU131.9
- DNA sequence encoding V3 loop, nt 885-989 [SEQ ID NO: 31] was chosen.
- V3 loops from HIV clade A, C, D, E, F, and G were ligated by PCR to form a single fragment containing multiclade V3 loops. Primers for cloning these V3 loops from their cognate HIV clades are listed in Figure 57. Since V3 loop of HIV clade B is already contained in the backbone of HIV-1 gp120, the cloned V3 loops from clade A, C, D, E, F, and G were inserted after V3 loop of clade B.
- Figure 24 illustrate a process for generating the ligated multiclade V3 loops by PCR and subsequent cloning into a construct encoding a modified gp120 of clade B.
- each of the gene fragments encoding the envelope V3 loop region from clade A, C, D, E, F, and G was individually amplified by PCR using a set of forward and reverse primers listed in Figure 57. Parameters for the PCR cycles are the following: denature: 94 °C for 1 min; annealing: 50 to 60 °C for 30 sec; and extension: 72 °C for 1 min; for 20 cycles.
- the PCR product encoding V3 loop of one clade was ligated with another using PCR.
- the PCR products encoding V3 loops of clade A and C were mixed together, ligated and amplified by PCR using the primers 1 and 4 as shown in Figure 24, procuding an A/C fragment.
- a PCR product encoding the ligated V3 loops of clade D and E was generated using primers 5 and 8, producing a D/E fragment; and clade F and G using primers 9 and 12 ( Figure 24), producing a F/G fragment.
- the A/C and D/E fragments were ligated by PCR using primers 1 and 8 and cloned into a vector at EcoRI and BamHI sites.
- the F/G fragment was restriction digested with BamHI and Xbal and fused with the sequence A/C/D/E to generate the multi-clade sequence ACDEFG (V3 m ).
- the final PCR product encoding the multi-clade ACDEFG sequence was restriction digested with Aval (at primer 1 and 12) and re-ligated head-to-tail, yielding the two repeat multiclade sequence 2x V3 m .
- Aval at primer 1 and 12
- V3 m The DNA sequence encoding V3 m or
- DNA sequence encoding Env (nt 5580-8150) from HIV strain BH10 (clade B) was modified by a) deleting the sequence encoding the cleavage site (nt 7101-7112); b) deleting V1 and V2 loops (nt 5961-6161) and inserting nucleotide sequence GGA GCT GGT [SEQ ID NO: 12] that encodes amino acid sequence GAG [SEQ ID NO: 13]; c) inserting the multi-clade V3 loop (V3 m ) sequence at position nt 6572; and d) replacing gp41 transmembrane domain sequence with a GPI anchor sequence encoding glycophosphatidyl inositol, SWLLLLLLSLSLLQATDFMSL [SEQ ID NO: 9].
- the sequnece encoding two repeats of V3 m sequence (2xV3 m , constructed above) was inserted into the sequence encoding the modified Env described in section 9) above.
- the resulting shuttle vector is designated pLAd-E m .2xV3 and is shown in Figure 26.
- the Pr55 Gag protein can be processed into four different proteins, p17MA, p24CA, p7NC, and p6.
- the p17MA protein remains associated with the inner side of the lipid envelope, and plays an important role in anchoring of envelope to the viral particle.
- the p24CA protein of all retrovimses contains a major homology region (MHR) that is required for efficient viral replication and particle production. Elispot data obtained implicates that p17MA (or p17) and p24CA (or p24) may have contributed significantly the specific CTL response in the Pr55 gag protein in peptide mapping experiments. According to the present invention, these HIV structural proteins are expressed by the recombinant virus to elicit specific CTL response to HIV infection.
- these structure proteins can be modified to include a signal peptide (e.g., the HIV gp120 signal peptide encoded by SEQ ID NO: 74: atgagagtgaaggagaaatatcagcacttgtggagatgggggtggagatggggcaccatgctccttggga tgttgatgatctgtagtgct) sequence which facilitates the secretion of these intracellular proteins by the infected cells.
- a signal peptide e.g., the HIV gp120 signal peptide encoded by SEQ ID NO: 74: atgagagtgaaggagaaatatcagcacttgtggagatgggggtggagatggggcaccatgctccttggga tgttgatctgtagtgct sequence which facilitates the secretion of these intracellular proteins by the infected cells.
- a membrane anchoring domain e.g, the HIV gp41 transmembrane domain encoded by SEQ ID NO: 75: ttattcataatgatagtaggaggcttggtaggtttaagaatagttttttgctgtactttctgtagtgaatagagttagg cagggatattcaccattatcgtttcagacccacctcccaatcccgagggga
- a modified HIV structural protein is rendered membrane bound, which better presents the HIV antigen to the body's immune system.
- Adenoviral shuttle vectors were constructed to encode the processed Gag proteins, p17, p24, and p17/24, each in three different forms: natural form, secreted form and membrane bound form.
- DNA sequences of p17 in the three forms [SEQ ID NOs: 40-42] are shown in Figure 51A (corresponding amino acid sequences [SEQ ID NOs: 43- 45], Figure 51 B) and were each inserted into E4 region of the adenoviral genome using a shuttle vector, resulting in shuttle vector pRAd-ORF6-p17 (natural form, Figure 28A), pRAd-ORF6-p17sec (secreted form, Figure 28B), and pRAd-ORF6-p17MB (membrane-bound form, Figure 28C), respectively.
- DNA sequences of p24 in the three forms [SEQ ID NOs: 46-48] are shown in Figure 52A (corresponding amino acid sequences [SEQ ID NOs: 49-
- Figures 30A-B illustrate the construction of a recombinant adenoviral vector encoding modified Env containing two copies of multi-clade V3 loops and p17/p24 in membrane-bound form.
- pLAd-E m .2xV3 m tails of the vector shown in Figure 26
- pRAd-ORF6- p17/24MB tails of the vector shown in Figure 27C
- Figures 31A-B illustrate the construction of a recombinant adenoviral vector encoding modified Env containing two copies of multi-clade V3 loops and p17 in membrane-bound form.
