WO2003016468A2 - Antagonistic anti-htnfsf13b human antibodies - Google Patents
Antagonistic anti-htnfsf13b human antibodies Download PDFInfo
- Publication number
- WO2003016468A2 WO2003016468A2 PCT/US2002/021842 US0221842W WO03016468A2 WO 2003016468 A2 WO2003016468 A2 WO 2003016468A2 US 0221842 W US0221842 W US 0221842W WO 03016468 A2 WO03016468 A2 WO 03016468A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- seq
- polypeptide
- hcvr
- lcvr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2875—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF/TNF superfamily, e.g. CD70, CD95L, CD153, CD154
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
- C07K2317/53—Hinge
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- the TNF family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including proliferation, cytotoxicity, anti- viral activity, immunoregulatory activities, and the transcriptional regulation of several genes.
- the TNF family of cytokines and receptors has undergone a large expansion in the last few years with the advent of massive EST sequencing.
- TNFSFl 3b is the official name adopted by the TNF Congress for BLyS, TALL-1, BAFF, THANK, neutrokine- ⁇ , and zTNF (for review see Locksley et al. Cell 2001 104:487).
- TNFSFl 3b Human TNFSFl 3b (hTNFSFl 3b) is a 285-amino acid type II membrane-bound protein that possesses a N- terminal cleavage site that allows for the existence of both soluble and membrane bound proteins. Functionally, TNFSFl 3b appears to regulate B cell and some T cell immune responses.
- the present invention provides anti -hTNFSFl 3b human antibodies, or antigen- binding portions thereof.
- the antibodies of the invention are characterized by high affinity binding to TNFSFl 3b polypeptides, slow dissociation kinetics, and the capacity to antagonize at least one in vitro and/or in vivo activity associated with TNFSFl 3b polypeptides.
- the present invention also provides anti-hTNFSF 13b human antibodies comprising a polypeptide selected from the group consisting of a polypeptide as shown in SEQ ID NO: 2, a polypeptide as shown in SEQ ID NO: 4, a polypeptide as shown in SEQ ID NO: 6, a polypeptide as shown in SEQ ID NO: 8, a polypeptide as shown in SEQ ID NO: 10, a polypeptide as shown in SEQ ID NO: 12, a polypeptide as shown in SEQ ID NO: 14, and a polypeptide as shown in SEQ ID NO: 16.
- the invention provides an isolated anti-hTNFSFl 3b human antibody which binds to a hTNFSFl 3b polypeptide and dissociates from the hTNFSFl 3b polypeptide with a K 0 ff rate constant of 1 X 10 ⁇ s" 1 or less, as determined by surface plasmon resonance, or which inhibits TNFSFl 3b induced proliferation in an in vitro neutralization assay with an IC50 of 1 x 10 " M or less.
- the invention provides an isolated anti-hTNFSFl 3b human antibody that has the following characteristics: a) inhibits TNFSFl 3b induced proliferation in an in vitro neutralization assay with an IC 50 of 1 x 10 -8 M or less; b) has a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 16; and c) has a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:
- the invention also provides methods of treating or preventing acute or chronic diseases or conditions associated with B cell and some T cell activity including, but not limited to, autoimmune disorders, such as systemic lupus erythematosus, rheumatoid arthritis, and/or neoplasia comprising the administration of an anti-hTNFSFl 3b human antibody of the present invention.
- autoimmune disorders such as systemic lupus erythematosus, rheumatoid arthritis, and/or neoplasia comprising the administration of an anti-hTNFSFl 3b human antibody of the present invention.
- the present invention provides sequences that encode the novel anti-hTNFSFl 3b human antibodies, vectors comprising the polynucleotide sequences encoding anti-hTNFSFl 3b human antibodies, host cells transformed with vectors incorporating polynucleotides that encode the anti-hTNFSFl 3b human antibodies, formulations comprising anti-hTNFSFl 3b human antibodies and methods of making and using the same.
- the present invention provides the epitope of the antigen to which the novel anti-hTNFSFl 3b human antibodies bind.
- the invention also provides a use of an antibody that binds the epitope of the present invention thereby neutralizing the TNFSFl 3b activity for the treatment or prevention of acute or chronic diseases or conditions associated with B cell and some T cell activity including, but not limited to, autoimmune disorders, such as systemic lupus erythematosus, rheumatoid arthritis, and/or neoplasia.
- the invention also encompasses an article of manufacture comprising a packaging material and an antibody contained within said packaging material, wherein the antibody neutralizes TNFSF 13b activity for treatment or prevention of a human subject suffering from a disorder in which TNFSFl 3b activity is detrimental, and wherein the packaging material comprises a package insert which indicates that the antibody neutralizes by binding an epitope of TNFSF 13b, wherein the epitope comprises lysine at position 71, threonine at position 72, tyrosine at position 73, and glutamic acid at position 105; and a package insert that provides for administration of the dosage form that results in neutralizing TNFSFl 3b activity.
- Fig. 1 Graph illustrating the inhibition of hTNFSFl 3b and IL-1 induced proliferation of Ti l 65.17 cells by human antibody 4A5-3.1.1 -B4.
- Fig. 2. Graph illustrating the neutralization of hTNFSFl 3b induced proliferation by human antibody 4A5-3.1.1-B4 in primary human B cells stimulated with anti-IgM.
- An antibody is an immunoglobulin molecule comprised of four polypeptide chains, two heavy (H) chains (about 50-70 kDa) and two light (L) chains (about 25 kDa) inter-connected by disulfide bonds.
- Light chains are classified as kappa and lambda.
- Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, and define the antibody's isotype as IgG, IgM, IgA, IgD, and IgE, respectively.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR) and a heavy chain constant region.
- HCVR heavy chain variable region
- the heavy chain constant region is comprised of three domains, CHI, CH2, and CH3 for IgG, IgD and IgA, and 4 domains, CHI, CH2, CH3, CH4 for IgM and IgE.
- Each light chain is comprised of a light chain variable region (abbreviated herein as LCNR) and a light chain constant region.
- the light chain constant region is comprised of one domain, CL.
- the HCVR and LCVR regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR).
- Each HCVR and LCVR is composed of three CDRs and four FRs, arranged from amino- terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the assignment of amino acids to each domain is in accordance with well known conventions. [Kabat, et al, Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242 (1991); Chothia, et al, J. Mol. Biol 196:901-917 (1987); Chothia, et al., Nature 342:878- 883 (1989)].
- the functional characteristics of the antibody to bind a particular antigen are determined by the CDRs.
- antibody is intended to refer to a monoclonal antibody per se.
- a monoclonal antibody can be a human antibody, chimeric antibody, humanized antibody, Fab fragment, Fab' fragment, F(ab')2, or single chain FV fragment.
- antibody refers to human antibody.
- human antibody includes antibodies having variable and constant regions corresponding to human germline immunoglobulin sequences.
- Human antibodies have several advantages over non-human and chimeric antibodies for use in human therapy. For example, the effector portion of a human antibody may interact better with the other parts of the human immune system (e.g., destroy the target cells more efficiently by complement-dependent cytotoxicity (CDC) or antibody-dependent cellular cytotoxicity (ADCC)). Another advantage is that the human immune system should not recognize the human antibody as foreign, and, therefore the antibody response against such an injected antibody should be less than against a totally foreign non-human antibody or a partially foreign chimeric antibody.
- injected non-human antibodies have been reported to have a half-life in the human circulation much shorter than the half-life of human antibodies. Injected human antibodies will have a half-life essentially identical to naturally occurring human antibodies, allowing smaller and less frequent doses to be given.
- hTNFSFl 3b refers to the human form of a member of the tumor necrosis factor family of ligands described in international patent applications WO98/18921 and WO00/50597 (referred to therein as neutrokine- ⁇ ).
- the term “TNFSFl 3b” is intended to encompass hTNFSFl 3b as well as homologs of hTNFSFl 3b derived from other species.
- the terms “hTNFSFl 3b” and “TNFSFl 3b” are intended to include forms thereof, which can be prepared by standard recombinant expression methods or purchased commercially (Research Diagnostics Inc. Catalog No. RDI-3113, rhuBAFF, Flanders, N.J.) as well as generated synthetically.
- biological property in reference to an antibody of the present invention are used interchangeably herein and include, but are not limited to, epitope affinity and specificity (e.g., anti- hTNFSFl 3b human antibody binding to hTNFSFl 3b), ability to antagonize the activity of the targeted polypeptide (e.g., TNFSF13b activity), the in vivo stability of the antibody, and the immunogenic properties of the antibody.
- epitope affinity and specificity e.g., anti- hTNFSFl 3b human antibody binding to hTNFSFl 3b
- ability to antagonize the activity of the targeted polypeptide e.g., TNFSF13b activity
- the in vivo stability of the antibody e.g., TNFSF13b activity
- an antibody recognized in the art include, for example, cross- reactivity, (i.e., with non-human homologs of the targeted polypeptide, or with other proteins or tissues, generally), and ability to preserve high expression levels of protein in mammalian cells.
- the aforementioned properties or characteristics can be observed or measured using art-recognized techniques including, but not limited to ELISA, competitive ELISA, surface plasmon resonance analysis, in vitro and in vivo neutralization assays (e.g., Example 2), and immunohistochemistry with tissue sections from different sources including human, primate, or any other source as the need may be.
- ELISA ELISA
- competitive ELISA surface plasmon resonance analysis
- in vitro and in vivo neutralization assays e.g., Example 2
- immunohistochemistry with tissue sections from different sources including human, primate, or any other source as the need may be.
- Particular activities and biological properties of anti-hTNFSFl 3b human antibodies are described in further detail in the Examples
- contact position includes an amino acid position in the CDR1, CDR2 or CDR3 of the heavy chain variable region or the light chain variable region of an antibody which is occupied by an amino acid that contacts antigen. If a CDR amino acid contacts the antigen, then that amino acid can be considered to occupy a contact position.
- Constant substitution or “conservative amino acid substitution” refers to amino acid substitutions, either from natural mutations or human manipulation, wherein the antibodies produced by such substitutions have substantially the same (or improved or reduced, as may be desirable) activity(ies) as the antibodies disclosed herein.
- epitope refers to a region of a protein molecule to which an antibody can bind.
- An "immunogenic epitope” is defined as the part of a protein that elicits an antibody response when the whole protein is the immunogen.
- binding as used herein, generally refers to the interaction of the antibody to the epitope of the antigen. More specifically, the term “binds” relates to the affinity of the antibody to the epitope of the antigen. Affinity is measured by K D .
