WO2002101232A2 - Proteine interagissant avec bace - Google Patents

Proteine interagissant avec bace Download PDF

Info

Publication number
WO2002101232A2
WO2002101232A2 PCT/EP2002/006667 EP0206667W WO02101232A2 WO 2002101232 A2 WO2002101232 A2 WO 2002101232A2 EP 0206667 W EP0206667 W EP 0206667W WO 02101232 A2 WO02101232 A2 WO 02101232A2
Authority
WO
WIPO (PCT)
Prior art keywords
bace
interacting
proteins
protein
cells
Prior art date
Application number
PCT/EP2002/006667
Other languages
English (en)
Other versions
WO2002101232A3 (fr
Inventor
Els Marjaux
Diana Ines Dominguez-Tinland
Wim Annaert
Bart De Strooper
Original Assignee
Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw filed Critical Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw
Priority to AU2002345051A priority Critical patent/AU2002345051A1/en
Publication of WO2002101232A2 publication Critical patent/WO2002101232A2/fr
Publication of WO2002101232A3 publication Critical patent/WO2002101232A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4711—Alzheimer's disease; Amyloid plaque core protein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to the field of Alzheimer's disease.
  • the invention describes the identification, isolation, sequencing of several genes that code for proteins that interact with ⁇ -secretase (BACE). These BACE-interacting proteins are involved in pathways that lead to the development of Alzheimer's disease. Nucleic acids and proteins comprising or derived from these BACE-interacting proteins are useful in screening and diagnosing Alzheimer's disease, in identifying and developing therapeutics for the treatment of Alzheimer's disease, and in producing cell lines and transgenic animals useful as models for Alzheimer's disease.
  • BACE ⁇ -secretase
  • AD Alzheimer's disease
  • histopathological hallmark of AD is the presence of neurofibrillary tangles and amyloid plaques throughout the hippocampus and cerebral neocortex.
  • the amyloid plaques are complex cellular lesions with a protein core that consists mainly of the 40-42 amino acid residue containing amyloid ⁇ peptide (A ⁇ ).
  • a ⁇ amyloid ⁇ peptide
  • the formation of A ⁇ requires two consecutive cleavages of a type I transmembrane glycoprotein, the amyloid ⁇ precursor protein (APP). Cleavage at the aminoterminus of A ⁇ is performed by ⁇ -secretase.
  • APP amyloid ⁇ precursor protein
  • BACE ⁇ -site APP cleaving enzyme
  • the Golgi apparatus and endosomes offer BACE the slightly acidic environment necessary to obtain its optimal activity.
  • Overexpression of BACE in cells leads to an increased cleavage of APP at the ⁇ -secretase site.
  • Cells treated with antisense oligonucleotides complementary to BACE mRNA have decreased A ⁇ production.
  • KO mice deficient in BACE were previously generated. These mice do not exhibit any obvious physical or behavioural difference compared to wild type mice but their ⁇ -secretase activity is abolished.
  • the results suggest that BACE has no vital function for which no redundancy exists. It is currently not understood how BACE is transported to its intracellular localisation and how the activity of BACE is modulated in the cell.
  • the transport and activity of BACE is regulated by proteins that interact with BACE.
  • proteins that interact with BACE are modulators of BACE activity and are therapeutic targets for the treatment of AD.
  • mutations in said proteins are causative of Alzheimer's disease.
  • Alzheimer's disease is a degenerative disorder of the human central nervous system characterized by progressive memory impairment and cognitive and intellectual decline during mid to late adult life.
  • the disease is accompanied by a constellation of neuro- pathological features principal amongst which are the presence of extracellular amyloid or senile plaques, and neurofibrillary tangles in neurons.
  • Recently BACE has been suggested to be an important target for interfering with the formation of extracellular amyloid.
  • a BACE derivative that lacks the cytoplasmic domains is as active as wild type BACE in cleaving APP.
  • the present invention provides isolated nucleic acid sequences encoding domains or functional fragment thereof that are capable to interact with the transmembrane or cytoplasmic domain of BACE in vivo. Said peptides or protein fragments are further defined herein as BACE-interacting proteins while said nucleic sequences encoding BACE-interacting proteins are further defined as BACE- interacting genes.
  • the invention provides a BACE-interacting polypeptide comprising a BACE interacting domain capable of interacting with the transmembrane and cytoplasmic domain of BACE.
  • a 'domain' is defined as a specific isolated region of a protein, here a region of a BACE-interacting protein that interacts with BACE.
  • BACE-interacting peptides or proteins can be identified which interact with specific functional domains of BACE or which interact specifically with mutant or normal forms.
  • the invention provides BACE-interacting proteins selected from the group consisting of sequences comprising SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or 40 and homologues thereof.
  • 'homologues it is meant proteins or protein fragments that have a homology of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even more homology with sequences comprising SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38 or 40.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705.
  • Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • SEQ ID NO: 2 represents a domain of the BAT3 protein that interacts with BACE.
  • the accession numbers in GenBank for BAT3 are AF109719 (mouse) and XM_004176 (human). The identity between the isolated domain of SEQ ID NO: 2 and its human counterpart is 100%.
  • SEQ ID NO: 4 represents a domain of the NIX (Bnip3l) that interacts with BACE.
  • NIX (Bnip3l) is a mitochondrial protein being a member of a subfamily of pro-apoptotic proteins.
  • GenBank for NIX (Bnip3l) are AF067395, NM_009761 (mouse) and AF067396, AF255051 (human).
  • SEQ ID NO: 4 represents a domain of the neutral sphingomyelinase (nSmase) that interacts with BACE.
  • nSMase is a protein localized in the endoplasmic reticulum. It has been shown that this enzyme has been shown that this enzyme has been shown that this enzyme has been shown that this enzyme has been shown that this enzyme has lyso-platelet activating factor (PAF) phospholipase C activity.
  • PAF lyso-platelet activating factor
  • GenBank accession numbers in GenBank for nSMase are NM_009213, AJ222800 (mouse) and AJ222801 , NM_003080, XM_004489, BC000038 (human).
  • the identity between the isolated domain of SEQ ID NO: 6 and its human counterpart is 87%.
  • SEQ ID NO: 8 represents a domain of the arsenite translocating ATPase that interacts with BACE.
  • Arsenite translocating ATPase is an efflux pump that can confer resistance to arsenite and antimonite by their extrusion from the cells.
  • GenBank accession numbers for the complete proteins in GenBank for arsenite transporter are NM_019652, AF039405 (mouse) and AF047469, BC002651 (human).
  • the identity between the isolated domain of SEQ ID NO: 8 and its human counterpart is 85%.
  • SEQ ID NO: 10 represents a domain of the A1U that interacts with BACE.
  • A1 U is a protein that interacts with ataxin-1 , the latter known to be involved in the pathology of spinocerebellar ataxia type 1.
  • A1U is widely expressed in Purkinje cells.
  • accession numbers for the complete proteins in GenBank for A1 U are AB040050 (mouse) and XM 002073, NM_020131 , AF188240 (human). The identity between the isolated domain of SEQ ID NO: 10 and its human counterpart is 100%.
  • SEQ ID NO: 12 represents a domain of the cytochrome oxidase subunit 2 that interacts with BACE. Cytochrome oxidase is an inner mitochondrial protein involved in ATP synthesis.
  • accession numbers for the complete proteins in GenBank for cytochrome oxidase are AB042432 (mouse) and AAB58946 (human). The identity between the isolated domain of SEQ ID NO: 12 and its human counterpart is 67%.
  • SEQ ID NO: 14 represents a domain of the GL004 that interacts with BACE.
  • GL004 is probably a membrane bound protein.