- pLAd- E m .2xV3 m (details of the vector shown in Figure 26)
- Figures 32A-B illustrate the construction of a recombinant adenoviral vector encoding modified Env containing two copies of multi-clade V3 loops and p24 in membrane-bound form.
- pLAd- E m .2xV3 m (details of the vector shown in Figure 26)
- pRAd-ORF6-p24MB (details of the vector shown in Figure 29C) were linearized using EcoRI and
- Ad-E m ⁇ C ⁇ T 300 .2xV3 m .T./p17/24sec DNA sequence encoding Env (including Tat1 (nt 5189-5403) and Tat2 (7734-7779)) from HIV strain BH10 was modified by a) deleting the sequence encoding the cleavage site (nt 7101-7112); b) deleting V1 and V2 loops (nt 5961-6161) and inserting nucleotide sequence GGA GCT GGT [SEQ ID NO: 12] that encodes amino acid sequence GAG [SEQ ID NO: 13]; c) inserting two copies of the multi-clade V3 loop (2xV3 ) sequence at position nt 6572; and d) deleting the cytosolic domain of 100 amino acids in length (encoded by nucleotide at position 7850-8150).
- Tat2 (7734-7779) and Rev2 (7734-8008)) from HIV strain BH10 was modified by a) deleting the sequence encoding the cleavage site (nt 7101-7112); b) deleting V1 and V2 loops (nt 5961-6161) and inserting nucleotide sequence GGA GCT GGT [SEQ ID NO: 12] that encodes amino acid sequence GAG [SEQ ID NO: 13]; c) inserting two copies of the multiclade V3 loop (2xV3 m ) sequence at position nt 6572; and d) deleting the cytosolic domain of 33 amino acids in length (nt 8687-8785).
- Gag protein may play significant roles in eliciting CTL response in animals immunized with the adenoviral vectors of the present invention.
- DNA sequence encoding the protease (PI, DNA SEQ ID NO: 56, Figure 55A; amino acid SEQ ID NO: 57, Figure 55B) from the pol region of HIV strain
- BH10 was inserted into a region downstream from the sequence encoding Gag in a shuttle vector pRAd-ORF6-G.PI ( Figure 35). As illustrated in Figure 35, Gag and PI are expressed separately from a CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SAi and SA 2 / SA 3 .
- SD retroviral splicing donor
- SA acceptor
- the HIV protease PI was expressed as a fusion protein with Gag by inserting a C residue at position nt1410 to allow pol to be read within the same reading frame of gag.
- DNA [SEQ ID NO: 58] and amino acid [SEQ ID NO: 59] sequences of the Gag-PI fusion protein are shown in Figures 56A and 56B, respectively.
- Gag and PI are expressed from the same CMV promoter within the same reading frame.
- the resulting shuttle vector is designated as pRAd-ORF6/G-PI. Both pLAd-E m ⁇ C ⁇ T 300 .2xV3 m .T ( Figure 33) and pRAd-ORF6/G-PI
- Figure 36 were linearized using appropriate restriction enzymes and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector Ad-E m ⁇ C ⁇ T 300 .2xV3 m .T/G-PI.
- DNA sequence encoding the protease (PI) and reverse transcriptase (RT) from the pol region of HIV strain BH10 was inserted into a region downstream from the sequence encoding Gag in a shuttle vector pRAd- ORF6-Gag/PI-RT ( Figure 58).
- Gag and PI-RT are expressed separately from a CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SA-i and SA 2 / SA 3 .
- SD retroviral splicing donor
- SA acceptor
- the right shuttle vector pRAd-ORF6-Gag/PI-RT can be combined with any of the left shuttle vector (pLAd) described above to generate a recombinant adenoviral vector.
- PI-RT was expressed as a fusion protein with Gag by inserting a C residue at position nt1410 to allow pol to be read within the same reading frame of gag.
- Gag and PI-RT are expressed from the same CMV promoter within the same reading frame.
- the resulting shuttle vector is designated as pRAd-ORF6-Gag-PI-RT.
- the right shuttle vector pRAd-ORF6-Gag-PI-RT can be combined with any of the left shuttle vector (pLAd) described above to generate a recombinant adenoviral vector.
- DNA sequence encoding the HIV enzymes PI, RT and IN from the pol region of HIV strain BH10 was inserted into a region downstream from the sequence encoding Gag in a shuttle vector pRAd-ORF6-Gag/Pol (Figure 60).
- Gag and Pol are expressed separately from a CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SAi and SA 2 / SA 3 .
- SD retroviral splicing donor
- SA acceptor
- the right shuttle vector pRAd-ORF6-Gag/Pol can be combined with any of the left shuttle vector (pLAd) described above to generate a recombinant adenoviral vector.
- pRAd-ORF6-Gag-Pol was expressed as a fusion protein with Gag by inserting a C residue at position nt1410 to allow pol to be read within the same reading frame of gag. As illustrated in Figure 61, Gag and Pol are expressed from the same CMV promoter within the same reading frame. The resulting shuttle vector is designated as pRAd-ORF6-Gag-Pol.
- the right shuttle vector pRAd-ORF6-Gag-Pol can be combined with any of the left shuttle vector (pLAd) described above to generate a recombinant adenoviral vector.
- Ad.tat.env.IL2 also designated as "Ad-E.T.R/IL2" as described above, section A, subsection 1
- Immunogenicity of the adenoviral vector was determined by measuring titers of antibody against HIV tat and env.
- FIGS. 6 and 7 show the immunogenicity of Ad.tat.env.IL2 against the HIV Env protein in two groups of mice, respectively. These groups of C57BL/6 mice (supplied by Charles River Laboratories. Wilmington, MA) were injected intramuscularly with 10 7 pfu Ad.tat.env.IL2 on different dates as indicated in the figures. Blood (about 150-500 ⁇ l for each animal) was collected from four animals every two weeks following inoculation and serum was prepared. At 77 days post-inoculation, these mice were re-challenged with an additional 10 7 pfu of Ad.tat.env.IL2. Blood was collected from three animals every day following secondary challenge. Titers of antibody elicited against HIV tat and env were determined by ELISA against Ad.tat.env.IL2- infected HeLa cell lysates.