- inhibitor or “inhibiting” includes the generally accepted meaning, which includes neutralizing, prohibiting, preventing, restraining, slowing, stopping, or reversing progression or severity of a disease or condition.
- TNFSF 13b biological activity can be assessed by measuring one or more in vitro or in vivo indicators of TNFSF 13b biological activity including, but not limited to, TNFSFl 3b-induced proliferation, TNFSF 13b-induced immunoglobulin secretion, TNFSF 13b-induced prevention of B cell apoptosis, or inhibition of receptor binding in a TNFSFl 3b receptor binding assay.
- Indicators of TNFSFl 3b biological activity can be assessed by one or more of the several in vitro or in vivo assays known in the art.
- the several in vitro or in vivo assays known in the art.
- the ability of an antibody to neutralize or antagonize TNFSFl 3b activity is assessed by inhibition of B cell proliferation as shown in Example 2.
- Kof *' is intended to refer to the off rate constant for dissociation of an antibody from the antibody/antigen complex.
- K D is intended to refer to the dissociation constant or the "off rate divided by the "on” rate, of a particular antibody-antigen interaction.
- K D was determined as shown in Example 4
- An “isolated” antibody is one that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non- proteinaceous solutes. Ordinarily, an isolated antibody is prepared by at least one purification step.
- the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, and (2) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue, or preferably, silver stain.
- an "isolated antibody” is an antibody that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds hTNFSFl 3b substantially free of antibodies that specifically bind antigens other than hTNFSFl 3b polypeptide).
- nucleic acid molecule includes DNA molecules and RNA molecules.
- a nucleic acid molecule may be single-stranded or double-stranded, but preferably is double-stranded DNA.
- isolated nucleic acid molecule includes a nucleic acid molecule in which the nucleotide sequences encoding the antibody, or antibody portion, are free of other nucleotide sequences encoding antibodies or antibody fragments that bind antigens other than hTNFSFl 3b polypeptide, which other sequences may naturally flank the nucleic acid in human genomic DNA.
- an isolated nucleic acid of the invention encoding a HCVR region of an anti-hTNFSFl 3b human antibody contains no other sequences encoding HCVR regions that bind antigens other than hTNFSFl 3b polypeptide.
- vector includes a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- plasmid refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
- viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
- vectors e.g., non-episomal mammalian vectors
- vectors can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
- certain vectors are capable of directing the expression of genes to which they are operatively linked.
- Such vectors are referred to herein as "recombinant expression vectors” (or simply, “expression vectors”).
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
- nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
- DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading frame. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites.
- recombinant in reference to an antibody includes antibodies that are prepared, expressed, created or isolated by recombinant means. Representative examples include antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library, antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes or antibodies prepared, expressed, created or isolated by any means that involves splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences.
- recombinant host cell includes a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term “host cell” as used herein.
- Recombinant human antibodies may also be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and, thus, the amino acid sequences of the HCVR and LCVR regions of the recombinant antibodies are sequences that, while derived from those related to human germline HCVR and LCVR sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- Transgenic animals e.g., mice
- mice that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production can be employed.
- Human antibodies can also be produced in phage display libraries
- Container means any receptacle and closure suitable for storing, shipping, dispensing, and/or handling a pharmaceutical product.
- Packaging material means a customer-friendly device allowing convenient administration and/or ancillary devices that aid in delivery, education, and/or administration.
- the packaging material may improve antibody administration to the patient, reduce or improve educational instruction time for the patient, provide a platform for improved health economic studies, and/or limit distribution channel workload.
- the packaging material may include but not be limited to a paper-based package, shrink wrapped package, see-through top packaging, trial-use coupons, educational materials, ancillary supplies, and/or delivery device.
- Package insert means information accompanying the product that provides a description of how to administer the product, along with the safety and efficacy data required to allow the physician, pharmacist, and patient to make an informed decision regarding use of the product, and/or patient education information.
- the package insert generally is regarded as the "label" for a pharmaceutical product.
- a "subject” means a mammal; preferably a human in need of a treatment.
- subjects in need of treatment include mammals that are suffering from, or are prone to suffer from a disorder in which TNFSFl 3b activity is detrimental, for example immune diseases, including autoimmune diseases, and inflammatory diseases.
- Preferred disorders include, but are not limited to, systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, Lyme arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel disease, asthma, allergic diseases, psoriasis, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, infectious diseases, parasitic diseases, female infertility, autoimmune thrombocytopenia, autoimmune thyroid disease, Hashimoto's disease, Sjogren's syndrome, and cancers, particularly B or T cell lymphomas or myelomas.
- the present invention relates to human monoclonal antibodies that are specific for and neutralize bioactive hTNFSFl 3b polypeptides. Also disclosed are antibody heavy and light chain amino acid sequences which are highly specific for and neutralize TNFSFl 3b polypeptides when they are bound to them. This high specificity enables the anti-hTNFSFl 3b human antibodies, and human monoclonal antibodies with like specificity, to be immunotherapy of TNFSFl 3b associated diseases.
- the invention provides an isolated human antibody comprising at least one of the amino acid sequences shown in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, or 16 and that binds a TNFSF 13b polypeptide epitope with high affinity, dissociates from a bound TNFSFl 3b polypeptide with a low K 0 ff rate constant of 1 x 10 "4 s" 1 or less, and has the capacity to antagonize TNFSFl 3b polypeptide activity.
- the anti-hTNFSFl 3b human antibody comprises a polypeptide selected from the group consisting of: CDR1 polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8; CDRl polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises at least two of the polypeptides selected from the group consisting of: CDRl polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8;CDR1 polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises at least three of the polypeptides selected from the group consisting of: CDRl polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8; CDRl polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises at least four of the polypeptides selected from the group consisting of: CDRl polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8; CDRl polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises at least five of the polypeptides selected from the group consisting of: CDRl polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8; CDRl polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises the polypeptides of CDRl polypeptide of the LCVR as shown in SEQ ID NO: 4; CDR2 polypeptide of the LCVR as shown in SEQ ID NO: 6; CDR3 polypeptide of the LCVR as shown in SEQ ID NO: 8; CDRl polypeptide of the HCVR as shown in SEQ ID NO: 12; CDR2 polypeptide of the HCVR as shown in SEQ ID NO: 14; and CDR3 polypeptide of the HCVR as shown in SEQ ID NO: 16.
- the anti-hTNFSFl 3b human antibody comprises a light chain variable region (LCVR) polypeptide as shown in SEQ ID NO: 2 or a heavy chain variable region (HCVR) polypeptide as shown in SEQ ID NO: 10.
- LCVR light chain variable region
- HCVR heavy chain variable region
- the anti- hTNFSFl 3b human antibody comprises the LCVR polypeptide as shown in SEQ ID NO: 2 and the HCVR polypeptide as shown in SEQ ID NO: 10.
- the isolated human antibody dissociates from a bound TNFSFl 3b polypeptide with a K 0 ff rate constant of 5 x 10" 5 s" 1 or less, and inhibits TNFSF 13b induced proliferation in an in vitro neutralization assay with an IC50 of 1 x 10" 7 M or less.
- the isolated human antibody dissociates from a bound TNFSF13b polypeptide epitope with a K 0 ff rate constant of 1 x 10 ⁇ 5 s _1 or less and inhibits TNFSFl 3b induced proliferation in an in vitro neutralization assay with an IC50 of 1 x 10" 8 M or less.
- the isolated anti- TNFSF13b human antibody dissociates from a bound hTNFSFl 3b polypeptide with a K 0 ff rate constant of 5 x 10 "6 s" 1 or less and inhibits TNFSF 13b induced proliferation in an in vitro assay with an IC50 of 1 x 10" 9 M or less.
- anti-hTNFSFl 3b human antibodies that meet, the aforementioned kinetic and neutralization criteria include 4A5-3.1.1-B4 antibodies.
- 4A5-3.1.1-B4 The most preferred anti-hTNFSFl 3b human antibody of the present invention is referred to herein as 4A5-3.1.1-B4.
- 4A5-3.1.1-B4 has LCVR and HCVR polypeptide sequences as shown in SEQ ID NO:2 and SEQ ID NO: 10, respectively.
- the poly- nucleotide sequence encoding the LCVR and HCVR of 4A5-3.1.1 -B4 is shown in SEQ ID NO:l and SEQ ID NO:9, respectively.
- the properties of the anti-hTNFSFl 3b human antibodies of the present invention are specifically disclosed in the Examples. Particularly notable is the high affinity for TNFSFl 3b polypeptide, slow dissociation kinetics, and high capacity to antagonize TNFSFl 3b polypeptide activity demonstrated by 4A5-3.1.1-B4.
- the K 0 ff of an anti-hTNFSFl 3b human antibody can be determined by surface plasmon resonance as generally described in Example 4.
- surface plasmon resonance analysis measures real-time binding interactions between ligand (recombinant TNFSFl 3b polypeptide immobilized on a biosensor matrix) and analyte (antibodies in solution) by surface plasmon resonance (SPR) using the BIAcore system (Pharmacia Biosensor, Piscataway, NJ). SPR analysis can also be performed by immobilizing the analyte (antibodies on a biosensor matrix) and presenting the ligand (recombinant TNFSFl 3b in solution).
- the present invention is also directed to the cell lines which produce the anti-hTNFSFl 3b human antibodies of the present invention.
- the isolation of cell lines producing monoclonal antibodies of the invention can be accomplished using routine screening techniques known in the art.
- a hybridoma which produces an anti- hTNFSFl 3b human antibody of the present invention has been deposited with ATCC, (ATCC PTA-3674) as disclosed herein.
- a wide variety of host expression systems can be used to express the antibodies of the present invention including bacterial, yeast, baculoviral, plant, and mammalian expression systems (as well as phage display expression systems).
- An example of a suitable bacterial expression vector is pUCl 19 (Sfi).
- Other antibody expression systems are also known in the art and are contemplated herein.
- An antibody of the invention can be prepared by recombinant expression of immunoglobulin light and heavy chain genes in a host cell.
- a host cell is transfected with one or more recombinant expression vectors carrying DNA fragments encoding the immunoglobulin light and heavy chains of the antibody such that the light and heavy chains are expressed in the host cell.
- the recombinant antibodies are secreted into the medium in which the host cells are cultured, from which medium the antibodies can be recovered. Standard recombinant DNA methodologies are used to obtain antibody heavy and light chain genes, incorporate these genes into recombinant expression vectors, and introduce the vectors into host cells.
- the isolated DNA encoding the HCVR region can be converted to a full-length heavy chain gene by operatively linking the HCVR-encoding DNA to another DNA molecule encoding heavy chain constant regions (CHI , CH2, and CH3).