  • the accession numbers for the complete proteins in GenBank for GL004 are AK017226 (mouse) and AF226049 (human). The identity between the isolated domain of SEQ ID NO: 14 and its human counterpart is 94%.
  • SEQ ID NO: 16 represents a domain of the Gpr 37-like protein 1 that interacts with BACE. Gpr 37-like protein 1 is probably a multi-transmembrane protein.
  • the accession numbers for the complete proteins in GenBank for Gpr 37-like protein 1 are AJ306537 (mouse) and NM_004767, Y16280 (human).
  • SEQ ID NO: 16 represents a domain of the lifeguard protein (NMP35/LFG) that interacts with BACE. Lifeguard was isolated as an anti-apoptotic gene that provides protection from fas- mediated cell death. Lifeguard is probably also involved in neuronal development.
  • the accession numbers for the complete proteins in GenBank for NMP35/LFG are AK013476 (mouse) and AF190461 , XM_012187 (human).
  • the identity between the isolated domain of SEQ ID NO: 18 and its human counterpart is 88%.
  • SEQ ID NO: 20 represents a domain of the Otx-2 that interacts with BACE.
  • Otx-2 is a homeobox transcription factor that is involved in anterior embryonic pattern formation.
  • the accession numbers for the complete proteins in GenBank for Otx-2 are X68884 (mouse) and XM_012334, NM_021728 (human). The identity between the isolated domain of SEQ ID NO: 20 and its human counterpart is 93%.
  • SEQ ID NO: 22 represents a domain of the Tip20p that interacts with BACE. Tip20p is a protein involved in the transport between endoplasmic reticulum and Golgi.
  • the accession numbers for the complete proteins in GenBank for Tip20p are unknown (mouse) and AF000560 (human). The identity between the isolated domain of SEQ ID NO: 22 and its human counterpart is 96%.
  • SEQ ID NO: 24 represents a domain of the s-rex/ NSP- C /Reticulon-1 that interacts with BACE.
  • s-rex/ NSP-C /Reticulon-1 is found in neural and neuroendocrine cells and is associated with the endoplasmic reticulum. Its expression is found to be correlated with the degree of neuronal differentiation. Strikingly, the expression of NSP-C is reduced in the brains of patients with Down syndrome and Alzheimer's disease.
  • GenBank for s-rex/ NSP-C /Reticulon-1 are unknown (mouse) and Q16799 (human). The identity between the isolated domain of SEQ ID NO: 24 and its human counterpart is 61%.
  • SEQ ID NO: 26 represents a domain of the NMDAR1 subunit isoform 4beta that interacts with BACE.
  • NMDAR1 subunit isoform 4beta is a protein involved in neuronal development and plasticity.
  • the accession numbers for the complete proteins in GenBank for NMDAR1 subunit isoform 4beta are unknown (mouse) and AF015731 (human).
  • the identity between the isolated domain of SEQ ID NO: 26 and its human counterpart is 100%.
  • SEQ ID NO: 28 represents a domain of the neuron specific enolase 2 that interacts with BACE. Neuron specific enolase 2 is a protein involved in neuronal differentiation.
  • accession numbers for the complete proteins in GenBank for neuron specific enolase 2 are NM_013509 (mouse) and XM_006974 (human). The identity between the isolated domain of SEQ ID NO: 28 and its human counterpart is 99.1%.
  • SEQ ID NO: 30 represents a domain of the hypothetical protein FLJ22056 that interacts with BACE.
  • the accession numbers for the complete proteins in GenBank for hypothetical protein FLJ22056 are AK011884 (mouse) and XM_015185 (human).
  • the identity between the isolated domain of SEQ ID NO: 30 and its human counterpart is 61 %.
  • SEQ ID NO: 32 represents a domain of the FKBP38 that interacts with BACE.
  • FKBP38 is a protein involved in protein folding and stabilization of multiprotein complexes.
  • the accession numbers for the complete proteins in GenBank for FKBP38 are BC003739 (mouse) and L37033 (human). The identity between the isolated domain of SEQ ID NO: 32 and its human counterpart is 91%.
  • SEQ ID NO: 34 represents a domain of the Bcl-rambo that interacts with BACE. Bcl-rambo is a pro- apoptotic protein localized in the outer mitochondrial membrane.
  • the accession numbers for the complete proteins in GenBank for Bcl-rambo are not known (mouse) and AF325209 (human). The identity between the isolated domain of SEQ ID NO: 34 and its human counterpart is 97%.
  • SEQ ID NO: 36 represents a domain of the Phogrin/ PTP-NP/ IA2beta/PTP-IAR that interacts with BACE.
  • Phogrin is an integral membrane protein localized to dense-core secretory granules of neuroendocrine cells (mainly pancreatic beta-cells) and is probably involved in signal transduction.
  • the accession numbers for the complete proteins in GenBank for Phogrin are U57345 (mouse) and AF007555 (human).
  • the identity between the isolated domain of SEQ ID NO: 36 and its human counterpart is 56%.
  • SEQ ID NO: 38 represents a domain of the PIK4Kbeta that interacts with BACE. PIK4Kbeta is a protein involved in signalling and membrane traffic.
  • accession numbers for the complete proteins in GenBank for PIK4Kbeta are not known (mouse) and BC000029 (human). The identity between the isolated domain of SEQ ID NO: 38 and its human counterpart is 100%.
  • SEQ ID NO: 40 represents a domain of the hypothetical protein FLJ20445 that interacts with BACE.
  • the accession numbers for the complete proteins in GenBank for FLJ20445 are AK009364 (mouse) and AK000452 (human). The identity between the isolated domain of SEQ ID NO: 40 and its human counterpart is 59%.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e. 70% identity over a specified region of a particular BACE-interacting protein), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using sequence comparison algorithms or by manual alignment and visual inspection.
  • identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides or even more in length.
  • the invention provides an isolated nucleic acid encoding for a BACE-interacting protein comprising a BACE interacting domain.
  • the invention provides an isolated nucleic acid encoding for a BACE-interacting protein (polypeptide) comprising a BACE interacting domain selected from the group consisting of sequences comprising SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37, 39 and homologues thereof.
  • nucleic acid sequences that have a homology of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or even more homology with SEQ ID NO: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 27, 29, 31 , 33, 35, 37 or 39.
  • nucleic acids corresponding to, or relating to, nucleic acid sequences encoding BACE-interacting proteins disclosed herein.
  • sequences include normal BACE-interacting gene sequences from humans and other mammalian species, mutant BACE interacting gene sequences from humans and other mammalian species, homologous sequences from non-mammalian species such as for example Drosophila and C.
  • subsets of these sequences useful as probes and PCR primers subsets of these sequences encoding fragments of BACE interacting proteins or corresponding to particular structural domains or polymorphic regions, complementary or antisense sequences corresponding to fragments of the BACE interacting genes, sequences in which the BACE interacting coding regions have been operably joined to exogenous regulatory regions, and sequences encoding fusion proteins of the portions of the BACE interacting proteins fused to other proteins useful as markers of expression, as "tags" for purification, or in screens and assays for proteins interacting with BACE.
  • nucleic acids representing BACE-interacting genes or cDNAs which are allelic to the disclosed sequences or which are heterospecific (BACE-interacting genes derived from other species) homologues.
  • the present invention provides isolated nucleic acids corresponding to these alleles and homologues by means that are well known in the art.
  • genomic or cDNA including samples prepared from individual organisms (e.g., human AD patients or their family members) as well as bacterial, viral, yeast or other libraries of genomic or cDNA, using probes or PCR primers to identify allelic or homologous sequences.