- lysates of the HeLa cells infected with Ad.tat.env.IL2 were prepared as follows. HeLa cells were infected with Ad.tat.env.IL2 at a multiplicity of infection (MOI) of 20. Fourty-eight hours post infection, HeLa cells were harvested and resuspended in a buffer that contained 1% TritonX- 100. A post-nuclear supernatant was obtained by centrifuging the lysates at 15,000 x g for 5 min. The lysates were diluted to 10 ⁇ g/ml for coating wells of ELISA plates. Standard ELISA assays were performed to measure OD450 of the sera and relative titers of antibody against HIV tat and env proteins were calculated by normalizing against the mean of the CD450 of mouse pre- immunization sera.
- MOI multiplicity of infection
- the three mice in this group had strong immune responses to the HIV antigens expressed by the adenoviral vector Ad.tat.env.IL2, with the highest titer of antibody against HIV antigens reached in about 42 days post inoculation.
- the second inoculation with Ad.tat.env.IL2 boosted the immune reponse again and very high titers were achieved within about 5 days of the second inoculation.
- mice in this group also had strong immune responses to the HIV antigens expressed by the adenoviral vector
- FIGS. 12 A-B show the antibody production elicited by the recombinant adenoviral vectors Ad.3C.env.gag (also designated as "Ad- 3C/E m ⁇ C ⁇ T 300 -G" as described above, section A, subsection 2)) in mice.
- C57BL/6 mice were injected intramuscularly with 10 7 pfu Ad.3C.env.gag.
- At 77 days post-inoculation these mice were re-challenged with an additional 10 7 pfu Ad.3C.env.gag.
- Relative antibody titers of these mice were determined by
- FIGs 13 A-B show the antibody production elicited by the recombinant adenoviral vectors Ad.3C.env.rev.gag (also designated as "Ad- 3C/E m ⁇ C ⁇ T 99 .T.R-G" as described above in section A, subsection 3)) in mice.
- C57BL/6 mice were injected intramuscularly with 10 7 pfu Ad.3C.env.rev.gag. At 77 days post-inoculation, these mice were re-challenged with an additional
- CTL cytotoxic T lymphocytes
- cytotoxic T lymphocytes CTL
- adenoviral vaccine against HIV antigens Activation of cytotoxic T lymphocytes (CTL) by immunization with the adenoviral vaccine against HIV antigens was measured by using two independent assays: an IFN ⁇ assay and a granzyme A assay.
- the IFN ⁇ and granzyme assays were designed to detect antigen-specific activation of T- cells.
- IFN ⁇ is secreted by activated CTL and T H 1 helper T cells which function specifically in the cellular immune pathway.
- Granzyme A is also secreted by activated CTL.
- the basic approach is to incubate splenocytes with target cells that express antigens of interest and look for secretion of IFN ⁇ or granzyme A into the medium.
- This assay is a modification of the standard 51 Cr-release lytic assay (Current Protocols in Immunology, Coligan et al., eds.) except that the target cells are not radiolabeled prior to incubation with the splenocytes. Detailed procedures for this assay are described in Di Fabio et al. (1994) "Quantitation of human influenza virus-specific cytotoxic T lymphocytes: correlation of cytotoxicity and increased numbers of IFN-gamma-(or IFN ⁇ -) producing CD8+ T cells" Int. Immunol. 6:11-9.
- splenocytes were incubated with 10 5 target cells (e.g., infected with appropriate viruses carrying the target antigens) in a total volume of .100 ⁇ l. Cells were incubated for 4h at 37°C. IFN ⁇ was measured by ELISA from 25 ⁇ l medium.
- target cells e.g., infected with appropriate viruses carrying the target antigens
- Activation of CTL in mice inoculated with the adenoviral vaccine against HIV antigens was determined by using the IFN ⁇ assay described above. Briefly, twelve C57BL/6 mice were injected intramuscularly with 10 7 pfu Ad.tat.env.IL2. Spleens were harvested from 4 inoculated mice at the time points indicated in Figures 8A-C. Splenocytes were activated by incubation with B16-F1 cells (a melanoma cell line from C57BL/6, ATCC No: CRL-6323) that had been infected with Ad.tat.env.IL2. At day seven after stimulation, activated splenocytes were mixed with B16-F1 cells infected with the indicated viruses. IFN ⁇ secretion into the medium was determined by ELISA (R&D Systems, Minneapolis, MN).
- Figures 8A-C show percent increases in the amount of IFN ⁇ secreted into the medium over the period of time ranging from 4-8 weeks post inoculation.
- secretion of IFN ⁇ increased significantly in splenocytes of the four mice harvested 4 weeks post inoculation with Ad.tat.env.IL2.
- little increase in IFN ⁇ secretion occurred when the splenocytes were incubated with B16-F1 cells infected with an adenoviral vector expressing non-specifc protein ⁇ -Gal (Ad.lacZ) or uninfected B16-F1 cells.
- Granzyme A assay was performed using a protocol modified from the one described in Deitz et al. (2000) "MHC l-dependent antigen presentation is inhibited by poliovirus protein 3A" Proc. Natl. Acad. Sci. 97:13790-13795.
- the granzyme A assay described in Deitz et al. was a modification of a protocol described in: Kane et al. (1989) "Cytolytic T-lymphocyte response to isolated class I H-2 proteins and influenza peptides" Nature (London)
- Granzyme A Assays were performed following similar procedures as for IFN ⁇ assays with the following exceptions.
- Granzyme A secretion into the medium was determined by an enzymatic assay.
- Units of granzyme A were determined by calculating the slope of activity during the linear phase of the reaction.
- One unit of granzyme A was defined as the amount of enzyme required to convert the substrate to 1 OD 405 in one hour.
- BLT N- ⁇ -benzyloxycarbonyl-L-lysinethiobenzyl ester, Sigma, St. Louis, MO
- 0.22 mM DTNB 5,5'-dithio-bis(2-nitrobenzoicacid, Sigma, St. Louis, MO)
- Absorbance at 405 nm was monitored over a period of several hours.
- Slopes of enzyme activity were determined for the linear phase of the reaction and converted to units of enzyme.
