WO2003006691A1 - Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells - Google Patents
Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells Download PDFInfo
- Publication number
- WO2003006691A1 WO2003006691A1 PCT/US2002/021907 US0221907W WO03006691A1 WO 2003006691 A1 WO2003006691 A1 WO 2003006691A1 US 0221907 W US0221907 W US 0221907W WO 03006691 A1 WO03006691 A1 WO 03006691A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- hematopoietic cells
- hematopoietic
- composition
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
- C12N2310/121—Hammerhead
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to gene therapy, particularly as applied to hematopoietic progenitor (HP) cells, to transduced cells and methods of obtaining them, and to methods of using.
- HP hematopoietic progenitor
- Gene therapy refers to the use of genetic sequences and their introduction into cells to alter the genetic makeup of the cells and thereby change the properties or functioning of those cells.
- Gene therapy may be used, for example, to correct a genetic defect by providing to the cells a good copy of a gene that functions as desired, or to provide a gene that encodes an RNA or protein that inhibits an undesired cellular or pathogen activity.
- Gene therapy may be aimed at any of a variety of diseases in which there is a genetic aspect. Of particular interest are diseases of the blood or immune systems since the hematopoietic cells are relatively easy to collect from a subject, allowing for ex vivo procedures to be used.
- hemoglobinopathies defects of leukocyte production or function, immune deficiencies, lysosomal storage diseases and stem cell defects such as Fanconi' s anemia, chronic granulomatous disease, Gaucher's disease, G6PD deficiency etc.
- stem cell defects such as Fanconi' s anemia, chronic granulomatous disease, Gaucher's disease, G6PD deficiency etc.
- Many of these disorders have been successfully treated by allogeneic bone marrow cell transplants (Parkman 1986) .
- the requirement for immune suppression or the occurrence of immunologic effects such as graft rejection are a disadvantage of allogeneic bone marrow transplantation.
- Gene therapy of hematopoietic stem cells has been suggested as an alternative means of treating disease affecting the hematopoietic system in humans.
- HS hematopoietic stem
- this study is unusual in that thymopoiesis in the SCID-X1 context results only from CD34 + cells that contain the exogenous gene (Cavazzana-Calvo et al 2001).
- this study is analogous to those where myeloablation is carried out in that the infused cells can fill the physiological space that is unoccupied in the SCID patient.
- Early studies with allogeneic bone marrow transplantation showed that HS cell engraftment was not sustained in patients that were not myeloablated, primarily because of the continued presence of the recipient HS cells (Parkman 1986) . Therefore, conclusions drawn from prior engraftment studies using human HS cells in an ablative context cannot be simply transferred to the non-ablative system.
- a clinical trial including three patients with Gaucher disease showed presence of the gene-containing vector in peripheral blood and bone marrow up to 3 months post-infusion but at very low levels (Dunbar et al 1998) .
- a trial with five patients suffering from Chronic Granulomatous Disease (CGD) was carried out whereby the p47phox gene was introduced into CD34 + cells from peripheral blood. Although corrected neutrophils were found in peripheral blood during the first few months after infusion, they were undetectable at 6 months post-infusion (Malech et al 1997).
- HS cells can be reduced in number in patients with HIV infection (Marandin et al 1996) , making it more difficult to obtain sufficient numbers of such cells. Moreover, HS cells of HIV-infected individuals are compromised in their replication and clonogenic capacities and show an enhanced propensity to apoptosis (Vignoli et al 1998, Zauli et al 1996) . Mobilization of peripheral blood HP cells using granulocyte colony- stimulating factor (G-CSF) was demonstrated in HIV-infected individuals (Law et al 1999) . Maximal mobilization was achieved after 4 days of G-CSF administration. The leukapheresis product contained approximately 3 x 10 6 CD34 + cells per kg.
- G-CSF granulocyte colony- stimulating factor
- Law et al did not transduce the isolated CD34 + cells nor show that the isolated CD34 + cells were capable of engrafting a subject long term. They merely speculate that gene therapy of HP cells might provide a cure for HIV infection. They also comment that discussion of the number of stem cells required for gene therapy of AIDS is premature because of many uncertainties, including the engraftment potential of the genetically modified cells, the need for chemotherapy, the need for myeloablation or not, the requirement to establish a niche for the infused cells, and the unknown response of the microenvironment in the marrow of AIDS patients after infusion of cells.
- the minimum number of CD34 + cells from peripheral blood required for efficient restoration of the hematopoietic system, particularly platelet recovery, in the context of myeloablation has been suggested to be 2.0 x 10 6 cells per kg of weight of a subject (Zimmerman 1995) .
- the number required for efficient engraftment when not performing myeloablation was unknown prior to this invention. It was unknown whether a "niche" had to be established for the infused cells, or the effect of competing, resident cells in the marrow. As mentioned above, this was particularly true in the context of HIV infection.
- This invention provides a composition suitable for administration to a human subject comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of the human subject to whom the composition is to be administered, at least 0.52 x 10 6 of such CD34 + hematopoietic cells being transduced by a viral construct which expresses an anti-HIV agent .
- This invention also provides a method of inserting into hematopoietic cells of a human subject a gene of interest comprising : a) mobilizing CD34 + hematopoietic progenitor cells into the blood of the human subject; b) isolating leukocytes from the subject by apheresis; c) isolating CD34 + hematopoietic cells from " the isolated leukocytes by an immunoselective method; d) subjecting the CD34 + hematopoietic cells of step c) to a transduction process with a gene of interest in the presence of an agent that colocalizes the cells with a transduction vector; e) determining the total number of CD34 + hematopoietic cells after step d) , and if the total number is at least 1.63 x 10 6 cells per kg of body weight of the human subject, then proceeding to step f ) , and if the total number of CD34 + hematopoietic cells
- This invention further provides a use of the composition comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of a human subject to whom the composition is to be administered, at least 0.52 x 10 6 CD34 + of such cells per kg being transduced with a viral construct which expresses an anti-HIV agent, for the manufacture of a medicament for the treatment of the human subject infected with HIV.
- kits comprising a) an amount of an agent capable of mobilizing hematopoietic progenitor cells in a human subject; b) a culture medium including at least one cytokine acceptable for culturing CD34 + hematopoietic cells; c) a retroviral vector comprising nucleotides having a sequence that in a cell gives rise to a ribozyme having the sequence 5' - UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC - 3' (Rz2) ; and d) tissue culture vessels coated on their inside with a recombinant fibronectin fragment.
- a package comprising the kit and instructions for its use is also provided by this ideation.
- Figure 1 (A) Replication cycle of a typical retrovirus .
- Virus binds to cell surface receptors on the target cell and the genomic RNA enters the target cell following fusion and viral uncoating.
- (C) cDNA enters the nucleus and is converted into a circular form.
- the viral core is formed from the virally encoded proteins and viral RNA packaged.
- the core obtains a membrane and exits the cell by budding through the cell membrane.
- Figure 1 (B) Proposed mode of action of invention.
- the ribozyme can act at any of several points in the life cycle of the HIV-1 virus. It can cleave the genomic RNA after uncoating and before reverse transcription, or it can cleave viral transcripts in the nucleus or cytoplasm to inhibit translation of viral proteins, or it can cleave newly-formed genomic RNA prior to or during assembly.
- Figure 2 Scientific rationale for use of ribozyme gene transfer to treat HIV/AIDS.
- FIG. 3 Schematic of hematopoiesis .
- the CD34 + hematopoietic progenitor cells give rise to cells of increasing maturity through intermediate progenitor cells.
- Key cells in terms of HIV/AIDS infection are CD4 + T- lymphocytes and the monocytes/macrophages (asterisked) . All of the cells shown schematically are hematopoietic cells.
- FIG. 1 Location of Rz2 target site.
- A Schematic of HIV-1 genome showing location of replicative, regulatory and accessory genes.
- B Ribozyme sequence together with the complementary target and hybridizing sequence within the ta t gene. Cleavage occurs immediately 3' of the triplet GUA.
- C Location of the GUA target sequence in the genes encoding Tat and Vpr proteins.
- FIG. 5 Schematic Representation of CD34 + Phase I Clinical Trial. Ten subjects with HIV-1 infection were enrolled. The LNL6 and RRz2 vector were separately introduced into autologous CD34 + hematopoietic cells. Both populations of cells were infused into the patients without myeloablative treatment .
- Figure 6 Effect of retronectin on transduction. This shows schematically how retronectin facilitates retroviral transduction by bringing the CD34 + cells into close proximity to the retroviral vector.
- Figure 7 Long-term vector presence and expression. Semi- quantitative PCR analysis was performed in leukocyte subsets using primers directed against the neo R gene that overlap the Rz2 sequence in the RRz2 vector. PCR products for LNL6 and RRz2 are 174 and 216 base pairs respectively, and include a tract of the untranslated terminus of the neo R gene.
- Graph A shows LNL6 and RRz2 vector sequences in peripheral blood mononuclear cells (PBMC), bone marrow mononuclear cells (BMMC) , T-lymphocytes and monocytes in patient 5 two years after infusion of transduced CD34 + cells.
- PBMC peripheral blood mononuclear cells
- BMMC bone marrow mononuclear cells
- Graph B shows short- and long-term expression of both LNL6 and RRz2 in PBMC in 3 representative patients, as measured by RT-PCR. Expression was assessed in a reverse-transcriptase (RT+) nested polymerase chain reaction using radiolabelled primer. For each sample, a reaction that did not contain reverse-transcriptase (-RT) was included.
- Graph C Detection of vector sequences in na ⁇ ve T- lymphocytes. Gel shows PCR analysis for LNL6 and RRz2 vector sequences in CD4 + and CD8 + T-lymphocytes, and in na ⁇ ve T- lymphocytes subsets selected from peripheral blood in patient 7 two years after infusion of transduced CD34 + cells.
- D, E and F show detection of vector sequences in na ⁇ ve T-lymphocytes.
- Gel shows PCR results for LNL6 and RRz2 vector sequences in CD4 + and CD8 + T-lymphocytes, and in na ⁇ ve T-lymphocytes subsets selected from peripheral blood in 3 patients.
- Vector sequences were detected in na ⁇ ve T-cell subsets as early as 4 weeks post-infusion (panel F) , and long-term detection is shown in panels E and D, at 2.5 and 2 years after infusion of transduced CD34 + cells respectively.
- FIG. 8 Summary of vector detection by PCR in 10 patients .
- Cells were examined by PCR for LNL6 or RRz2 vector detection up to 36 months post-infusion.
- Cell types were bone marrow mononuclear cells, peripheral blood mononuclear cells (PBMC) , granulocytes, T-lymphocytes and monocytes as indicated. Data are shown for each patient as labeled in the Y-axis. Longer- term gene marking was observed after the use of the fibronectin fragment (CH-296) , which resulted in an increase in transduction efficiency (see table 1) .
- the presence or absence of vector detection is indicated by circles, without regards to vector copy number: black, both vectors detected; open, neither vector detected; circle with vertical stripe, ribozyme vector only detected; circle with horizontal stripe, LNL6 control vector only detected.
- FIG. 9 Comparison between the kinetics of vector decay in T-lymphocytes and bone marrow mononuclear cells. Comparison of rate of decay of vector copies across T-lymphocytes and bone marrow mononuclear cells (BMMC) shows increased persistence of RRz2 marking in T-lymphocytes compared to that of LNL6 (A) . LNL6 marking is shown in (B) . Plots show vector marking level represented as percent of baseline, where baseline is defined as the average of vector copy numbers at weeks 4 and 12 for each cell type (red diamond and line: T-lymphocytes, open squares and black line: BMMC) .
- FIG. 1 shows the plots depicting the linear relationship between RRz2-transduced CD34 + cell dose, and difference between LNL6 and RRz2 copy number (protection index) in T-lymphocytes (C) and PBMC (D) .
- (E) , (F) , (G) and (H) show the comparison between the kinetics of vector decay in T-lymphocytes and bone marrow mononuclear cells, and correlation with transduced-CD34 + cell dose infused. Ribozyme-induced protection against HIV-related cell depletion was assessed by comparing the decay of RRz2 and LNL6 vector DNA in cells vulnerable and nonvulnerable to HIV infection.
- Panel E shows detection of RRz2 and LNL6 vectors by PCR in CD4 + T-lymphocytes for patient 7 at the time points indicated. Radioactivity volumes for each band were normalized to known standards run in the same PCR reaction (not shown) , and the ratio of RRz2 to LNL6 (values shown under each gel) was plotted against time (panel F) . As a negative control for RRz2 protection, the plot of BMMC (which contain mostly cells invulnerable to HIV infection) is shown in panel F (PCR gels not shown) .
- RRz2 gene marking for a given patient was related to the number of RRz2-transduced cells infused, the difference between decay slopes of each vector for was correlated (spearman rank) with the number of RRz2-transduced CD34 + cells reintroduced.
- Patient-specific decay slopes for LNL6 and RRz2 marking were calculated by linear regression, and the difference between these slopes
- Panels G and H show the plots depicting this linear relationship and confidence intervals (dotted lines) between RRz2-transduced CD34 + cell dose, and difference between LNL6 and RRz2 copy number (protection index) in T- lymphocytes (plot H) and PBMC (plot G) .
- FIG. 10 Absolute CD4 + cell counts (A) and viral loads (B) in study patients. Absolute CD4 + cell counts per mm 3 (A) and viral loads (B) in HIV RNA copies per ml of blood are shown for patient Nos. 1-10 through the study. An initial increase in viral load was observed at day 1 post-infusion in some patients who discontinued antiretroviral therapy during the period of mobilization. Drug discontinuation or substitution of nucleoside reverse transcriptase inhibitors for non- nucleoside reverse transcriptase inhibitor or protease inhibitor was included in the protocol to prevent potential inhibition of MMLV reverse transcriptase during transduction. Occasional rises in viremia were corrected after modification of antiretroviral therapy.
- Figure 11 Long-term marking of hematopoietic cell populations in Patient #005 from the Phase I Autologous CD34 + study. Shown in the gel are PCR amplified bands from LNL6 and RRz2 marked cells in bone marrow and peripheral blood populations 2 years post-infusion.
- FIG. 12 Gene Expression in Peripheral Blood Mononuclear Cells in 4 patients from the Phase I autologous CD34 + cell study. Expression of both LNL6 and RRz2 is shown for 2 patients at 2 years post-infusion. Expression was assessed in a reverse transcriptase-nested PCR reaction using radiolabelled primer. For each sample, a reaction that did not contain RT (-RT) was included. Presence or absence of RT is indicated.
- FIG. 13 Long-term marking of T-lymphocyte (CD4 + , CD8 + ) sub- populations in Patient #007. Results show the marking in na ⁇ ve and memory CD4 + and CD8 + lymphocytes 1 year post-infusion of the autologous LNL6 or RRz2 transduced CD34 + cells.
- FIG. 14 Schematic design of an RNAi with multiple- targeting ability.
- the RNA transcript contains three RNAi units each containing sense (IA, 2A, 3A) and antisense (IB, 2B, 3B) segments separated by spacers (SP) .
- the RNAi units are flanked by self cleaving hammerhead and hairpin ribozymes, which cleave at the positions indicated by arrows.
- This invention provides a composition
- a composition comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of the human subject to whom the composition is to be administered, at least 0.52 x 10 6 of such CD34 + hematopoietic cells being transduced with a viral construct which expresses an anti-HIV agent.
- the composition comprises at least about 1.7 x 10 6 CD34 + hematopoietic cells per kg, at least about 0.5 x 10 6 of such cells per kg being transduced with the viral construct.
- the composition is suitable for administration to a human subject.
- the human subject may be an adult.
- the viral construct may be a retroviral construct.
- the composition may also be substantially free of cytokines, or substantially free of virus.
- This invention also provides a composition where at least 5 x 10 6 CD34 + hematopoietic cells per kg of body weight of a human subject to whom the composition is to be administered are transduced; or comprising at least 9.37 x 10 6 CD34 + hematopoietic cells per kg of body weight of a human subject, wherein at least 5 x 10 6 of such CD34 + hematopoietic cells are transduced; or comprising at least about 10 x 10 6 CD34 + hematopoietic cells per kg of body weight where at least 5 x 10 6 such cells are transduced; or where the anti-HIV agent is an RNA molecule; or where the anti-HIV agent is an RNAi molecule; or where the anti-HIV agent is an antisense molecule; or where the anti-HIV agent is a ribozyme.
- the ribozyme may comprise nucleotides having the sequence 5'- UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC -3' (Rz2).
- the transduced CD34 + cells are capable of engraftment, and of giving rise to progeny cells for at least 12 months, in the subject.
- the cells may be in a primary cell culture.
- compositions comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of the subject to whom the composition is to be administered, at least 0.52 x 10 6 of such CD34 + hematopoietic cells being transduced with a viral construct which expresses an anti-HIV agent, wherein the composition is produced by a process comprising the steps of:
- composition (e) mixing the CD34 + hematopoietic cells with a pharmaceutically acceptable carrier, to thereby obtain the composition.
- the composition is suitable for administration to a human subject.
- the culturing of step (b) may be performed in the presence of at least one cytokine, at least two cytokines or only two cytokines.
- Step (c) may be performed in the presence of a recombinant fibronectin fragment.
- This invention also provides a composition
- a composition comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of the human subject to whom the composition is to be administered, at least 0.52 x 10 6 CD34 + of such CD34 + hematopoietic cells being transformed with a gene of interest not found in the CD34 + cells prior to transformation.
- the composition is suitable for administration to a human subject.
- the numbers of cells can be as defined above.
- the subject may be an adult.
- the gene of interest may express an RNA agent.
- This invention yet also provides a composition
- a composition comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of a human subject to whom the composition is to be administered, at least 0.52 x 10 6 CD34 + of such CD34 + hematopoietic cells being transformed with a gene of interest not found in the CD34 + cells prior to transformation, wherein the composition is produced by a process comprising the steps of:
- composition is suitable for administration to a human subject.
- the numbers of cells can be as defined above.
- the subject may be an adult.
- the gene of interest may express an RNA agent .
- This invention further provides a method of inserting into hematopoietic cells of a human subject a gene of interest comprising : a) mobilizing CD34 + hematopoietic progenitor cells into the blood of the human subject; b) isolating leukocytes from the subject's blood by apheresis; c) isolating CD34 + hematopoietic cells from the isolated leukocytes by an immunoselective method; d) subjecting the CD34 + hematopoietic cells of step c) to a transduction process with a gene of interest in the presence of an agent that colocalizes the cells with a transduction vector; e) determining the total number of CD34 + hematopoietic cells after step d) , and if the total number is at least 1.63 x 10 6 cells per kg of body weight of the human subject, then proceeding to step f ) , and if the total number of CD34 + hematopoi
- the agent that colocalizes the cells with a transduction vector may be -a fragment of fibronectin.
- step f) may be performed without myeloablation.
- Step a) of mobilizing hematopoietic progenitor cells in the subject may be performed by administering to the subject an amount of a cytokine sufficient to mobilize the hematopoietic progenitor cells.
- apheresis may be performed at least twice .
- the step of subjecting the CD34 + hematopoietic cells to a transduction process with a gene of interest is performed in the presence of a recombinant fibronectin fragment, which may be recombinant fibronectin fragment CH- 296.
- the gene of interest may encode an anti-HIV agent.
- the anti-HIV agent may be an RNA molecule; or an RNAi molecule; or an antisense molecule; or a ribozyme.
- the ribozyme may comprise nucleotides having the sequence 5'- UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC -3' (Rz2) .
- step e) if the total number of CD34 + hematopoietic cells after step d) is less than 1.63 x 10 6 cells per kg of body weight of the human subject, then further including a step of cryogenically storing the CD34 + hematopoietic cells from step d) , repeating steps a)-d), and combining any- cryogenically stored cells with the cells from step d) .
- the specific number of cells to be obtained may be increased as described above.
- all or almost all of the CD34 + hematopoietic cells of step e) are delivered to the subject, for example at least 90% of the total number.
- the method may further comprise a step of culturing the isolated CD34 + hematopoietic cells of step c) in the presence of at least two cytokines or a cytokine mixture.