- the DNA sequences of human heavy chain constant region genes are known in the art and DNA fragments encompassing these regions can be obtained by standard PCR amplification.
- the heavy chain constant region can be an IgGl, IgG2, IgG3, IgG4, IgA, IgE, IgM or IgD constant region and any allotypic variant therein as described in Kabat, (Kabat, et al, Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of
- the antibody portion can be an Fab fragment, a Fab' fragment, F(ab')2, or a single chain FV fragment.
- the HCVR-encoding DNA can be operatively linked to another DNA molecule encoding only the heavy chain CHI constant region.
- the isolated DNA encoding the LCVR region can be converted to a full-length light chain gene (as well as a Fab light chain gene) by operatively linking the LCVR- encoding DNA to another DNA molecule encoding the light chain constant region, CL.
- the DNA sequences of human light chain constant region genes are known in the art and DNA fragments encompassing these regions can be obtained by standard PCR amplification.
- the light chain constant region can be a kappa or lambda constant region.
- the HCVR- and LCVR-encoding DNA fragments are operatively linked to another fragment encoding a flexible linker, e.g., encoding the amino acid sequence Gly-Gly-Gly-Gly-Ser- Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Gly-Ser (Gly4- Ser)3, such that the HCVR and LCVR sequences can be expressed as a contiguous single- chain protein, with the LCVR and HCVR regions joined by the flexible linker (see e.g., Bird et al. Science 242:423-426 (1988); Huston, et al, Proc. Natl. Acad Sci. USA 85:5879-5883 (1988); McCafferty, et al, Nature 348:552-554 (1990)).
- a flexible linker e.g., encoding the amino acid sequence Gly-Gly-Gly-Gly-Ser
- DNAs encoding partial or full-length light and heavy chains, obtained as described above, are inserted into expression vectors such that the genes are operatively linked to transcriptional and translational control sequences.
- the antibody gene is ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the antibody gene.
- the expression vector and expression control sequences are chosen to be compatible with the expression host cell used.
- the antibody light chain gene and the antibody heavy chain gene can be inserted into separate vector or, more typically, both genes are inserted into the same expression vector.
- the antibody genes are inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the antibody gene fragment and vector, or blunt end ligation if no restriction sites are present).
- the recombinant expression vector can encode a signal peptide that facilitates secretion of the anti-hTNFSFl 3b human antibody chain from a host cell.
- the anti-hTNFSFl 3b human antibody chain gene can be cloned into the vector such that the signal peptide is linked in-frame to the amino terminus of the antibody chain gene.
- the signal peptide can be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).
- the recombinant expression vectors of the invention carry regulatory sequences that control the expression of the antibody chain genes in a host cell.
- Regulatory sequences comprise promoters, enhancers and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation of the antibody chain genes.
- expression control elements e.g., polyadenylation signals
- Preferred regulatory sequences for mammalian host cell expression include viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from cytomegalovirus (CMV) (such as the CMV promoter/enhancer), Simian Virus 40 (SV40) (such as the SV40 promoter/enhancer), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)) and polyoma.
- CMV cytomegalovirus
- SV40 Simian Virus 40
- AdMLP adenovirus major late promoter
- the recombinant expression vectors of the invention may carry additional sequences, such as sequences that regulate replication of the vector in host cells (e.g., origins of replication) and selectable marker genes.
- the selectable marker gene facilitates selection of host cells into which the vector has been introduced.
- the selectable marker gene confers resistance to drugs, such as G418, hygromycin, or methotrexate, on a host cell into which the vector has been introduced.
- Preferred selectable marker genes include the dihydrofolate reductase (DHFR) gene (for use in dhfr-host cells with methotrexate selection/amplification) and the neo gene (for G418 selection).
- DHFR dihydrofolate reductase
- the expression vector(s) encoding the heavy and light chains is transfected into a host cell by standard techniques.
- the various forms of the term "transfection" are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection and the like.
- eukaryotic cells eukaryotic cells
- expression of antibodies in eukaryotic cells, and most preferably mammalian host cells is the most preferred because such eukaryotic cells, and in particular mammalian cells, are more likely than prokaryotic cells to assemble and secrete a properly folded and immunologically active antibody.
- Preferred mammalian host cells for expressing the recombinant antibodies of the invention include Chinese Hamster Ovary (CHO cells) (including dhfr-CHO cells, described in Uriaub and Chasin, Proc. Natl. Acad. Sci.
- DHFR selectable marker e.g., as described in R.J. Kaufman and P.A. Sharp, Mol. Biol, 159:601-621 (1982)
- NS0 myeloma cells COS cells and SP2 cells.
- the antibodies are produced by culturing the host cells for a period of time sufficient to allow for expression of the antibody in the host cells or, more preferably, secretion of the antibody into the culture medium in which the host cells are grown.
- Antibodies can be recovered from the culture medium using standard protein purification methods.
- Host cells can also be used to produce portions of intact antibodies, such as Fab fragments of scFV molecules. It will be understood that variations on the above procedure are within the scope of the present invention. For example, it may be desirable to transfect a host cell with DNA encoding either the light chain or the heavy chain (but not both) of an antibody of this invention. Recombinant DNA technology may also be used to remove some or all of the DNA encoding either or both of the light and heavy chains that is not necessary for binding to hTNFSFl 3b. The molecules expressed from such truncated DNA molecules are also encompassed by the antibodies of the invention.
- a recombinant expression vector encoding both the antibody heavy chain and the antibody light chain is introduced into dhfr-CHO cells by calcium phosphate-mediated transfection.
- the antibody heavy and light chain genes are each operatively linked to enhancer/promoter regulatory elements (e.g., derived from SV40, CMV, adenovirus and the like, such as a CMV enhancer/AdMLP promoter regulatory element or an SV40 enhancer/AdMLP promoter regulatory element) to drive high levels of transcription of the genes.
- enhancer/promoter regulatory elements e.g., derived from SV40, CMV, adenovirus and the like, such as a CMV enhancer/AdMLP promoter regulatory element or an SV40 enhancer/AdMLP promoter regulatory element
- the recombinant expression vector also carries a DHFR gene, which allows for selection of CHO cells that have been transfected with the vector using methotrexate selection/amplification.
- the selected transformant host cells are culture to allow for expression of the antibody heavy and light chains and intact antibody is recovered from the culture medium. Standard molecular biology techniques are used to prepare the recombinant expression vector, transfect the host cells, select for transformants, culture the host cells and recover the antibody from the culture medium.
- Antibodies or antigen-binding portions thereof of the invention can be expressed in an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see e.g., Taylor, L.D., et ⁇ l Nucl. Acids Res., 20:6287-6295(1992)).
- Plant cells can also be modified to create transgenic plants that express the antibody or antigen binding portion thereof, of the invention.
- nucleic acids, vectors, and host cell compositions that can be used for recombinant expression of the antibodies and antibody portions of the invention.
- the invention features isolated nucleic acids that encode CDRs of 4A5-3.1.1-B4, or the full heavy and/or light chain variable region of 4A5-3.1.1-B4.
- the invention features an isolated nucleic acid encoding an antibody heavy chain variable region that encodes the 4A5-3.1.1 -B4 heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 16.
- the nucleic acid encoding the antibody heavy chain variable region further encodes a 4A5-3.1.1-B4 heavy chain CDR2 which comprises the amino acid sequence of SEQ ID NO: 14. More preferably, the nucleic acid encoding the antibody heavy chain variable region further encodes a 4A5-3.1.1-B4 heavy chain CDRl which comprises the amino acid sequence of SEQ ID NO: 12. Even more preferably, the isolated nucleic acid encodes an antibody heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 10 (the full HCVR region of 4A5-3.1.1-B4).
- the invention features an isolated nucleic acid encoding an antibody light chain variable region that encodes the 4A5-3.1.1-B4 light chain CDR3 comprising the amino acid sequence of SEQ ID NO:8
- the nucleic acid encoding the antibody light chain variable region further encodes a 4A5-3.1.1-B4 light chain CDRl which comprises the amino acid sequence of SEQ ID NO:4.
- the isolated nucleic acid encodes an antibody light chain variable region comprising the amino acid sequence of SEQ ID NO:2 (the full LCVR region of 4A5- 3.1.1-B4).
- the invention features an isolated nucleic acid encoding an antibody light chain variable region that encodes the 4A5-3.1.1 -B4 light chain CDR3 comprising the amino acid sequence of SEQ ID NO:8
- the nucleic acid encoding the antibody light chain variable region further encodes a 4A5-3.1.1-B4 light chain CDRl which comprises the amino acid sequence of SEQ ID NO:4.
- the isolated nucleic acid encodes an antibody light chain variable region comprising the amino acid sequence of SEQ ID NO:2 (the full LCVR region of 4A5- 3.1.1-B4).
- the invention provides an isolated nucleic acid encoding a heavy chain CDR3 domain comprising the amino acid sequence of SEQ ID NO: 16 (i.e., the 4A5-3.1.1 -B4 HCVR CDR3).
- This nucleic acid can encode only the CDR3 region or, more preferably, encodes an entire antibody heavy chain variable region (HCVR).
- the nucleic acid can encode a HCVR having a CDR2 domain comprising the amino acid sequence of SEQ ID NO:14 (i.e., the 4A5-3.1.1-B4 HCVR CDR2) and a CDRl domain comprising the amino acid sequence of SED ID NO:12 (i.e., 4A5-3.1.1-B4 HCVR CDRl).
- the invention provides an isolated nucleic acid encoding an antibody light chain variable region comprising the amino acid sequence of SEQ ID NO:2 (i.e., the 4A5-3.1.1-B4 LCVR).
- this nucleic acid comprises the nucleotide sequence of SEQ ID NO: 1, although the skilled artisan will appreciate that due to the degeneracy of the genetic code, other nucleotide sequences can encode the amino acid sequence of SEQ ID NO:2.
- the nucleic acid can encode only the LCVR or can also encode an antibody light chain constant region, operatively linked to the LCVR. In one embodiment, this nucleic acid is in a recombinant expression vector.
- the invention provides an isolated nucleic acid encoding an antibody heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 10 (i.e., the 4A5-3.1.1 -B4 HCVR).
- this nucleic acid comprises the nucleotide sequence of SEQ ID NO:9, although the skilled artisan will appreciate that due to the degeneracy of the genetic code, other nucleotide sequences can encode the amino acid sequence of SEQ ID NO: 10.
- the nucleic acid can encode only the HCVR or can also encode a heavy chain constant region, operatively linked to the HCVR.
- the nucleic acid can comprise an IgGl or IgG4 constant region.