- Figure 9 shows increases in the amount of granzyme A secreted into , the medium for splenocytes of mice harvested 8 weeks post inoculation. As shown in Figure 9, secretion of granzyme A increased significantly in splenocytes of the four mice harvested 8 weeks post inoculation with
- Ad.tat.env.IL2 In contrast, much less granzyme A secretion occurred when the splenocytes were incubated with B16-F1 cells infected with an adenoviral vector expressing non-specifc protein ⁇ -Gal (Ad.lacZ), an adenoviral vector expressing both hepatitis B surface antigen and IL-2 (Ad.HBsAg/IL2) or uninfected B16-F1 cells. Similarly, there is little spontaneous granzyme A secrection in these splenocytes not incubated with the target cells.
- Figure 14A shows the results of the granzyme A assays for series 1 mice at various time points indicated, including week 4, 6, 8 post-immunization and week 12/1 , 13/2, 14/3 (prime/boost) post-secondary inoculation with
- Figure 14B shows the results of the granzyme A assays for series 2 mice at various time points indicated, including week 2, 4, 6, 8 post- immunization with Ad.3C.env.gag.
- ELISPOT assays were performed to determine CTL activation in mice inoculated with the recombinant adenoviral vectors, Ad.3C.env.gag and
- Ad.3C.env.gag.rev. C57BL/6 mice were inoculated with 10 7 pfu Ad.3C.env.gag or Ad.3C.env.gag.rev. Mice were sacrificed at two-week intervals and splenocytes were prepared (see Current Protocols in Immunology, Coligan et al. eds.). At week 11 , mice were inoculated with a second dose of 10 7 pfu of Ad.3C.env.gag or Ad.3C.env.gag.rev.
- IFN ⁇ spots were visualized as per the kit instructions and counted. Wild type and recombinant vaccinia viruses were obtained from the NIH AIDS Research and Reference Reagent Program, Bethesda, MD.
- Figures 15A shows the ELISPOT results for the four mice in memoril at week 13/2 post-prime/boost with Ad.3C.env.gag.
- Figures 15B shows the ELISPOT results for the four mice in memoril at week 13/2 post-prime/boost with Ad.3C.env.rev.gag.
- Embodiments of the genetic vaccine against hepatitis B virus and methods of their construction are described in detail as follows.
- Ad. HBsAg. IL2 Ad. HBsAg. IL2
- Ad. HBcAg. IL2 Ad. HBcAg. IL2
- HBsAg hepatitis B surface antigen
- HBcAg HBV core antigen
- DNA sequence encoding interleukin-2 (IL-2) was also included and expressed by a promoter different from that for expressing the viral antigen. This design is believed to be able to ensure high level expression of both the viral antigens and the immuno-stimulator IL-2 and to enhance immunogenicity of the adenoviral vaccine. As shown by experimental data presented in the next section, both of these two adenoviral vectors are capable of eliciting strong and long-lasting immune responses in animals against hepatitis B antigens.
- IL-2 interleukin-2
- Ad. HBsAg. IL2 Ad. HBcAg. IL2
- Ad. HBcAg. IL2 Ad. HBcAg. IL2
- HBsAg (with a silent mutation caused by deletion of Xba I site) was inserted into the left end (E1 region) of the adenoviral genome using a shuttle vector pLAd ( Figure 4A, left side), resulting in a shuttle vector pLAd-CMV-HBsAg.
- IL-2 (with a silent mutation caused by deletion of Xba I site) was inserted into E4 region of the adenoviral genome using the shuttle vector pRAd ( Figure 4A, right side), resulting in a shuttle vector pRAd- CMV-IL2.
- Both pLAd-CMV-HBsAg and pRAd-CMV-IL2 were linearized using appropriate restriction enzymes such as Xba I and EcoRI and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector designated Ad. HBsAg. IL2.
- HBsAg and HBcAg are expressed separately from another CMV promoter via a retroviral splicing donor (SD) and acceptor (SA) mechanism at two splicing acceptor sites, SAi and SA 2 .
- SD retroviral splicing donor
- SA acceptor
- the shuttle vector produced is designated pLAd-CMV-SD/SA HBsAg-SA 2 -HbcAg.
- Both pLAd-CMV-SD/SA r HBsAg-SA 2 -HbcAg and pRAd-CMV-SD/SA IL2-SA 2 - INF ⁇ -SA 3 -GMCSF were linearized using appropriate restriction enzymes such as Xba I and EcoRI and ligated to the backbone of the adenovirus ( Figure 4B), resulting in the recombinant adenoviral vector designated Ad. HBcAg. IL2.
- mice were inoculated with the adoviral vaccine constructed above, Ad. HBsAg. IL2 and Ad. HBcAg. IL2, to elicit immune response to the hepatitis B surface antigen and core antigen expressed by these two vectors, respectively. Immunogenicity of these adenoviral vectors was determined by measuring titers of antibodies against HBsAg and HbcAg, respectively.
- HBV surface antigen (HBsAg) antibody titers CD-1 mice (Charles River Laboratories, Wilmington, MA) were injected intramuscularly with several different concentrations of Ad. HBsAg. IL2: 10°, 1x10 6 , 1x10 7 , 1x10 s , 5 x 10 5 , 5 x 10 6 , and 5 x 10 7 pfu virus.
- Figure 10A shows the relative Anti-HBsAg antibody titers measured for sera harvested from mice inoculated with 1 x 10 5 and 5 x 10 5 pfu. Serum in each measurement was diluted 1 :500.
- Figure 10B shows the relative Anti-HbsAg antibody titers measured for sera harvested from mice inoculated with 1x10 7 and 1x10 8 pfu. Serum in each measurement was diluted 1 :1500.
- Relative anti-HBsAg titers were determined by ELISA against recombinant HBsAg purified from yeast (from Aldevron, LLC, Fargo, ND). As shown in Figure 10A, the mice in group 1 had increasingly strong immune responses to HBsAg expressed by the adenoviral vector, Ad. HBsAg. IL2, within 8 weeks post inoculation. This vector with a titer as low as 5 x 10 5 pfu was sufficient to elicit high levels of antibody specifically against HBsAg.