- the cytokine mixture may comprise one or more cytokines selected from the group consisting of stem cell factor (SCF) , megakaryocyte growth and development factor (MGDF) , Flt-3 ligand (FL, sometimes abbreviated Flt-3), interleukin 3 (IL- 3), granulocyte-macrophage colony stimulating factor (GM-CSF) 5 and thrombopoietin (TPO) .
- SCF stem cell factor
- MGDF megakaryocyte growth and development factor
- Flt-3 ligand FL, sometimes abbreviated Flt-3
- IL- 3 interleukin 3
- GM-CSF granulocyte-macrophage colony stimulating factor
- TPO thrombopoietin
- the cytokine mixture may further comprise one or more cytokines selected from the group consisting of interleukin 1 (IL-1), interleukin 4 (IL-4), interleukin 5 (IL-5), interleukin 6 (IL-6), interleukin 7 (IL- 7), interleukin 9 (IL-9), interleukin 11 (IL-11), interleukin
- IL-1 interleukin 1
- IL-4 interleukin 4
- IL-5 interleukin 5
- IL-6 interleukin 6
- IL- 7 interleukin 9
- IL-11 interleukin 11
- IL-12 interleukin 15
- G-CSF granulocyte colony stimulating factor
- M-CSF macrophage colony stimulating factor
- EPO erythropoietin
- LIF leukemia inhibitory factor
- TGF- ⁇ transforming growth factor beta
- MIP-1 macrophage inhibitory protein 1
- TNF tumor necrosis factor
- SDF-1 stromal cell-derived factor 1
- the cytokine mixture comprises one cytokine selected from a first group and one cytokine selected from a second group, wherein the first group
- the 20 consists of SCF, MGDF, FL, IL-3, GM-CSF, TPO, IL-1, IL-4, IL- 5, IL-6, IL-7, IL-9, IL-11, IL-12, IL-15, G-CSF, M-CSF, EPO, LIF, TGF- ⁇ , MIP-1, TNF and SDF-1, and wherein the second group consists of MGDF, FL, GM-CSF, TPO, IL-1, IL-4, IL-5, IL-7, IL- 9, IL-11, IL-12, IL-15, G-CSF, M-CSF, EPO, LIF, TGF- ⁇ , MIP-1,
- This invention further provides a method of inserting into hematopoietic cells of a human subject a gene of interest comprising: 30 a) mobilizing CD34 + hematopoietic progenitor cells into the blood of the subject; b) isolating leukocytes from the subject's blood by apheresis; c) isolating CD34 + hematopoietic cells from the isolated leukocytes by an immunoselective method; d) determining the total number of CD34 + hematopoietic cells after step c) , and if the total number is at least 1.63 x 10 6 cells per kg of body weight of the human subject, then proceeding to step e) , and if the total number of CD34 + hematopoietic cells after step c) is less than 1.63 x 10 6 cells per kg of body weight of the human subject, then performing steps b)-c) and combining the CD34 + hematopoietic cells; e) subject
- the invention further provides a method of inserting into hematopoietic cells of a human subject a gene that expresses a ribozyme comprising nucleotides having the sequence 5' - UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC - 3' (Rz2) comprising: a) mobilizing CD34 + hematopoietic progenitor cells into the blood of the subject by administering to the subject an amount of a cytokine sufficient to mobilize the hematopoietic progenitor cells; b) isolating leukocytes from the subject's blood by apheresis, which is performed at least twice; c) isolating CD34 + hematopoietic cells from the isolated leukocytes by an immunoselective method; d) culturing the isolated CD34 + hematopoietic cells of step c) for about one day in a culture medium in the presence of
- compositions comprising a pharmaceutically acceptable carrier and at least 1.63 x 10 6 CD34 + hematopoietic cells per kg of body weight of a human subject to whom the composition is to be administered, at least 0.52 x 10 6 CD34 + of such cells per kg being transduced with a viral construct which expresses an anti-HIV agent, for the manufacture of a medicament for the treatment of the human subject infected with HIV.
- kits comprising elements for use in carrying out the described methods.
- a specific embodiment of a kit comprises a) an amount of an agent capable of mobilizing hematopoietic progenitor cells in a human subject; b) a culture medium including at least one cytokine acceptable for culturing CD34 + hematopoietic cells; c) a retroviral vector comprising nucleotides having a sequence that in a cell gives rise to a ribozyme having the sequence 5'- UUA GGA UCC UGA UGA GUC CGU GAG GAC GAA ACU GGC UCC -3' (Rz2) ; and d) tissue culture vessels coated on their inside with a recombinant fibronectin fragment.
- kits comprising the described kits and instructions for the use of the kits.
- the total combined time taken for the steps of culturing and transducing the CD34 + hematopoietic cells is not more than about three days, that is, the time during which the cells are in a culture medium at 37°C in the presence of added cytokines (at normal levels) is not more than about three days.
- the time during which the cells are in culture media in the presence of more than one cytokine is not more than three days.
- the transduction of the cells may be performed in the presence of a recombinant fibronectin fragment CH-296 or an equivalent agent.
- compositions and methods of this invention can be used to treat any of a variety of diseases in which there is a genetic aspect.
- diseases of the blood or immune systems include hemoglobinopathies, defects of leukocyte production or function including cancers, immune deficiencies such as HIV, viral infections, lysosomal storage diseases and stem cell defects such as Fanconi' s anemia, chronic granulomatous disease, Gaucher' s disease, G6PD deficiency etc. They also include infectious diseases such as AIDS/HIV infection or acquired disease such as cancers or cardiovascular diseases.
- the present invention relates to gene therapy, particularly as applied to hematopoietic progenitor (HP) cells, to transduced cells and methods of obtaining them, and to methods of using them to provide prolonged engraftment of modified hematopoietic cells in human subjects.
- the invention particularly relates to ex vivo gene therapy of HP cells for treatment or prevention of HIV infection.
- the invention provides compositions of transduced HP cells that comprise sufficient numbers of totipotent cells capable of providing therapeutic benefit.
- this invention provides compositions of transduced human HP cells and methods of gene therapy against HIV in order to give rise, in human subjects, to protected T-lymphocytes.
- the transduced human HP cells of the composition or system are capable of long-term engraftment when infused into a patient, giving rise to differentiated hematopoietic cells for at least 12 months after infusion, preferably at least 24 months and even more preferably at least 30 months after infusion.
- the transduced human HP cells are capable of long-term engraftment when infused into an autologous subject.
- the transduced human HP cells are capable of long- term engraftment when infused into a subject without myeloablation .
- compositions or system comprising transduced human HP cells in sufficient numbers that, when delivered into a human subject, provide long term engraftment at a level such that at least 0.01% gene-modified cells of at least one cell type can be detected in the blood or bone marrow for example, by biopsy.
- the cell type be T-lymphocytes or macrophages/monocytes .
- the level of gene-modified cells is at least 0.1%, more preferably at least 1% and most preferably at least 10%. It is preferred that the transduced cells are delivered into an autologous subject. It is preferred that the transduced cells are delivered in the absence of myeloablation.
- transduced gene is for treatment of diseases other than SCID, for example cancers and infectious diseases. It is more preferred that the transduced gene is for treatment or prevention of HIV infection.
- the HP cells for transduction were preferably obtained from one subject.
- the CD34 + purity of the transduced human HP cells should be at least 65%, preferably at least 90% and more preferably at least 95%.
- the percentage transduction should be at least about 10%, preferably at least about 30% and more preferably at least about 50%.
- the transduced human HP cells are derived from CD34 + cells isolated from the blood of a human subject after mobilization of HP cells into the peripheral blood. Mobilization can be achieved by the use of cytokines, preferably one or more from the group consisting of granulocyte colony-stimulating factor (G-CSF) , conjugated G- CSF, pegylated G-CSF and granulocyte-macrophage colony- stimulating factor (GM-CSF).
- G-CSF granulocyte colony-stimulating factor
- GM-CSF granulocyte-macrophage colony- stimulating factor
- the cytokine (s) may further comprise stem cell factor (SCF), interleukin 3 (IL-3), or stromal cell-derived factor-1 (SDF-1, Lataillade et al 2000) or similar acting cytokines.
- SCF stem cell factor
- IL-3 interleukin 3
- SDF-1 stromal cell-derived factor-1
- Mobilization may be assisted by the use of a short course of chemotherapy with agents such as cyclophosphamide. More preferably, mobilization is carried out using G-CSF or pegylated G-CSF.
- the cytokine (s) may be administered daily at an amount of at least about 10 ⁇ g per kg of weight of the subject and more preferably at about 30 ⁇ g per kg.
- the CD34 + cells may be collected by apheresis on days 3, 4, 5, 6 or later after beginning cytokine treatment. Preferably, apheresis is carried out at least twice.
- the CD34 + cells may be selected by any of the clinical grade devices known in the art such as the Isolex 300i cell selection system or the CEPRATE SC Stem Cell Concentration System.
- the CD34 + cells are treated prior to transduction with a cytokine mixture, preferably comprising MGDF and SCF, or essentially MGDF and SCF, to induce entry into cell cycle, preferably at concentrations of about 100 ng/ml and 50 ng/ml, respectively. It is preferred that cell cycle induction occur in the absence of added cytokines IL-3, IL-6 or SCF, or the combination of the three of these.
- a cytokine mixture preferably comprising MGDF and SCF, or essentially MGDF and SCF, to induce entry into cell cycle, preferably at concentrations of about 100 ng/ml and 50 ng/ml, respectively. It is preferred that cell cycle induction occur in the absence of added cytokines IL-3, IL-6 or SCF, or the combination of the three of these.
- the transduced human HP cells contain an introduced gene which may encode one or more proteins or RNA molecules, for example antisense molecules, RNAi molecules, RNA decoys or ribozyme RNA (ie. RNA agents) .
- the introduced gene may be any introduced gene provided that the encoded protein or RNA or both alter the properties of the transduced human HP cells in a desired way compared to the non-transduced HP cells.
- the introduced gene when expressed, provides resistance to the transduced HP cells or to differentiated progeny of these cells against viral infection, preferably resistance against HIV infection. More preferably, the introduced gene encodes antisense or ribozyme RNA capable of inhibiting HIV-1 replication in cells.
- Types of ribozymes which may be directed against viral infection such as HIV-1 infection or against non-viral diseases include the hammerhead, hairpin, RNAse P, hepatitis delta virus (HDV) , intervening sequence ribozymes of the Group I or Group II type, or catalytic motifs selected by in vi tro selection methods.
- the ribozymes are preferably hammerhead or hairpin ribozymes, more preferably hammerhead ribozymes. Such ribozymes are capable of cleaving RNA molecules associated with the disease.
- the invention includes the use of multiple ribozymes (eg. Ramezani et al 2002), for example a ribozyme with multiple catalytic domains, or a combination of types of ribozymes. This should reduce the likelihood of viral resistance in the case of treatment of virus infection. It is also preferred that the ribozyme cleavage site(s) is highly conserved in the viral target RNA, as is the case for the Rz2 cleavage site. Any combination of the above is also possible, providing more than one mechanism of effect.
- the transduced human HP cells of the composition or system are transduced by DNA or a plasmid or viral transfer vector. It is desired that the introduced gene is integrated into the cell genome, after reverse transcription if appropriate.
- the cells are transduced with a retroviral vector, for example a murine retroviral vector or a lentiviral vector. More preferably, the retroviral vector is derived from LNL6 (Bender et al. 1987) or other oncoretroviral vector.
- the cells are transduced with RRz2.
- the introduced gene is expressed in the transduced human HP cells or progeny cells from a promoter.
- the promoter may be constitutively expressed or inducible, for example being expressed preferentially under favorable conditions or circumstances.
- the gene may be transcribed by RNA polymerase II (RNA pol II promoters) or by RNA polymerase III.
- the composition is formulated to be ready for delivery into a human subject.
- the great majority of cells should be viable for example greater than 95% and preferably greater than 98%.
- the volume of the composition is preferably from about 10 ml to about 1000 ml, more preferably from about 100 ml to about 500 ml.
- the composition comprises a pharmaceutically acceptable carrier which is preferably a buffered salts solution comprising a protein agent such as an albumin or gelatine and/or a sugar such as glucose, which agents may act to stabilize the cells.
- the carrier may contain anticoagulant agents such as sodium citrate.
- the carrier may comprise a plasma expander, well known in the art.
- the composition is sterile (bacterial, fungal, mycoplasma) , detectably free of bacteria, endotoxin, mycoplasma, HIV p24 antigen or replication-competent retrovirus, substantially free of free transducing vector, or any combination of these.
- the composition is substantially free of added cytokines.
- the composition is administered to the subject by parenteral means, preferably by infusion or injection on one or more occasions.
- the invention also provides methods for gene therapy of hematopoietic cells, particularly hematopoietic progenitor cells, using the compositions as described herein.
- the invention also provides methods of treatment or prevention of genetic or infectious diseases, for example HIV infection.
- the methods may comprise the use of the CH-296 fragment of human fibronectin (RetroNectinTM) or equivalent, or one or more debulking steps to remove unwanted cells, or one or more washing steps.
- Gene therapy can be carried out ex vivo or in vivo .
- the methods described here preferably apply to the ex vivo approach but could also be applied to in vivo approaches (for example, Newbound et al., 2001).
- the invention can be performed for subjects already having disease, or prophylactically to reduce the occurrence or prevent disease.
- HP cells for use in the methods of the invention can be obtained from peripheral blood, bone marrow, umbilical cord blood, or from stem cells that give rise to hematopoietic cells. They are preferably obtained from peripheral blood after mobilization. HP cells can be mobilized into the peripheral blood by administering one or more cytokines, with or without administration of a chemotherapeutic agent.
- the cytokines may be selected from the group consisting of G-CSF, pegylated G-CSF, conjugated G-CSF, GM-CSF and any combination of the above.
- the cytokines may further comprise one or more selected from the group consisting of SCF, FL and IL-3.
- the methods of the invention are capable of providing at least 0.01% of gene-modified hematopoietic cells long term in a patient in the absence of myeloablation.
- Hematopoietic cells refer to cells normally found in the blood as well as cells that give rise to cells normally found in the blood, such as cells found in the bone marrow.
- "normally” includes the situation where a person is treated to alter the number or quality of cells in the blood or bone marrow.
- Viral vector is used herein to mean a vector that comprises all or parts of a viral genome which is capable of being introduced into cells and expressed.
- Such viral vectors may include native, mutant or recombinant viruses.
- Such viruses may have an RNA or DNA genome.
- suitable viral vectors include retroviral vectors (including lentiviral vectors), adenoviral vectors, adeno-associated viral vectors and hybrid vectors.
- a retroviral vector is a viral vector where the virus is from the family retroviridae .
- a “construct” is used to mean recombinant nucleic acid which may be a recombinant DNA or RNA molecule, that has been generated for the purpose of the expression of a specific nucleotide sequence (s), or is to be used in the construction of other recombinant nucleic acids.
- "construct” is used herein to refer to an isolated, recombinant DNA or RNA molecule .
- an "anti-HIV agent” as used here refers to any agent that can be expressed by a mammalian cell and which inhibits the replication of HIV or the entry of HIV into the mammalian cell.
- agents may be nucleic acids or polypeptides.
- Capable of engraftment is used in here to refer to the ability of a hematopoietic cell to implant into the bone marrow for an extended period of time, e.g. at least one year. Implantation may be detected directly (e.g. by biopsy) or by the production of progeny cells in the blood.
- cytokine is used to refer to any number of hormone like, low-molecular weight proteins, whether secreted by various cell types or recombinant, that regulate the intensity and duration of cell growth or function, for example cell-to- cell communication. Cytokines are involved, for example, in mediating immunity, allergy, and in regulating maturation and growth of cells.
- An “adult” is used here to refer to a fully grown and physically mature human subject. Generally accepted age of a human “adult” is 18 years or more.
- Transduction is used to refer to the introduction of genetic material into a cell by using a viral vector.
- transduced cell results from a transduction process and contains genetic material it did not contain before the transduction process, whether stably integrated or not.
- transduced cells may refer to a population of cells which has resulted from a transduction process and which population includes cells containing the genetic material and cells not containing the genetic material, whether stably integrated or not .
- Transfection refers to the introduction of genetic material into a cell without using a viral vector. Examples of transfection include insertion of "naked" DNA or DNA in liposomes, that is without a viral coat or envelope.
- Myeloablation refers to treatment, generally chemical or radiological, which results in the destruction of at least a significant part of the myeloid compartment (which includes hematopoietic progenitor cells) in a patient. Myeloablation does not include conditioning treatments which may cause only a minor or unsubstantial destruction of cells of the myeloid compartment.
- pharmaceutically acceptable carrier is used to mean any of the standard pharmaceutically acceptable carriers. Examples include, but are not limited to, phosphate buffered saline, physiological saline, and water.
- Recombinant fibronectin fragment is used to refer to an agent that functions to colocalize the cells with the vector during the transduction process and is based on the activity of fibronectin.
- RetroNectinTM for example, RetroNectinTM, TaKaRa Shuzo Co.
- fibronectin fragment that contains three domains, a central cell binding domain that binds to integrin VLA-5, a high affinity heparin-binding domain that binds proteoglycans, and a CS-1 site within the alternatively splices IIICS region that binds integrin VLA-4 (Williams
- Equivalent retronectins contain three domains that are functionally equivalent to RetroNectinTM, while colocalization agents that are similar to RetroNectinTM contain at least two domains that are functionally equivalent.
- Nucleic acid sequence refers to an oligonucleotide, or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof, and to naturally occurring or synthetic molecules.
- antisense refers to nucleotide sequences which are complementary to a specific DNA or RNA sequence.
- antisense strand is used in reference to a nucleic acid strand that is complementary to the “sense” strand.
- Antisense molecules may be produced by any method, including synthesis by ligating the gene(s) of interest in a reverse orientation to a promoter which permits the synthesis of a complementary strand. Once introduced into a cell, this transcribed strand combines with natural sequences produced by the cell to form duplexes. These duplexes then block either the further transcription or translation. In this manner, mutant phenotypes may be generated.
- the designation “negative” is sometimes used in reference to the antisense strand, and "positive” is sometimes used in reference to the sense strand.
- the model selected to prove the principles of the invention is an HIV infected human.
- An effective, long term and practical treatment or eradication or prevention of HIV infection in a human subject has been an elusive goal.
- the advantages of the invention are exemplified in the context of a highly complex problem, i.e. therapy against HIV infection in a human subject .
- compositions or methods of the invention including any of the blood or immune systems.
- diseases include hemoglobinopathies, defects of leukocyte production or function, immune deficiencies, lysosomal storage diseases and stem cell defects such as Fanconi' s anemia, chronic granulomatous disease, Gaucher' s disease, G6PD deficiency etc.
- stem cell defects such as Fanconi' s anemia, chronic granulomatous disease, Gaucher' s disease, G6PD deficiency etc.
- Fanconi' s anemia chronic granulomatous disease
- Gaucher' s disease Gaucher' s disease
- G6PD deficiency etc.
- Many of these disorders have been successfully treated by allogeneic HP cell transplants
- the invention provides advantages where autologous HP cells are used.
- the invention can also be used to confer resistance to HP cells or their progeny against myelosuppressive effects.
- the invention can also be used to treat infectious disease, such as the exemplified AIDS or other viral infection such as HTLV-1 (Bunnel and Morgan 1998), or acquired diseases such as cardiovascular diseases (for example, see Orlic et al 2001) or cancers.
- infectious disease such as the exemplified AIDS or other viral infection such as HTLV-1 (Bunnel and Morgan 1998)
- acquired diseases such as cardiovascular diseases (for example, see Orlic et al 2001) or cancers.
- cancers bone marrow transplantation techniques have been used for a variety of cancers including those primarily of the hematopoietic system.
- Genes that can be used include the multidrug resistance (MDR) gene which confers resistance to anthracyclines, Vinca alkaloids, podophyllins and taxol, and mutant dihydrofolate reductase (mDHFR) genes to confer resistance to methotrexate or trimetrexate, and genes for O-alkylguanine-DNA- alkyltransferase for resistance to alkylating agents.