- this nucleic acid is in a recombinant expression vector.
- modifications in the amino acid sequence of the antibody can result in an antibody that display equivalent or superior functional characteristics when compared to the original antibody.
- Alterations in the antibodies of the present invention can include one or more amino acid insertions, deletions, substitutions, truncations, fusions, and the like, either from natural mutations or human manipulation.
- the present invention encompasses antibodies disclosed herein further comprising one or more amino acid substitutions provided that the substituted antibodies have substantially the same (or improved or reduced, as may be desirable) activity(ies) as the antibodies disclosed herein.
- a CDR of the present invention has 3 or less conservative substitutions.
- a CDR of the present invention has 2 or less conservative substitutions.
- a CDR of the present invention has one conservative substitution.
- antibodies having conservative amino acid substitutions can be prepared by a variety of techniques known in the art. For example, a number of mutagenesis methods can be used, including PCR assembly, Kunkel (dut-ung-) and thiophosphate (Amersham Sculptor kit) oligonucleotide- directed mutagenesis. Conservative substitutions of interest are shown in Table 1 along with preferred substitutions.
- the invention also provides recombinant expression vectors encoding an antibody comprising a polypeptide selected from the group consisting of a polypeptide as shown in SEQ ID NO: 2, a polypeptide as shown in SEQ ID NO: 4, a polypeptide as shown in SEQ ID NO: 6, a polypeptide as shown in SEQ ID NO: 8, a polypeptide as shown in SEQ ID NO: 10, a polypeptide as shown in SEQ ID NO: 12, a polypeptide as shown in SEQ ID NO: 14; and a polypeptide as shown in SEQ ID NO: 16.
- the invention also provides recombinant expression vectors encoding both an antibody heavy chain and an antibody light chain.
- the invention provides a recombinant expression vector encoding: a) an antibody heavy chain having a variable region comprising the amino acid sequence of SEQ ID NO: 10; and b) an antibody light chain having a variable region comprising the amino acid sequence of SEQ ID NO:2.
- the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, ion exchange, affinity, reverse phase, hydrophobic interaction column chromatography, gel electro-phoresis and the like. Substantially pure immunoglobulins of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the polypeptides may then be used therapeutically or prophylactically, as directed herein.
- the antibodies of the present invention can be incorporated into pharmaceutical compositions suitable for administration to a subject.
- the pharmaceutical composition comprises an antibody or antibody portion of the invention and a pharmaceutically acceptable diluent, carrier, and/or excipient.
- the pharmaceutical compositions for administration are designed to be appropriate for the selected mode of administration, and pharmaceutically acceptable diluents, carrier, and/or excipients such as dispersing agents, buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing agents and the like are used as appropriate.
- a pharmaceutical composition comprising an anti-hTNFSFl 3b human antibody of the present invention can be administered to a mammal at risk for or exhibiting autoimmunity related symptoms or pathology such as systemic lupus erythematosus using standard administration techniques by intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration.
- the antibodies of the invention can be incorporated into a pharmaceutical composition suitable for parenteral administration.
- Peripheral systemic delivery by intravenous or intraperitoneal or subcutaneous injection is preferred.
- Suitable vehicles for such injections are straightforward.
- administration may also be effected through the mucosal membranes by means of nasal aerosols or suppositories.
- Suitable formulations for such modes of administration are well known and typically include surfactants that facilitate cross-membrane transfer.
- compositions typically must be sterile and stable under the conditions of manufacture and storage. Therefore, pharmaceutical compositions may be sterile filtered after making the formulation, or otherwise made microbiologically acceptable.
- a typical composition for intravenous infusion could have a volume as much as 250 mL of fluid, such as sterile Ringer's solution, and 1-100 mg per mL, or more in antibody concentration.
- Therapeutic agents of the invention can all be frozen or lyophilized for storage and reconstituted in a suitable sterile carrier prior to use. Lyophilization and reconstitution can lead to varying degrees of antibody activity loss (e.g. with conventional immune globulins, IgM antibodies tend to have greater activity loss than IgG antibodies). Dosages may have to be adjusted to compensate.
- the pH of the formulation will be selected to balance antibody stability (chemical and physical) and comfort to the patient when administered. Generally, pH between 6 and 8 is tolerated.
- TNFSF 13b plays a critical role in the pathology associated with a variety of diseases involving immune and inflammatory factors. Therefore, a pharmaceutical composition comprising an anti-hTNFSFl 3b human antibody of the invention can be used to treat disorders in which TNFSFl 3b activity is detrimental, for example immune diseases including autoimmune diseseases and inflammatory diseases.
- Preferred disorders include, but are not limited to, systemic lupus erythematosus, rheumatoid arthritis, juvenile chronic arthritis, Lyme arthritis, Crohn's disease, ulcerative colitis, inflammatory bowel disease, asthma, allergic diseases, psoriasis, graft versus host disease, organ transplant rejection, acute or chronic immune disease associated with organ transplantation, sarcoidosis, infectious diseases, parasitic diseases, female infertility, autoimmune thrombocytopenia, autoimmune thyroid disease, Hashimoto's disease, Sjogren's syndrome, and cancers, particularly B or T cell lymphomas or myelomas.
- a pharmaceutical composition comprising an anti-hTNFSFl 3b human antibody and/or antibody fragment of the invention is used to treat systemic lupus erythematosus.
- an antibody of an anti-hTNFSFl 3b human antibody of the present invention in the manufacture of a medicament for the treatment of at least one of the aforementioned disorders in which TNFSFl 3b activity is detrimental is also contemplated herein.
- an antibody of the invention will be co-formulated with and/or co-adminstered with one or more additional therapeutic agents that are used in the treatment of autoimmune and/or inflammatory diseases.
- Such combination therapies may advantageously utilize lower dosages of the administered therapeutic agents, thus avoiding possible toxicities or complications associated with the various monotherapies.
- compositions of the invention may include a "therapeutically effective amount” or a “prophylactically effective amount” of an antibody of the invention.
- a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.
- a therapeutically effective amount of the antibody may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or antibody portion to elicit a desired response in the individual.
- a therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects.
- a “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount. Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response).
- antibodies, of the invention can be used to detect TNFSF 13b polypeptides (e.g, in a biological sample, such as serum or plasma), using a conventional immunoassay, such as an enzyme linked immunosorbent assays (ELISA), an radioimmunoassay (RIA) or tissue immunohistochemistry.
- ELISA enzyme linked immunosorbent assays
- RIA radioimmunoassay
- the invention provides a method for detecting TNFSF 13b in a biological sample comprising contacting a biological sample with an antibody, or antibody portion, of the invention and detecting either the antibody (or antibody portion) bound to hTNFSFl 3b or unbound antibody (or antibody portion), to thereby detect hTNFSFl 3b in the biological sample.
- the antibody is directly or indirectly labeled with a detectable substance to facilitate detection of the bound or unbound antibody. Suitable detectable substances include various enzymens, prosthetic groups, fluorescent materials, luminescent materials and radioactive materials.
- suitable enzymes include horseradish peroxidase, alkaline phosphatase, ⁇ - galactosidase, or acetylcholinesterase;
- suitable prosthetic group complexes include streptavidin/biotin and avidin biotin;
- suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinyl-amine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include '251, 1 31 . 35s, or 3H.
- TNFSFl 3b can be assayed in biological fluids by a competition immunoassay utilizing TNFSF 13b standards labeled with a detectable substance and an unlabeled anti-hTNFSFl 3b human antibody.
- the biological sample, the labeled TNFSF 13b standards and the anti-hTNFSFl 3b human antibody are combined and the amount of labeled TNFSFl 3b standard bound to the unlabeled antibody is determined.
- the amount of TNFSF 13b in the biological sample is inversely proportional to the amount of labeled rTNFSF13b standard bound to the anti- hTNFSF 13b human antibody.
- the present invention provides a use of an antibody that neutralizes TNFSFl 3b activity by binding an epitope of TNFSFl 3b.
- the epitope was identified as described in Example 10.
- the soluble portion of hTNFSFl 3b is represented as follows:
- the hTNFSFl 3b amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise at least one of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71, threonine at position 72, tyrosine at position 73, glutamic acid at position 105, threonine at position 106, leucine at position 107, and asparagine at position 109.
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise at least two of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71 , threonine at position 72, tyrosine at position 73, glutamic acid at position
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise at least three of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71, threonine at position 72, tyrosine at position 73, glutamic acid at position 105, threonine at position 106, leucine at position 107, and asparagine at position 109.
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise at least four of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71, threonine at position 72, tyrosine at position 73, glutamic acid at position 105, threonine at position 106, leucine at position 107, and asparagine at position 109.
- the amino acids involved in binding the novel anti- hTNFSFl 3b human antibodies comprise lysine at position 71 , threonine at position 72, tyrosine at position 73, and glutamic acid at position 105.
- the amino acids involved in binding the novel anti- hTNFSFl 3b human antibodies comprise glutamic acid at position 105 and at least one of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71 , threonine at position 72, and tyrosine at position 73.
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise threonine at position 106 and at least one of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71, threonine at position 72, and tyrosine at position 73.
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise leucine at position 107 and at least one of the amino acids selected from the group consisting of: threonine at position 69, lysine at position 71 , threonine at position 72, and tyrosine at position 73.
- the amino acids involved in binding the novel anti-hTNFSFl 3b human antibodies comprise asparagine at position 109 and at least one of the amino acids selected from the group consisting of: lysine at position 71, threonine at position 72, and tyrosine at position 73.
- the amino acids involved in binding the novel anti- hTNFSFl 3b human antibodies comprise lysine at position 71, threonine at position 72, tyrosine at position 73, and glutamic acid at position 105.
- Example 1 Generation of Anti-hTNFSF13b Human Monoclonal Antibodies
- Monoclonal antibodies were generated using the HuMAb-MouseTM technology at Medarex by immunizing the mice with soluble hTNFSFl 3b (amino acids 133-285, purchased from RDI, Flanders, NJ). Both the HCo7 and HCol2 mice were used. Mice were immunized with 15 ⁇ g to 50 ⁇ g soluble hTNFSFl 3b in RIBI, Freund's complete adjuvant or Freund's incomplete adjuvant. Eight mice producing serum antibody titers to hTNFSFl 3b were injected i.v. with 10 ⁇ g hTNFSFl 3b in PBS.