- FIG 10B shows the immunogenicity of Ad. HBsAg. IL2 with higher titers. As shown in Figure 10B, immunogenicity of Ad. HBsAg. IL2 increased dramatically as the titer of the adenoviral vector was increased from 1 x 10 7 pfu to 1x 10 8 pfu.
- HBV core antigen (HBcAg) antibody titers Groups of C57BL/6 mice (Charles River Laboratories, Wilmington, MA) were injected intramuscularly with 1x10 7 pfu Ad. HBcAg. IL2 on different dates. Blood was collected from four animals every two weeks following inoculation and serum was prepared. At 91 days (Group 3, Figure 11 A) or 84 days (Group 4, Figure 11B) post-inoculation, mice were re-challenged with an additional 1x10 7 pfu virus. Blood was collected from three animals every day following secondary challenge. Antibody titer was determined by ELISA against recombinant HBcAg purified from E. coli (from Chemicon International, Inc., Temecula, CA).
- mice in group 3 had strong immune response to the hepatitis core antigen HBcAg expressed by the adenoviral vector
- mice in group 4 also had strong immune response to the hepatitis core antigen HBcAg expressed by the adenoviral vector Ad. HBcAg. IL2, with the high titer of antibody against HBcAg reached in about 34 days post inoculation.
- the second inoculation with Ad. HBcAg. IL2 boosted the immune reponse again and very high titers were achieved within about 3 days of the second inoculation.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Communicable Diseases (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Oncology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- AIDS & HIV (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP02784374A EP1451329A4 (en) | 2001-11-01 | 2002-11-01 | GENETIC VACCINE AGAINST HUMAN IMMUNODEFICIENCY VIRUS (HIV) |
| JP2003540322A JP2005525085A (ja) | 2001-11-01 | 2002-11-01 | ヒト免疫不全ウイルスに対する遺伝子ワクチン |
| HK06100203.7A HK1077601A1 (zh) | 2001-11-01 | 2002-11-01 | 针对人免疫缺陷病毒的遗传疫苗 |
| CA002465037A CA2465037A1 (en) | 2001-11-01 | 2002-11-01 | Genetic vaccine against human immunodeficiency virus |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US10/003,035 | 2001-11-01 | ||
| US10/003,035 US20020155127A1 (en) | 2000-06-02 | 2001-11-01 | Genetic vaccine against human immunodeficiency virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003038057A2 true WO2003038057A2 (en) | 2003-05-08 |
| WO2003038057A3 WO2003038057A3 (en) | 2003-07-17 |
Family
ID=21703782
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/035112 Ceased WO2003038057A2 (en) | 2001-11-01 | 2002-11-01 | Genetic vaccine against human immunodeficiency virus |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US20020155127A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP1451329A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2005525085A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20050042458A (cg-RX-API-DMAC7.html) |
| CN (1) | CN1636063A (cg-RX-API-DMAC7.html) |
| CA (1) | CA2465037A1 (cg-RX-API-DMAC7.html) |
| HK (1) | HK1077601A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2003038057A2 (cg-RX-API-DMAC7.html) |
| ZA (1) | ZA200403434B (cg-RX-API-DMAC7.html) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005012538A3 (en) * | 2003-08-01 | 2006-01-26 | Us Gov Health & Human Serv | Accelerated vaccination |
| WO2006050394A3 (en) * | 2004-11-01 | 2006-08-24 | Chiron Corp | Combination approaches for generating immune responses |
| WO2007055952A3 (en) * | 2005-11-03 | 2007-09-07 | Wyeth Corp | Process for producing stable hiv th-ctl peptides |
| JP2008507987A (ja) * | 2004-08-05 | 2008-03-21 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | Hiv感染の予防および治療のためのワクチン |
| US8222224B2 (en) | 2006-02-28 | 2012-07-17 | Vaxart, Inc. | Chimeric adenoviral vectors |
| WO2012137071A2 (en) | 2011-04-06 | 2012-10-11 | Biovaxim Limited | Pharmaceutical compositions for preventing and/or treating an hiv disease in humans |
| US8784825B2 (en) | 2008-08-28 | 2014-07-22 | Taiga Biotechnologies, Inc. | Modulators of MYC, methods of using the same, and methods of identifying agents that modulate MYC |
| US8883507B2 (en) | 2005-10-18 | 2014-11-11 | The Regents Of The University Of Colorado | Conditionally immortalized long-term hematopoietic stem cells and methods of making and using such cells |
| US8986702B2 (en) | 2008-05-16 | 2015-03-24 | Taiga Biotechnologies, Inc. | Antibodies and processes for preparing the same |
| US9169462B2 (en) | 2008-07-21 | 2015-10-27 | Taiga Biotechnologies, Inc. | Methods for preparing mature erythrocytes from conditionally immortalized hematopoietic stem cells |
| US9365825B2 (en) | 2013-03-11 | 2016-06-14 | Taiga Biotechnologies, Inc. | Expansion of adult stem cells in vitro |
| US9789135B2 (en) | 2012-07-20 | 2017-10-17 | Taiga Biotechnologies, Inc. | Enhanced reconstitution and autoreconstitution of the hematopoietic compartment |
| US10272115B2 (en) | 2013-03-11 | 2019-04-30 | Taiga Biotechnologies, Inc. | Production and use of red blood cells |
| RU2722648C2 (ru) * | 2018-11-16 | 2020-06-02 | федеральное государственное бюджетное учреждение "Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи" Министерства здравоохранения Российской Федерации | Способ проверки иммуногенности вакцинных антигенов для получения высокоэффективных вакцин против опасных инфекций |