  • BACE-interacting gene mutations which can contribute to the development of AD or other disorders, because it is desirable to identify BACE-interacting polymorphisms which are not pathogenic, and because it is also desired to create a variety of animal models which can be used to study AD and screen for potential therapeutics, it is particularly contemplated that BACE-interacting sequences will be isolated from other preparations or libraries of human nucleic acids and from preparations or libraries from animals including rats, hamsters, guinea pigs, rabbits, dogs, cats, goats, sheep, pigs, and non-human primates. Furthermore, BACE- interacting gene homologues from for example invertebrate species, including C.
  • invertebrates bearing mutant BACE- interacting gene homologues which cause a rapidly occurring and easily scored phenotype (e.g., abnormal development of specific organs (e.g. wings, eyes, vulva) after several days) can be used as screens for drugs which block the effect of the mutant gene.
  • phenotype e.g., abnormal development of specific organs (e.g. wings, eyes, vulva) after several days
  • Such invertebrates can prove far more rapid and efficient for mass screenings than larger vertebrate animals. Once lead compounds are found through such screens, they can be tested in higher animals.
  • Standard hybridization screening or PCR techniques can be employed to identify and/or isolate such allelic and homologous sequences using relatively short BACE-interacting gene sequences.
  • sequences may include 8 or fewer nucleotides depending upon the nature of the target sequences, the method employed, and the specificity required. Future technological developments can allow the advantageous use of even shorter sequences. With current technology, sequences of 9-50 nucleotides, and preferably about 18-24 are preferred. These sequences can be chosen from those disclosed herein, or can be derived from other allelic or heterospecific homologues. When probing mRNA or screening cDNA libraries, probes and primers from coding sequences (rather than introns) are preferably employed, and sequences which are omitted in alternative splice variants typically are avoided unless it is specifically desired to identify those variants.
  • Allelic variants of the BACE-interacting genes may be expected to hybridize to the disclosed sequences under stringent hybridization conditions, as defined herein, whereas lower stringency may be employed to identify heterospecific homologues.
  • 'Mutant' as used herein refers to a gene that encodes a mutant protein.
  • mutant means a protein which does not perform its usual or normal physiological role and which is associated with, or causative of, a pathogenic condition or state.
  • mutant is essentially synonymous with the terms “dysfunctional,” “pathogenic,” “disease-causing,” and “deleterious.”
  • mutant refers to genes encoding BACE and BACE-interacting proteins, bearing one or more nucleotide/amino acid substitutions, insertions and/or deletions which for example can lead to the development of the symptoms of Alzheimer's when expressed in humans. This definition is understood to include the various mutations that naturally exist, including but not limited to those disclosed herein, as well as synthetic or recombinant mutations produced by human intervention.
  • mutant as applied to genes encoding BACE and BACE-interacting proteins, is not intended to embrace sequence variants which, due to the degeneracy of the genetic code, encode proteins identical to the normal sequences disclosed or otherwise presented herein; nor is it intended to embrace sequence variants which, although they encode different proteins, encode proteins which are functionally equivalent to normal BACE and BACE-interacting proteins.
  • the isolated nucleic acids of the present invention include any of the above described sequences or fragments thereof when included in vectors.
  • Appropriate vectors include cloning vectors and expression vectors of all types, including plasmids, phagemids, cosmids, episomes, and the like, as well as integration vectors.
  • the vectors may also include various marker genes (e.g., antibiotic resistance or susceptibility genes) that are useful in identifying cells successfully transformed therewith.
  • the vectors may include regulatory sequences to which the nucleic acids of the invention are operably joined, and/or may also include coding regions such that the nucleic acids of the invention, when appropriately ligated into the vector, are expressed as fusion proteins.
  • Such vectors may also include vectors for use in yeast "two hybrid,” baculovirus, and phage-display systems.
  • the vectors may be chosen to be useful for prokaryotic, eukaryotic or viral expression, as needed or desired for the particular application.
  • vaccinia virus vectors or simian virus vectors with the SV40 promoter (e.g., pSV2), or Herpes simplex virus or adeno- associated virus may be useful for transfection of mammalian cells including neurons in culture or in vivo, and the baculovirus vectors may be used in transfecting insect cells (e.g., butterfly cells).
  • SV40 promoter e.g., pSV2
  • Herpes simplex virus or adeno- associated virus may be useful for transfection of mammalian cells including neurons in culture or in vivo
  • the baculovirus vectors may be used in transfecting insect cells (e.g., butterfly cells).
  • the present invention provides assays for identifying compounds that are capable of inducing or inhibiting the expression of the BACE interacting genes and proteins.
  • a method for identifying compounds which can modulate the expression of a gene encoding a BACE-interacting protein comprises the steps of (1) contacting a cell with at least one compound wherein said cell includes a regulatory region of a gene encoding a BACE-interacting protein operably joined to a coding region, and (2) detecting a change in expression of said region.
  • 'Compound' means any anorganic or organic compound, including simple or complex inorganic or organic molecules, peptides, peptido-mimetics, proteins, antibodies, carbohydrates, nucleic acids or derivatives thereof.
  • Candidate/test compounds such as small molecules, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries as described above.
  • “Inhibitors,” “activators” of BACE-interacting proteins refer to inhibitory or activating molecules identified using in vitro and in vivo assays for BACE-interacting protein function. As such a “modulator” can be an inhibitor or an activator.
  • samples or assays comprising said BACE-interacting proteins are treated with a potential inhibitor and are compared to control samples without the inhibitor. Control samples (untreated with inhibitors) are assigned a relative BACE- interacting protein value of 100%.
  • BACE-interacting protein activity value relative to the control is about 90%, preferably 50%, more preferably 25-0%.
  • Activation of BACE-interacting proteins is achieved when the BACE-interacting protein activity value relative to the control is 110%, more preferably 150%, most preferably at least 200-500% higher or 1000% or even higher.
  • Operably joined' can be explained as follows. A coding sequence and a regulatory region are said to be operably joined when they are covalently linked in such a way as to place the expression or transcription of the coding sequence under the influence or control of the regulatory region.
  • coding sequences be translated into a functional protein
  • two DNA sequences are said to be operably joined if induction of promoter function results in the transcription of the coding sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the regulatory region to direct the transcription of the coding sequences, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
  • a regulatory region would be operably joined to a coding sequence if the regulatory region were capable of effecting transcription of that DNA sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
  • the method also called assay
  • the assays may be performed in vitro using nontransformed cells, immortalized cell lines, or recombinant cell lines, or in vivo using transgenic animal models.
  • the assays may detect the presence of increased or decreased expression of BACE interacting genes or proteins on the basis of increased or decreased mRNA expression (using, e.g., the nucleic acid probes disclosed herein), increased or decreased levels of BACE interacting protein products or increased or decreased levels of expression of a marker gene (e.g., beta-galactosidase or luciferase) operably joined to a 5' regulatory region of a BACE interacting gene in a recombinant construct.
  • a marker gene e.g., beta-galactosidase or luciferase
  • the cells are from an immortalized cell line such as a human neuroblastoma, glioblastoma or a hybridoma cell line.
  • a recombinant assay is employed in which a reporter gene such as for example a beta- galactosidase, green fluorescent protein, alkaline phosphatase, or luciferase is operably joined to the 5' regulatory regions of a BACE interacting gene.
  • a reporter gene such as for example a beta- galactosidase, green fluorescent protein, alkaline phosphatase, or luciferase is operably joined to the 5' regulatory regions of a BACE interacting gene.
  • the human BACE interacting gene regulatory regions may be easily isolated and cloned by one of ordinary skill in the art.
  • the reporter gene and regulatory regions are joined in-frame (or in each of the three possible reading frames) so that transcription and translation of the reporter gene may proceed under the control of the BACE interacting gene regulatory elements.
  • the recombinant construct may then be introduced into any appropriate cell type.