- spleen was harvested three days later from each mouse and fused with myeloma cells according to the method described in Zola (Zola, H. Monoclonal antibodies: A Manual of Techniques. CRC Press, Boca Raton, FL. (1987)). Hybridomas were tested for binding to hTNFSFl 3b and to make sure they were expressing human immunoglobulin heavy and light chains. Antibody binding to hTNFSFl 3b was detected by ELISA as follows:
- Plates were coated with 50 ⁇ l of 5 ⁇ g/ml hTNFSFl 3b in PBS overnight at 4°C. Plates were then emptied and blocked with 100 ⁇ l PBS + 0.05% Tween 20 (PBST) + 5% chicken serum for 1 hour at room temperature. After washing three times with PBST, the plates were drained and 100 ⁇ l diluted secondary reagents (HRP-HuIgGFc, Jackson cat# 109-036-098 or HRP-HuKappa, Bethyl cat#A80-l 15P; 1 :5000 in blocking buffer) was added per well. After an 1 hour incubation at room temperature plates were washed three times as described above.
- Plates were developed using 10 ml citrate phosphate buffer pH 4.0, 80 ⁇ l ABTS, 8 ⁇ l H 2 O 2 per plate. After incubating 30 min. to 1 hour at room temperature, absorbance of the plates was read A415-A490. Hybridomas that showed binding to hTNFSFl 3b and that were hulgG heavy chain and human kappa light chain were selected for subcloning.
- Cell culture media of subcloned hybridomas was concentrated in Amicon ProFlux Ml 2 tangential filtration systems using an Amicon S3Y30 UF membranes.
- the concentrated media was passed over protein-A Sephaose columns (5 to 20 ml column) at a flow rate of 5 ml/min. The columns were washed with buffer A (PBS, pH 7.4) until the absorbance returned to baseline and the bound polypeptides were eluted with 50 mM citric acid, pH 3.2. Fractions were immediately neutralized with 1M Tris, pH 8.0. Fractions were then analyzed by SDS-PAGE. Fractions containing antibody were pooled and concentrated using an Ultrafree centrifugal filter unit (Millipore, 10 kDa molecular weight cut-off).
- Neutralizing activity of the anti-hTNFSFl 3b human antibodies of the invention was measured using a murine II- 1 dependent B cell line, Tl 165.17.
- the cells were washed three times with assay media (RPMI1640 containing 10% FBS, 1 mM sodium pyruvate, 5 x 10 "5 M 2-mercaptoethanol and penicillin, streptomycin and fungizone) to remove IL-1.
- the cells were resuspended at 100,000 cells/ml in assay media containing 2.5 ng/ml soluble huTNFSF13b and plated at 5000 cells/well in a 96 well plate and incubated at 37°C in 5% CO 2 .
- the neutralizing antibodies were tested for the ability to inhibit TNFSF 13b augmented primary human B cell proliferation in response to anti-IgM stimulation.
- Primary human B cells were isolated from human blood using CD 19 positive selection using the MACS magnetic isolation system (Miltenyi Biotec, Auburn, CA). The B cells were added to wells of a 96-well plate at 2 x 10 5 cells per well in complete RPMI containing 10% FCS (complete RPMI is RPMI 1640 containing 10 mM L-glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 1 mM sodium puruvate, 0.1 mM non-essential amino acids, and 1 x 10 "5 M ⁇ -mercaptoethanol).
- FIG. 1 illustrates the ability of 4A5-3.1.1-B4 to neutralize the stimulatory effect of hTNFSFl 3b.
- neutralizing anti-hTNFSFl 3b antibodies were either human IgGl or human IgG4. They were also assayed for their ability to bind to hTNFSFl 3b in a denatured state, i.e., hTNFSFl 3b separated on SDS-PAGE and blotted onto nitrocellulose. All of the neutralizing antibodies failed to bind hTNFSFl 3b in a Western blot while several of the non-neutralizing antibodies were able to do so.
- 4A5-3.1.1-B4 was immobilized on a solid phase by passing the antibody solution over an IMAC resin loaded with Co +2 . Following binding, the cobalt was oxidized to the +3 state by incubation of the resin with a dilute peroxide solution. After washing the resin, native hTNFSFl 3b and hTNFSFl 3b that was modified (by reduction/alkylation or by thermal denaturation) was passed over the column. After washing, the bound protein was eluted with an acidic solution and the eluted proteins were analyzed by MALDI MS.
- 4A5-3.1.1-B4 bound native recombinant hTNFSFl 3b, but did not bind either the chemically or thermally modified hTNFSFl 3b. Therefore, the 4A5-3.1.1 -B4 appears to recognize a conformational epitope on soluble hTNFSFl 3b.
- Recombinant soluble hTNFSFl 3b was incubated with 4A5-3.1.1-B4 or anti-TNFSF13b rabbit polyclonal antibody (MoBiTec, Marco Island, FL; against amino acids 254 to 269 of hTNFSFl 3b) on ice for 2 hours and the protein mixture was applied to a size-exclusion HPLC (two, tandem TosoHaas TSK-GEL G3000PW columns) equilibrated in PBS at a flow rate of 0.25 ml/min. Proteins were eluted with PBS. As controls, antibody solutions and the solution of hTNFSFl 3b were analyzed separately.
- Human TNFSFl 3b eluted from the size exclusion column in a position consistent with a trimer of TNFSF 13b molecules.
- the elution of trimeric hTNFSFl 3b shifted to an earlier timepoint in the presence of 4A5-3.1.1-B4 but not in the presence of anti-TNFSF13b polyclonal antibodies indicating the binding of trimeric hTNFSFl 3b to the 4A5-3.1.1-B4 antibody.
- This data suggests that the neutralizing mAb 4A5-3.1.1 -B4 binds to a conformational epitope on hTNFSFl 3b.
- the affinity of various anti-hTNFSFl 3b human antibodies for hTNFSFl 3b was measured using a BIAcore 2000 instrument system.
- the system utilizes the optical properties of Surface Plasmon Resonance to detect alteration in protein concentration of interacting molecules within a dextran biosensor matrix. Except where noted, all reagents and materials were purchased from BIAcore AB (Upsala, Sweden). All measurements were performed at 25°C. Samples were dissolved in HBS-EP buffer (150 mM NaCl, 3 mM EDTA, 0.005% (w/v) surfactant P-20, and 10 mM HEPES, pH 7.4).
- Goat anti- mouse IgG (Fc specific; Jackson Immunoresearch, West Grove, PA) was immobilized on flow cell 1 on a CM5 sensor chip using the amine coupling kit.
- Goat anti-human IgG (Fc specific; Jackson Immunoresearch) was immobilized on flow cell 2 also by amine coupling. Both antibodies were immobilized to reach 700 response units each.
- Binding of recombinant hTNFSFl 3b Research Diagnostics, Inc., Flanders, NJ was evaluated using multiple analytical cycles. Each cycle was performed at a flow rate of 30 ⁇ l/min.
- variable region for the heavy and light chain for the neutralizing human mAb 4A5-3.1.1-B4 were cloned and sequenced using the following protocols.
- mRNA was prepared from 2 x 10 6 hybridoma cells using the Micro-Fast Track protocol (Invitrogen) supplied with the kit.
- cDNA was prepared from 200 ⁇ l of ethanol precipitate of mRNA using cDNA Cycle kit (Invitrogen) by spinning the aliquot of mRNA for 30 min. at 14,000 rpm at 4°C followed by washing the pellet with 70% ethanol. The air dried pellet was resuspended in 1 1.5 ⁇ l of sterile water and cDNA was prepared following the kit's instructions.
- the optional second round of cDNA systhesis was omitted but the cDNA was cleaned using the pheno/chlorform extraction step and ethanol precipitation.
- the cDNA pellet was resuspended in 30 ⁇ l of TE for use in PCR.
- the PCR reactions were set up with degenerate primers at the 5' end of the variable region for the heavy and light chain paired with 3' primers in the constant region. For each 50 ul reaction, 1 ul of cDNA was used. The reaction was set up as directed for use with Pful followed by 20 cycles. The PCR products were checked by running 5 ⁇ l of each reaction on a 1% agarose gel. The positive reactions were cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen). Minipreps from the positive clones were sequenced and analyzed for productive gene rearrangements. Results from independent PCR reactions and sequencing of multiple clones revealed the sequences as described below.
- Human antibody 4A5-3.1.1-B4 heavy chain sequences (CDRs are in bold, signal sequence is italicized).
- an ELISA was set up utilizing 4A5-3.1.1-B4 as both the capture and detecting mAb.
- Human recombinant TNFSFl 3b was used as the standard curve. Human TNFSFl 3b could be detected in the culture supernatant from CHO cells transfected with a vector expressing hTNFSFl 3b, supernatants from cultured human monocytes or human serum or plasma. Supernatants from CHO cells expressing murine TNFSF 13b were tested for reactivity in the ELISA and were negative.
- 4A5-3.1.1 -B4 was also unable to immunopreciptate murine TNFSFl 3b but was able to immunoprecipitate human TNFSFl 3b.
- Murine TNFSFl 3b was used in the proliferation assay described in Example 2. Using this proliferation assay, 4A5-3.1.1-B4 was unable to neutralize the proliferation induced by murine TNFSF13b. This indicates that 4A5-3.1.1-B4 is unable to recognize murine TNFSF 13b.
- the human IgG4 constant region has a serine at position 231. However, this position at 231 was substituted from a serine to a proline which introduces a structural change in the hinge region for obtaining optimal inter-chain disulfide bonds. This reduces the generation of half antibodies.
- Half antibodies are formed from one heavy chain and one light chain.
- an alanine for phenylalanine substitution at position 237 and an alanine or glutamic acid substitituion for leucine at position 238 can be made to lessen the effector function of the antibody.
- Example 8 Amino Acid sequence of Heavy Chain 4A5-3.1.1-B4 Below is the amino acid sequence of the heavy chain 4A5-3.1.1-B4 antibody which comprises the HCVR and the IgGl constant region.
- Mouse TNFSF13b 50 DSDTPTIRKG TYTFVPWLLS FKRGNA EEK ENKIWRQTG YFFIYSQVLY 99 Human TNFSF13b 19 DSETPTIQKG SYTFVP LLS FKRGSALEEK ENKILVKETG YFFIYGQVLY 68 Mouse TNFSF13b 100 TDPIFAMGHV IQRKKVHVFG DELSLVTLFR CIQNMPKTLP NNSCYSAGIA 1 4 9 Human TNFSF13 69 TDKTYAMGHL IQRKKVHVFG DELSLVTLFR CIQNMPETLP NNSCYSAGIA 118
- Mouse TNFSF13b 150 RLEEGDEIQL AIPRENAQIS RNGDDTFFGA LKLL 183 Human TNFSF13b 119 KLEEGDELQL AIPRENAQIS LDGDVTFFGA LKLL 152
- a homology model was created for human TNFSF 13b based on the known crystal structure for several TNF family members. Exposed residues that are different between mouse and human TNFSFl 3b are potential binding sites for 4A5-3.1.1-B4 since 4A5- 3.1.1-B4 neutralizes human but not mouse TNFSFl 3b.