| US10864259B2 (en) | 2017-08-03 | 2020-12-15 | Taiga Biotechnologies, Inc. | Methods and compositions for the treatment of melanoma |
| US11027009B2 (en) | 2008-04-04 | 2021-06-08 | The Trustees Of The University Of Pennsylvania | Vaccines and immunotherapeutics using IL-28 and compositions and methods of using the same |
| US11116796B2 (en) | 2016-12-02 | 2021-09-14 | Taiga Biotechnologies, Inc. | Nanoparticle formulations |
| EP3897691A4 (en) * | 2018-12-21 | 2022-08-31 | The Regents of the University of California | IL-10 CONTAINING VACCINES AND THEIR USES |
| US12250943B2 (en) | 2019-04-08 | 2025-03-18 | Htyr Acquisition Llc | Compositions and methods for the cryopreservation of immune cells |
| US12370217B2 (en) | 2019-05-14 | 2025-07-29 | Htyr Acquisition Llc | Compositions and methods for treating T cell exhaustion |
Families Citing this family (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6733993B2 (en) * | 2000-09-15 | 2004-05-11 | Merck & Co., Inc. | Enhanced first generation adenovirus vaccines expressing codon optimized HIV1-gag, pol, nef and modifications |
| US20040101957A1 (en) * | 2001-09-14 | 2004-05-27 | Emini Emilio A. | Enhanced first generation adenovirus vaccines expressing codon optimized hiv1-gag, pol.nef and modifications |
| EP1784493A2 (en) * | 2004-09-01 | 2007-05-16 | The Government of the United States of America as Represented by The Department of Health and Human Services | Adenoviral vectors able to transduce apcs, potential use in immune response generation |
| CN102220357B (zh) * | 2004-11-16 | 2013-12-25 | 克鲁塞尔荷兰公司 | 包含重组病毒载体的多价疫苗 |
| US8450055B2 (en) * | 2005-08-31 | 2013-05-28 | The United States Of America As Represented By The Secretary Of The Navy | Malaria antigen screening method |
| BRPI0615400A2 (pt) * | 2005-08-31 | 2011-05-17 | Genvec Inc | vacinas para malária baseadas em vetor adenoviral |
| WO2007134325A2 (en) * | 2006-05-15 | 2007-11-22 | Introgen Therapeutics, Inc. | Methods and compositions for protein production using adenoviral vectors |
| US20080248060A1 (en) * | 2007-01-09 | 2008-10-09 | Genvec, Inc. | Adenoviral vector-based malaria vaccines |
| CA2709981A1 (en) * | 2007-12-18 | 2009-09-24 | Trustees Of Boston University | Pre- or post-exposure treatment for filovirus or arenavirus infection |
| US20110217328A1 (en) * | 2007-12-18 | 2011-09-08 | Trustees Of Boston University | Compositions and methods for treating ebola virus infection |
| WO2009111738A2 (en) * | 2008-03-06 | 2009-09-11 | Mayo Foundation For Medical Education And Research | Single cycle replicating adenovirus vectors |
| WO2009120306A1 (en) * | 2008-03-25 | 2009-10-01 | Trustees Of Boston University | Multivalent vaccine vector for the treatment and inhibition of viral infection |
| CN101591379B (zh) * | 2008-05-27 | 2017-01-18 | 中国疾病预防控制中心性病艾滋病预防控制中心 | 基于eiav减毒活疫苗的氨基酸突变而构建的抗hiv疫苗 |
| CN102625832A (zh) | 2009-08-24 | 2012-08-01 | 贝勒医学院 | 产生对多种肿瘤抗原或多种病毒特异的ctl细胞系 |
| EP2603799A4 (en) | 2010-08-12 | 2014-02-12 | Clontech Lab Inc | SIDEFLOW ASSAYS FOR NON-DIAGNOSTIC ANALYSIS |
| GB201121308D0 (en) | 2011-12-12 | 2012-01-25 | Cell Medica Ltd | Process |
| WO2013112801A1 (en) * | 2012-01-26 | 2013-08-01 | Ibc Pharmaceuticals, Inc. | Targeting interferon-lambda with antibodies potently enhances anti-tumor and anti-viral activities |
| ES2748652T3 (es) | 2012-02-09 | 2020-03-17 | Baylor College Medicine | Mezclas pep para generar CTL multivíricos con amplia especificidad |
| CN104995299B (zh) * | 2012-12-11 | 2020-02-28 | 宝生物工程株式会社 | 表达盒 |
| GB201301119D0 (en) * | 2013-01-22 | 2013-03-06 | Vaxxit Srl | Viral vaccines |
| EP3077417A1 (en) * | 2013-12-08 | 2016-10-12 | Peptcell Limited | Hiv antigens and antibodies and compositions, methods and uses thereof |
| EP3350600A4 (en) | 2015-09-18 | 2019-04-17 | Baylor College of Medicine | DISTINCTION OF AN IMMUNOGENIC ANTIGEN OF A PATHOGEN AND CORRELATION WITH CLINICAL EFFECTIVENESS |
| TWI746473B (zh) * | 2015-11-02 | 2021-11-21 | 美商辛分子醫藥有限公司 | 針對細胞內抗原之單域抗體 |
| CN107149675A (zh) * | 2016-03-10 | 2017-09-12 | 广东思峰生物科技有限责任公司 | 一种白细胞介素-12的新用途 |
| CN108823232A (zh) * | 2018-04-20 | 2018-11-16 | 中国科学院广州生物医药与健康研究院 | 一种艾滋病疫苗及其制备方法 |
| CN111117974B (zh) * | 2019-12-20 | 2022-02-22 | 华南农业大学 | 一种可视化绿色荧光猪伪狂犬病毒及其构建方法 |
| WO2024048793A1 (ja) * | 2022-09-02 | 2024-03-07 | 国立研究開発法人医薬基盤・健康・栄養研究所 | 感染を治療するための弱毒化ウイルス |
| CN119390828A (zh) * | 2024-12-31 | 2025-02-07 | 天津龙晟生物科技有限公司 | 人类免疫缺陷病毒hiv抗体及其应用和其检测产品 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866136A (en) * | 1986-08-01 | 1999-02-02 | Commonwealth Scientific And Industrial Organisation | Recombinant vaccine |
| US5141867A (en) * | 1987-02-02 | 1992-08-25 | E. I. Du Pont De Nemours And Company | Nucleotide sequence encoding a human immunodeficiency virus antigen |
| US5516657A (en) * | 1992-05-11 | 1996-05-14 | Cambridge Biotech Corporation | Baculovirus vectors for expression of secretory and membrane-bound proteins |
| AU712714B2 (en) * | 1994-10-03 | 1999-11-11 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Enhanced immune response by introduction of cytokine gene and/or costimulatory molecule B7 gene in a recombinant virus expressing system |
| AU2678797A (en) * | 1996-04-22 | 1997-11-12 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Heterologous boosting immunizations |