  • the transformed cells may be grown in culture and, after establishing the baseline level of expression of the reporter gene, test compounds may be added to the medium.
  • the ease of detection of the expression of the reporter gene provides for a rapid, high through-put assay for the identification of inducers and repressors of the BACE interacting gene.
  • Compounds identified by this method will have potential utility in modifying the expression of the BACE interacting genes in vivo.
  • these compounds may be further tested in Alzheimer animal models known in the art to identify those compounds having the most potent in vivo effects.
  • these molecules may serve as "lead compounds" for the further development of pharmaceuticals by, for example, subjecting the compounds to sequential modifications, molecular modelling, and other routine procedures employed in rational drug design.
  • the invention provides a method or an assay for the identification of compounds which can modulate the activity of a BACE-interacting protein comprising the steps of (1) providing a cell expressing a normal or mutant gene encoding a BACE-interacting protein and (2) contacting said cell with at least one candidate compound, and detecting a change in a marker of said activity.
  • a BACE-interacting protein comprising the steps of (1) providing a cell expressing a normal or mutant gene encoding a BACE-interacting protein and (2) contacting said cell with at least one candidate compound, and detecting a change in a marker of said activity.
  • the proteins and molecules will include endogenous cellular components which interact with BACE interacting proteins in vivo and which, therefore, provide new targets for pharmaceutical and therapeutic interventions, as well as recombinant, synthetic and otherwise exogenous compounds which may have BACE interacting protein binding capacity and, therefore, may be candidates for pharmaceutical agents.
  • cell lysates or tissue homogenates e.g., human brain homogenates, lymphocyte lysates
  • tissue homogenates e.g., human brain homogenates, lymphocyte lysates
  • any of a variety of exogenous compounds, both naturally occurring and/or synthetic e.g., libraries of small molecules or peptides
  • BACE-interacting protein binding capacity e.g., libraries of small molecules or peptides
  • Small molecules are particularly preferred in this context because they are more readily absorbed after oral administration, have fewer potential antigenic determinants, and/or are more likely to cross the blood brain barrier than larger molecules such as nucleic acids or proteins.
  • the effect of agents which bind to a BACE-interacting protein can be monitored either by the direct monitoring of this binding using instruments (e.g., BIAcore, LKB Pharmacia, Sweden) to detect this binding by, for example, a change in fluorescence, molecular weight, or concentration of either the binding agent or BACE-interacting protein component, either in a soluble phase or in a substrate-bound phase.
  • instruments e.g., BIAcore, LKB Pharmacia, Sweden
  • candidate compounds may then be administered to for example transformed cells or to transgenic animal models, to cell lines derived from the animal models or from human patients, or eventually to Alzheimer's patients.
  • the candidate compounds may also serve as "lead compounds" in the design and development of new pharmaceuticals. For example, as is well known in the art, sequential modification of small molecules (e.g., amino acid residue replacement with peptides; functional group replacement with peptide or non-peptide molecules) is a standard approach in the pharmaceutical industry for the development of new pharmaceuticals.
  • Such development generally proceeds from a "lead compound” which is shown to have at least some of the activity (e.g., BACE-interacting protein binding - promoting or blocking activity) of the desired pharmaceutical.
  • activity e.g., BACE-interacting protein binding - promoting or blocking activity
  • structural comparison of the molecules can greatly inform the skilled practitioner by suggesting portions of the lead compounds which should be conserved and portions which may be varied in the design of new candidate compounds.
  • the present invention also provides a means of identifying lead compounds which may be sequentially modified to produce new candidate compounds for use in the treatment of Alzheimer's Disease.
  • BACE-interacting protein-binding - promoting or blocking activity e.g., in the binding assays described above
  • therapeutic efficacy e.g., in known animal models
  • This procedure may be iterated until compounds having the desired therapeutic activity and/or efficacy are identified.
  • an assay or method is conducted to detect binding between a "BACE-interacting protein component" and some other moiety.
  • the " BACE-interacting protein component" in these assays may be a complete normal or mutant form of a BACE-interacting protein but need not be. Rather, particular functional domains of the BACE-interacting protein, as disclosed in this patent application, may be employed either as separate molecules or as part of a fusion protein. For example, to isolate proteins or molecules that interact with these functional domains, screening may be carried out using fusion constructs and/or synthetic; peptides corresponding to these regions. Obviously, various combinations of fusion proteins and BACE-interacting protein functional domains are possible.
  • the functional domains may be altered so as to aid in the assay by, for example, introducing into the functional domain a reactive group or amino acid residue (e.g., cysteine) which will facilitate immobilization of the domain on a substrate (e.g., using sulfhydryl reactions).
  • a reactive group or amino acid residue e.g., cysteine
  • other functional domain or antigenic fragments may be created with modified residues.
  • the proteins or other molecules identified by these methods may be purified and characterized by any of the standard methods known in the art. Proteins may, for example, be purified and separated using electrophoretic (e.g., SDS-PAGE, 2D PAGE) or chromatographic (e.g., HPLC) techniques and may then be microsequenced.
  • cleavage e.g., by CNBr and/or trypsin
  • cleavage e.g., by CNBr and/or trypsin
  • Further purification/characterization by HPLC and microsequencing and/or mass spectrometry by conventional methods provides internal sequence data on such blocked proteins.
  • standard organic chemical analysis techniques e.g., IR, NMR and mass spectrometry; functional group analysis; X-ray crystallography
  • BACE-interacting protein-binding molecules Methods for screening cellular lysates, tissue homogenates, or small molecule libraries for candidate BACE-interacting protein-binding molecules are well known in the art and, in light of the present disclosure, may now be employed to identify compounds which bind to normal or mutant BACE-interacting protein components or which modulate BACE-interacting protein activity as defined by non-specific measures (e.g., changes, in intracellular Ca 2+ , GTP/GDP ratio) or by specific measures (e.g., changes in amyloid-beta peptide production or changes in the expression of other downstream genes which can be monitored by differential display, 2D gel electrophoresis, differential hybridization, or SAGE methods).
  • non-specific measures e.g., changes, in intracellular Ca 2+ , GTP/GDP ratio
  • specific measures e.g., changes in amyloid-beta peptide production or changes in the expression of other downstream genes which can be monitored by differential display, 2D gel electrophoresis, differential hybridization
  • the preferred methods involve variations on the following techniques: (1) direct extraction by affinity chromatography; (2) co-isolation of BACE-interacting protein components and bound proteins or other molecules by immunoprecipitation; (3) the Biomolecular Interaction Assay (BIAcore); and (4) the yeast two-hybrid systems. These and others are discussed briefly below.
  • Affinity Chromatography in light of the present disclosure, a variety of affinity binding techniques well known in the art may be employed to isolate proteins or other molecules which bind to the BACE-interacting protein disclosed herein.
  • a BACE-interacting protein component may be immobilized on a substrate (e.g., a column or filter) and a solution including the test compound(s) is contacted with the BACE-interacting protein, fusion or fragment under conditions which are permissive for binding.
  • the substrate is then washed with a solution to remove unbound or weakly bound molecules.
  • a second wash may then elute those compounds which strongly bound to the immobilized normal or mutant BACE- interacting protein component.
  • the test compounds may be immobilized and a solution containing one or more BACE-interacting protein components may be contacted with the column, filter or other substrate.
  • the ability of the BACE-interacting protein component to bind to the test compounds may be determined as above or a labeled form of the BACE-interacting protein component (e.g., a radio-labeled or chemiluminescent functional domain) may be used to more rapidly assess binding to the substrate-immobilized compound(s).