- MDR multidrug resistance
- mDHFR mutant dihydrofolate reductase
- the gene therapy methods of this invention can be also used in treatment of malignancies by altering the immune response to the cancerous cells or simply by marking cells to monitor the efficacy of conventional therapies (Cornetta et al 1996) .
- partial or complete myeloablation will often be performed prior to delivery of the modified cel l s .
- HIV Human Immunodeficiency Virus
- HIV-2 The Human Immunodeficiency Virus
- Replication of HIV-1 is now well understood.
- the current standard treatment uses a combination of antiretroviral drugs, often three or more, and may provide control of HIV replication in the short-term but is often associated with negative aspects such as drug toxicity, viral resistance, awkward dosing regimes, and cost of treatment.
- gene therapy for HIV/AIDS aims to replace a fraction of the HIV-infected cellular pool with cells engineered to inhibit virus replication.
- This strategy can potentially contribute to virus eradication by protecting CD4 + cells and by allowing the establishment of an antiviral response mediated by protected immune elements.
- it is essential that i) a degree of immune reconstitution occur in the setting of HIV infection, ii) the reconstituted immune system be protected against HIV-induced depletion, enabling it to recognize antigen and to protect the host against pathogens. It is desired that this strategy impact on viral load.
- HAART highly active antiretroviral therapy
- peripheral blood progenitor cells to undergo T-lymphocyte development in the adult thymus has not previously been elucidated in the setting of active HIV replication, as the emergence of T-lymphocytes after autologous transplantation of HIV patients could be ascribed to T-lymphocyte development arising from endogenous residual T-lymphocyte precursors (Gabarre et al 2000) .
- uninfected adult patients receiving allogeneic hematopoietic progenitor cell transplantation using selected CD34 + cells display marked delay and suboptimal T-lymphocyte recovery, indicating subnormal thymic activity after intensive bone marrow suppression (Behringer et 1999; Martinez et al 1999) .
- T-lymphoid development It should also be considered that potential factors inherent to the methods employed in genetic manipulation of hematopoietic progenitors might affect their ability to undergo T-lymphoid development. These previously identified factors include the induction of progenitors into cell cycle in preparation for transduction with murine retroviruses (Roe et al 1993) , which could result in myeloid lineage commitment, and the presence of a constitutively expressed foreign gene that might interfere with the required processes of progenitor cell migration, homing and differentiation. Therefore we sought to determine whether genetically protected T- lymphocytes, including na ⁇ ve T-lymphocytes, could be produced in the context of adult HIV infection.
- Retroviral infection of a cell is initiated by the interaction of viral glycoproteins with cellular receptors (A) (see Figure 1). Following adsorption and uncoating, the viral RNA enters the target cell and is converted into cDNA by the action of reverse transcriptase, an enzyme brought within the virion (B) .
- the cDNA adopts a circular form (C) , is converted to double-stranded cDNA and then becomes integrated into the host cell's genomic DNA by the action of integrase (D) .
- proviral cDNA is transcribed from the promoter within the 5' LTR (E) .
- the transcribed RNA including the mRNAs for gag, pol and env and the regulatory factors tat, rev and vpr are translated to produce the viral proteins (F) or is left as nascent viral RNA.
- This viral RNA contains a Psi packaging sequence which is essential for its packaging into virions (G) .
- G virions
- retroviruses do not cause lysis of the host cell; HIV is an exception to this.
- the proviral cDNA remains stably integrated in the host genome and is replicated with the host DNA so that progeny cells also inherit the provirus.
- Potential anti-viral agents may be targeted at any of these replicative control points. For example, down-regulation of the CCR5 receptor can inhibit HIV- 1 replication (Bai et al 2000) .
- RNAi eg. Novina et al 2002
- Transdominant (mutant) proteins act by binding to HIV RNA or factors required for HIV replication. They have an altered function compared to the non-mutant protein such that they interfere with the function of the non-mutant protein. They may be a fusion protein, combining two or more activities.
- the transdominant protein is the RevMlO protein
- RevMlO transduced CD34 + cells isolated from human umbilical cord blood or peripheral blood gave rise to mature thymocytes in a mouse model and protected T cells against HIV-1 (Bonyhadi et al 1997) . Furthermore, retroviral delivery of RevMlO to CD4 + cells protected these cells in HIV-infected individuals (Ranga et al 1998).
- Intracellular antibodies generally of the single-chain type, such as that produced from the retroviral construct pSLXCMV (Shaheen et al 1996), can inhibit the HIV life cycle by binding or sequestering specific viral proteins.
- anti-reverse transcriptase (RT) antibody fragments inhibited HIV infection in vitro (Maciejewski et al 1995) .
- Antisense RNA may bind to viral RNA, either genomic or transcription products, and destabilize the RNA or inhibit 5 processes such as translation or export from the nucleus. Binding to the nascent viral RNA may also act to inhibit productive packaging of RNA into virions.
- the complementary region for an antisense molecule can be as short as 15 nucleotides, more
- RNAs preferably more than 30 nucleotides, and most preferably between 100 and 500 nucleotides in length. Inhibition of HIV-1 replication has been demonstrated for antisense RNAs targeted against several viral regulatory and structural genes including pol , gag, env, ta t , vif, and psi (see Veres et al
- the retroviral vector HGTV43 encodes an antisense molecule targeting tar and two separate sites of the tat/rev region in the HIV-1 genome. This molecule has been shown to provide protection against HIV infection in vi tro .
- RNA decoys such as RRE decoys and TAR decoys have also been used to protect cells against HIV (Lee et al 1994, Lisziewicz et al 1993) and are preferably used in a polymeric form to increase the ability to bind HIV-1 related proteins and
- Ribozymes may act not only by binding viral RNAs but also by cleaving and inactivating them and so are attractive for use with this invention. They consist of one or more (usually two) regions of complementarity to the target RNA and a catalytic region that provides enzymatic activity. Ribozymes, particularly those with longer hybridizing arms, may also act through mechanisms similar to those used by antisense molecules.
- the most widely used ribozyme motifs are the hammerhead and hairpin types, which are described in US Patent
- the retroviral vector pTCAG encodes a hairpin ribozyme targeting the U5 region (position +111/112 from the cap site) of HIV-1 LTR fused with part of an RRE sequence and a ribozyme targeting the rev/env coding region
- RNAi molecules are those with double stranded RNA regions that trigger host cell RNA degradation mechanisms in a sequence- specific manner. They may therefore be used to inactivate endogenous RNAs or pathogen RNA such as HIV-1 RNA.
- Each double stranded region may be relatively short, for example 21-25 base pairs in length, preferably less than about 30 base pairs in length and more preferably with a double stranded region of 19 to 25 base pairs. It is preferred that there be not more than one mismatch (mismatches are defined as not including G:U pairs) in each double-stranded region, more preferably no mismatches, and most preferred that the double stranded region (s) be perfectly matched. Where the targeted molecule is variable (eg.
- HIV-1 RNA HIV-1 RNA
- highly conserved regions should be targeted.
- a family of variants can be targeted provided they do not have more than one mismatch with one or other of the strands of the double-stranded region of the RNAi molecule.
- the RNAi duplexes may also be produced from longer RNA transcripts by splicing or self- ⁇ l RSVJ n ⁇ m p ans, for example by incorporating self-cleaving ribozymes between or flanking the duplex regions.
- RNAi molecules are easily formed from DNA molecules having an inverted repeat structure.
- RNAi duplexes may be formed from two RNA molecules with complementary regions. RNAi molecules with double-stranded regions of greater than 30 -base pairs can be used if they are nuclear localized, eg. if they are made without signals for cytoplasmic export such as polyadenylated sequences. Until recently, RNAi had not been shown to work in human cells. Recently, however, RNAi (also called iRNA, or short siRNA, or hairpin RNA) has been shown to inhibit HIV-1 replication in T lymphocytes (Novina et al 2002).
- RNAi molecules targeted to the viral LTR, or the accessory vif and nef genes inhibited early and late steps of HIV replication in cell lines and primary lymphocytes (Jacque et al 2002).
- RNAi has also been successfully targeted to other viruses (eg. Gitlin et al 2002) and can be targeted against endogenous genes .
- RNA agents disclosed herein for use in the invention can be expressed from viral promoters (eg retroviral LTR, cytomegalovirus) or other promoters utilizing RNA polymerase II for high level expression.
- the RNA agent can be incorporated into longer transcripts, for example in the 3' untranslated region of a marker gene.
- the transcript may be engineered for self-cleavage for release of the agent.
- the RNA agent may also be expressed from RNA polymerase III promoters using gene constructs derived from tRNA genes, adenovirus VA1, Ul and U6 or other small nuclear RNA genes.
- the RNA agent may be provided with signals that aid in colocalizing the agent with the target molecule (for example, see Michienzi et al 2000) .
- Hematopoietic cells include cells normally found in the blood as well as cells that give rise to cells normally found in the blood, such as cells found in the bone marrow.
- "normally” includes the situation where a person is treated to alter the number or quality of cells in the blood or bone marrow.
- the process of differentiation of hematopoietic cells is shown schematically in Figure 3.
- Hematopoiesis is the process through which the blood-forming system is maintained. This process involves a balance between cell death and regeneration and differentiation of new cells.
- T-lymphocytes Production of mature lymphoid cells requires that precursors leave the bone marrow, pass through the selection mechanisms within the thymus and be exported as na ⁇ ve cells into the peripheral blood. The efficiency of this process is age related as the thymus involutes with age and its rate of CD4 + T-lymphocyte export decays accordingly. Survival and expansion of T-lymphocytes to give rise to activated and memory T-cells is dependent on natural homeostatic mechanisms.
- Hematopoiesis is maintained by a pool of pluripotent hematopoietic stem (HS) cells which have the long term capacity for self-renewal as well as giving rise to progeny which proliferate and differentiate into mature effector blood cells of both the myeloid ' and lymphoid groups (Ogawa et al 1993, Orlic and Bodine 1994).
- the numbers of HS cells are maintained by cell division so that these cells are effectively immortal. At least in theory, the whole hematopoietic system could be regenerated from a single HS cell. Many of the HS cells are quiescent in the body (Hodgson and Bradley 1979, Jones et al 1990) .
- Hematopoietic progenitor (HP) cells are characterized by the presence of the CD34 cell surface antigen and their ability to give rise to multilineage progeny of both the myeloid and lymphoid types. Some CD34 + hematopoietic progenitor cells have the capacity for self-renewal and can be considered true stem cells, while other CD34 + hematopoietic cells may not have the capacity for self-renewal or only a limited capacity. The CD34 + antigen is absent on more mature hematopoietic cells.
- the CD34 + cells are themselves heterogenous (Bertolini et al 1998) and can be fractionated into subpopulations based on expression of other markers, for example CD38 (Hogan et al 2002) .
- 2.5 x 10 4 CD34VCD38 " (CD34 + /CD381ow) cells may be equivalent to 5 x 10 5 CD34 + cells.
- markers that can be used to enrich the cell population for cells with long-term reconstituting ability include Thy- 1 + , CD133 + , human KDR + (VEGF receptor) , human ClQR p + , HLA-DR " , and low-level retention of vital dyes such as Rhodamine 123 or Hoechst 33342.
- the capacity of the HP cells, which are to be altered by gene therapy according to this invention, to engraft and give rise long term to multilineage differentiated progeny is a critical feature of this invention. This provides for persistence of gene-modified hematopoietic cells in the human subject. This capacity may be assayed by the ability to repopulate the hematopoietic systems of myeloablated animals (Harrison 1980, Harrison 1988) or preferably myeloablated humans, or more preferably non-myeloablated humans. Even more preferably, this capacity is assayed in the context of viral infection such as HIV-1 infection.
- HP cells for use in gene therapy according to the invention can be isolated from peripheral blood after mobilization, bone marrow, or umbilical cord blood. HP cells may also be obtained from stem cells that give rise to hematopoietic cells.
- HP cells are preferably obtained from peripheral blood after mobilization (Huss 2000) .
- peripheral blood after mobilization Huss 2000
- a higher absolute number of CD34 + ' cells can be collected from the peripheral blood after mobilization compared to bone marrow or umbilical cord blood, due to the relatively large amount of blood that can be processed.
- the procedure does not require a general anaesthetic and is associated with reduced hospitilization costs.
- Fu and Liesveld 2000 that mobilization can be performed by treatment with one or more cytokines, optionally adding a short course of chemotherapy with agents such as cyclophosphamide (Campos et al 1993) .
- HP cells can be mobilized into the peripheral blood using G-CSF (Ho 1993, Lane et al 1995), pegylated G-CSF, conjugated G-CSF, GM-CSF (Siena et al 1989), or any combination of these. Mobilization can be enhanced by combining one or more of these cytokines with others such as stem cell factor (SCF) , Flt-3 ligand (Ho et al 1996 abbreviated as Flt3) , or interleukin 3 (IL-3; Huhn et al 1996) . Mobilization may be enhanced by counteracting stromal cell-derived factor-1 (SDF-1; Benboubker et al 2001) or other factors that act negatively to restrict mobilization.
- SCF stem cell factor
- Flt-3 ligand Ho et al 1996 abbreviated as Flt3
- IL-3 interleukin 3
- Mobilization may be enhanced by counteracting stromal cell-derived factor-1 (SDF-1; Benboubker et
- HP cells may be obtained by apheresis on days 4 , 5, 6 or later.
- Levels of CD34 + cells in the blood may be monitored from about day 3- onward, for example Complete Blood Counts (CBCs) , differential and platelet count may be performed daily during cytokine administration to assess the extent of the leucocytosis .
- the CD34 + cell count is preferably greater than 20 cells/mm 3 prior to the start of apheresis .
- Apheresis may be carried out with the Cobe Spectra (Gambra) , Hemonetics (Domediac), Amicus (Baxter) or equivalent equipment. Apheresis results in a leukocyte population highly enriched in mononuclear cells and depleted for granulocytes, which is desired. If insufficient CD34 + cells are obtained from a first series of mobilization/apheresis, the procedure can be repeated with the same or modified mobilization regime. Alternatively, apheresis can be repeated. CD34 + cells from the first procedure can be cryopreserved and combined with those from subsequent procedures.
- HP cells can also be isolated from aspirated bone marrow by isolating mononuclear cells (MNC) and purifying CD34 + cells.
- HP cells can also be isolated from umbilical cord blood (Gluckman 2000) . Up to about 200 ml of cord blood can be obtained at birth. Such cells can be cryopreserved and used for successful transduction and transplantation later (Huss 2000) . There is evidence that HP cells from umbilical cord blood are more readily transduced and have greater self- renewal potential than those from peripheral blood (Moore and MacKenzie 1999) .
- CD34 + cell surface antigen which is a transmembrane sialomucin that is expressed on HP cells and on vascular endothelial cells.
- the methods include immunoselective methods using antibodies with specificity for the CD34 antigen, which antibodies may be tagged with magnetic or fluorescent or other tags that allow selection.
- Cells may be expressing the CD34 protein internally but this would not allow immunoselection. Only cells expressing the CD34 antigen on the cell surface at same time, allowing access to the antibody, are considered CD34 + .
- Populations of hematopoietic cells that are highly enriched for CD34 + cells can also be obtained from the sources mentioned above by antigen-depletion strategies, for example to selectively deplete the population of cells expressing lineage-specific markers such as CD2, CD3, CD14, CD16, CD19, 5 CD24, CD56, or CD66b glycoprotein A.
- This type of strategy allows the isolation of cell populations enriched for CD34 " HS cells as well as CD34 + cells.
- the enriched pool of CD34 + or lineage depleted cells preferably comprises at least 40%, more preferably at least 60% and most preferably at least 80% cells 10 of this type. A balance must be struck between the purity and recovery of the desired cells.
- the proportion of CD34 + cells in samples can be determined by flow cytometry methods, for example as done by Bender et al
- CD34 + cells 15 1991, or immunologic methods.
- the absolute number and proportion of CD34 + cells can be determined by standardized procedures (Barnett et al 1998, Sandhaus et al. 1998). Absolute nucleated cell counts can be determined by hematological analyzers, or more preferably in single-platform
- CD34+ cells can be cultured in any suitable medium, well known in the art, in vessels such as flasks or bags, for example the gas-permeable polypropylene bags (Giarratana et al 1998) .
- Efficient transduction of human HP cells with murine oncoretroviral vectors requires induction of cell cycle, for example with one or more cytokines (growth factors) (Dao and Nolta 1999) or inhibitors of cell cycle control.
- cytokines growth factors
- TPO thrombopoietin
- FL Flt-3 ligand
- Kit ligand KL, also known as SCF
- TPO thrombopoietin
- FL Flt-3 ligand
- Kit ligand Kit ligand
- the combination of MGDF, SCF and FL was used in repopulation assays in primates (Wu et al 2000) .
- Amado et al showed that treatment of cells with MGDF and SCF better supported the survival of thymocyte precursor cells than other combinations of factors in a mouse model (Amado et al 1998) .
- IL-3, IL-6, SCF or TPO or combinations thereof have been shown to have beneficial effects on HP cell transduction (Nolta et al 1992, Hennemann et al 1999) .
- the combinations FL/SCF/IL-3/IL-6, SCF/G-CSF, FL/SCF/TPO/IL-6, FL/SCF/G-CSF, FL/SCF/TPO, and FL/SCF/GM-CSF have also been used in large animal models (Richter and Karlson 2001) .
- SCF c-kit ligand
- Flt-3 ligand FL is a cytokine that binds to a class III receptor tyrosine kinase that is expressed on
- Thrombopoietin is a ligand for the c-Mpl receptor and is a growth factor involved in early hematopoiesis as well as
- MGDF is a pegylated and truncated form of TPO and acts in a similar fashion to TPO; it may be regarded as functionally equivalent to TPO. Any of these cytokines may be modified, formulated differently or conjugated while still providing an equivalent
- Ribozymes are enzymatic RNAs that can specifically cleave RNA
- Haseloff and Gerlach 1988. Being catalytic,
- Ribozymes pair with the specific target RNA by virtue of complementary sequence and induce cleavage at specific sites along the phosphodiester backbone of RNA
- the hammerhead ribozyme is small, simple and has an ability to maintain site-specific cleavage when incorporated into a variety of flanking sequence motifs (Haseloff and Gerlach, 1988; Rossi et al., 1992).
- the requirements for cleavage by a ribozyme are an accessible region of RNA and, in the case of the hammerhead ribozyme, a
- NUH target motif (where N is any ribonucleotide and H is A, C or U ribonucleotides) . Cleavage occurs immediately 3' of the
- NUH target motif These features make it particularly well suited for gene suppression.
- Other types of ribozymes include the so-called hairpin ribozyme, hepatitis delta virus ribozyme
- HDV HDV
- RNAse P intervening sequence (IVS) Group I
- IVS Group IVS Group
- Rz2 ribozyme cleavage activity in test tube reactions, and protective effects in tissue culture systems against laboratory and clinical isolates of HIV-1 (Sarver et al. 1990; Sun et al. 1995; Wang et al. 1998).
- a particular hammerhead ribozyme denoted Rz2 is directed against a highly conserved region of the tat gene ( Figure 4) .
- the ta t gene is essential for HIV-1 replication; it encodes and produces the Tat protein that is a transcriptional activator of integrated HIV-1 provirus.
- Sun et al (1995) used Rz2 to protect T lymphocytes against HIV-1 in vitro but did not describe results in patients.
- Figure 4 shows the structure of Rz2 and its target sequence at position 5833 to 5849 within the HIV-1 strain HXB2 (Genbank sequence K03455) , where cleavage occurs after the GUA triplet at position 5842.
- the target sequences comprise nucleotides 5833-5849 (GGAGCCA GUA GAUCCUA) of reference strain HIV-HXB2 (Genbank accession number K03455) or nucleotides 5865 to 5882 (GGAGCCA GUA GAUCCUA) of HIV IIIB (Genbank accession number X01762) or the corresponding region from other HIV strains.