| CA2378539A1 (en) * | 1999-07-06 | 2001-01-11 | Merck & Co., Inc. | Adenovirus carrying gag gene hiv vaccine |
| US6544780B1 (en) * | 2000-06-02 | 2003-04-08 | Genphar, Inc. | Adenovirus vector with multiple expression cassettes |
-
2001
- 2001-11-01 US US10/003,035 patent/US20020155127A1/en not_active Abandoned
-
2002
- 2002-10-24 US US10/280,915 patent/US20040265336A9/en not_active Abandoned
- 2002-11-01 EP EP02784374A patent/EP1451329A4/en not_active Ceased
- 2002-11-01 KR KR1020047006676A patent/KR20050042458A/ko not_active Abandoned
- 2002-11-01 WO PCT/US2002/035112 patent/WO2003038057A2/en not_active Ceased
- 2002-11-01 HK HK06100203.7A patent/HK1077601A1/zh unknown
- 2002-11-01 JP JP2003540322A patent/JP2005525085A/ja active Pending
- 2002-11-01 CA CA002465037A patent/CA2465037A1/en not_active Abandoned
- 2002-11-01 CN CNA028266110A patent/CN1636063A/zh active Pending
-
2004
- 2004-05-06 ZA ZA200403434A patent/ZA200403434B/en unknown
Non-Patent Citations (2)
| Title |
|---|
| SANCHEZ, A. ET AL., PROC NATL ACAD SCI, vol. 93, no. 8, 1996, pages 3602 - 7 |
| See also references of EP1451329A4 |
Cited By (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7635485B2 (en) | 2003-08-01 | 2009-12-22 | The United States Of America As Represented By The Department Of Health And Human Services | Method of accelerated vaccination against Ebola viruses |
| WO2005012538A3 (en) * | 2003-08-01 | 2006-01-26 | Us Gov Health & Human Serv | Accelerated vaccination |
| US8017130B2 (en) | 2003-08-01 | 2011-09-13 | The United States Of America As Represented By The Department Of Health And Human Services | Method of accelerated vaccination against Ebola viruses |
| AU2004262022B2 (en) * | 2003-08-01 | 2010-10-28 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health & Human Services | Accelerated vaccination |
| JP2011234722A (ja) * | 2004-08-05 | 2011-11-24 | Glaxosmithkline Biologicals Sa | Hiv感染の予防および治療のためのワクチン |
| JP2008507987A (ja) * | 2004-08-05 | 2008-03-21 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | Hiv感染の予防および治療のためのワクチン |
| JP2014239687A (ja) * | 2004-08-05 | 2014-12-25 | グラクソスミスクライン バイオロジカルズ ソシエテ アノニム | Hiv感染の予防および治療のためのワクチン |
| EP2266602A3 (en) * | 2004-11-01 | 2011-08-10 | Novartis Vaccines and Diagnostics, Inc. | Combination approaches for generating immune responses |
| WO2006050394A3 (en) * | 2004-11-01 | 2006-08-24 | Chiron Corp | Combination approaches for generating immune responses |
| US9796961B2 (en) | 2005-10-18 | 2017-10-24 | The Regents Of The University Of Colorado | Conditionally immortalized long-term stem cells and methods of making and using such cells |
| US10760055B2 (en) | 2005-10-18 | 2020-09-01 | National Jewish Health | Conditionally immortalized long-term stem cells and methods of making and using such cells |
| US8883507B2 (en) | 2005-10-18 | 2014-11-11 | The Regents Of The University Of Colorado | Conditionally immortalized long-term hematopoietic stem cells and methods of making and using such cells |
| US9150831B2 (en) | 2005-10-18 | 2015-10-06 | The Regents Of The University Of Colorado | Conditionally immortalized long-term stem cells and methods of making and using such cells |
| WO2007055952A3 (en) * | 2005-11-03 | 2007-09-07 | Wyeth Corp | Process for producing stable hiv th-ctl peptides |
| US8999946B2 (en) | 2006-02-28 | 2015-04-07 | Vaxart, Inc. | Chimeric adenoviral vectors |
| US8222224B2 (en) | 2006-02-28 | 2012-07-17 | Vaxart, Inc. | Chimeric adenoviral vectors |
| US11998598B2 (en) | 2008-04-04 | 2024-06-04 | The Trustees Of The University Of Pennsylvania | Vaccines and immunotherapeutics using IL-28 and compositions and methods of using the same |
| US11027009B2 (en) | 2008-04-04 | 2021-06-08 | The Trustees Of The University Of Pennsylvania | Vaccines and immunotherapeutics using IL-28 and compositions and methods of using the same |
| US8986702B2 (en) | 2008-05-16 | 2015-03-24 | Taiga Biotechnologies, Inc. | Antibodies and processes for preparing the same |
| US10442853B2 (en) | 2008-05-16 | 2019-10-15 | Taiga Biotechnologies, Inc. | Antibodies and processes for preparing the same |
| US9428571B2 (en) | 2008-05-16 | 2016-08-30 | Taiga Biotechnologies, Inc. | Antibodies and processes for preparing the same |
| US11667695B2 (en) | 2008-05-16 | 2023-06-06 | Taiga Biotechnologies, Inc. | Antibodies and processes for preparing the same |
| US9169462B2 (en) | 2008-07-21 | 2015-10-27 | Taiga Biotechnologies, Inc. | Methods for preparing mature erythrocytes from conditionally immortalized hematopoietic stem cells |
| US9775897B2 (en) | 2008-08-28 | 2017-10-03 | Taiga Biotechnologies, Inc. | Modulators of MYC and methods of using the same |
| US8784825B2 (en) | 2008-08-28 | 2014-07-22 | Taiga Biotechnologies, Inc. | Modulators of MYC, methods of using the same, and methods of identifying agents that modulate MYC |
| US12496341B2 (en) | 2008-08-28 | 2025-12-16 | Htyr Acquisition Llc | Methods for reducing anergy in lymphocytes using modulators of MYC |
| US11369678B2 (en) | 2008-08-28 | 2022-06-28 | Taiga Biotechnologies, Inc. | Compositions and methods for modulating immune cells |
| US8828723B2 (en) | 2008-08-28 | 2014-09-09 | Taiga Biotechnologies, Inc. | Modulators of MYC, methods of using the same, and methods of identifying agents that modulate MYC |