  • a labeled form of the BACE-interacting protein component e.g., a radio-labeled or chemiluminescent functional domain
  • membrane associated proteins it may be preferred that a particular BACE-interacting protein, fusion or fragment be incorporated into lipid bilayers (e.g., Iiposomes) to promote their proper folding. This is particularly true when a BACE-interacting protein component including at least one transmembrane domain is employed (e.g. arsenite translocating ATPase, Gpr 37-like protein 1).
  • Such BACE-interacting protein-liposomes may be immobilized on substrates (either directly or by means of another element in the liposome membrane), passed over substrates with immobilized test compounds, or used in any of a variety of other well known binding assays for membrane proteins.
  • the BACE-interacting protein component may be isolated in a membrane fraction from cells producing the component, and this membrane fraction may be used in the binding assay.
  • Co-lmmunoprecipitation another well characterized technique for the isolation of the BACE-interacting protein components and their associated proteins or other molecules is direct immunoprecipitation with antibodies. This procedure has been successfully used, for example, to isolate many of the synaptic vesicle associated proteins (Phizicky and Fields (1994) Microbiol.
  • BACE-interacting protein components may be mixed in a solution with the candidate compound(s) under conditions which are permissive for binding, and the BACE-interacting protein component(s) may be immunoprecipitated. Proteins or other molecules which co- immunoprecipitate with the BACE-interacting protein component may then be identified by standard techniques as described above. General techniques for immunoprecipitation may be found in, for example, Harlow and Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
  • the Biomolecular Interaction Assay another useful method for the detection and isolation of binding proteins is the Biomolecular Interaction Assay or "BIAcore" system developed by Pharmacia Biosensor and described in the manufacturer's protocol (LKB Pharmacia, Sweden).
  • BIAcore Biomolecular Interaction Assay
  • the BIAcore system uses an affinity purified anti-GST antibody (commercially available from Amersham- Pharmacia-Biotech) to immobilize GST-fusion proteins onto a sensor chip. Obviously, other fusion proteins and corresponding antibodies may be substituted.
  • the sensor utilizes surface plasmon resonance which is an optical phenomenon that detects changes in refractive indices.
  • the yeast "two-hybrid" system takes advantage of transcriptional factors that are composed of two physically separable, functional domains (Phizicky and Fields, 1994). The most commonly used is the yeast GAL4 transcriptional activator consisting of a DNA binding domain and a transcriptional activation domain. Two different cloning vectors are used to generate separate fusions of the GAL4 domains to genes encoding potential binding proteins.
  • the fusion proteins are co-expressed, targeted to the nucleus and, if interactions occur, activation of a reporter gene (e.g., lacZ) produces a detectable phenotype.
  • a reporter gene e.g., lacZ
  • the Clontech Matchmaker System-2 may be used with the Clontech brain cDNA GAL4 activation domain fusion library with BACE-interacting protein-GAL4 binding domain fusion clones (Clontech, Palo Alto, Calif.).
  • BACE-interacting protein-fusions including fusions including either normal or mutant functional domains of the BACE- interacting proteins, and to screen such fusion libraries in order to identify BACE- interacting proteins binding proteins.
  • nucleotide sequences and protein products including both mutant and normal forms of BACE-interacting genes and proteins can be used with the above techniques to isolate other interacting proteins, and to identify other genes whose expression is altered by the over- expression of normal BACE-interacting gene sequences, by the under-expression of normal BACE-interacting gene sequences, or by the expression of mutant BACE- interacting gene sequences. Identification of these interacting proteins, as well as the identification of other genes whose expression levels are altered in the face of mutant BACE-interacting gene sequences (for instance) will identify other gene targets which have direct relevance to the pathogenesis of for example AD in its clinical or pathological forms.
  • genes will be identified which may themselves be the site of other mutations causing Alzheimer's Disease, or which can themselves be targeted therapeutically (e.g., to reduce their expression levels to normal or to pharmacologically block the effects of their over-expression) as a potential treatment for this disease.
  • these techniques rely on PCR-based and/or hybridization- based methods to identify genes which are differentially expressed between two conditions (a cell line expressing normal BACE-interacting genes compared to the same cell type expressing a mutant BACE-interacting proteins gene sequence).
  • All of these methods comprise the step of mixing a normal or mutant BACE-interacting protein, fusion, or fragment with test compounds, allowing for binding (if any), and assaying for bound complexes.
  • the invention provides a method of identifying compounds which can modulate the interaction between a BACE-interacting protein or a functional fragment thereof and BACE comprising the steps of (1) providing a cell expressing a normal or mutant gene encoding a BACE-interacting protein and a normal or mutant gene encoding BACE, and (2) contacting said cell with at least one candidate compound, and detecting a change in the interaction.
  • a 'functional fragment thereof means a contiguous polypeptide fragment derived from a BACE-interacting protein that is still capable of binding to BACE with the same binding specificity as the entire protein.
  • the ability to disrupt specific BACE interactions with a particular or more BACE-interacting proteins is of great therapeutic value, and will be important in understanding the etiology of AD and in identifying additional targets for therapy. It should be clear that the methods used to identify compounds which disrupt BACE interactions may be applied equally well to interactions involving either normal or mutant BACE and either normal or mutant BACE interacting proteins. Assays for compounds which can disrupt BACE interactions may be performed by any of a variety of methods well known in the art.
  • the assay may employ methods including (1) affinity chromatography; (2) immunoprecipitation; (3) the Biomolecular Interaction Assay (BIAcore); or (4) the yeast two-hybrid systems.
  • affinity chromatography affinity chromatography
  • immunoprecipitation immunoprecipitation
  • Biomolecular Interaction Assay BIOS
  • yeast two-hybrid systems Such assays can be developed using either normal or mutant purified BACE proteins, and/or either normal or mutant and purified BACE-interacting proteins.
  • either the BACE or the BACE-interacting protein may be affixed to a matrix, for example in a column, and the counterpart protein (the BACE- interacting protein if BACE is affixed to the matrix, or BACE if the BACE-interacting protein is affixed to the matrix) is then exposed to the affixed protein either before or after adding the candidate compound(s).
  • the counterpart protein the BACE- interacting protein if BACE is affixed to the matrix, or BACE if the BACE-interacting protein is affixed to the matrix
  • the counterpart protein the counterpart protein to bind to the affixed protein.
  • Any compound which disrupts the interaction will cause release of the counterpart protein from the matrix. Release of the counterpart protein from the matrix can be measured using methods known in the art.
  • these assays may also be employed to identify compounds which disrupt the interaction. Briefly, the BACE and BACE-interacting proteins (or appropriate structural domains of each) are employed in the fusion proteins of the system and the cells may be exposed to candidate compounds to determine their effect upon the expression of the reporter gene.
  • a reporter gene By appropriate choice of a reporter gene, such a system can be readily adapted for high through-put screening of large libraries of compounds by, for example, using a reporter gene which confers resistance to an antibiotic which is present in the medium, or which rescues an auxotrophic strain grown in minimal medium.
  • These assays may be used to screen many different types of molecules for their disruptive effect on the interactions of BACE.
  • the molecules may belong to a library of synthetic molecules, or be specifically designed to disrupt the interaction.
  • the compounds may also be peptides corresponding to the interacting domain of either protein.
  • This type of assay can be used to identify compounds that disrupt a specific interaction between a given BACE-interacting protein variant and a given interacting protein.
  • compounds that disrupt all interactions with BACE may be identified.
  • a compound that specifically disrupts the folding of BACE or BACE-interacting proteins is expected to disrupt all interactions between BACE and other proteins.
  • this type of disruption assay can be used to identify compounds which disrupt only a range of different BACE interactions, or only a single BACE interaction.
  • BACE has been observed immunocytochemically to be localized in membrane structures associated with mainly the endosomes, and some of the BACE-interacting proteins disclosed herein are responsible for the transport of BACE to its normal intracellular localisation, it is clear that a change in the activity of one particular or even more BACE-interacting genes or proteins has an effect on the normal intracellular localisation of BACE.