- DNA nucleotides with the sequence 5 ' -TTA GGA TCC TGA TGA GTC CGT GAG GAC GAA ACT GGC TC-3' corresponding to the Rz2 ribozyme were inserted into the Sail site in the 3' untranslated region of the neo R gene within the plasmid pLNL6, which contains the replication-incompetent retroviral vector LNL6 (Genbank accession number M63653) to generate a new virus, RRz2.
- the ribozyme sequence was expressed as a neo R - ribozyme fusion transcript from the Moloney Murine Leukemia Virus (MoMLV) Long Terminal Repeat (LTR) in RRz2.
- MoMLV Moloney Murine Leukemia Virus
- LTR Long Terminal Repeat
- nucleotide sequence immediately around the ribozyme cleavage site(s) is highly conserved in the viral target RNA. This can readily be determined by comparison of sequences available in sequence databases, or tested experimentally by multiple-passage assays (Wang et al 1998).
- the Rz2 target/cleavage site in HIV-1 is conserved in almost all naturally occurring infectious isolates.
- two sequence variants were observed at positions -4 and -1 relative to the GUA triplet at the cleavage site. However, these variants may represent less fit pseudotypes .
- CD4 + and CD8 + T-lymphocytes are the most susceptible to HIV infection
- genetic modification of these cells so that they express Rz2 leads to inhibition of HIV infection.
- the genetic modification is accomplished during the early stage of hematopoiesis .
- Retroviral vectors have been used widely so far in gene therapy (Chu et al 1998), particularly those based on
- Moloney murine leukemia virus (MoMLV) , a member of the murine oncoretroviruses.
- Other murine retroviral vectors that can be used include those based on murine embryonic stem cell virus
- Murine stem cell virus (MESV) and murine stem cell virus (MSCV) .
- Vectors based on murine oncoretroviruses can be used for high efficiency transduction of cells, however, they require that the cells be active in cell division. Following entry into the cell cytoplasm and reverse transcription, transport of the preintegration complex to the nucleus requires the breakdown of the nuclear membrane during mitosis. Transduction of HP cells with murine retroviral based vectors therefore requires activation of the cells.
- Lentiviral vectors (Amado and Chen 1999) , a subclass of the retroviral vectors, can also be used for high-efficiency transduction (Haas et al 2000, Miyoshi et al 1999, Case et al 1999) and are able to transduce non-dividing cells (Uchida et al 1998, Sutton et al 1998).
- the preintegration complex is able to enter the nucleus without mitosis, and therefore lentiviral transduction does not require the induction of HP cells into cell cycle. This increases the likelihood that the cells remain pluripotent .
- the use of lentiviral vectors in gene therapy against HIV-1 has been reviewed (Mautino and Morgan 2002) .
- Other groups of retroviruses such as spumaviruses, for example the foamy viruses (Vassilopoulos et al 2001) are also capable of efficiently transducing non-dividing cells.
- viral vectors that can be used in the invention include adenoviral vectors (Fan et al 2000, Knaan-Shanzer et al 2001, Marini et al 2000), adeno-associated viral (AAV) vectors (Fisher-Adams et al 1996), SV40 based vectors (Strayer et al 2000), or forms of hybrid vectors (for example Feng et al, 1997 or Lieber et al 1999) .
- Adenoviral vectors can be readily produced at high titers, that can be easily concentrated (10 12 pfu/ml) , and can transduce non-dividing cells. Large DNA inserts can be accommodated (7-8 kb) . Immune reactions against adenovirus in vivo can be alleviated by removing genes encoding certain proteins.
- AAV vectors are non-pathogenic, transduce both proliferating and non-proliferating cells including CD34 + cells, and integrate stably into the cellular genome (Grimm and Kleinschmidt 1999) . Moreover, they do not induce a host immune response and can be produced in helper-free systems to high titers of about 10 10 cfu per ml.
- AAV is a non-enveloped virus with a single-stranded DNA genome.
- AAV vectors can readily incorporate up to about 4 kilobases of new DNA, although recent studies have extended this. AAV vectors can effectively transduce CD34 + cells in long-term cultures (Chatterjee et al 1999) .
- Retroviral vectors including lentiviral vectors, and AAV vectors.
- Integrating viral vectors are herein defined as those which result in the integration of all or part of their genetic material into the cellular genome. They include retroviral vectors and AAV vectors. They also include hybrid vectors such as adenoviral/retroviral vectors (for example, Feng et al 1997) and adenoviral/AAV vectors (for example Lieber et al 1999) . However, vectors that replicate stably as episomes can also be used. It is also desired that the vector can be produced in cell lines to a high titre, in a cost- effective manner, and have minimal risk for patients, for example not giving rise to replication competent virus.
- retroviral vectors Methods for constructing and producing retroviral vectors are reviewed in Gambotto et al (2000) .
- the vectors are packaged in packaging cell lines such as the PA317 or AM-12 cell lines which contain helper vector (s) that is itself defective in packaging.
- helper vector s
- Several variations in the methods for producing high-titer retroviral supernatants have been described (Schilz et al 2001) , including variations in the medium, packaging cells, temperature of harvest and concentration methods by centrifugation or complexation (Le Doux et al 2001) . Any of these methods can be used with this invention.
- Retroviruses packaged in murine amphotropic envelopes may not transduce primitive HP cells efficiently due to low levels of the amphotropic receptor (Bodine et al 1998). However, cell cycle induction has been shown to lead to increased expression of the amphotropic receptor with a concordant increase in gene transfer (Orlic et al 1999) .
- pseudotype retroviral vectors with envelopes such as the envelope from gibbon ape leukemia virus (GALV) (Kiem et al 1997, Eglitis and Schneiderman 1997, Relander et al 2002), vesicular stomatitis virus (VSV-G protein) (Naldini et al 1996, von Laer et al 1998) or feline endogenous virus (Kelly et al 2002).
- GLV gibbon ape leukemia virus
- VSV-G protein vesicular stomatitis virus
- feline endogenous virus Korean et al 2002.
- Pseudo-typing vectors may allow concentration, for example by centrifugation.
- AAV vectors may be produced in packaging cell lines or cells expressing the AAV rep and cap genes either constitutively or
- Adenoviral vectors can be produced and purified according to standard methods (eg. see Fan et al
- the biological titre of viral stocks can be readily determined (for example Tavoloni et al 1997) .
- the introduced gene is expressed in the transduced human HP cells of this invention or progeny cells from a promoter.
- the promoter may be constitutively expressed or inducible, for example being expressed, preferentially under favorable
- 25 retroviral LTR promoter can be modified for improved expression (Robbins et al 1998, Halene et al 1999) or modified by insertion of elements such as insulators (Rivella et al 2000) or scaffold attachment regions (SAR) (Murray 2000) .
- elements such as insulators (Rivella et al 2000) or scaffold attachment regions (SAR) (Murray 2000) .
- polyadenylation signals are those which should yield maximum expression in the cell type (eg T-lymphocytes) which the gene therapy agent is to be expressed in.
- a transcriptional control unit promoter and polyadenylation signal
- promoters are selected which provide efficient expression in hematopoietic, particularly lymphoid cells (or tissues) .
- Preferred promoters are the cytomegalovirus (CMV) immediate early promoter, optionally used in conjunction with the growth hormone polyadenylation signals, and the promoter of the Moloney-MuLV LTR.
- CMV cytomegalovirus
- an LTR promoter has the same tissue tropism as does the retrovirus of its origin.
- the CMV promoter is expressed in lymphocytes.
- Other promoters include VA1 and tRNA promoters which are dependent on RNA polymerase III.
- the metallothionein promoter has the advantage of inducability .
- the SV40 early promoter exhibits high level expression in vitro in bone marrow cells. Hematopoietic cell- specific promoters can be used instead of viral promoters (for example Malik et al 1995) .
- the human HP cells may need to be treated with growth factors to induce cell cycle (see above) . This may not be the case with other retroviral vectors. Following any such treatment, the cells need to be contacted with the transducing vector.
- the extracellular matrix protein fibronectin or chymotryptic fragments of fibronectin which enhances colocalization of cells and viral particles and increases transduction frequencies (Hanenberg et al 1996, Hanenberg et al 1997, Kramer et al 1999, Williams et al 1999), or more preferably the recombinant fibronectin fragment CH-296.
- Equivalent fragments containing the heparin-binding domain and the alternatively spliced type 3 connecting segment region can also be used (Kiem et al 1998) .
- CH-296 may also aid in the maintenance of the regenerative potential of the HP cells as shown in a mouse xenograft model (Dao et al 1998). Use of CH-296 and growth factor combinations was used in a canine model (Goerner et al 1999) but it was not known how this would apply to humans. Other colocalization agents such as polybrene and protamine sulfate can also be used. These agents act by increasing the apparent titer of viral particles.
- the transduction frequency can be increased, particularly for CD34 + CD381ow cells, in the presence of fibronectin fragment by reducing the concentration of the vector containing medium or preloading of the vector alone onto the fibronectin fragment (Relander et al 2001) .
- Increased transduction frequency can also be achieved by enriching the virus preparations, for example with cationic and anionic polymers (LeDoux etal 2001) .
- Transfection of cells by non-viral means can be achieved by the use of cationic liposomes, or DNA-protein complexes such as poly-lysine-DNA complexes, or other means known in the art.
- the frequency of transfer of genes into human HP cells can be determined by standard methods, for example PCR or fluorescent detection (Gerard et al 1996) . Transduction frequencies of up to 70-100% have been obtained with retroviral vectors, but this was for relatively small cell samples (Halene et al 1999) . Scaling up to clinically relevant levels of material generally results in lower transduction frequencies, particularly for the more primitive HP cells that are needed for long-term reconstitution (eg in the range 1-5% without colocalization agents) .
- IL-3 and IL-6 were not preferred (Herrera et al 2001).
- culture of the cells post-transduction with SCF alone for two days can improve engraftment potential (Dunbar et al 2001). Treatment to de-activate the cells post-transduction may improve engraftment potential.
- the transduced human HP cells can also be enriched by introducing marker genes such as ones encoding cell-surface reporters (for example see Fehse et al 1997), however this may not be desirable in a clinical setting.
- Transduction frequencies can be measured by any of the methods well known in the art, for example by PCR, growth of colonies in the presence of selective agents such as G418 when a selectable marker is included in the construct, or fluorescence-activated sorting. It is preferred that the transduction frequency is measured on a truly representative sample of cells from the total population, for example by quantitative PCR methods (eg real-time PCR) on total DNA from a sample of the cell population. Analysis of transduction frequencies on individual colonies produced from cells in the population is not preferred, but not excluded.
- transduced human HP cells must be used for prolonged engraftment. Moreover, the transduced HP cells must be capable of undergoing thymopoiesis in order to give rise to differentiated multi-lineage leukocytes.
- genes introduced Any gene can be introduced by transduction into human HP cells for this invention.
- the gene may be used to correct immune deficiencies, including severe combined immunodeficiencies.
- vectors expressing the adenosine deaminase gene, the RAG1, RAG2 or recombination/DNA repair process genes that are defective in the Alymphocytosis type of SCID, the CD45 gene, or the yc, Jak3, IL-7 R genes can all be used (Cavazzana-Calvo 2001) .
- Lysosomal storage diseases such as Gauchers Disease, the most prevalent human lysosomal storage disorder, can be treated.
- Glucocerebrosidase (GC) gene such as the MFG-GC retroviral vector (Takiyama et al 1998) can be used for the treatment of Gauchers disease (Dunbar et al 1998a, Dunbar et al 1998b) .
- Chronic Granulomatous Disease (CGD) results from defects in NADPH oxidase, a multisubunit enzyme with four components, and can be corrected with the appropriate gene such as the p47phox gene or the gp ⁇ lphox gene.
- Glucose-6-Phosphate dehydrogenase deficiency which is relatively prevalent in humans, can be treated with the G6PD gene (Rovira et al 2000).
- Fanconi' s Anemia which results from defects any one of at least eight genes, can be corrected with the appropriate gene, for example by the complementation group C gene (Liu et al 1999) .
- Hemaglobinopathies can be corrected, as can Glanzmann thrombasthenia (Wilcox et al 2000) , and Fabry disease (Takenaka et al 2000), each with the appropriate gene.
- CD34 + cells can be transduced with myeloprotective genes such as MDR-1 as part of treatment for hematopoietic malignancies including leukemias, myelomas and lymphomas as well as non- hematopoietic malignancies where chemotherapeutic regimes would result in myeloablation (for example, Abonour et al 2000, Michallet et al 2000) .
- Non-myeloablative conditioning can be used in such cases (Nagler et al 2000) . If there is the potential for deleterious effects of expression of the gene on HP cell function where this is not desired, expression of the gene can be controlled by regulatable promoters, well understood in the art.
- RNA products from the transgene such as ribozymes are expected to have negligible immunogenicity.
- the RevMlO gene encoding an anti-HIV protein did not inhibit the differentiation of transduced human CD34 + cells in SCID mice (Su et al 1997, also Yu et al 1995) . Proteins such as INFalpha have been expressed in CD34 + cells without affecting engraftment and differentiation in NOD/SCID mice (Quan et al 1999) .
- human HP cells can be modified to provide them with a selective advantage in vivo in certain circumstances (for example Kirby et al 2000) or in the presence of selective agents (Omori et al 1999, Ragg et al 2000) .
- 'PBMC Cryopreservation Medium was used for the cryopreservation of PBMC cells for archival and safety testing purposes.
- the medium is constituted to provide maximum viable recovery of
- IMDM Iscove's Modified Dulbecco's Medium, Gibco BRL, Cat 12440-046 .
- One tube (4 ml) per patient was used for archival samples and co-cultivation samples.
- the cryopreservation medium was thawed and kept at 4 ' C until ready for use. (DMSO is toxic to cells at higher temperatures).
- the recombinant human pegylated Megakaryocyte Growth and Development Factor was used for stem cell culture to promote cell growth and retroviral transduction. It was prepared and aliquotted as a 100 mg/ml working stock solution and added to the stem cell culture medium at a final concentration of 100 ng/ml .
- MGDF vial Amgen Inc., 500 mg/ml recombinant human pegylated MGDF in 1 ' ml 10 mM sodium acetate containing 5% sorbitol, pH 5) and some IMDM culture medium (Iscove's Modified Dulbecco' s Medium; Gibco BRL Cat# 12440-046) were warmed to room temperature.
- IMDM culture medium Iscove's Modified Dulbecco' s Medium; Gibco BRL Cat# 12440-046
- 1 ml of MGDF solution was withdrawn from the vial and transferred to a sterile 15 ml tube (polypropylene conical tube; Corning Cat# 25319-15 or Falcon Cat# 352097) .
- the MGDF was diluted to 5 ml final volume with 4 ml of IMDM to create a 100 mg/ml working stock solution. Aliquots (1 ml) of working stock solution were transferred to sterile screw cap microcentrifuge tubes (Sarstedt Cat# 72692005) .
- the MGDF working stock solution has a limited shelf life of 3 days.
- Prepared MGDF aliquots were stored at 4" - 8' C for up to three days without freezing.
- a batch of MGDF was prepared fresh for each patient on the day of CD34 + cell preparation (day 0 of culture) .
- working stock aliquots of MGDF were prepared from a separate vial of material that was discarded after use. Sufficient aliquots are prepared for at least five individual cell culture medium preparations.
- Stem Cell Factor 50 ⁇ g/ml Recombinant Methionyl Human Stem Cell Factor
- the recombinant methionyl human Stem Cell Factor was used in stem cell culture medium to promote cell growth and retroviral transduction. It was prepared as a 50 mg/ml stock solution and used at a final concentration of 50 ng/ml.
- SCF vial Amgen Inc., 1875 mg lyophilized recombinant human methionyl SCF
- IMDM culture medium Iscove's Modified Dulbecco' s Medium; Gibco BRL Cat# 12440-046
- SCF vial Amgen Inc., 1875 mg lyophilized recombinant human methionyl SCF
- IMDM culture medium Iscove's Modified Dulbecco' s Medium; Gibco BRL Cat# 12440-046
- the SCF was reconstituted by swirling without shaking.
- 0.2 ml of the SCF solution was withdrawn and added to a 15 ml sterile conical tube containing 5.8 ml of IMDM. This made 6 ml of a 50 mg/ml working stock solution.
- a sterile 5ml pipette 1 ml aliquots of SCF working stock solution were transferred to sterile microcentrifuge tubes.
- Nevirapine (5 mg/ml Nevirapine-VirimmuneTM, 18.7 mM)
- Nevirapine (VirimmuneTM) was used to inhibit the replication of HIV in the CD34 stem cell cultures during the period of cell culture and retroviral transduction. Nevirapine was prepared and aliquotted as a 5 mg/ml (18.7 mM) stock solution and added to the cell culture medium at a final concentration of 500 nM. A single batch of nevirapine working stock was prepared for the entire clinical trial. This stock was aliquoted to provide three vials per patient for each day of culture medium preparation.
- Nevirapine anhydrous powder (Boehringer Ingelheim. Mfr# 43074) was weighed into a 50ml tube (BluemaxTM 50 ml sterile polypropylene centrifuge tube; Falcon Cat# 2098) . Ethanol (200 Proof Dehydrated Alcohol USP, Punctilious; Quantum Chemical Corp) was added to the tube to make a 5mg/ml solution. 0.5 ml aliquots of 5mg/ml working stock solution were transferred to 1.5 ml sterile screw-capped microcentrifuge tubes (Sarstedt Cat# 72692005) and stored at -20' C.
- the Nevirapine stock solution was thawed at room temperature before use. Each aliquot was single-use for daily cell culture medium preparation.
- Fetal bovine serum was a constituent of the CD34 + culture medium and was used at a concentration of 20%.
- the viral supernatants used for transduction contained 10% FBS and therefore were supplemented with 10% FBS before use in transduction of the CD34 cells.
- FBS FBS, supplied in 500ml bottles, was aliquoted into 50ml volumes to minimize wastage.
- the serum Fetal bovine serum, 500 ml; Stem Cell Technologies HCC-6450
- the serum was thawed in a 37' C water bath, mixed by swirling without shaking until visibly homogeneous and aliquoted aseptically into 50 ml volumes in 50ml centrifuge tubes (BluemaxTM 50ml sterile polypropylene centrifuge tube; Falcon Cat# 2098).
- the aliquots were stored frozen. Each aliquot was single use for daily medium preparation.
- Isolated CD34 + cells were grown in this culture medium for at least one day before transduction.
- the medium was designed to maintain high viability of progenitor cells. This procedure is for the preparation of 500ml of medium:
- FBS Fetal bovine serum 2 x 50ml aliquoted according to 1.2 above
- the CD34 + culture medium was prepared fresh when required. It was stored at room temperature in a light protected environment until approximately 30 minutes before use, then warmed to 37 ' C in a water bath. Medium in excess of immediate requirements was labeled with the patient CRF ID# and stored at 4 ' C. It was not used for any other patient and discarded when the patient cell culture/transduction/harvest procedure was completed.
- Protamine facilitates binding of the vector in viral conditioned medium to target CD34 + cells.
- Protamine Sulfate from ampoules (Elkin-Sinn, 5 ml, lOmg/ml) was aliquoted to minimise wastage.
- Each CD34 + transduction used 2 aliquots per patient so approximate 0.5 ml aliquots were dispensed into 10 x 1.5 ml sterile screw-capped microfuge tubes. These were stored at 4 ' C without freezing.
- One vial was used on each day of transduction (day 1 and day 2) for preparing the VCM transduction mix. Aliquots were single use and discarded after VCM preparation on each day. 1.10 VCM Transduction Mixes with protamine sulfate.
- VCM Virus Conditioned Medium
- VCM transduction proceeded over two consecutive days.
- each VCM was supplemented with growth factors and serum to match the culture medium of the first day 15 as follows:
- PA317/LNL6 PA317/LNL6-3; Magenta Corporation, titre
- the RRz2 VCM was prepared in the same fashion except that the following volumes were used: 30 ml FBS
- PA317/RRz2 PA317/RRz2-17R' ; Magenta Corporation, titre 0.8xl0 7 ivp/ml
- the remaining 100 ml RRz2 VCM was labeled with the CRF# and immediately re-frozen at -80 C. This was used on the second day of transduction.