- TNFSFl 3b mutants were produced for chimera A, B, and C and the assay was repeated using 11 ng/ml of each parent TNFSF 13b or chimera TNFSF 13b and 1 ug/ml of 4A5-3.1.1-B4. The results showed 100% neutralization was observed with human TNFSFl 3b and chimera A, 88% neutralization with chimera B, and no neutralization was observed for murine TNFSFl 3b or chimera C.
- Transgenic mice overexpressing soluble human TNFSF 13b are generated using established techniques as described by Hogan, B. et al. (1986) Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor Laboratory, NY] as modified by Fox and Solter (Mol. Cell. Biol. 8: 5470, 1988). Briefly, a DNA fragment encompassing the hTNFSFl 3b gene is microinjected into the male pronuclei of newly fertilized one-cell- stage embryos (zygotes) of the FVB/N strain. The embryos are cultured in vitro overnight to allow development to the two-cell-stage. Two-cell embryos are then transplanted into the oviducts of pseudopregnant CD-I strain mice to allow development to term.
- mice To test for the presence of the transgene in the newborn mice, a small piece of toe is removed from each animal and digested with proteinase K to release the nucleic acids. A sample of the toe extract is subsequently subjected to PCR analysis to identify transgene- containing mice.
- the hTNFSFl 3b transgenic mice had a dramatic increase in peripheral B cells, generally about three fold compared to age and sex matched littermates. There was a slight increase in peripheral T cells as well.
- the hTNFSFl 3b transgenic mice were treated with 4A5-3.1.1-B4 to determine if neutralization of hTNFSFl 3b would result in a reduction in B cell numbers back to normal levels.
- Female hTNFSFl 3b mice were injected subcutaneously twice a week for three weeks with either 25 ug of 4A5-3.1.1-B4 or isotype control antibody. Four days after the last injection of antibody, the mice were sacrificed and the spleen removed for analysis.
- B and T cell numbers were calculated by determining the percentage of CD 19+ cells, for B cells, and CD3+ cells, for T cells using flow cytometry and absolute white blood cell count for each spleen.
- the results are shown below demonstrate that in vivo administration of 4A5-3.1.1-B4 to hTNFSFl 3b transgenic mice is able to restore the normal numbers of T and B cells (average +_standard deviation)
- SEQ ID NO:l polynucleotide sequence encoding light chain variable region
- SEQ ID NO: 3 polynucleotide sequence encoding light chain CDRl AGGGCCAGTCAGAGTGTTAGCCGCTACTTAGCC
- DASNRAT SEQ ID NO: 7 polynucleotide sequence encoding light chain CDR3 CAGCAGCGTAGCAACTGGCCTCGGACG
- SEQ ID NO: 9 polynucleotide sequence encoding heavy chain variable region
- SEQ ID NO: 10 > amino acid sequence encoding heavy chain variable region
- SEQ ID NO: 15 polynucleotide sequence encoding heavy chain CDR3 GGGTATTACGATATTTTGACTGGTTATTATTACTACTTTGACTAC
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Dermatology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Oncology (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Reproductive Health (AREA)
- Endocrinology (AREA)
- Communicable Diseases (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (20)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| BR0211630-8A BR0211630A (pt) | 2001-08-16 | 2002-08-15 | Anticorpo, ácido nucleico isolado, vetores de expressão recombinantes, composição farmacêutica, método de inibição da atividade de tnfsf13b em um indivìduo sofrendo de um distúrbio no qual a atividade de tnfsf13b é prejudicial, uso do dito anticorpo, e, artigo de manufatura |
| EP02756428A EP1432735B1 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
| MXPA04001344A MXPA04001344A (es) | 2001-08-16 | 2002-08-15 | Anticuerpos humanos antagonistas contra htnfsf13b. |
| EA200400312A EA009074B1 (ru) | 2001-08-16 | 2002-08-15 | АНТАГОНИСТИЧЕСКИЕ АНТИТЕЛА ПРОТИВ hTNFSF13b ЧЕЛОВЕКА |
| CA2452447A CA2452447C (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
| US10/484,790 US7317089B2 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-hTNFSF13b human antibodies |
| HR20040147A HRP20040147A2 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
| DK02756428.5T DK1432735T3 (da) | 2001-08-16 | 2002-08-15 | Antagonistiske humane anti-htnfsf13b-antistoffer |
| NZ530657A NZ530657A (en) | 2001-08-16 | 2002-08-15 | Anti-hTNFSF13b human antibodies characterised by high affinity binding to TNFSF13b polypeptides and the capacity to antagonise at least one activity associated with TNFSF13b polypeptides |
| UA2004021088A UA89017C2 (uk) | 2001-08-16 | 2002-08-15 | ЛЮДСЬКЕ АНТИТІЛО, ЩО СПЕЦИФІЧНО ЗВ'ЯЗУЄТЬСЯ З ЛЮДСЬКИМ TNFSF13b |
| JP2003521777A JP4012880B2 (ja) | 2001-08-16 | 2002-08-15 | 拮抗的抗hTNFSF13bヒト抗体 |
| AU2002322436A AU2002322436C1 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-HTNFSF13B human antibodies |
| ES02756428T ES2389834T3 (es) | 2001-08-16 | 2002-08-15 | Anticuerpos humanos anti-HTNFSF13B antagonistas |
| KR1020047002203A KR100961299B1 (ko) | 2001-08-16 | 2002-08-15 | 길항성 항-hTNFSF13b 인간 항체 |
| IL16037302A IL160373A0 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
| HU0500816A HU230006B1 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
| NO20040603A NO20040603L (no) | 2001-08-16 | 2004-02-10 | Antagonistiske anti-HTNSF13B humane antistoffer |
| AU2008246261A AU2008246261B2 (en) | 2001-08-16 | 2008-11-20 | Antagonistic Anti-hTNSF 13b Human Antibodies |
| US12/777,306 US8173124B2 (en) | 2001-08-16 | 2010-05-11 | Method to treat using antagonistic anti-hTNFSF13b human antibodies |
| US13/444,216 US20120195904A1 (en) | 2001-08-16 | 2012-04-11 | METHOD TO TREAT USING ANTAGONISTIC ANTI-hTNFSF13B HUMAN ANTIBODIES |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US31280801P | 2001-08-16 | 2001-08-16 | |
| US60/312,808 | 2001-08-16 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/484,790 Continuation US7317089B2 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-hTNFSF13b human antibodies |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2003016468A2 true WO2003016468A2 (en) | 2003-02-27 |
| WO2003016468A3 WO2003016468A3 (en) | 2003-11-20 |
Family
ID=23213094
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/021842 Ceased WO2003016468A2 (en) | 2001-08-16 | 2002-08-15 | Antagonistic anti-htnfsf13b human antibodies |
Country Status (26)
| Country | Link |
|---|---|
| US (4) | US7317089B2 (https=) |
| EP (2) | EP2348048B1 (https=) |
| JP (1) | JP4012880B2 (https=) |
| KR (1) | KR100961299B1 (https=) |
| CN (1) | CN100497392C (https=) |
| AR (1) | AR035119A1 (https=) |
| AU (2) | AU2002322436C1 (https=) |
| BR (1) | BR0211630A (https=) |
| CA (1) | CA2452447C (https=) |
| CO (1) | CO5560617A2 (https=) |
| DK (2) | DK1432735T3 (https=) |
| EA (1) | EA009074B1 (https=) |
| EC (1) | ECSP044978A (https=) |
| ES (2) | ES2389834T3 (https=) |
| HR (1) | HRP20040147A2 (https=) |
| HU (1) | HU230006B1 (https=) |
| IL (1) | IL160373A0 (https=) |
| MX (1) | MXPA04001344A (https=) |
| NO (1) | NO20040603L (https=) |
| NZ (1) | NZ530657A (https=) |
| PE (1) | PE20030334A1 (https=) |
| PL (1) | PL212404B1 (https=) |
| PT (2) | PT1432735E (https=) |
| UA (1) | UA89017C2 (https=) |
| WO (1) | WO2003016468A2 (https=) |
| ZA (1) | ZA200401154B (https=) |
Cited By (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006025345A1 (ja) * | 2004-08-31 | 2006-03-09 | Kowa Company, Ltd. | 抗ヒトbaff抗体 |
| US8062906B2 (en) | 2000-08-18 | 2011-11-22 | Human Genome Sciences, Inc. | B-lymphocyte stimulator binding polypeptides and methods based thereon |
| US8071092B1 (en) | 1996-10-25 | 2011-12-06 | Human Genome Sciences, Inc. | Methods of inhibiting B lymphocytes using antibodies to Neutrokine-alpha |
| US8101181B2 (en) * | 2000-06-16 | 2012-01-24 | Human Genome Sciences, Inc. | Antibodies that immunospecifically bind to B lymphocyte stimulator protein |
| US8212004B2 (en) | 1999-03-02 | 2012-07-03 | Human Genome Sciences, Inc. | Neutrokine-alpha fusion proteins |
| US8211649B2 (en) | 2006-03-31 | 2012-07-03 | Human Genome Sciences, Inc. | Methods of diagnosing and prognosing hodgkin's lymphoma |
| EP2396035A4 (en) * | 2009-02-12 | 2012-09-12 | Human Genome Sciences Inc | USE OF ANTAGONISTS OF THE B-LYMPHOCYTE STIMULATOR PROTEIN TO PROMOTE TRANSPLANT TOLERANCE |
| US8461307B2 (en) | 2006-08-28 | 2013-06-11 | Kyowa Hakko Kirin Co., Limited | Antagonistic human LIGHT-specific human monoclonal antibodies |
| WO2013158577A1 (en) | 2012-04-20 | 2013-10-24 | Eli Lilly And Company | Anti-baff-anti-il-17 bispecific antibodies |
| US8906373B2 (en) | 2002-07-19 | 2014-12-09 | Abbvie Biotechnology Ltd. | Use of TNF-alpha inhibitor for treatment of psoriasis |