  • BACE-interacting protein-related diseases such as Alzheimer's disease.
  • Compounds which can affect the localization of the BACE-interacting proteins or BACE can, therefore, be identified as potential therapeutics.
  • Standard techniques known in the art can be employed to detect the localization of the BACE-interacting proteins or BACE. Generally, these techniques will employ antibodies and in particular antibodies which selectively bind to one or more mutant BACE-interacting proteins but not to normal BACE-interacting proteins.
  • such antibodies may be labeled by any of a variety of techniques (e.g., fluorescent or radioactive tags, labeled secondary antibodies, avidin-biotin, etc.) to aid in visualizing the intracellular location of a BACE-interacting protein.
  • Western blots of purified fractions from cell lysates enriched for different intracellular membrane bound organelles e.g., lysosomes, synaptosomes, endosomes, Golgi
  • the monitoring of a specific compounds or compounds can also be observed for their ability to modulate the activity of the specific BACE-interacting proteins based upon measures in intracellular Ca 2+ , Na + or K + levels or metabolism.
  • BACE-interacting proteins are membrane associated proteins which may serve as, or interact with, ion receptors or ion channels.
  • compounds may be screened for their ability to modulate BACE-interacting protein- related calcium or other ion metabolism either in vivo or in vitro by measurements of ion channel fluxes and/or transmembrane voltage or current fluxes using patch clamp, voltage clamp and fluorescent dyes sensitive to intracellular calcium or transmembrane voltage.
  • Ion channel or receptor function can also be assayed by measurements of activation of second messengers such as cyclic AMP, cGMP tyrosine kinases, phosphates, increases in intracellular Ca 2+ levels, etc.
  • Recombinantly made proteins may also be reconstructed in artificial membrane systems to study ion channel conductance and, therefore, the "cell" employed in such assays may comprise an artificial membrane or cell.
  • Assays for changes in ion regulation or metabolism can be performed on cultured cells expressing endogenous normal or mutant BACE- interacting proteins. Such studies also can be performed on cells transfected with vectors capable of expressing one of the BACE-interacting proteins, or functional domains of one of the BACE-interacting proteins, in normal or mutant form.
  • cells may be co-transfected with genes encoding ion channel proteins.
  • Compounds may be screened for their ability to modulate the activity of the BACE-interacting proteins or one or more interactions between BACE and a BACE-interacting protein based upon their effects on apoptosis or cell death.
  • pro-apoptotic e.g. bcl-rambo
  • anti- apoptotic e.g. lifeguard
  • baseline rates of apoptosis or cell death can be established for cells in culture, or the baseline degree of neuronal loss at a particular age may be established post-mortem for animal models or human subjects, and the ability of a candidate compound to suppress or inhibit apoptosis or cell death may be measured.
  • Cell death may be measured by standard microscopic techniques (e.g., light microscopy) or apoptosis may be measured more specifically by characteristic nuclear morphologies or DNA fragmentation patterns which create nucleosomal ladders (see, e.g., Gavrieli et al. (1992) J. Cell Biol. 119:493-501 ; Jacobson et al. (1993) Nature 361 :365; Vito et al.
  • TUNEL may also be employed to evaluate cell death in brain (see, e.g., Lassmann et al., 1995).
  • the quality and the quantity of amyloid beta production can be easily measured by methods known in the art and thus used to monitor the effect of a compound on a BACE-interacting protein or the modulation of the interaction between a BACE-interacting protein and BACE.
  • Another monitoring method makes use of the possibility of effects of compounds, that modulate the activity of a BACE-interacting protein or modulate the interaction between a BACE- interacting protein and BACE, on the levels of phosphorylation of microtubule associated proteins (MAPs) such as Tau.
  • MAPs microtubule associated proteins
  • MAPs The abnormal phosphorylation of Tau and other MAPs in the brains of victims of Alzheimer's Disease is well known in the art.
  • compounds which prevent or inhibit the abnormal phosphorylation of MAPs may have utility in treating BACE-interacting protein associated diseases such as AD.
  • BACE-interacting protein associated diseases such as AD.
  • cells from normal or mutant animals or subjects, or the transformed cell lines and existing animal models may be employed.
  • the invention provides a diagnostic method for determining if a subject bears a mutant gene encoding a BACE-interacting protein comprising the steps of (1) providing a biological sample of said subject, and (2) detecting in said sample a mutant nucleic acid encoding a BACE-interacting protein, a mutant BACE- interacting protein, or a mutant BACE-interacting protein activity.
  • the BACE interacting genes and gene products can be useful in the diagnosis of Alzheimer's Disease, but also possibly in the diagnosis of presenile and senile dementias, and probably also in neurologic diseases such as stroke and cerebral hemorrhage - all of which are seen to a greater or lesser extent in symptomatic subjects bearing mutations in currently known genes that are involved in AD disease.
  • Diagnosis of inherited cases of these diseases can be accomplished by methods based upon the nucleic acids (including genomic and mRNA/cDNA sequences), proteins, and/or antibodies.
  • the methods and products are based upon the human BACE interacting genes, proteins or antibodies against BACE interacting proteins.
  • BACE and BACE- interacting genes are highly expressed in brain tissue but brain biopsies are invasive and expensive procedures, particularly for routine screening.
  • Other tissues which express BACE interacting genes at significant levels may demonstrate alternative splicing (e.g., white blood cells) and, therefore mRNA derived from BACE interacting genes or proteins from such cells may be less informative.
  • assays based upon a subject's genomic DNA may be the preferred methods for diagnostics of BACE interacting genes as no information will be lost due to alternative splicing and because essentially any nucleate cells may provide a usable sample.
  • diagnostic assay is to be based upon BACE interacting proteins
  • diagnosis can be achieved by monitoring differences in the electrophoretic mobility of normal and mutant proteins.
  • Such an approach will be particularly useful in identifying mutants in which charge substitutions are present, or in which insertions, deletions or substitutions have resulted in a significant change in the molecular mass of the resultant protein.
  • diagnosis may be based upon differences in the proteolytic cleavage patterns of normal and mutant proteins, differences in molar ratios of the various amino acid residues, or by functional assays demonstrating altered function of the gene products.
  • protein-based diagnostics will employ differences in the ability of antibodies to bind to normal and mutant BACE interacting proteins. Such diagnostic tests may employ antibodies which bind to the normal proteins but not to mutant proteins, or vice versa.
  • an assay in which a plurality of monoclonal antibodies, each capable of binding to a mutant epitope may be employed.
  • the levels of anti-mutant examples binding in a sample obtained from a test subject may be compared to the levels of binding to a control sample.
  • Such antibody diagnostics may be used for in situ immunohistochemistry using biopsy samples of CNS tissues obtained antemortem or postmortem, including neuropathological structures associated with these diseases such as neurofibrillary tangles and amyloid plaques, or may be used with fluid samples such a cerebrospinal fluid or with peripheral tissues such as white blood cells.
  • the diagnostic assay is to be based upon nucleic acids from a sample, either mRNA or genomic DNA may be used.
  • mRNA When mRNA is used from a sample, many of the same considerations apply with respect to source tissues and the possibility of alternative splicing. That is there may be little or no expression of transcripts unless appropriate tissue sources are chosen or available, and alternative splicing may result in the loss of some information.
  • tissue sources are chosen or available, and alternative splicing may result in the loss of some information.
  • standard methods well known in the art may be used to detect the presence of a particular sequence either in situ or in vitro (see, e.g. Sambrook et al., eds. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.).