- Each VCM transduction mix was prepared fresh on each day of transduction and stored in the biological safety cabinet until the CD34 + cells were ready for transduction.
- Retronectin® 25 mg/ml Retronectin in PBS
- Retronectin® human fibronectin fragment CH-2966 solution was used to coat tissue culture vessels to facilitate retroviral transduction of CD34 + cells.
- 2% HSA was used to block the tissue culture vessels after they were coated with Retronectin. It was prepared by aseptically mixing 8 ml of 25% HSA solution (Albumarc25TM) with 92 ml PBS
- Retronectin Flasks coated with Retronectin were used for some patients to transduce CD34 + cells with retroviral vectors.
- Retronectin solution 25 ml was pipetted into 4x 175 ml flasks (Bacterial plastic flasks 175 cm 2 , with 0.2 ⁇ m vented closures, Sarstedt 83.1812.502) and let stand for 2 hours at room temperature.
- the solution was removed from the flasks and 25 ml of the 2% HSA added. After a further 30 min at room temperature, the solution was removed and the flasks washed with 25 ml of IMDM (Iscove's Modified Dulbecco 1 s Medium; GIBCO BRL, Cat #12440-046) .
- IMDM Iscove's Modified Dulbecco 1 s Medium
- GIBCO BRL Cat #12440-046
- Transduction Mixes (with Retronectin) were prepared by adding into a filter funnel (Nalgene 0.45 ⁇ m filter flask with 250 ml receiver, Nalge SFCA 162-0045) in this order: 15 10 ml FBS (see above)
- VCM transduction mixes used with Retronectin patients 8- 3010 .
- VCM transduction mixes for patients #8-10 were prepared and used in the same way except that the volumes used in the preparation were doubled. Three rounds of transduction were preformed over 2 days, namely on the evening of day 1, and morning and afternoon of day 2.
- CD34 + cell Wash Buffer PBS with Ca 2+ & Mg 2+ , + 1% HSA).
- CD34 + wash buffer containing 1% (final concentration) HSA was used for washing of the cells prior to infusion of the
- IL wash buffer was used per patient and was prepared fresh or several days in advance.
- CD34 + Infusion buffer is designed to maintain viability of the transduced CD34 + cell harvest until transfused.
- the RPMI was free of phenol red as it was used for direct infusion into the patient. It contained human serum albumin at 5% final
- phenol red-free RPMI Phenol Red free, Gibco-BRL, Cat 118-030
- 20 ml 25% HSA solution Albumarc25TM
- the mixture was swirled gently. If the reagent was prepared in advance, it was stored at 4 ° C, but if prepared fresh on the day of harvest, it was stored at room temperature until use. The mixture was prewarmed to 37 ' C before use. A 100ml batch was for the exclusive use of one patient and was single-use only.
- FACS PBS is a wash buffer that was used to wash the cells during the FACS staining procedure. Additionally, if FACS analysis was performed immediately after staining (ie within the next 4-6 hours) it was used to resuspend the stained cells .
- An Azide stock solution (10%) was prepared by dissolving 4 g of sodium azide in a 50-ml tube in distilled water.
- the FACS PBS solution was prepared by adding to 48.5 ml of PBS, in a 50 ml tube, 1 ml fetal bovine serum and 0.5 ml of the sodium azide solution. The solutions were stored at 4 ' C.
- the azide stock solution has an unlimited shelf life, the FACS PBS has a shelf life of 1 year.
- the FACS PBS was used chilled.
- the FACS Paraformaldehyde is a fixative solution that preserves cells after antibody staining for FACS anaysis. Used at 1% concentration to resuspend cells after FACS staining, the antibody staining will remain stable for up to at least 3 days. After this time, the background signal from the fluorescent antibodies may increase. It contained 10 ml of 10% paraformaldehyde ( Polysciences #04018) mixed with 40 ml of PBS and was stored at 4" C. Cells were suspended in 200 ⁇ l of PBS and then fixed with 200 ⁇ l of this buffer to create a working concentration of 1%.
- Urea lysis buffer was used. to prepare cell lysates for phenol extraction of DNA. It contains 84 g urea (Boehringer-Mannheim 1685 899), 4 g SDS (USB 21651), 1 ml 0.2M EDTA, 1 ml 1M Tris base, 1 ml 1M Tris HCl, 14 ml 5M NaCl in a final volume of 200 ml in water. This solution was filtered through a 0.45 ⁇ filter and stored at room temperature.
- EXAMPLE 2 Phase I Clinical Trial .
- RRz2 For transduction of cells with a ribozyme gene, RRz2 was used. RRz2 encodes the hammerhead ribozyme Rz2, which is directed against a highly conserved region of the tat gene of HIV-1. The DNA sequence encoding Rz2 was sub-cloned into a Sal-I site within the untranslated region of the neomycin phosphotransferase ⁇ neo R ) gene in pLNL6 (Bender et al 1987) to make RRz2. The ribozyme is expressed as a neo-ribozyme transcript from the MoMLV LTR in RRz2.
- progenitor cells were also transduced with the control retroviral vector LNL6.
- HIV-1 infected patients with viremia less than 10,000 copies/ml and CD4 counts between 300 and 700 cells/mm 3 underwent mobilization of peripheral blood progenitor cells (PBPC) with the cytokine granulocyte colony stimulating factor (G-CSF) for 6 days.
- PBPC procurement was carried out by performing one blood volume of apheresis on days 5 and 6 of G- CSF treatment using the COBE ® Spectra" Apheresis System (Gambro BCT, Lakewood, CO) .
- CD34 + cell selection was performed using the CEPRATE ® SC Stem Cell Concentration System (CellPro Inc. Bothell, WA) (patients 1 to 7) and Isolex 300i cell selection system (Nexell Therapeutics, Irvine, CA) (patients 8 to 10).
- PBPC peripheral blood mononuclear cell
- Isolex 300i cell selection system Nexell Therapeutics, Irvine, CA
- MGDF megakaryocyte growth and development factor
- SCF stem cell factor
- MGDF and SCF were supplied by Amgen Inc. (Thousand Oaks, CA) and used at a concentration of 100 ng/ml and 50 ng/ml respectively.
- CD34 + cells were transduced independently with the RRz2 and LNL6 vectors.
- the LNL6 and RRz2 producer cell lines were prepared in a two stage process by transfecting the cDNA constructs, pLNL6 or pRRz2, into the psi2 packaging cell line to produce two populations of ecotropic replication-incompetent virus. These two populations were then used to infect the PA317 amphotropic packaging cell line (Miller and Buttimore 1986) .
- Clonal producer cell lines derived following selection in G418, were checked for integrity of the constructs and sent to BioReliance Corporation (Rockville, MD) for manufacture of a Master Cell Bank and subsequent manufacture of GMP virus with safety testing.
- Retroviral supernatant All batches of retroviral supernatant (LNL6 and RRz2) were tested for sterility, replication-competent retrovirus and general safety by BioReliance Corporation. Viral titers were confirmed by infecting the NIH 3T3 cell line using serial dilutions and scoring G418 resistance. LNL6 and RRz2 titers were 1.4 x 10 7 and 0.8 x 10 7 infectious viral particles/ml respectively. Retroviral supernatant (VCM Transduction Mix) was added once daily for two days for patients 1 to 3, twice in one day for patients 4-7, and 3 times over 2 days for patients 8 to 10.
- VCM Transduction Mix VCM Transduction Mix
- transductions were performed in flasks coated with the CH296 fragment of human fibronectin (RetroNectinTM, Takara Shuzo, obtained from BioWhittaker, Inc. Walkersville, MD) .
- RetroNectinTM human fibronectin
- CD34 + cell cultures and transductions were carried out in the presence of Nevirapine at a concentration of 500nM (Boehringer Ingelheim, Ridgefield, CT) . Absence of HIV replication was verified by measuring p24 antigen by ELISA in the final infusate (all 10 samples had undetectable p24 levels) .
- Fungal, bacterial and mycoplasma cultures, as well as endotoxin assays were negative in the final cell product for all 10 patients.
- Figure 7 shows long-term multilineage gene presence in a representative patient.
- Figure 7a shows LNL6 and RRz2 vector sequences in peripheral blood mononuclear cells (PBMC), bone marrow mononuclear cells (BMMC) , T-lymphocytes and monocytes in patient 5 two years after infusion of transduced CD34 + cells.
- T-lymphocytes and monocytes were selected from PBMC to a purity >90%, as confirmed by flow cytometry. For each cell type, 4 replicates of a pool of samples are shown.
- FIG. 7b shows short- and long-term vector expression of both LNL6 and RRz2 in PBMC up to 2 years post-infusion in 3 representative patients using a radiolabelled primer. For each sample, a reaction that did not contain reverse-transcriptase (-RT) was included.
- -RT reverse-transcriptase
- peripheral blood CD4 + and CD8 + cells for CD45RA and CD62L surface marker expression, which characterize na ⁇ ve T- lymphocytes (Sanders et al 1988; Tedder et 1985; Kansas 1996; Picker et al 1993), and we analyzed these T-lymphocyte subpopulations for the presence of LNL6 and RRz2.
- PCR analysis was performed in leukocyte subsets using primers directed against the neo R gene that overlap the Rz2 sequence in the RRz2 vector.
- DNA was extracted from cell populations using the exclusively Polymer extraction method (Ward et al 1998).
- Primers used were 5L1A: CAC TCA TGA GAT GCC TGC AAG; 3L2A: GAG TTC TAC CGG CAG TGC AAA; 5Nesl: GAT CCC CTC GCG AGT TGG TTC A (Primers Round #1: 5Nesl & 3L2A, Round #2: 3L2A and labeled: 5L1A) .
- Ten replicates per sample were included in a Round 1 PCR of 17 cycles annealing at 68 C and denaturation at 94 C. The replicate samples were then pooled and used as template for the Round 2 PCR of 35 cycles with annealing temperature at 68 C and denaturation temperature at 94 C.
- Quadruple product samples were resolved on a 5% denaturing PAGE gel, and quantitated using Molecular Dynamics Imagequant software.
- PCR products for LNL6 and RRz2 were 174 and 216 base pairs respectively, and include a stretch of the untranslated terminus of the neo R gene. Results were included if the ratio control was within the acceptable limits (for a ratio of 1:3.5 LNL6:RRz2 in a 0.005% vector containing sample, accepted range was 1:1.1 to 1: 6.9).
- Figure 7c shows detection of vector sequences in na ⁇ ve T- lymphocytes.
- the gel shows PCR analysis for LNL6 and RRz2 vector sequences in CD4 + and CD8 + T-lymphocytes, and in na ⁇ ve T-lymphocytes subsets selected from peripheral blood in patient 7 two years after infusion of transduced CD34 + cells.
- Na ⁇ ve T-lymphocyte populations were selected to purity >90% from CD4 and CD8 selected populations.
- T-lymphocytes and monocytes were selected from PBMC using CD3 and CD14 MACS MicroBeads (Miltenyi Biotec Inc., Auburn, CA) .
- Na ⁇ ve T- lymphocytes were selected by staining with a FITC-conjugated monoclonal IgG : anti-CD45RA antibody (Becton Dickinson, Franklin Lakes, NJ) followed by selection using an anti-FITC Multisort kit (Miltenyi Biotec Inc., Auburn, CA) . Subsequently, CD62L selection was performed using a murine IgG 2a anti-CD62L antibody (Becton Dickinson, Franklin Lakes, NJ) , followed by selection with rat anti-mouse IgG a+b Microbeads (Miltenyi Biotec Inc., Auburn, CA) .
- Figure 7(D) shows vector sequences detected in na ⁇ ve T-cell subsets in patient 5 at 2.5 years.
- Figure 7 (E) shows vector sequences detected in na ⁇ ve T-cell subsets in patient 7 at 2 years.
- Figure 7(F) shows vector sequences detected in na ⁇ ve T-cell subsets in patient 8 at 4 weeks post-infusion.
- Figure 8 shows a summary of detection of both ribozyme and control vector transgene by semi-quantitative PCR in bone marrow mononuclear cells (BMMC) , PBMC, granulocytes, T- lymphocytes and monocytes .in all 10 patients up to 3 years post-infusion. In all 10 patients, biological assays for replication competent retrovirus (RCR) at the end of transduction using both viral supernatant and cultured CD34 + enriched cells were negative.
- BMMC bone marrow mononuclear cells
- PBMC granulocytes
- T- lymphocytes T- lymphocytes
- monocytes monocytes
- DNA extracted from PBMC 6 months and 1 year after transduced-CD34 + cell infusion was analyzed for the presence of amphotropic envelope sequences using the following primers: 5 ' -CTA TGT GAT CTG GTC GGA GA-3' and 5 ' -CCA CAG GCA ACT TTA GAG CA-3'.
- the assay allows the detection of replication competent retrovirus by amplifying a highly conserved region that encodes part of the host-determining region of the envelope gene, which is required for infection of cells through the amphotropic receptor. The amplified region is 289 base pair-long.
- the sensitivity of the assay is 1 positive cell in a background of 10 5 negative cells.
- the PA317-packaging cell line was run in each assay. PCR products were resolved on a 2.5% NuSieve gel. )
- LNL6 marking is correlated with the quantity of LNL6-transduced cells reintroduced
- RRz2 marking is correlated with the quantity of RRz2-transduced cells reintroduced.
- the minimum number of transduced CD34 + cells that resulted in marking longer than one year was 0.5X10 6 cells/kg.
- Vector sequences were detected in na ⁇ ve cells up to 2.5 years post-infusion (the last time point evaluated) .
- Figure 7c shows presence of vector sequences in highly enriched na ⁇ ve cells in a representative patient.
- Vector sequences were detected in na ⁇ ve cells up to 3 years post-infusion (the last time point evaluated) .
- Figures 7D-F show vector sequences in highly enriched na ⁇ ve and memory cells from 4 to 130 weeks post-infusion in 3 patients.
- the average age and viral load of patients whose na ⁇ ve T- lymphocytes had detectable vector sequences were 41 years (range 32 to 48 years) and 3,680 copies /ml (range: undetectable to 22,628 copies/ml) respectively.
- a summary of vector detection is na ⁇ ve T-lymphocytes and viral load at the time of detection is shown in Table 2.
- Table 2 - Naive T-Cell Vector Detection Summary . Circulating na ⁇ ve T-lymphocyte populations were selected to purity >85% from CD4 and CD8 selected populations. Cells were analyzed by PCR. Viral load at the time point of vector analysis is shown under each symbol, ND: not determined. Two values indicate that two determinations are available from a time interval. NT: not tested; ( + ) : LNL6, RRz2 or both vectors detected in CD4 + CD45 + CD62L + or CD8 + CD45 + CD62L + (na ⁇ ve) Tlymphocytes; (-) : Neither vector detected in CD4 or CD8 na ⁇ ve T-cells.
- a more sustained level of RRz2 marking in HIV vulnerable cell types than in cell types not subject to HIV-induced depletion is consistent with Rz2-induced protection providing a selective survival advantage for RRz2-transduced cells.
- LNL6 marking is shown in Figure 9b.
- This analysis showed a decay rate of LNL6 copies of -0.716 for T-lymphocytes and -0.725 for BMMC. Both curves were significantly different from a zero decay rate curve (p values 0.0019 and 0.004 for T-lymphocytes and bone marrow respectively) .
- the p value for the statistical test comparing the decay rates of RRz2 between both cell types was 0.97 reflecting near identical decay kinetics for the LNL6 vector. These comparisons were implemented as mixed effect regression models (Miller 1986) .
- RRz2 was correlated with the number of RRz2-transduced CD34 + cells that each patient received. To this end, the difference between decay slopes between both vectors for each patient was correlated with the number of RRz2-transduced CD34 + cells that were infused. Patient-specific decay slopes for LNL6 and RRz2 marking were calculated by linear regression, and the difference in slopes (RRz2 - LNL6) was taken as an indicator of RRz2-mediated protection. Spearman rank correlation was used to examine relationships between differential decay rates and the numbers of transduced CD34 + cells infused.).
- the average change in CD4 + T-lymphocyte count from entry to year 3 was an increase of 10 cells per mm 3 (range -40 to +80) .
- Single-stranded DNA for cycle sequencing was produced by a second PCR step using AmpliTaq (Perkin-Elmer) and Primer 3 (AGTTTTAGGCTGACTTCCTGG) for 25 cycles at 94' C for 20 sec, 55 ' C for 30 sec, and 68' C for 30 sec. Sequencing was performed on purified PCR products with the ABI PRISM Dye termination cycle sequencing Ready Reaction kit with AmpliTaq DNA polymerase (Perkin-Elmer) on an automated DNA sequencer (ABI Model 377, Applied
- Test samples (1 sample per donor) and a negative control sample (1 ml aliquot of fresh RPMI culture media containing 5% human serum albumin) were centrifuged in microcentrifuge tubes at maximum speed for
- Positive assay controls were accepted if they were higher than 1.2 A 450 -A 690 -units, if lower the assay was repeated. Samples were regarded as positive for mycoplasma contamination if the absorbance was more than 0.2 A 450 -A 690 -units higher than the negative controls.
- the presence of endotoxin was determined in the cell cultures following culture and transduction for two reasons: the presence of low level endotoxin in the cultures would be an indication of a possible previous contamination by Gram negative micro-organisms, and secondly, high levels of endotoxin are toxic to cells in culture.
- This assay was carried out on the day of harvest after transduction, prior to infusion. The assay was carried out using the QCL-1000 Limulus Amebocyte Lysate kit (BioWhittaker # 50-647U) according to the manufacturers instructions. A stop solution consiting of 25% glacial acetic acid was prepared as it was not provided with the BioWhittaker kit. One kit was sufficient for 5 patient cultures. Results were analyzed with Softmax software.
- Gram staining was used to test for Gram positive and Gram negative bacteria in cell cultures before infusion. Quality controlled slides, which have positive and negative controls 5 incorporated (Fisherbrand Gramv QC slides cat #08-80) and the Fisher diagnostics Gram Stain Set (Cat #SG 100D) were used according to the manufacturers instructions. A 5 ⁇ l sample of each infusion mixture was smeared evenly on the slides. After staining, slides were examined under a lOOx objective with
- the patient retrovirus-transduced cells and the transduced cell culture supernatant were tested for replication competent retrovirus (RCR).
- RCR replication competent retrovirus
- FDA Per U.S. Food & Drug Administration
- Amplification RCR Samples were prepared for storage as follows. Supernatant samples from the final harvested CD34 + cells were prepared in triplicate and consisted of alignots of clarified supernatant (5% total volume per tube) . They were stored at -80 ' C until the final transduced patient amplification sample had been collected. Duplicate RCR Co- cultivation Samples were prepared for storage, using 2% of each CD34 + cell batch per sample, and resuspended in cryopreservation media. Samples were then stored in liquid nitrogen until time of shipment. Enough cells were included to assure that the correct number of viable cells (1%) would be achieved upon thawing of the sample at BioReliance Corp. laboratories.
- Blood samples and bone marrow samples were collected from patients at screening prior to infusion and at various time points up to at least 3 years after infusion.
- the blood was collected into 10ml ACD tubes, the volume collected depending on the tests required.
- plasma was collected and PBMC prepared as cell pellets or cryopreserved samples.
- BMMC were prepared from bone marrow and used fresh for CFC assay and the remainder cryopreserved. The procedures used were as follows.
- Plasma samples (10 ml, ACD-A vacutainers) were centrifuged for 10 minutes at 2000 rpm. The plasma fraction from each tube was carefully collected and pooled into a 50ml sterile tube. 2 ml volumes of plasma were aliquoted and stored at -80' C.