| WO2015100246A1 (en) | 2013-12-24 | 2015-07-02 | Ossianix, Inc. | Baff selective binding compounds and related methods |
| US9168286B2 (en) | 2005-10-13 | 2015-10-27 | Human Genome Sciences, Inc. | Methods and compositions for use in treatment of patients with autoantibody positive disease |
| WO2015173782A1 (en) * | 2014-05-16 | 2015-11-19 | Glaxosmithkline Intellectual Property Management Limited | Antibody formulation |
| WO2015187521A3 (en) * | 2014-06-03 | 2016-03-10 | Merck Sharp & Dohme Corp. | Anti-blys antibodies |
| EP3037544A1 (en) | 2005-10-13 | 2016-06-29 | Human Genome Sciences, Inc. | Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases |
| WO2016160476A1 (en) * | 2015-04-03 | 2016-10-06 | Eli Lilly And Company | Anti-cd20- / anti-baff bispecific antibodies |
| US9605064B2 (en) | 2006-04-10 | 2017-03-28 | Abbvie Biotechnology Ltd | Methods and compositions for treatment of skin disorders |
| US9879082B2 (en) | 2007-01-11 | 2018-01-30 | Novo Nordisk A/S | Anti-KIR antibodies, formulations, and uses thereof |
| US10377804B2 (en) | 2014-01-31 | 2019-08-13 | Boehringer Ingelheim International Gmbh | Anti-BAFF antibodies |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7879328B2 (en) | 2000-06-16 | 2011-02-01 | Human Genome Sciences, Inc. | Antibodies that immunospecifically bind to B lymphocyte stimulator |
| DK1385882T3 (da) | 2001-05-11 | 2008-02-11 | Amgen Inc | Peptider og relaterede molekyler, der binder til TALL-1 |
| US8202698B2 (en) * | 2005-11-08 | 2012-06-19 | Biogen Idec Ma Inc. | Methods of evaluating BAFF |
| US9399061B2 (en) | 2006-04-10 | 2016-07-26 | Abbvie Biotechnology Ltd | Methods for determining efficacy of TNF-α inhibitors for treatment of rheumatoid arthritis |
| EP1852108A1 (en) | 2006-05-04 | 2007-11-07 | Boehringer Ingelheim Pharma GmbH & Co.KG | DPP IV inhibitor formulations |
| EP2540725A1 (de) | 2006-05-04 | 2013-01-02 | Boehringer Ingelheim International GmbH | Polymorphe von 1-((4-Methyl-chinazolin-2-yl)methyl)-3-methyl-7-(2-butin-1-yl)-8-(3-(R)-amino-piperidin-1-yl)xanthin |
| PE20080251A1 (es) | 2006-05-04 | 2008-04-25 | Boehringer Ingelheim Int | Usos de inhibidores de dpp iv |
| PE20091730A1 (es) | 2008-04-03 | 2009-12-10 | Boehringer Ingelheim Int | Formulaciones que comprenden un inhibidor de dpp4 |
| US20200155558A1 (en) | 2018-11-20 | 2020-05-21 | Boehringer Ingelheim International Gmbh | Treatment for diabetes in patients with insufficient glycemic control despite therapy with an oral antidiabetic drug |
| AR083878A1 (es) | 2010-11-15 | 2013-03-27 | Boehringer Ingelheim Int | Terapia antidiabetica vasoprotectora y cardioprotectora, linagliptina, metodo de tratamiento |
| EP3559049B1 (en) | 2011-10-28 | 2025-06-11 | Teva Pharmaceuticals Australia Pty Ltd | Polypeptide constructs and uses thereof |
| JP6218811B2 (ja) | 2012-05-14 | 2017-10-25 | ベーリンガー インゲルハイム インターナショナル ゲゼルシャフト ミット ベシュレンクテル ハフツング | Sirs及び/又は敗血症の治療に用いるdpp−4阻害薬としてのキサンチン誘導体 |
| SG10201708959WA (en) | 2012-07-03 | 2017-11-29 | Univ Washington | Antibodies to tau |
| US9458246B2 (en) | 2013-03-13 | 2016-10-04 | Amgen Inc. | Proteins specific for BAFF and B7RP1 |
| PH12022550138A1 (en) | 2013-03-13 | 2023-03-06 | Amgen Inc | Proteins specific for baff and b7rp1 and uses thereof |
| US9700485B2 (en) | 2013-04-24 | 2017-07-11 | Corning Incorporated | Delamination resistant pharmaceutical glass containers containing active pharmaceutical ingredients |
| US11117975B2 (en) | 2013-04-29 | 2021-09-14 | Teva Pharmaceuticals Australia Pty Ltd | Anti-CD38 antibodies and fusions to attenuated interferon alpha-2B |
| BR112015027313A2 (pt) | 2013-04-29 | 2017-09-26 | Teva Pharmaceuticals Australia Pty Ltd | anticorpos anti-cd38 e fusões ao interferon alfa-2b atenuado |
| UA119352C2 (uk) | 2014-05-01 | 2019-06-10 | Тева Фармасьютикалз Острейліа Пті Лтд | Комбінація леналідоміду або помалідоміду і конструкції анти-cd38 антитіло-атенуйований інтерферон альфа-2b та спосіб лікування суб'єкта, який має cd38-експресуючу пухлину |
| TWI734975B (zh) | 2014-06-27 | 2021-08-01 | 美商C2N醫療診斷有限責任公司 | 人類化抗-tau抗體 |
| US10544199B2 (en) | 2014-10-29 | 2020-01-28 | Teva Pharmaceuticals Australia Pty Ltd | Interferon alpha 2B variants |
| CN109310697A (zh) | 2016-06-10 | 2019-02-05 | 勃林格殷格翰国际有限公司 | 利格列汀和二甲双胍的组合 |
| CN118515767B (zh) * | 2024-07-23 | 2024-10-18 | 江苏双全生物医药科技有限公司 | 一种TNFSF13b抗体及其应用 |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO1998018921A1 (en) | 1996-10-25 | 1998-05-07 | Human Genome Sciences, Inc. | NEUTROKINE $g(a) |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO2000050597A2 (en) | 1999-02-23 | 2000-08-31 | Human Genome Sciences, Inc. | Neutrokine-alpha and neutrokine-alpha splice variant |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6096878A (en) | 1993-05-10 | 2000-08-01 | Japan Tobacco Inc. | Human immunoglobulin VH gene segments and DNA fragments containing the same |
| US6812327B1 (en) | 1996-10-25 | 2004-11-02 | Human Genome Sciences, Inc. | Neutrokine-alpha polypeptides |
| WO1998027114A2 (en) | 1996-12-17 | 1998-06-25 | Schering Corporation | Mammalian cell surface antigens; related reagents |
| EP1012270A2 (en) | 1997-09-12 | 2000-06-28 | Apotech R&D S.A. | Kay - a novel immune system protein |
| US6297367B1 (en) | 1997-12-30 | 2001-10-02 | Chiron Corporation | Polynucleotide encoding TNFL1 |
| US6787638B1 (en) | 1998-12-02 | 2004-09-07 | Applied Molecular Evolution, Inc. | Tumor specific human monoclonal antibodies and methods of use |
| IL144202A0 (en) | 1999-01-25 | 2002-05-23 | Biogen Inc | Baff, related blocking agents and their use in the stimulation and inhibition of b-cells and immunoglobulins in immune responses |
| PT2281843T (pt) | 2000-06-16 | 2017-01-02 | Human Genome Sciences Inc | Anticorpos que se ligam imunoespecificamente a blys |
-
2002
- 2002-08-13 AR ARP020103052A patent/AR035119A1/es not_active Application Discontinuation
- 2002-08-15 MX MXPA04001344A patent/MXPA04001344A/es active IP Right Grant
- 2002-08-15 CN CNB028159217A patent/CN100497392C/zh not_active Expired - Fee Related
- 2002-08-15 KR KR1020047002203A patent/KR100961299B1/ko not_active Expired - Fee Related
- 2002-08-15 NZ NZ530657A patent/NZ530657A/en unknown
- 2002-08-15 HU HU0500816A patent/HU230006B1/hu not_active IP Right Cessation
- 2002-08-15 EA EA200400312A patent/EA009074B1/ru not_active IP Right Cessation
- 2002-08-15 EP EP10184675.6A patent/EP2348048B1/en not_active Expired - Lifetime
- 2002-08-15 PT PT02756428T patent/PT1432735E/pt unknown
- 2002-08-15 AU AU2002322436A patent/AU2002322436C1/en not_active Ceased
- 2002-08-15 DK DK02756428.5T patent/DK1432735T3/da active
- 2002-08-15 ES ES02756428T patent/ES2389834T3/es not_active Expired - Lifetime
- 2002-08-15 JP JP2003521777A patent/JP4012880B2/ja not_active Expired - Fee Related
- 2002-08-15 CA CA2452447A patent/CA2452447C/en not_active Expired - Fee Related
- 2002-08-15 IL IL16037302A patent/IL160373A0/xx unknown
- 2002-08-15 DK DK10184675.6T patent/DK2348048T3/en active
- 2002-08-15 PT PT101846756T patent/PT2348048E/pt unknown
- 2002-08-15 PL PL370534A patent/PL212404B1/pl unknown
- 2002-08-15 WO PCT/US2002/021842 patent/WO2003016468A2/en not_active Ceased
- 2002-08-15 ES ES10184675.6T patent/ES2526990T3/es not_active Expired - Lifetime
- 2002-08-15 UA UA2004021088A patent/UA89017C2/uk unknown
- 2002-08-15 HR HR20040147A patent/HRP20040147A2/hr not_active Application Discontinuation
- 2002-08-15 US US10/484,790 patent/US7317089B2/en not_active Expired - Fee Related
- 2002-08-15 BR BR0211630-8A patent/BR0211630A/pt not_active IP Right Cessation
- 2002-08-15 EP EP02756428A patent/EP1432735B1/en not_active Expired - Lifetime
- 2002-08-16 PE PE2002000745A patent/PE20030334A1/es not_active Application Discontinuation
-
2004
- 2004-02-10 NO NO20040603A patent/NO20040603L/no not_active Application Discontinuation
- 2004-02-12 ZA ZA200401154A patent/ZA200401154B/en unknown
- 2004-02-13 CO CO04012060A patent/CO5560617A2/es not_active Application Discontinuation
- 2004-02-13 EC EC2004004978A patent/ECSP044978A/es unknown
-
2007
- 2007-12-07 US US11/952,363 patent/US7728109B2/en not_active Expired - Fee Related
-
2008
- 2008-11-20 AU AU2008246261A patent/AU2008246261B2/en not_active Ceased
-
2010
- 2010-05-11 US US12/777,306 patent/US8173124B2/en not_active Expired - Fee Related
-
2012
- 2012-04-11 US US13/444,216 patent/US20120195904A1/en not_active Abandoned
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO1998018921A1 (en) | 1996-10-25 | 1998-05-07 | Human Genome Sciences, Inc. | NEUTROKINE $g(a) |
| WO2000050597A2 (en) | 1999-02-23 | 2000-08-31 | Human Genome Sciences, Inc. | Neutrokine-alpha and neutrokine-alpha splice variant |
Non-Patent Citations (13)
| Title |
|---|