| US10556006B2 (en) | 2008-08-28 | 2020-02-11 | Taiga Biotechnologies, Inc. | Compositions and methods for modulating an immune response |
| WO2012137071A2 (en) | 2011-04-06 | 2012-10-11 | Biovaxim Limited | Pharmaceutical compositions for preventing and/or treating an hiv disease in humans |
| EP3000476A1 (en) | 2011-04-06 | 2016-03-30 | Biovaxim Limited | Pharmaceutical compositions for preventing and/or treating an hiv disease in humans |
| US10953048B2 (en) | 2012-07-20 | 2021-03-23 | Taiga Biotechnologies, Inc. | Enhanced reconstitution and autoreconstitution of the hematopoietic compartment |
| US10206952B2 (en) | 2012-07-20 | 2019-02-19 | Taiga Biotechnologies, Inc. | Enhanced reconstitution and autoreconstitution of the hematopoietic compartment |
| US9789135B2 (en) | 2012-07-20 | 2017-10-17 | Taiga Biotechnologies, Inc. | Enhanced reconstitution and autoreconstitution of the hematopoietic compartment |
| US10087420B2 (en) | 2013-03-11 | 2018-10-02 | Taiga Biotechnologies, Inc. | Expansion of adult stem cells in vitro |
| US10786534B2 (en) | 2013-03-11 | 2020-09-29 | Taiga Biotechnologies, Inc. | Production and use of red blood cells |
| US9365825B2 (en) | 2013-03-11 | 2016-06-14 | Taiga Biotechnologies, Inc. | Expansion of adult stem cells in vitro |
| US10272115B2 (en) | 2013-03-11 | 2019-04-30 | Taiga Biotechnologies, Inc. | Production and use of red blood cells |
| US11116796B2 (en) | 2016-12-02 | 2021-09-14 | Taiga Biotechnologies, Inc. | Nanoparticle formulations |
| US12344658B2 (en) | 2016-12-02 | 2025-07-01 | HTYR Acquistion LLC | Nanoparticle formulations |
| US10864259B2 (en) | 2017-08-03 | 2020-12-15 | Taiga Biotechnologies, Inc. | Methods and compositions for the treatment of melanoma |
| RU2722648C2 (ru) * | 2018-11-16 | 2020-06-02 | федеральное государственное бюджетное учреждение "Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи" Министерства здравоохранения Российской Федерации | Способ проверки иммуногенности вакцинных антигенов для получения высокоэффективных вакцин против опасных инфекций |
| EP3897691A4 (en) * | 2018-12-21 | 2022-08-31 | The Regents of the University of California | IL-10 CONTAINING VACCINES AND THEIR USES |
| EP4582440A3 (en) * | 2018-12-21 | 2025-10-08 | The Regents of the University of California | Il-10-containing vaccines and uses thereof |
| US12250943B2 (en) | 2019-04-08 | 2025-03-18 | Htyr Acquisition Llc | Compositions and methods for the cryopreservation of immune cells |
| US12370217B2 (en) | 2019-05-14 | 2025-07-29 | Htyr Acquisition Llc | Compositions and methods for treating T cell exhaustion |
Also Published As
| Publication number | Publication date |
|---|---|
| US20020155127A1 (en) | 2002-10-24 |
| CN1636063A (zh) | 2005-07-06 |
| EP1451329A2 (en) | 2004-09-01 |
| EP1451329A4 (en) | 2005-11-30 |
| US20030219458A1 (en) | 2003-11-27 |
| KR20050042458A (ko) | 2005-05-09 |
| US20040265336A9 (en) | 2004-12-30 |
| JP2005525085A (ja) | 2005-08-25 |
| CA2465037A1 (en) | 2003-05-08 |
| ZA200403434B (en) | 2006-05-31 |
| HK1077601A1 (zh) | 2006-02-17 |
| WO2003038057A3 (en) | 2003-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6964762B2 (en) | Composition and method for stimulating immune response to pathogen using complex adenoviral vector | |
| EP1451329A2 (en) | Genetic vaccine against human immunodeficiency virus | |
| US7754201B2 (en) | Method of vaccination through serotype rotation | |
| US8017130B2 (en) | Method of accelerated vaccination against Ebola viruses | |
| EP2570423A1 (en) | Hepatitis C virus nucleic acid vaccine | |
| Patterson et al. | Potent, persistent induction and modulation of cellular immune responses in rhesus macaques primed with Ad5hr-simian immunodeficiency virus (SIV) env/rev, gag, and/or nef vaccines and boosted with SIV gp120 | |
| JP2003510341A (ja) | 細胞ターゲッティング組成物及びそれらを使用する方法 | |
| Wild et al. | Preclinical evaluation of the immunogenicity of C-type HIV-1-based DNA and NYVAC vaccines in the Balb/C mouse model | |
| AU2007203565B2 (en) | Genetic vaccine that mimics natural viral infection and induces long-lasting immunity to pathogens | |
| AU2002348154A1 (en) | Genetic vaccine against human immunodeficiency virus | |
| Wahren et al. | Therapeutic vaccination against HIV | |
| AU2008207649A1 (en) | Genetic vaccine against human immunodeficiency virus | |
| Young et al. | Elicitation of immunity to HIV type 1 Gag is determined by Gag structure | |
| Singh et al. | HIV vaccine development | |
| against Simian | A Replication-Competent | |
| Thanawastien | Optimizing Vaccine Strategies to Induce HIV-1 Virus-specific Cytotoxic T-lymphocyte Activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2465037 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020047006676 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004/03434 Country of ref document: ZA Ref document number: 2003540322 Country of ref document: JP Ref document number: 200403434 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002348154 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002784374 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1207/CHENP/2004 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20028266110 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002784374 Country of ref document: EP |