- PBMC PBMC
- the cells were aliquoted at 1-2 x 10 6 cells per tube and stored frozen if required, and lysed with 140 ⁇ l
- BMMC Bone Marrow Mononuclear Cells
- CFU assays were performed on bone marrow from patients prior to infusion, thereby providing a baseline or control for all 30 other colony assays performed after infusion. As the cells had not been exposed to a gene therapeutic or control, they were not selected on G418. All procedures were performed in a biocontainment hood and aseptic technique was applied at all times .
- BMMC prepared as described above were aliquoted into three 1.5ml sterile microfuge tubes at 1.5X10 6 cells, 7.5X10 5 cells, 5 and 3X10 5 cells per tube. The samples were centrifuged at 2500 rpm for 2 min, the medium aspirated and the cell pellets resuspended thoroughly in ' 300 ⁇ l of RPMI (Gibco BRL, Cat # 118-030) + 1%FBS (Stem Cell technologies, Cat# HCC-6450) . The cell mixtures were pipetted into tubes (6 ml polystyrene
- CFC post infusion Colony Forming Cell
- BMMC BMMC were prepared as described above and aliquoted at 6xl0 5 or 1.5xl0 6 cells to sterile microfuge tubes. The cells were pelleted at ⁇ 2500 rpm for 2min. The medium was aspirated and
- T-Cell Monocyte and Granulocyte Preparation from blood.
- Leucocytes were isolated from patient's blood at several time points after infusion. These cells were fractionated into 3 types (the T-cell, macrophage and granulocyte lineages) to follow RRz2 or LNL6 presence and HIV levels.
- the blood was first separated on 1-Step Polymorphs into erythrocytes, granulocytes, and peripheral blood mononuclear cells (PBMCs) .
- the PBMCs are further fractionated on two columns: A CD3 column to yield lymphocytes and a CD14 column to yield monocytes.
- the granulocyte fraction was assessed for purity by Giemsa stain and the Lymphocyte and monocyte fractions were FACS stained to assess purity. All fractions were treated to prepare cell lysates for later DNA extraction and PCR analysis .
- the tubes were centrifuged at 1650 rpm for 30 minutes at room temp in a swinging-bucket rotor. After centrifugation, two leukocyte bands were visible.
- the top band at the plasma /l- Step interface consisted of mononuclear cells and the lower band of PMN cells (Granulocytes) .
- the erythrocytes are pelleted. All but about 1 ml of plasma was aspirated and transferred to a "Plasma" tube, leaving the mononuclear cell layer undisturbed at the interface. All plasma collections were pooled for each patient, aliquoted in 2 ml lots and kept for later preparation of the granulocyte stain.
- the PBMC interface cells were carefully transferred to a "PBMC” tube, being careful not to pick up the lower band. All PBMC collections were pooled for each patient. The lower band was transferred to a "Granulocyte” tube and pooled. An equal volume of hypotonic PBS was added to the granulocyte tube. Both the "PBMC” and “Granulocyte” tubes were filled with wash buffer up to 50 ml, mixed and centrifuged at 1500 rpm for 15 minutes at room temperature. The supernatant was aspirated and the cells washed once with 50 ml of Wash Buffer. After pelleting, the cells were resuspended in 10 ml of PBS. A cell count was performed (1:20 dilution with PBMC cell suspension and a 1:5 with the Granulocyte suspension).
- Granulocyte cell pellet/lysate preparation and phenotyping The original suspension or cell pellet was resuspended to a final concentration of 1 x 10cells/ml, if necessary repelleting the cells first. 100 ⁇ l was transferred to a microfuge tube for phenotype staining. These cells were pelleted in a microfuge at ⁇ 3000 rpm for 1 minute, suspended in 10 ⁇ l of plasma fraction, and 5 ⁇ l of this concentrated suspension smeared onto each of two microscope slides. The slides were air dried, stained with Giemsa stain for 30 min, rinsed with distilled water and let air dry. They were examined under a 20x 'objective and the fraction of granulocytes counted. The remainder of the Granulocyte cells were pelleted in a microfuge at -3000 rpm for 2 minutes for late DNA exraction.
- Vacutainers (Hemogard, SerumSep, 6 ml. Cat# 369789) were used for some DNA extractions. This was a rapid way to extract genomic DNA from CD34 selected cells, methylcellulose colonies, and patient PBMCs. 1 or 2 million cells in a 1.5 ml microfuge tube were pelleted at 3000 RPM for 3 minutes in the microcentrifuge, washed once with 1 ml of PBS and then dispersed in 70 ⁇ l of water. 140 ⁇ l of Urea Lysis Buffer was added to each tube, and the phases mixed throughly by vortexing the tubes five to eight times. These tubes can be kept frozen at -70 C indefinitely.
- phenol solution Tris equilibrated United States Biochemical #20083, with 0.4 g of hydroxyquinoline hemisulfate added per 400 ml
- the mixture pumped 2 or 3 times using a 1 ml syringe with a 23 or 25 G needle, then squirted into a vacutainer containing 210 ⁇ l of water.
- 15 ⁇ l of chloroform was then added to each vacutainer. They were capped, centrifuged at 2400 rpm for 5 min, then 0.5 ml of phenol/chloroform added. They were shaken for 30 seconds and recentrifuged at 2000 rpm for 3 min.
- the phenol/chloroform extraction was repeated, followed by two extractions with chloroform/isoamyl alcohol.
- 400 ⁇ l of the extract above the plug was transferred to a microfuge tube with an aerosol-resistant tip, and the DNA precipitated with 25 ⁇ l 5 M NaCl and 850 ⁇ l absolute ethanol at -20' C.
- the DNA was recovered by centrifugation, washed once with 70% ethanol, air dried, and resuspended in 50 ⁇ l water or 5 mM Tris pH 9.
- 20 ⁇ l was used for each 10 6 cells.
- DNA preparations were stored at -70' C.
- the 210 ⁇ l water in the vacutainers contained 10 ⁇ g tRNA (Sigma R 9001) as carrier.
- DNA was also prepared from cells using the "Acest Protocol" and used in competitive PCR and PCR-RCR assays.
- Cell pellets of approximately 5 x 10 6 cells in a microfuge tube were resuspended in 300 ⁇ l lysis buffer (10 mM Tris-HCl, 50 mM KC1, 3mM CaCl 2 , 0.4% Triton x 100, pH 8.0, filter sterilized), 3 ⁇ l of PreTaq (Boehringer Mannheim Cat #1696491) added, the sample boiled for 5 min and centrifuged at 13000rpm for 2 min. The supernatant was transferred to a clean screw-capped 1.5 ml tube, 100 ⁇ l ACES Buffer (2.28 Aces (Sigma Cat. No.
- PCR analysis of cellular DNA was carried out.
- PCR primers were labelled with P32 to enable quantitative detection of the PCR product. Labelling was carried out with ⁇ 32 P-ATP (ICN # 3502005) and T4 Polynucleotide kinase (GIBCO-
- Tris 50 mM MgCl 2 , 500 mM NaCl, 2.5 mM each of dATP, dCTP, dGTP, TTP (Gibco BRL 10297-018), 1.0 mg/ml BSA (Sigma A-4378, made up as 100 mg/ml), pH 8.0.
- LNL6/RRz2 "High copies” Method used for quantitating relatively high levels of LNL6 and RRz in preparations of DNA. Such DNA was derived from CD34 cells and hematopoietic colonies. In this protocol the PCR reactions were of 25 ⁇ l with no more than 10 4 copies of the human genome. Oligonucleotide primers we ' re 5L1A, 3L1D, Taq polymerase from Fisher. Amplification was carried out at 94 ' C for 3 min, 68 ' C for 1 min, followed by 27 cycles of 94' C for 1 min and 68' C for 1 min using an MJ Research Programmable Thermal Controller.
- Ten standard (control) samples were also treated, containing 5000, 1000, 500, 100, 50, 10, 5, 0, 0, and 0 copies of RRz2 and 0, 0, 0, 5, 10, 50, 100, 500, 1000, and 5000 copies of LNL6, respectively, all in the presence of 5000 copies of the human genome.
- LNL6/RRz2 "Low copies” Method used for quantitating relatively low levels of LNL6 and RRz in preparations of DNA. Such DNA was derived from peripheral blood cells (lymphocytes, macrophages, and granulocytes). In this protocol the reaction was run on 50 ⁇ l samples with approximately 10 6 copies of the human genome. 20 ⁇ l of DNA samples were mixed with 30 ⁇ l containing primers 5L1A and 3L1D (one labeled) , buffer and polymerase, and treated as for the "High copies” except that the 94' C steps were for 90 seconds. The standard samples were in the presence of 10 6 copies of the human genome.
- DNA was derived from CD34 + cells and hematopoietic colonies, and patient PBMCs, T-cells, and bone marrow.
- Amplification was carried out using oligonucleotide primers LX1 and LA2 , and 25 cycles of 94 ' C for 1 min, 65' C for 2 min.
- a nested radioactive PCR method was also used to calculate the ratio of LNL6:RRz2 marking where less than approximately 0.01% of cells contain either construct.
- the two rounds of PCR provided increased sensitivity and the incorporation of radioactive label readily allowed quantitation using Imagequant software. Meticulous laboratory technique was used to avoid cross-contamination and appropriate controls carried out.
- the first round of PCR used 1 ⁇ g of template DNA, primers 5Nesl and 3L2A, Buffer II (Perkin Elmer Cat #N808-0010) with 2 mM MgC12, dNTPs and Taq DNA Polymerase (Perkin Elmer Cat #N801-0060) in 50 ⁇ l volumes with taqbeads (Perkin Elmer Cat #N808-0100).
- Amplification was carried out for ten replicates of each sample in Thermofast 96 PCR plates (Advanced Biotechnologies, Cat #AB0600) using 1 cycle at 94' C, 17 cycles of 30 sec/68' C and 30 sec/94' C, and cooling to 4 ' C. Products from the ten replicates were pooled and 5 ⁇ l pooled sample used for each second round amplification reaction. The second round PCR used labelled primer 5L1A and primer 3L2A under the same conditions as the first round except that 35 cycles of amplification were carried out. Products were analysed on polyacrylamide gels. The 216 bp product corresponded to RRz2, the 174 bp product to LNL6. 3 . 11 RCR- PCR .
- the RCR-PCR assay allowed the detection of replication competent retrovirus by amplifying a highly conserved region of the env gene.
- the amplified sequence encodes part of the 5 host-determining region of the envelope protein which is required for infection of cells through the amphotropic receptor.
- the amplified region was 289bp long.
- the sensitivity of the assay was one positive cell in a background of one million negative cells (10 ⁇ 6 ) .
- the CFC assay was performed on patient bone marrow cells, CD34 + enriched cells from apheresis, and the final transduced product. Colonies from the assay were analyzed by PCR for the
- RNA was extracted from patient samples using the QIAmp RNA
- Example 4 Example 4 :
- HP cells are harvested, transduced and re-infused as follows.
- the method comprises the following steps:
- Washing Step #1 washing of the unpurified peripheral blood mononuclear cells by using a cell washer in preparation for de-bulking;
- Washing Stop #3 washing of the purified HP cells using a cell washer
- Step 1 HP Cell Mobilization.
- the first step of this procedure uses an agent to mobilize HP cells from the bone marrow into the peripheral blood.
- An example here is the use of Granulocyte Colony Stimulating Factor (G-CSF, NeupogenTM) which is administered to the patient subcutaneously, at least at 10 ⁇ g/kg/day and preferably at 30 ⁇ g/kg/day, once daily, for up to five consecutive days.
- G-CSF Granulocyte Colony Stimulating Factor
- CBCs Complete Blood Counts
- differential and platelet count are performed daily during G-CSF administration to assess the extent of the leucocytosis .
- a blood sample for CD34 + cell count is drawn on day 3 of G-CSF administration to ensure that the peripheral blood CD34 + count is greater than 20 cells/mm 3 prior to the start of apheresis.
- Step 2 - Apheresis is a method of "blood filtration” to obtain the mononuclear cell fraction of the peripheral blood.
- this apheresis yields cellular product from about 5 Liters (L) of blood flow through, preferably this will be 5-10 L, but more preferably 10-20 L, and more preferably still 20L or greater.
- Steps 1 & 2 will produce up to greater than 5xl0 6 , preferably greater than 2xl0 7 , more preferably greater than 4xl0 7 HP (as measured by CD34 positivity) cells/kg Step 3 - Washing Step #1 (preferably on days of apheresis) .
- the pooled cells are washed. This is done by cell centrifugation or more preferably using an automated cell washer, in one example this cell washing is done by using a Nexell CytoMate washer.
- Step 4 De-Bulking Step (preferably on days of apheresis) .
- the cells from the apheresis procedure (s) are "de-bulked" using a system like a Charter Medical DACS-SCTM system.
- the two apheresis products are de-bulked on the day of collection and the first product stored until the second product has been de-bulked.
- Step 5 Washing Step #2 (preferably Day 6) .
- the cells are taken, pooled (in the embodiment where there are two products) and washed by centrifugation or by using a Nexell CytoMate device or similar. (If there are more than two products all will be pooled at the latest time point) .
- Step 6 - CD34 + Cell Selection (preferably Day 6) .
- CD34 + cells are selected from the post-washing product by using the Isolex 300i, Miltenyi or a lineage depletion strategy of cells expressing markers (e.g. CD2, CD3, CD14, CD16, CD19, CD24, CD56, CD66b glycoprotein A, StemSep) .
- the enriched pool of CD34 + or lineage depleted cells preferably comprises at least 40%, more preferably at least 60% and most preferably at least 80% cells of this type.
- Step 7 - Washing Step #3 (preferably Day 6) .
- the cells are washed by centrifugation or by using the Nexell CytoMate or similar equipment.
- Step 8 Cell Culture (preferably Days 6-9) .
- the cells are counted and placed at preferably 1x10 s to 5xl0 6 cells/ml into cell culture flasks, cell culture bags or in a preferred embodiment into 1,000ml (390cm 2 ) Nexell Lifecell X-Fold Culture Bag or similar with Iscove's Modified Dulbecco' s Medium plus 10% Fetal Bovine Serum (FBS) containing cytokines/growth factors.
- FBS Fetal Bovine Serum
- this cytokine/ growth factor mixture consists of Stem Cell Factor (50ng/ml) and Megakaryocyte Growth and Development Factor (lOOng/ml) . Steps 3-9 will result in up to 12xl0 7 HP cells or more (as assessed by CD34 positivity) per kg.
- Step 9 - Transduction Procedure (preferably Day 8).
- the cells are harvested from the first flask, tissue culture bag, including a preferred embodiment of a Lifecell Culture Bag or similar and using the Cytomate device or similar, resuspended in retroviral supernatant (an example of this is a 200 ml aliquot) and transferred into a second tissue culture container, one type of which is the Lifecell X-Fold Culture Bag which have a retrovirus transduction facilitating agent.
- retrovirus transduction facilitating agent include polybrene, protamine sulphate, cationic lipids or in a preferred embodiment, in a tissue culture container that has been pre-coated with RetroNectin at l-4mcg/cm 2 .
- the transfer procedure will be repeated using the CytoMate or similar; for this second transduction cells are either transferred to a new tissue culture container (polybrene, protamine sulphate) or returned to the same or similar RetroNectin-coated container from which they came. In a preferred embodiment, this is done in a fresh aliquot of retroviral supernatant and cultured overnight. In other embodiments this is either not done or repeated several times for similar periods of time. An aliquot of the retroviral supernatant (s) is collected for sterility testing. This will result in up to 6xl0 7 gene- containing HP cells or more (as assessed by CD34 positivity) per kg. This number is determined by a quantitative assay. The transduction efficiency will be at least 20%, and preferably in the range from 30-50%, and more preferably greater than 50%. Step 10 - Harvest Cell Product (preferably on day 9) .
- Step 11 Infusion Product (preferably Day 9) .
- Step 12 Infusion of Patient (preferably Day 9) .
- the CD34 + cell preparation is administered to the patient pre-medicated as appropriate.
- the patient receives a single infusion of 0.5-6 x 10 7 transduced CD34 + cells per kilogram of body weight (cells/kg) in the physiologic infusion buffer containing 5% human serum albumin or similar as carrier.
- the dose of transduced CD34 + cells per patient will depend on the efficiency of each step of the mobilization, apheresis, isolation, culture and transduction procedures.
- the total number of CD34 + cells (transduced and non-transduced) is determined by cell counting and flow cytometry.
- the introduced gene-containing HP cells give rise to a chimeric hematopoietic system in which there is a percentage of gene-containing HP cells in the bone marrow.
- this percentage of gene-containing HP cells is at least 5%, preferably greater than 10% and more preferably than 20%.
- Example 5 Use of RNAi with multiple-targeting ability to inhibit HIV-1 replication.
- RNAi construct with multiple-targeting ability against HIV- 1 is designed as follows.
- a cassette is made comprising three RNAi units each having 19-25 nucleotide segments corresponding to HIV-1 in sense orientation (IA, 2A, 3A) and antisense orientation (IB, 2B, 3B) see Figure 14, such that IB, 2B and 3B are complementary in sequence to IA, 2A and 3A, respectively.
- sequences IA, 2A and 3A are selected as being highly conserved in most HIV-1 strains, for example sequence position 5831-5849 (atggagccagtagatccta) , sequence position 5852-5870 (ctagagccctggaagcatc) , and sequence position 5971-5989 (tggcaggaagaagcggaga) in strain HXB2 or corresponding regions in other strains.
- the sequences were calculated using the service located at the following web site : http : / /hi V- eb . lanl . qov/content /hiv-db/NUM-HXB2 /HXB2 . Nuc . html .
- the sequences IA, 2A and 3A preferably differ by not more than 1 nucleotide compared to the corresponding sequences in most HIV-1 strains.
- Each of the above nineteen nucleotide sequences are reasonably conserved within the ta t gene over many HIV subtypes and very well conserved in Subtype B.
- Each of these nineteen nucleotide sequences have no more than one base pair deviation from the consensus sequence within Subtype B.
- the first sequence includes the target for Rz2. Differences close to the ends of the sequences may be better tolerated.
- the RNAi units are separated by spacers which may be 3-7 nucleotides in length. Spacers may be longer, for example comprising intron sequences to aid in cytoplasmic localization of the RNAi units.
- the cassette is flanked by self-cleaving ribozyme sequences to allow release of the multiple RNAi molecule.
- the 5' end may be processed by a hammerhead ribozyme where the catalytic domain is designed according to US Patent No. 6,127,114, and the 3' end by an autocatalytic hairpin ribozyme designed according to US Patent No. 5,856,188.
- Such a configuration allows basepaired (blunt) ends to the RNAi molecule without extra nucleotides, although these can be tolerated.
- Autocatalytic cleavage occurs at the arrowed positions ( Figure 14) to release the 3 RNAi containing molecule.
- Spacers 1/2 and 2/3 may comprise cleavable sequences, for example sequences cleavable by the hammerhead or hairpin ribozymes or additional ribozyme units, to allow separation of the RNAi units.
- sequences cleavable by the hammerhead or hairpin ribozymes or additional ribozyme units to allow separation of the RNAi units.
- single RNAi units can be used or multimers of up to six or even ten units.
- the cassette is assembled as a DNA molecule from overlapping annealed oligonucleotides and inserted into a plasmid vector under the control of a T7 promoter.
- a recombination-deficient E . coli strain that allows the stable replication of plasmids with inverted repeat sequences, well understood in the art, is used as a cloning host. Longer spacers (eg introns) also assist in this regard.
- the nucleotide sequence of the DNA insert is confirmed by DNA sequencing. T7 RNA polymerase is used to transcribe the DNA in vi tro in the presence of radiolabelled UTP and the self-cleavage ability of the ribozyme units is assayed by electrophoresis of the transcription products .
- Self-cleavage occurs at greater than 90% efficiency during transcription at 37°C for 1 hour.
- the length and/or sequence of stems and loops in the ribozyme domains can be adjusted if cleavage is less efficient than desired.
- the cassette is inserted into the plasmid form of a retroviral vector such as pLNL6 under the control of an RNA polymerase II-dependent promoter. Alternatively, an RNA polymerase III- dependent promoter can be used.