| BOERNER ET AL., J. IMMUNOL., vol. 147, no. 1, 1991, pages 86 - 95 |
| BRUGGEMANN ET AL., YEAR IN IMMUN., vol. 7, 1993, pages 33 |
| COLE ET AL.: "Monoclonal Antibodies and Cancer Therap", 1985, ALAN R. LISS, pages: 77 |
| GROSS, J.A. ET AL., NATURE, vol. 404, 2000, pages 995 - 999 |
| HOOGENBOOM; WINTER, J. MOL. BIOL., vol. 227, 1992, pages 381 |
| JAKOBOVITS ET AL., NATURE, vol. 362, 1993, pages 255 - 258 |
| JAKOBOVITS ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 2551 - 2555 |
| LOCKSLEY ET AL., CELL, vol. 104, 2001, pages 487 |
| MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 |
| NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 826 |
| NATURE, vol. 148, 1994, pages 1547 - 1553 |
| SCHNEIDER ET AL., J. EXP. MED., vol. 189, no. 11, 7 June 1999 (1999-06-07), pages 1747 - 1756 |
| See also references of EP1432735A4 |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8303951B2 (en) | 1996-10-25 | 2012-11-06 | Human Genome Sciences, Inc. | Neutrokine-alpha antibodies and methods of use thereof |
| US8231873B2 (en) | 1996-10-25 | 2012-07-31 | Human Genome Sciences, Inc. | Methods of treatment using antibodies to Neutrokine-alpha |
| US8071092B1 (en) | 1996-10-25 | 2011-12-06 | Human Genome Sciences, Inc. | Methods of inhibiting B lymphocytes using antibodies to Neutrokine-alpha |
| US8173122B2 (en) | 1996-10-25 | 2012-05-08 | Human Genome Sciences, Inc. | Methods of treatment using antibodies to neutrokine-alpha |
| US8212004B2 (en) | 1999-03-02 | 2012-07-03 | Human Genome Sciences, Inc. | Neutrokine-alpha fusion proteins |
| US9187548B2 (en) | 2000-06-16 | 2015-11-17 | Human Genome Sciences, Inc. | Antibodies that immunospecifically bind to B lymphocyte stimulator protein |
| US8101181B2 (en) * | 2000-06-16 | 2012-01-24 | Human Genome Sciences, Inc. | Antibodies that immunospecifically bind to B lymphocyte stimulator protein |
| US8062906B2 (en) | 2000-08-18 | 2011-11-22 | Human Genome Sciences, Inc. | B-lymphocyte stimulator binding polypeptides and methods based thereon |
| US8906373B2 (en) | 2002-07-19 | 2014-12-09 | Abbvie Biotechnology Ltd. | Use of TNF-alpha inhibitor for treatment of psoriasis |
| US9090689B1 (en) | 2002-07-19 | 2015-07-28 | Abbvie Biotechnology Ltd. | Use of TNFα inhibitor for treatment of psoriasis |
| US9512216B2 (en) | 2004-04-09 | 2016-12-06 | Abbvie Biotechnology Ltd. | Use of TNFα inhibitor |
| JP5570681B2 (ja) * | 2004-08-31 | 2014-08-13 | 興和株式会社 | 抗ヒトbaff抗体 |
| JP2011191316A (ja) * | 2004-08-31 | 2011-09-29 | Kowa Co | 抗ヒトbaff抗体 |
| JPWO2006025345A1 (ja) * | 2004-08-31 | 2008-05-08 | 興和株式会社 | 抗ヒトbaff抗体 |
| EP1826218A4 (en) * | 2004-08-31 | 2009-11-25 | Kowa Co | ANTI-HUMAN BAFF ANTIBODIES |
| WO2006025345A1 (ja) * | 2004-08-31 | 2006-03-09 | Kowa Company, Ltd. | 抗ヒトbaff抗体 |
| US9168286B2 (en) | 2005-10-13 | 2015-10-27 | Human Genome Sciences, Inc. | Methods and compositions for use in treatment of patients with autoantibody positive disease |
| EP3037544A1 (en) | 2005-10-13 | 2016-06-29 | Human Genome Sciences, Inc. | Methods and compositions for use in treatment of systemic lupus erythematosus (sle) patients with autoantibody positive diseases |
| US8211649B2 (en) | 2006-03-31 | 2012-07-03 | Human Genome Sciences, Inc. | Methods of diagnosing and prognosing hodgkin's lymphoma |
| US9605064B2 (en) | 2006-04-10 | 2017-03-28 | Abbvie Biotechnology Ltd | Methods and compositions for treatment of skin disorders |
| US8974787B2 (en) | 2006-08-28 | 2015-03-10 | Kyowa Hakko Kirin Co., Limited | Antagonistic human light-specific human monoclonal antibodies |
| US8461307B2 (en) | 2006-08-28 | 2013-06-11 | Kyowa Hakko Kirin Co., Limited | Antagonistic human LIGHT-specific human monoclonal antibodies |
| US9771419B2 (en) | 2006-08-28 | 2017-09-26 | Kyowa Hakko Kirin Co., Limited | Antagonistic human light-specific human monoclonal antibodies |
| US9879082B2 (en) | 2007-01-11 | 2018-01-30 | Novo Nordisk A/S | Anti-KIR antibodies, formulations, and uses thereof |
| US10815299B2 (en) | 2007-01-11 | 2020-10-27 | Novo Nordisk A/S | Anti-KIR antibodies, formulations, and uses thereof |
| EP2396035A4 (en) * | 2009-02-12 | 2012-09-12 | Human Genome Sciences Inc | USE OF ANTAGONISTS OF THE B-LYMPHOCYTE STIMULATOR PROTEIN TO PROMOTE TRANSPLANT TOLERANCE |
| US9359448B2 (en) | 2012-04-20 | 2016-06-07 | Eli Lilly And Company | Anti-BAFF-anti-IL-17 bispecific antibodies |
| WO2013158577A1 (en) | 2012-04-20 | 2013-10-24 | Eli Lilly And Company | Anti-baff-anti-il-17 bispecific antibodies |
| EP3192809A1 (en) | 2012-04-20 | 2017-07-19 | Eli Lilly and Company | Anti-baff-anti-il-17 bispecific antibodies |
| US11267894B2 (en) | 2013-12-24 | 2022-03-08 | Ossianix, Inc. | BAFF selective binding compounds and related methods |
| WO2015100246A1 (en) | 2013-12-24 | 2015-07-02 | Ossianix, Inc. | Baff selective binding compounds and related methods |
| US10435474B2 (en) | 2013-12-24 | 2019-10-08 | Ossianix, Inc. | Baff selective binding compounds and related methods |
| US10377804B2 (en) | 2014-01-31 | 2019-08-13 | Boehringer Ingelheim International Gmbh | Anti-BAFF antibodies |
| US11370818B2 (en) | 2014-01-31 | 2022-06-28 | Boehringer Ingelheim International Gmbh | Anti-BAFF antibodies |
| WO2015173782A1 (en) * | 2014-05-16 | 2015-11-19 | Glaxosmithkline Intellectual Property Management Limited | Antibody formulation |
| EP3715371A1 (en) * | 2014-05-16 | 2020-09-30 | GlaxoSmithKline Intellectual Property Management Limited | Belimumab formulation |
| EP3719038A1 (en) * | 2014-05-16 | 2020-10-07 | GlaxoSmithKline Intellectual Property Management Limited | Belimumab formulation |
| AU2015260758B2 (en) * | 2014-05-16 | 2017-11-02 | Glaxosmithkline Intellectual Property Management Limited | Antibody formulation |
| US11179463B2 (en) | 2014-05-16 | 2021-11-23 | Glaxosmithkline Intellectual Property Management Limited | BLyS antibody formulation |
| US12296007B2 (en) | 2014-05-16 | 2025-05-13 | Glaxosmithkline Intellectual Property Management Limited | High concentration anti-blys pharmaceutical formulations |
| WO2015187521A3 (en) * | 2014-06-03 | 2016-03-10 | Merck Sharp & Dohme Corp. | Anti-blys antibodies |
| CN108064250A (zh) * | 2015-04-03 | 2018-05-22 | 伊莱利利公司 | 抗-cd20-/抗-baff双特异性抗体 |
| US9951146B2 (en) | 2015-04-03 | 2018-04-24 | Eli Lilly And Company | Anti-CD20− / anti-BAFF bispecific antibodies |
| WO2016160476A1 (en) * | 2015-04-03 | 2016-10-06 | Eli Lilly And Company | Anti-cd20- / anti-baff bispecific antibodies |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2008246261B2 (en) | Antagonistic Anti-hTNSF 13b Human Antibodies | |
| AU2002322436A1 (en) | Antagonistic anti-HTNFSF13B human antibodies | |
| JP7514363B2 (ja) | Il-7rアルファサブユニットに対する抗体及びその使用 | |
| AU2003295471B2 (en) | Human monoclonal antibodies against CD25 | |
| IL175855A (en) | Ip-10 antibodies and their uses | |
| AU2003219954B2 (en) | Antagonistic anti-hFas ligand human antibodies and fragments thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GM HR HU ID IL IN IS JP KE KG KP KZ LC LK LR LS LT LU LV MA MD MK MN MW MX MZ NO NZ OM PH PT RO RU SD SE SG SI SK SL TJ TM TN TR TZ UA UG US UZ VC VN YU ZA ZM Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ CZ DE DE DK DK DM DZ EC EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ UG ZM ZW AM AZ BY KG KZ RU TJ TM AT BE BG CH CY CZ DK EE ES FI FR GB GR IE IT LU MC PT SE SK TR BF BJ CF CG CI GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2452447 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 530657 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002322436 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10484790 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004/01154 Country of ref document: ZA Ref document number: 160373 Country of ref document: IL Ref document number: PA/a/2004/001344 Country of ref document: MX Ref document number: 200401154 Country of ref document: ZA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20028159217 Country of ref document: CN Ref document number: 1-2004-500218 Country of ref document: PH Ref document number: 1020047002203 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: P20040147A Country of ref document: HR Ref document number: 2003521777 Country of ref document: JP Ref document number: 210/KOLNP/2004 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2004000050 Country of ref document: DZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002756428 Country of ref document: EP Ref document number: 200400312 Country of ref document: EA |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002756428 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 530657 Country of ref document: NZ |
|
| DPE2 | Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101) |