- the cassette is inserted into a restriction site in the vector in the appropriate orientation.
- the resultant plasmid is introduced into packaging cell lines such as the AM-12 line and stably transfected cells used to produce retroviral vector.
- the CemT4 cell line or PBLs are transduced with the retroviral vector and the expression of the RNAi construct determined by RNAse protection assays or reverse transcription-PCR, well understood in the art. Significant protection of the transduced cells is observed after infection with any of several HIV-1 strains. A reduction of p24 production of more than 90% compared to the control (vector without RNAi cassette) is observed, indicating reduced HIV-1 replication.
- CD34 + cells are obtained from patients, transduced with the retroviral vector in the presence of RetroNectin by methods as described earlier in this application. At least 0.5 x 10 6 transduced CD34 + cells per kg (of weight of the patient) in a total cell population of more than 1.63 x 10 6 CD34 + such cells per kg are administered to the patients by infusion. Preferably, more than 5 x 10 6 transduced CD34 + cells per kg are administered. These cells engraft the patients' bone marrow and produce protected T-lymphocytes and macrophages/monocytes for more than three years post-infusion. These cells are relatively protected against HIV-1 infection and contribute to improved immune function.
- the non-transduced cells could play a role in enhancing the survival of the transduced cells in the peripheral blood and organs such as the liver as they are homing to the bone marrow compartment.
- Prolonged engraftment of transduced CD34 + hematopoietic cells required a minimum dose of 0.52 x 10 6 transduced cells in a total CD34 + cell population of at least 1.63 x 10 6 cells, in the context of the absence of myeloablative pre-conditioning.
- the degree of preferential survival was CD34 + cell dose-dependent, i.e. correlated positively with the number of infused transduced cells', which was unexpected. It is reasonable to expect an even greater degree of preferential survival of ribozyme-protected lymphocytes at higher levels of selection, and greater therapeutic benefit at higher cell doses .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- AIDS & HIV (AREA)
- Veterinary Medicine (AREA)
- Plant Pathology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Communicable Diseases (AREA)
- Tropical Medicine & Parasitology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (17)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE60238486T DE60238486D1 (de) | 2001-07-10 | 2002-07-10 | Verfahren zur genetischen modifikation hämatopoetischer vorläuferzellen und verwendungen der modifizierten zellen |
| HK04107955.4A HK1065074B (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| IL15963702A IL159637A0 (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| AT02746963T ATE490322T1 (de) | 2001-07-10 | 2002-07-10 | Verfahren zur genetischen modifikation hämatopoetischer vorläuferzellen und verwendungen der modifizierten zellen |
| BR0211079-2A BR0211079A (pt) | 2001-07-10 | 2002-07-10 | Processos para a modificação genética de células hematopoiéticas progenitoras e empregos das células modificadas |
| MXPA04000268A MXPA04000268A (es) | 2001-07-10 | 2002-07-10 | Metodos para la modificacion genetica de celulas hemotopoyeticas progenitoras y usos de las celulas modificadas. |
| JP2003512448A JP5179697B2 (ja) | 2001-07-10 | 2002-07-10 | 造血前駆細胞を遺伝的に改変する方法及び改変された細胞の使用 |
| DK02746963.4T DK1414996T3 (da) | 2001-07-10 | 2002-07-10 | Fremgangsmåder til genetisk modifikation af hæmatopoetiske progenitorceller og anvendelser af modificerede celler |
| US10/483,347 US7994144B2 (en) | 2001-07-10 | 2002-07-10 | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
| CA002453531A CA2453531A1 (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| AU2002316640A AU2002316640C1 (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| NZ530624A NZ530624A (en) | 2001-07-10 | 2002-07-10 | Compositions comprising C34+ hematopoietic progenitor cells transformed with an anti-viral agent for treating HIV |
| KR1020047000421A KR101015913B1 (ko) | 2001-07-10 | 2002-07-10 | 조혈모세포의 유전적 변이 치료 방법 및 변이 세포의 용도 |
| EP02746963A EP1414996B1 (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| IL159637A IL159637A (en) | 2001-07-10 | 2003-12-29 | Preparations @ for use @ in medicine @ genes that contain and transform cd34 + cells |
| US13/206,301 US20120058092A1 (en) | 2001-07-10 | 2011-08-09 | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
| US13/936,781 US20130344040A1 (en) | 2001-07-10 | 2013-07-08 | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
Applications Claiming Priority (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US30428301P | 2001-07-10 | 2001-07-10 | |
| US30412701P | 2001-07-10 | 2001-07-10 | |
| US60/304,127 | 2001-07-10 | ||
| US60/304,283 | 2001-07-10 | ||
| US34348401P | 2001-12-21 | 2001-12-21 | |
| US60/343,484 | 2001-12-21 | ||
| US38606302P | 2002-06-04 | 2002-06-04 | |
| US60/386,063 | 2002-06-04 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US10/483,347 A-371-Of-International US7994144B2 (en) | 2001-07-10 | 2002-07-10 | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
| US13/206,301 Continuation US20120058092A1 (en) | 2001-07-10 | 2011-08-09 | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2003006691A1 true WO2003006691A1 (en) | 2003-01-23 |
Family
ID=27501852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2002/021907 Ceased WO2003006691A1 (en) | 2001-07-10 | 2002-07-10 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
Country Status (15)
| Country | Link |
|---|---|
| US (2) | US7345025B2 (https=) |
| EP (2) | EP2322618A1 (https=) |
| JP (2) | JP5179697B2 (https=) |
| KR (1) | KR101015913B1 (https=) |
| CN (2) | CN101926824A (https=) |
| AT (1) | ATE490322T1 (https=) |
| AU (1) | AU2002316640C1 (https=) |
| BR (1) | BR0211079A (https=) |
| CA (1) | CA2453531A1 (https=) |
| DE (1) | DE60238486D1 (https=) |
| DK (1) | DK1414996T3 (https=) |
| IL (2) | IL159637A0 (https=) |
| MX (1) | MXPA04000268A (https=) |
| NZ (1) | NZ530624A (https=) |
| WO (1) | WO2003006691A1 (https=) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007011088A1 (en) * | 2005-07-20 | 2007-01-25 | Seoul National University Industry Foundation | Method for culturingand proliferating hematopoietic stem cells and progenitor cells using human endometrial cells |
| JP2007535965A (ja) * | 2004-05-06 | 2007-12-13 | モルメド エスピーエー | 細胞の調製 |
| WO2010075061A2 (en) | 2008-12-23 | 2010-07-01 | Johnson & Johnson Research Pty Limited | Processing blood |
| JP2010263907A (ja) * | 2003-04-08 | 2010-11-25 | Yeda Research & Devlopment Co Ltd | 化学誘引物質に対する増大させた感受性を有する幹細胞およびそれを産生および使用する方法 |
| US7994144B2 (en) | 2001-07-10 | 2011-08-09 | Johnson & Johnson Research Pty, Limited | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
| WO2014087408A1 (en) | 2012-12-06 | 2014-06-12 | Enlivex Therapeutics Ltd | Therapeutic apoptotic cell preparations, method for producing same and uses thereof |
| US20190269734A1 (en) * | 2017-11-15 | 2019-09-05 | Weird Science Llc | Methods and compositions for non-myeloablative bone marrow reconstitution |
Families Citing this family (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020058636A1 (en) * | 1994-09-21 | 2002-05-16 | Geoffrey P. Symonds | Ribozymes targeting the retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs |
| CA2279673A1 (en) * | 1995-12-15 | 1997-06-16 | Enzo Therapeutics, Inc. | Property effecting and/or property exhibiting constructs for the expression of non-native nucleic acids for therapeutic and diagnostic uses |
| US6627442B1 (en) * | 2000-08-31 | 2003-09-30 | Virxsys Corporation | Methods for stable transduction of cells with hiv-derived viral vectors |
| US7345025B2 (en) | 2001-07-10 | 2008-03-18 | Johnson & Johnson Research Pty. Limited | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| CA2453187A1 (en) * | 2001-07-10 | 2003-01-23 | J & J Research Pty Ltd | Production of transduced hematopoietic progenitor cells |
| AU2002326906C1 (en) | 2001-09-13 | 2009-01-29 | California Institute Of Technology | Method for expression of small antiviral RNA molecules within a cell |
| US7737124B2 (en) * | 2001-09-13 | 2010-06-15 | California Institute Of Technology | Method for expression of small antiviral RNA molecules with reduced cytotoxicity within a cell |
| DE10212892A1 (de) * | 2002-03-20 | 2003-10-09 | Basf Plant Science Gmbh | Konstrukte und Verfahren zur Regulation der Genexpression |
| DE10224750A1 (de) | 2002-06-04 | 2003-12-24 | Fresenius Medical Care De Gmbh | Vorrichtung zur Behandlung einer medizinischen Flüssigkeit |
| WO2004071418A2 (en) * | 2003-02-06 | 2004-08-26 | Walter Reed Army Institute Of Research | Compounds for the treatment of systemic lupus erythematosus |
| US7935074B2 (en) * | 2005-02-28 | 2011-05-03 | Fresenius Medical Care Holdings, Inc. | Cassette system for peritoneal dialysis machine |
| US8197231B2 (en) | 2005-07-13 | 2012-06-12 | Purity Solutions Llc | Diaphragm pump and related methods |
| EP2032691A2 (en) * | 2006-06-15 | 2009-03-11 | Neostem, Inc | Processing procedure for peripheral blood stem cells |
| JP2011160661A (ja) * | 2008-06-02 | 2011-08-25 | Kyowa Hakko Kirin Co Ltd | 血球細胞の初期化法 |
| US8112365B2 (en) * | 2008-12-19 | 2012-02-07 | Foster Scott C | System and method for online employment recruiting and evaluation |
| US8192401B2 (en) * | 2009-03-20 | 2012-06-05 | Fresenius Medical Care Holdings, Inc. | Medical fluid pump systems and related components and methods |
| US20120034197A1 (en) * | 2009-04-09 | 2012-02-09 | Stemcyte Inc. | Hiv-resistant stem cells and uses thereof |
| CN102497895A (zh) | 2009-07-15 | 2012-06-13 | 弗雷塞尼斯医疗保健控股公司 | 医疗流体盒及相关系统和方法 |
| US8720913B2 (en) | 2009-08-11 | 2014-05-13 | Fresenius Medical Care Holdings, Inc. | Portable peritoneal dialysis carts and related systems |
| JP5946775B2 (ja) * | 2010-12-01 | 2016-07-06 | 日産化学工業株式会社 | ピラゾール化合物による造血幹細胞の製造方法 |
| DE102010053973A1 (de) | 2010-12-09 | 2012-06-14 | Fresenius Medical Care Deutschland Gmbh | Medizinisches Gerät mit einer Heizung |
| EP2654825B1 (en) | 2010-12-20 | 2017-08-02 | Fresenius Medical Care Holdings, Inc. | Medical fluid cassettes and related systems and methods |
| US9624915B2 (en) | 2011-03-09 | 2017-04-18 | Fresenius Medical Care Holdings, Inc. | Medical fluid delivery sets and related systems and methods |
| CN103648540B (zh) | 2011-04-21 | 2016-06-01 | 弗雷塞尼斯医疗保健控股公司 | 医疗流体泵送系统及相关装置和方法 |
| US9186449B2 (en) | 2011-11-01 | 2015-11-17 | Fresenius Medical Care Holdings, Inc. | Dialysis machine support assemblies and related systems and methods |
| US9610392B2 (en) | 2012-06-08 | 2017-04-04 | Fresenius Medical Care Holdings, Inc. | Medical fluid cassettes and related systems and methods |
| US9500188B2 (en) | 2012-06-11 | 2016-11-22 | Fresenius Medical Care Holdings, Inc. | Medical fluid cassettes and related systems and methods |
| IN2015DN02032A (https=) * | 2012-09-07 | 2015-08-14 | Univ Yale | |
| CA2887706C (en) * | 2012-11-05 | 2022-08-02 | Regeneron Pharmaceuticals | Genetically modified non-human animals and methods of use thereof |
| US9561323B2 (en) | 2013-03-14 | 2017-02-07 | Fresenius Medical Care Holdings, Inc. | Medical fluid cassette leak detection methods and devices |
| US10117985B2 (en) | 2013-08-21 | 2018-11-06 | Fresenius Medical Care Holdings, Inc. | Determining a volume of medical fluid pumped into or out of a medical fluid cassette |
| CN103471896A (zh) * | 2013-09-09 | 2013-12-25 | 上海兰卫临床检验有限公司 | 革兰染色液质控品制备方法 |
| US20200199534A1 (en) * | 2017-04-27 | 2020-06-25 | Fred Hutchinson Cancer Research Center | Therapeutic formulations containing cd34+ stem cells derived from negative selection |
Family Cites Families (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE115999T1 (de) | 1987-12-15 | 1995-01-15 | Gene Shears Pty Ltd | Ribozyme. |
| US5254678A (en) | 1987-12-15 | 1993-10-19 | Gene Shears Pty. Limited | Ribozymes |
| US5866701A (en) | 1988-09-20 | 1999-02-02 | The Board Of Regents For Northern Illinois University Of Dekalb | HIV targeted hairpin ribozymes |
| US4978514A (en) | 1989-09-12 | 1990-12-18 | Fuel Tech, Inc. | Combined catalytic/non-catalytic process for nitrogen oxides reduction |
| US5225337A (en) | 1989-09-25 | 1993-07-06 | Innovir Laboratories, Inc. | Ribozyme compositions and methods for use |
| US5500357A (en) * | 1990-11-02 | 1996-03-19 | Agency Of Industrial Science & Technology, Ministry Of International Trade & Industry | RNA transcription system using novel ribozyme |
| WO1992017211A1 (en) | 1991-04-05 | 1992-10-15 | Edison Animal Biotechnology Center, Ohio University | Retrovirus inhibition with antisense nucleic acids complementary to packaging sequences |
| US5525468A (en) * | 1992-05-14 | 1996-06-11 | Ribozyme Pharmaceuticals, Inc. | Assay for Ribozyme target site |
| US5693535A (en) * | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| US5911983A (en) | 1992-06-26 | 1999-06-15 | University Of Pittsburgh | Gene therapy for Gaucher disease using retroviral vectors |
| PT652705E (pt) | 1992-06-29 | 2006-05-31 | Gene Shears Pty Ltd | Acidos nucleicos e metodos para a sua utilizacao para combater patogenios virais |
| EP0681482B1 (en) | 1993-01-22 | 2005-12-07 | University Research Corporation | Localization of therapeutic agents |
| IL108719A0 (en) | 1993-02-25 | 1994-08-26 | Ortho Pharma Corp | Expression constructs containing hiv inhibitory antisense and other nucleotide sequences, retroviralvectors and recombinant retroviruses containing them |
| WO1995004818A1 (en) | 1993-08-06 | 1995-02-16 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting human immunodeficiency virus replication |
| US5624803A (en) * | 1993-10-14 | 1997-04-29 | The Regents Of The University Of California | In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom |
| US5712384A (en) * | 1994-01-05 | 1998-01-27 | Gene Shears Pty Ltd. | Ribozymes targeting retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs |
| CA2180358A1 (en) | 1994-01-05 | 1995-07-13 | Geoffrey P. Symonds | Ribozymes targeting the retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs |
| US20020058636A1 (en) | 1994-09-21 | 2002-05-16 | Geoffrey P. Symonds | Ribozymes targeting the retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs |
| AU5557196A (en) | 1995-04-20 | 1996-11-07 | Chiron Corporation | High efficiency ex vivo transduction of hematopoietic stem cells by recombinant retroviral preparations |
| US5741706A (en) | 1996-06-13 | 1998-04-21 | Immusol, Incorporated | Anti-HIV ribozymes |
| TWI239352B (en) * | 1997-07-23 | 2005-09-11 | Takara Bio Inc | Gene transfer method with the use of serum-free medium |
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| US6060317A (en) * | 1998-08-11 | 2000-05-09 | The United States Of America As Represented By The Department Of Health And Human Services | Method of transducing mammalian cells, and products related thereto |
| AU2036700A (en) | 1998-12-04 | 2000-06-26 | City Of Hope | A method of genetically modifying very primitive quiescent human hematopoietic stem cells |
| WO2000075291A2 (en) * | 1999-06-08 | 2000-12-14 | Novartis Ag | Cells with enforced expression of bcl-xl |
| WO2002022611A2 (en) | 2000-09-13 | 2002-03-21 | Vertex Pharmaceuticals Incorporated | Caspase inhibitors and uses thereof |
| JP2004532616A (ja) | 2000-12-28 | 2004-10-28 | ジョンソン・アンド・ジョンソン・リサーチ・ピー・ティー・ワイ・リミテッド | 二本鎖rna仲介遺伝子抑制 |
| CA2453187A1 (en) * | 2001-07-10 | 2003-01-23 | J & J Research Pty Ltd | Production of transduced hematopoietic progenitor cells |
| ES2358187T3 (es) | 2001-07-10 | 2011-05-06 | JOHNSON & JOHNSON RESEARCH PTY LIMITED | Procedimientos para la modificación genética de las células progenitoras hematopoyéticas y utilizaciones de las células modificadas. |
| US7345025B2 (en) | 2001-07-10 | 2008-03-18 | Johnson & Johnson Research Pty. Limited | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells |
| KR100646702B1 (ko) * | 2001-08-16 | 2006-11-17 | 에스케이씨 주식회사 | 홀 및/또는 그루브로 형성된 화학적 기계적 연마패드 |
-
2002
- 2002-07-10 US US10/192,980 patent/US7345025B2/en not_active Expired - Fee Related
- 2002-07-10 AU AU2002316640A patent/AU2002316640C1/en not_active Ceased
- 2002-07-10 EP EP10183035A patent/EP2322618A1/en not_active Withdrawn
- 2002-07-10 DK DK02746963.4T patent/DK1414996T3/da active
- 2002-07-10 CA CA002453531A patent/CA2453531A1/en not_active Abandoned
- 2002-07-10 AT AT02746963T patent/ATE490322T1/de not_active IP Right Cessation
- 2002-07-10 MX MXPA04000268A patent/MXPA04000268A/es active IP Right Grant
- 2002-07-10 JP JP2003512448A patent/JP5179697B2/ja not_active Expired - Fee Related
- 2002-07-10 DE DE60238486T patent/DE60238486D1/de not_active Expired - Lifetime
- 2002-07-10 NZ NZ530624A patent/NZ530624A/en not_active IP Right Cessation
- 2002-07-10 IL IL15963702A patent/IL159637A0/xx unknown
- 2002-07-10 CN CN2010102736257A patent/CN101926824A/zh active Pending
- 2002-07-10 EP EP02746963A patent/EP1414996B1/en not_active Expired - Lifetime
- 2002-07-10 KR KR1020047000421A patent/KR101015913B1/ko not_active Expired - Fee Related
- 2002-07-10 WO PCT/US2002/021907 patent/WO2003006691A1/en not_active Ceased
- 2002-07-10 BR BR0211079-2A patent/BR0211079A/pt not_active IP Right Cessation
- 2002-07-10 CN CNA028177428A patent/CN1553963A/zh active Pending
-
2003
- 2003-12-29 IL IL159637A patent/IL159637A/en not_active IP Right Cessation
-
2006
- 2006-08-18 US US11/506,722 patent/US7776595B2/en not_active Expired - Fee Related
-
2009
- 2009-09-14 JP JP2009211662A patent/JP2010077125A/ja active Pending
Non-Patent Citations (123)
| Title |
|---|
| AMADO ET AL.: "A phase I trial of autologous CD34+ hematopoietic progenitor cells transduced with an anti-HIV ribozyme", HUMAN GENE THERAPY, vol. 10, 1 September 1999 (1999-09-01), pages 2255 - 2270, XP002955706 * |
| BAUER ET AL.: "Gene therapy for pediatric AIDS", ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 918, 2000, pages 318 - 329, XP002955701 * |
| CALENDA ET AL.: "The effects of HIV on hematopoiesis", EUROPEAN JOURNAL OF HAEMATOLOGY, vol. 48, 1992, pages 181 - 186, XP002955704 * |
| CHERRY ET AL., MOL CELL BIOL, vol. 20, 2000, pages 7419 - 26 |
| CHU ET AL., J MOL MED, vol. 76, 1998, pages 184 - 192 |
| COHEN-HAGUENAUER ET AL., HUM GENE THER, vol. 9, 1998, pages 207 - 16 |
| CRYSTAL, SCIENCE, vol. 270, 1995, pages 404 - 10 |
| DAO ET AL., BLOOD, vol. 89, 1997, pages 446 - 56 |
| DAO ET AL., BLOOD, vol. 92, 1998, pages 4612 - 21 |
| DAO ET AL., PROC NATL ACAD SCI USA, vol. 95, 1998, pages 13006 - 11 |
| DAO; NOLTA, LEUKEMIA, vol. 13, 1999, pages 1473 - 80 |
| DAO; NOLTA, LEUKEMIA, vol. 14, 2000, pages 773 - 6 |
| DE FEYTER ET AL.: "Technology evalution: HIV ribozyme gene therapy, gene shears Pty Ltd.", CURRENT OPINION IN MOLECULAR THERAPEUTICS, vol. 2, no. 3, 2000, pages 332 - 335, XP002955705 * |
| DONAHUE ET AL., NATURE MED, vol. 4, 1998, pages 181 - 6 |
| DOUEK ET AL., NATURE, vol. 396, 1998, pages 690 - 695 |
| DUCOS ET AL., GENE THER, vol. 7, no. 1, 2000, pages 790 - 4 |
| DUNBAR ET AL., ANN NY ACAD SCI, vol. 938, 2001, pages 236 - 45 |
| DUNBAR ET AL., BLOOD, vol. 85, 1995, pages 3048 - 3057 |
| DUNBAR ET AL., HUM GENE THER, vol. 7, 1998, pages 231 - 53 |
| DUNBAR ET AL., HUM GENE THER, vol. 9, 1998, pages 2629 - 40 |
| EGLITIS; SCHNEIDERMAN, BIOCHEM BIOPHYS RES COMMUN, vol. 231, 1997, pages 477 - 80 |
| FAN ET AL., HUM GENE THER, vol. 11, 2000, pages 1313 - 27 |
| FEHSE ET AL., HUM GENE THER, vol. 8, 1997, pages 1815 - 24 |
| FENG ET AL., NATURE BIOTECHNOL, vol. 15, 1997, pages 866 - 870 |
| FISHER-ADAMS ET AL., BLOOD, vol. 88, 1996, pages 492 - 504 |
| FU; LIESVELD, BLOOD REV, vol. 14, 2000, pages 205 - 18 |
| GABARRE ET AL., THE LANCET, vol. 355, 2000, pages 1071 - 2 |
| GAMBOTTO ET AL., METHODS MOL BIOL, vol. 135, 2000, pages 495 - 508 |
| GERARD ET AL., HUM GENE THER, vol. 7, 1996, pages 343 - 54 |
| GERVAIX ET AL., HUM GENE THER, vol. 8, 1997, pages 2229 - 38 |
| GIARRATANA ET AL., BONE MARROW TRANSPL, vol. 22, 1998, pages 707 - 15 |
| GITLIN ET AL., NATURE ADVANCE ONLINE PUBLICN., 26 June 2002 (2002-06-26) |
| GLIMM ET AL., HUM GENE THER, vol. 9, 1998, pages 771 - 8 |
| GLUCKMAN, EXP HEMATOL, vol. 28, 2000, pages 1197 - 205 |
| GOERNER ET AL., BLOOD, vol. 94, 1999, pages 2287 - 92 |
| GOTHOT ET AL., BLOOD, vol. 92, 1998, pages 2641 - 2649 |
| GRIMM; KLEINSCHMIDT, HUM GENE THER, vol. 10, 1999, pages 2445 - 2450 |
| HAAS ET AL., MOL THER, vol. 2, 2000, pages 71 - 80 |
| HACEIN-BEY-ABINA ET AL., NEW ENG J MEDICINE, vol. 346, 2002, pages 1185 - 93 |
| HALENE ET AL., BLOOD, vol. 94, 1999, pages 3349 - 57 |
| HALENE; KOHN, HUM GENE THER, vol. 11, 2000, pages 1259 - 67 |
| HAMPEL ET AL., NUCLEIC ACIDS RES, vol. 18, 1990, pages 299 - 304 |
| HANENBERG ET AL., HUM GENE THER, vol. 8, 1997, pages 2193 - 2206 |
| HANENBERG ET AL., NAT MED, vol. 2, 1996, pages 876 - 82 |
| HAO ET AL., BLOOD, vol. 88, 1996, pages 3306 - 3313 |
| HARRISON ET AL., PROC NATL ACAD SCI USA, vol. 85, 1988, pages 822 - 6 |
| HARRISON, BLOOD, vol. 55, 1980, pages 77 - 81 |
| HASELOFF; GERLACH, NATURE, vol. 334, 1988, pages 585 - 91 |
| HENNEMANN ET AL., EXP HEMATOL, vol. 27, 1999, pages 817 - 825 |
| HERRERA ET AL., BRIT J HEMATOL, vol. 114, 2001, pages 920 - 30 |
| HESFORFFER ET AL., J CLIN ONCOL, vol. 16, 1998, pages 165 - 72 |
| HO ET AL., BLOOD, vol. 88, no. 1, 1996, pages 405A |
| HO ET AL., NATURE, vol. 373, 1995, pages 123 - 126 |
| HO, LEUKEMIA, vol. 7, 1993, pages 1738 - 46 |
| HODGSON; BRADLEY, NATURE, vol. 281, 1979, pages 381 - 2 |
| HOGAN ET AL., PROC NATL ACAD SCI USA, vol. 99, 2002, pages 413 - 8 |
| HOOGERBRUGGE ET AL., GENE THER, vol. 3, 1996, pages 179 - 183 |
| HUHN ET AL., EXP HEMATOL, vol. 24, 1996, pages 839 - 47 |
| HUSS, STEM CELLS, vol. 18, 2000, pages 1 - 9 |
| HUTCHINGS ET AL., J HEMATOTHER, vol. 7, 1998, pages 217 - 24 |
| IJICHI ET AL.: "In vivo induction of human immunodeficiency virus type 1 entry into nucleus-free cells by CD4 gene transfer to hematopoietic stem cells: a hypothetical possible strategy for therapeutic intervention", MEDICAL HYPOTHESIS, vol. 59, no. 1, 2002, pages 24 - 34, XP002955296 * |
| IMBERT ET AL., EXP HEMATOL, vol. 26, 1998, pages 374 - 81 |
| JACQUE ET AL., NATURE ADVANCE ONLINE PUBLICN, 26 June 2002 (2002-06-26) |
| JAMIESON ET AL., IMMUNITY, vol. 10, 1999, pages 569 - 575 |
| JONES ET AL., NATURE, vol. 347, 1990, pages 188 - 9 |
| KANSAS, BLOOD, vol. 88, 1996, pages 3259 - 87 |
| KIEM ET AL., BLOOD, vol. 90, 1997, pages 4638 - 4645 |
| KIEM ET AL., BLOOD, vol. 92, 1998, pages 1878 - 1886 |
| KIRBY ET AL., BLOOD, vol. 95, 2000, pages 3710 - 5 |
| KNAAN-SHANZER ET AL., HUM GENE THER, vol. 12, 2001, pages 1989 - 2005 |
| KNOP ET AL., GENE THERAPY, vol. 6, 1999, pages 373 - 84 |
| KOBARI ET AL., EXP HEMATOL, vol. 28, 2000, pages 1470 - 80 |
| KOHN ET AL., BLOOD, vol. 94, 1999, pages 368 - 71 |
| KOHN ET AL., NATURE MEDICINE, vol. 4, 1998, pages 775 - 780 |
| KOHN ET AL.: "A clinical trail of retroviral-mediated transfer of a rev-responsive element decoy gene into CD34+ cells from the bone marrow of human immunodeficiency virus-1-infected children", BLOOD, vol. 94, no. 1, 1 July 1999 (1999-07-01), pages 368 - 371, XP002955297 * |
| KOHN, NATURE MEDICINE, vol. 1, 1995, pages 1017 - 1023 |
| KRÄMER ET AL., PROC NATL ACAD SCI USA, vol. 96, 1999, pages 2087 - 92 |
| KUME ET AL., INT J HEMATOL, vol. 69, 1999, pages 227 - 33 |
| LANE ET AL., BLOOD, vol. 85, 1995, pages 275 - 82 |
| LANGE; BLANKENSTEIN, GENE THERAPY, vol. 4, 1997, pages 303 - 8 |
| LATAILLADE ET AL., BLOOD, vol. 95, 2000, pages 756 - 68 |
| LAW ET AL., EXP HEMATOL, vol. 27, 1999, pages 147 - 54 |
| LAW ET AL.: "Mobilization of peripheral blood progenitor cells for human immunodeficiency virus-infected individuals", EXPERIMENTAL HEMATOLOGY, vol. 27, 1999, pages 147 - 154, XP002955299 * |
| LAWRENCE: "RNAi Could hold promise in the treatment of HIV", THE LANCET, vol. 359, 8 June 2002 (2002-06-08), pages 2007, XP002955721 * |
| LEDOUX ET AL., HUM GENE THER, vol. 12, 2001, pages 1611 - 21 |
| LEE ET AL., J VIROL, vol. 68, 1994, pages 8254 - 64 |
| LEE ET AL.: "An intricate web: Chemokine receptors, HIV-1 and hematopoiesis", STEM CELLS, vol. 16, 1998, pages 79 - 88, XP002955707 * |
| LEWIS; VERFAILLIE, EXP HEMATOL, vol. 28, 2000, pages 1087 - 95 |
| LIEBER ET AL., J VIROL, vol. 73, 1999, pages 9314 - 24 |
| LISZIEWICZ ET AL., PROC NATL ACAD SCI USA, vol. 90, 1993, pages 8000 - 4 |
| LIU ET AL., HUM GENE THER, vol. 10, 1999, pages 2337 - 46 |
| LYMAN; JACOBSEN, BLOOD, vol. 91, 1998, pages 1101 - 34 |
| MACIEJEWSKI ET AL., NATURE MED, vol. 1, 1995, pages 667 - 73 |
| MALECH ET AL., PROC NATL ACAD SCI USA, vol. 94, 1997, pages 12133 - 8 |
| MALIK ET AL., BLOOD, vol. 86, 1995, pages 2993 - 3005 |
| MARANDIN ET AL., BLOOD, vol. 88, 1996, pages 4568 - 78 |
| MARASCO ET AL., HUMAN GENE THER, vol. 9, 1998, pages 1627 - 42 |
| MARINI ET AL., CANER GENE THER, vol. 7, 2000, pages 816 - 25 |
| MARTINEZ ET AL., EXP HEMATOL, vol. 27, 1999, pages 561 - 8 |
| MAUTINO ET AL.: "Gene therapy of HIV-1 infection using lentiviral vectors expressing anti-HIV genes", AIDS PATIENT CARE AND STDS, vol. 16, no. 1, 2002, pages 11 - 26, XP002955702 * |
| MAUTINO; MORGAN, AIDS PATIENT CARE AND STDS, vol. 16, 2002, pages 11 - 26 |
| MICHIENZI ET AL., PROC NATL ACAD SCI USA, vol. 97, 2000, pages 8955 - 60 |
| MILLER: "Beyond ANOVA", 1986, JOHN WILEY AND SONS |
| MILLER; BUTTIMORE, MOL CELL BIOL, vol. 6, 1986, pages 2895 - 902 |
| MIYOSHI ET AL., SCIENCE, vol. 283, 1999, pages 682 - 686 |
| MOORE; MACKENZIE, PROG EXP TUMOR RES, vol. 36, 1999, pages 20 - 49 |
| MOREL ET AL.: "Hematologic recovery in mice transplanted with bone marrow stem cells expressing anti-human immunodeficiencey virus genes", HUMAN GENE THERAPY, vol. 10, 20 November 1999 (1999-11-20), pages 2779 - 2787, XP002955703 * |
| NOVINA ET AL.: "siRNA directed inhibition of HIV-1 infection", NATURE MEDICINE, vol. 7, no. 8, July 2002 (2002-07-01), pages 681 - 686, XP002955298 * |
| POESCHLA ET AL.: "Development of HIV vectors for anti-HIV gene therapy", PROC. NATL. ACAD. SCI. USA, vol. 93, October 1996 (1996-10-01), pages 11395 - 11399, XP000616290 * |
| SADELAIN ET AL.: "Issues in the manufacture and transplantation of genetically modified hematopoietic stem cells", CURRENT OPINION IN HEMATOLOGY, vol. 7, 2000, pages 364 - 377, XP002955300 * |
| VERES ET AL., J VIROL, vol. 72, 1998, pages 1894 |
| VERFAILLIE ET AL., EXP HEMATOL, vol. 28, 2000, pages 1071 - 9 |
| VIGNOLI ET AL., AIDS, vol. 12, 1998, pages 999 - 1005 |
| VON LAER ET AL., J VIROL, vol. 72, 1998, pages 1424 - 30 |
| WANG ET AL., HUMAN GENE THER, vol. 9, 1998, pages 1283 - 91 |
| WARD ET AL., AMERICAN J PATHOLOGY, vol. 153, 1998, pages 373 - 379 |
| WILLIAMS ET AL., ANN NY ACAD SCI, vol. 872, 1999, pages 109 - 13 |
| YU ET AL., PROC NATL ACAD SCI USA, vol. 92, 1995, pages 699 - 703 |
| ZANJANI ET AL., EXP HEMATOL, vol. 26, 1998, pages 353 - 60 |
| ZAULI ET AL., J EXP MED, vol. 183, 1996, pages 99 - 108 |
| ZHANG ET AL., J EXP MED, vol. 190, 1999, pages 725 - 32 |
| ZHANG ET AL., PROC NATL ACAD SCI USA, vol. 95, 1998, pages 1154 - 9 |
| ZIMMERMANN ET AL., BONE MARROW TRANSPL, vol. 9, 1995, pages 439 - 44 |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7994144B2 (en) | 2001-07-10 | 2011-08-09 | Johnson & Johnson Research Pty, Limited | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells |
| JP2010263907A (ja) * | 2003-04-08 | 2010-11-25 | Yeda Research & Devlopment Co Ltd | 化学誘引物質に対する増大させた感受性を有する幹細胞およびそれを産生および使用する方法 |
| JP2007535965A (ja) * | 2004-05-06 | 2007-12-13 | モルメド エスピーエー | 細胞の調製 |
| WO2007011088A1 (en) * | 2005-07-20 | 2007-01-25 | Seoul National University Industry Foundation | Method for culturingand proliferating hematopoietic stem cells and progenitor cells using human endometrial cells |
| US10940259B2 (en) | 2008-12-23 | 2021-03-09 | Mallinckrodt Hospital Products IP Limited | Processing blood |
| EP2392369A1 (en) | 2008-12-23 | 2011-12-07 | Therakos, Inc. | Processing blood |
| US10926020B2 (en) | 2008-12-23 | 2021-02-23 | Mallinckrodt Hospital Products IP Limited | Processing blood |
| WO2010075061A2 (en) | 2008-12-23 | 2010-07-01 | Johnson & Johnson Research Pty Limited | Processing blood |
| US10953149B2 (en) | 2008-12-23 | 2021-03-23 | Mallinckrodt Hospital Products IP Limited | Processing blood |
| US12447253B2 (en) | 2008-12-23 | 2025-10-21 | Therakos Development Limited | Processing blood |
| WO2014087408A1 (en) | 2012-12-06 | 2014-06-12 | Enlivex Therapeutics Ltd | Therapeutic apoptotic cell preparations, method for producing same and uses thereof |
| CN105102612A (zh) * | 2012-12-06 | 2015-11-25 | 恩立夫克治疗有限责任公司 | 治疗性凋亡细胞制剂、其制备方法以及其用途 |
| US10077426B2 (en) | 2012-12-06 | 2018-09-18 | Enlivex Therapeutics Ltd | Therapeutic apoptotic cell preparations, method for producing same and uses thereof |
| US10927343B2 (en) | 2012-12-06 | 2021-02-23 | Enlivex Therapeutics Ltd | Therapeutic apoptotic cell preparations, method for producing same and uses thereof |
| US20190269734A1 (en) * | 2017-11-15 | 2019-09-05 | Weird Science Llc | Methods and compositions for non-myeloablative bone marrow reconstitution |
| EP3710013A4 (en) * | 2017-11-15 | 2021-06-16 | Weird Science LLC | PROCEDURES AND COMPOSITIONS FOR NON-MYELOABLATIVE BONE MARROW RECONSTITUTION |
| US12194062B2 (en) | 2017-11-15 | 2025-01-14 | Weird Science Llc | Methods for non-myeloablative bone marrow reconstitution |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1414996B1 (en) | 2010-12-01 |
| US7776595B2 (en) | 2010-08-17 |
| EP2322618A1 (en) | 2011-05-18 |
| HK1065074A1 (en) | 2005-02-08 |
| AU2002316640C1 (en) | 2009-01-29 |
| BR0211079A (pt) | 2005-08-30 |
| EP1414996A4 (en) | 2007-03-28 |
| KR101015913B1 (ko) | 2011-02-23 |
| CN101926824A (zh) | 2010-12-29 |
| MXPA04000268A (es) | 2005-03-07 |
| DK1414996T3 (da) | 2011-03-21 |
| IL159637A0 (en) | 2004-06-01 |
| US7345025B2 (en) | 2008-03-18 |
| AU2002316640B2 (en) | 2008-06-12 |
| JP2005528319A (ja) | 2005-09-22 |
| EP1414996A1 (en) | 2004-05-06 |
| NZ530624A (en) | 2009-02-28 |
| KR20040032852A (ko) | 2004-04-17 |
| IL159637A (en) | 2013-07-31 |
| CA2453531A1 (en) | 2003-01-23 |
| US20080044394A1 (en) | 2008-02-21 |
| CN1553963A (zh) | 2004-12-08 |
| ATE490322T1 (de) | 2010-12-15 |
| DE60238486D1 (de) | 2011-01-13 |
| US20040072771A1 (en) | 2004-04-15 |
| JP5179697B2 (ja) | 2013-04-10 |
| JP2010077125A (ja) | 2010-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2002316640C1 (en) | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells | |
| AU2002316640A1 (en) | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells | |
| US20130344040A1 (en) | Process for the preparation of a composition of genetically modified hematopoietic progenitor cells | |
| KR102390629B1 (ko) | 헤모글로빈병증을 치료하기 위한 조성물 및 방법 | |
| OA10194A (en) | Ribozyme gene therapy for hiv infection and aids | |
| Fanning et al. | Gene therapy for HIV/AIDS: the potential for a new therapeutic regimen | |
| JP2005521632A (ja) | 形質導入造血前駆細胞の生産 | |
| US12350284B2 (en) | BCL11A microRNAs for treating hemoglobinopathies | |
| Ngok et al. | Clinical gene therapy research utilizing ribozymes: application to the treatment of HIV/AIDS | |
| HK1065074B (en) | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells | |
| RU2824194C2 (ru) | Способы генной модификации гемопоэтических клеток | |
| Moritz et al. | Methods for gene transfer: genetic manipulation of hematopoietic stem cells | |
| AU7681394A (en) | Methods of suppressing graft rejection | |
| AU2002320365A1 (en) | Production of transduced hematopoietic progenitor cells | |
| Trobridge et al. | Protection of Stem Cell-Derived Lymphocytes in a Primate AIDS Gene Therapy Model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LU MC NL PT SE SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 159637 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2004/000268 Country of ref document: MX Ref document number: 2003512448 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020047000421 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2453531 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200400322 Country of ref document: ZA Ref document number: 530624 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002316640 Country of ref document: AU Ref document number: 197/DELNP/2004 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2002746963 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 20028177428 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2002746963 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10483347 Country of ref document: US |