  • a sample of tissue may be prepared by standard techniques and then contacted with a probe, preferably one which is labelled to facilitate detection, and an assay for nucleic acid hybridization is conducted under stringent conditions which permit hybridization only between the probe and highly or perfectly complementary sequences. Because many mutations in genes that cause diseases detected to date consist of a single nucleotide substitution, high stringency hybridization conditions will be required to distinguish normal sequences from most mutant sequences.
  • a significant advantage of the use of either DNA or mRNA is the ability to amplify the amount of genetic material using the polymerase chain reaction (PCR), either alone (with genomic DNA) or in combination with reverse transcription (with mRNA to produce cDNA).
  • nucleotide sequence amplification techniques may be used, such as ligation-mediated PCR, anchored PCR and enzymatic amplification as will be understood by those skilled in the art. Sequence alterations may also generate fortuitous restriction enzyme recognition sites which are revealed by the use of appropriate enzyme digestion followed by gel-blot hybridization. DNA fragments carrying the site (normal or mutant) are detected by their increase or reduction in size, or by the increase or decrease of corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme and the fragments of different sizes are visualized, for example under UV light in the presence of ethidium bromide, after gel electrophoresis.
  • Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis of single stranded DNA, or as changes in the migration pattern of DNA heteroduplexes in non-denaturing gel electrophoresis. Alternatively, a single base substitution mutation may be detected based on differential PCR product length in PCR. The PCR products of the normal and mutant gene may be differentially detected in acrylamide gels. Nuclease protection assays (S1 or ligase-mediated) also reveal sequence changes at specific locations. Alternatively, to confirm or detect a polymorphism resulting in restriction mapping changes.
  • Ligated PCR, ASO, REF-SSCP chemical cleavage, endonuclease cleavage at mismatch sites or SSCP may be used. Both REF-SSCP and SSCP are mobility shift assays which are based upon the change in conformation due to mutations. DNA fragments may also be visualized by methods in which the individual DNA samples are not immobilized on membranes. The probe and target sequences may be in solution or the probe sequence may be immobilized. Autoradiography, radioactive decay, spectrophotometry and fluorometry may also be used to identify specific individual genotypes. Mutations can also be detected by direct nucleotide sequencing. The wording 'stringent hybridisation conditions' is a term of art understood by those of ordinary skill in the art.
  • stringent hybridisation conditions are those conditions of temperature, chaotrophic salts, pH and ionic strength which will permit hybridisation or that nucleic acid sequence to its complementary sequence and not to substantially different sequences.
  • the exact conditions which constitute "stringent” conditions depend upon the nature of the nucleic acid sequence, the length of the sequence, and the frequency of occurrence of subsets of that sequence within other non-identical sequences.
  • Hybridisation conditions may include temperatures of 20°C-65°C and ionic strengths from 5x to 0.1x SSC.
  • Highly stringent hybridisation conditions may include temperatures as low as 40-42°C (when denaturants such as formamide are included) or up to 60-65°C in ionic strengths as low as O.lxSSC. These ranges, however, are only illustrative and, depending upon the nature of the target sequence, and possible future technological developments, may be more stringent than necessary. Less than stringent conditions are employed to isolate nucleic acid sequences which are substantially similar, allelic or homologous to a given sequence.
  • the isolated nucleotide sequences that comprise a nucleotide sequence encoding a BACE-interacting protein or a functional fragment thereof can be used as a medicament.
  • the isolated nucleotide sequences that comprise a nucleotide sequence encoding a BACE-interacting protein or a functional fragment thereof can be used for the manufacture of a medicament to treat Alzheimer's disease.
  • the term 'to manufacture of a medicament' relates here to the application of gene therapy to deliver at least one BACE-interacting gene to a cell of a patient in need thereof.
  • the present invention provides the nucleic acids of BACE-interacting genes for the transfection of cells in vitro and in vivo.
  • nucleic acids can be inserted into any of a number of well-known vectors for the transfection of target cells and organisms as described below.
  • the nucleic acids are transfected into cells, ex vivo or in vivo, through the interaction of the vector and the target cell.
  • the nucleic acids encoding BACE-interacting proteins under the control of a promoter, then expresses a particular BACE-interacting protein of the present invention, thereby mitigating the effects of absent, partial inactivation, or abnormal expression of the said BACE-interacting gene.
  • Such gene therapy procedures have been used to correct acquired and inherited genetic defects, cancer, and viral infection in a number of contexts.
  • Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • Methods of non-viral delivery of nucleic acids include lipofection, microinjection, biolistics, virosomes, Iiposomes, immunoliposomes, polycation or lipid: nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA.
  • Lipofection is described in, e.g., US Pat. No. 5,049,386, US Pat No. 4,946,787; and US Pat. No. 4,897,355 and lipofection reagents are sold commercially (e.g., TransfectamTM and LipofectinTM).
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Flegner, WO 91/17424, WO 91/16024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).
  • RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus.
  • Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo).
  • Conventional viral based systems for the delivery of nucleic acids could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer.
  • Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.
  • Lentiviral vectors are retroviral vector that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised on c/ ' s-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum c/s-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression.
  • Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); PCT/US94/05700.
  • adenoviral based systems are typically used.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titter and levels of expression have been obtained.
  • Adeno-associated virus vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., U.S. Patent No. 4,797,368; WO 93/24641 ; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka. Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No. 5,173,414; Hermonat & Muzyczka, Proc. Natl. Acad. Sci.
  • Pa317/pLASN was the first therapeutic vector used in a gene therapy trials. (Blaese ef al., Science 270:475-480 (1995)). Transduction efficiencies of 50% greater have been observed for MFG-S packaged vectors (Ellem et al. Immunol Immunother. 44(1): 10-20 (1997); Dranoff ef a/., Hum. Gene Ther. 1 :111-2 (1997)).
  • Recombinant adeno-associated virus vectors rAAV are a promising alternative gene delivery systems based on the defective and non-pathogenic parvovirus adeno-associated type 2 virus.
  • All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system (Wagner et al., Lancet 351 :9117 1702-3 (1998). Replication-deficient recombinant adenoviral vectors (Ad) are predominantly used transient expression gene therapy, because they can be produced at high titter and they readily infect a number of different cell types.
  • Ad vectors are engineered such that a transgene replaced the Ad E1a, E1b, and E3 genes; subsequently the replication defector vector is propagated in human 293 cells that supply deleted gene function in trans.
  • Ad vectors can transduce multiple types of tissues in vivo, including nondividing, differentiated cells such as those found in the liver, kidney and muscle system tissues.
  • Conventional Ad vectors have a large carrying capacity.
  • An example of the use of an Ad vector in a clinical trial involved polynucleotide therapy for antitumor immunization with intramuscular injection (Sterman ef al., Hum. Gene Ther. 7:1083-9 (1998)).
  • adenovirus vectors for gene transfer in clinical trials include Sterman ef al., Hum. Gene Ther. 9:7 1083-1089 (1998); Alvarez ef al., Hum. Gene Ther. 5:597-613 (1997); Topf et al., Gene Ther. 5:507-513 (1998)).
  • Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, and ⁇ 2 cells or PA317 cells, which package retrovirus.
  • Viral vectors used in gene therapy are usually generated by producer cell line that packages a nucleic acid vector into a viral particle.
  • the vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the protein to be expressed.
  • the missing viral functions are supplied in trans by the packaging cell line.
  • AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome.
  • Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences.
  • the cell line is also infected with adenovirus as a helper.
  • the helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid.
  • the helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV.
  • the gene therapy vector be delivered with a high degree of specificity to a particular tissue type.
  • a viral vector is typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the viruses outer surface.
  • the ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al., Proc. Natl. Acad. Sci. U.S.A.
  • Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor.
  • This principle can be extended to other pairs of virus expressing a ligand fusion protein and target cell expressing a receptor.
  • filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.
  • Gene therapy vectors can be delivered in vivo by administration to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below.
  • vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, usually after selection for cells which have incorporated the vector.
  • Ex vivo cell transfection for diagnostics, research, or for gene therapy is well known to those of skill in the art.
  • cells are isolated from the subject organism, transfected with a nucleic acid (gene or cDNA), and re-infused back into the subject organism (e.g., patient).
  • a nucleic acid gene or cDNA
  • Various cell types suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney ef al., Culture of Animal Cells, A Manual of Basic Technique (3 rd ed. 1994)) and the references cited therein for a discussion of how to isolate and culture cells from patients).
  • stem cells are used in ex vivo procedures for cell transfection and gene therapy.
  • the advantage to using stem cells is that they can be differentiated into other cell types in vitro, or can be introduced into a mammal (such as the donor of the cells) where they will engraft in the bone marrow.
  • Methods for differentiating CD34+ cells in vitro into clinically important immune cell types using cytokines such a GM-CSF, IFN- ⁇ and TNF- ⁇ are known (see Inaba ef al., J. Exp. Med. 176: 1693-1702 (1992)).
  • cytokines such as GM-CSF, IFN- ⁇ and TNF- ⁇ are known (see Inaba ef al., J. Exp. Med. 176: 1693-1702 (1992)).
  • Stem cells are isolated for transduction and differentiation using known methods.
  • stem cells are isolated from bone marrow cells by panning the bone marrow cells with antibodies which bind unwanted cells, such as CD4+ and CD8+ (T cells), CD45+ (panB cells), GR-1 (granulocytes), and lad (differentiated antigen presenting cells) (see Inaba et al., J. Exp. Med. 176:1693-1702 (1992)).
  • Vectors e.g., retroviruses, adenoviruses, Iiposomes, etc.
  • therapeutic nucleic acids can be also administered directly to the organism for transduction of cells in vivo.
  • naked DNA can be administered. Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells.
  • Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. Examples 1) APP processing in COS cells by a BACE derivative that lacks the cytoplasmic domain
  • COS cells were transiently co-transfected with a plasmid encoding human APP (pSG5 ** -hAPP) and either an empty pSG ⁇ " vector, a plasmid encoding mouse BACE wild type (pSG5 ** -mBACE) or mBACE ⁇ cyt (pSG5 ** -mBACE ⁇ cyt).
  • a plasmid encoding human APP pSG5 ** -hAPP
  • pSG5 ** -mBACE a plasmid encoding mouse BACE wild type
  • mBACE ⁇ cyt pSG5 ** -mBACE ⁇ cyt
  • Equal amounts of media were subjected to SDS-PAGE and Western blotting to detect sAPP ⁇ , the secreted ectodomain of APP generated after ⁇ -secretase cleavage at Asp1 (A ⁇ numbering).
  • Radiolabeled APP-C-Terminal Fragments (CTFs or stubs) were purified from cell extracts by immunoprecipitation using antibody B11.4
  • antibody B11/4 is similar to antibody B12/4 and was generated by us against a peptide comprising the last twenty amino acid residues of the APP protein, and separated by SDS-PAGE. CTFs were subsequently detected by exposing the gel to a Phosphor Imaging screen. APP processing by ⁇ - and ⁇ -secretase leads to the generation of 3 different CTFs.
  • the CTF generated by ⁇ -secretase cleavage of APP consists of 83 amino acids (C83).
  • C89 are the CTFs that originate from ⁇ -secretase cleavage of APP at the Asp1 and Glu11 site (A ⁇ numbering), respectively.
  • BACE and BACE ⁇ cyt were immunoprecipitated from COS cell lysates with antibody B45.1 (this antibody is described in Creemers et al., J. Biol Chem, 276, 4211-4217, 2001 ), that recognizes an epitope at the N-terminus of mature BACE.
  • Cortical neurons were co-transduced with Semliki Forest Virus (SFV) encoding human APP and either mouse BACE or mouse BACE ⁇ cyt. Transduced neurons were metabolically labeled with [ 35 S] methionine and APP processing was analyzed by immunoprecipitation of cell-associated CTFs and Western blotting of sAPP ⁇ , as before.
  • SFV Semliki Forest Virus
  • APP was mainly processed by the non-amyloidogenic pathway, similar to control neurons expressing APP alone. Very little increase (if at all) in sAPP ⁇ was observed upon co-expression of BACE ⁇ cyt. The same is true when immunoprecipitated CTFs were analyzed. In this particular experiment more APP is expressed in BACE ⁇ cyt-expressing neurons what results in slightly higher C99 and C89. However the relative abundance of the fragments resembles more APP processing in the absence of BACE protein. Similar results were obtained in three independent experiments. It is possible that neuron specific factors are required for the activation of BACE most probably through an interaction with the cytoplasmic domain of BACE.
  • BACE and BACE ⁇ cyt were immunoprecipitated from neuronal extracts with antibody B45.1 , that recognizes an epitope at the N-terminus of mature BACE.
  • BACE and BACE ⁇ cyt proteins could be detected by immunoprecipitation using antibody B45.1 , whereas BACE ⁇ cyt could not be detected in COS cells. It is possible that the truncated BACE derivative is rapidly degraded in COS cells in a cell-type specific manner.
  • DNA sequence encoding the cytoplasmic domain of BACE (pBD-GAL4-Bcyt) was constructed.
  • Gal4-Bcyt chimeric protein causes auto-activation, i.e. the fusion protein is capable of inducing expression of the HIS3 and lacZ reporter genes, even in the absence of the Gal4 activation domain.
  • the pBD-GAL4-Bcyt phagemid vector was thus unsuitable for detecting protein-protein interactions in this yeast two-hybrid vector system. Therefore another bait plasmid encoding a chimeric protein, consisting of the Gal4 BD and the transmembrane and cytoplasmic domains of BACE (pBD-GAL4-Bt/c) was constructed.
  • the transmembrane and cytoplasmic domains of BACE are depicted in SEQ ID NO 42.
  • mice hippocampal cDNA libraries When transformed into yeast cells, pBD-GAL4-Bt/c did not cause auto-activation.
  • this bait construct we screened a mouse hippocampal cDNA library.
  • Mouse hippocampal mRNA was purified (Triazol) and cloned after reverse transcription into the lamba library HybriZAP, Stratagene. Mass excision in vivo was used to generate the pAD-GAL4 plasmid library, in accordance to the instructions of the manufacturer (Stratagene).
  • This library was chosen because BACE is highly expressed in neurons and the deletion of BACE cytoplasmic domain affects BACE activity in neurons.
  • the hippocampus is a region in the brain that is most affected in patients with Alzheimer's disease.
  • double transformants can be selected on medium lacking tryptophane and leucine (SD-L-W). It was calculated that -13% of the mouse hippocampal library was screened with this pilot transformation.
  • the remaining of the transformants was plated on histidine-negative medium to select for yeast colonies expressing the HIS3 reporter gene.
  • the HIS3 gene should only be expressed when a prey protein interacts with the Gal4 BD-Bt/c fusion protein.
  • the transformants were incubated for 14 days at 30°C and histidine positive colonies were picked and grown on new plates. Colonies were considered as histidine positive when they had a diameter of at least 1 ,5mm after 14 days of growth. Colonies with a diameter smaller than 1 ,5mm were considered as background, a result of the leaky expression of the HIS3 reporter gene.
  • the nucleotide sequence of the DNA was determined and subjected to similarity searches (NCBI BLAST sequence similarity searching) to identify related or homologous sequences.
  • NBI BLAST sequence similarity searching a sequence similarity searching for 30 HIS3 and lacZ positive yeast transformants.
  • 14 were transformed with a prey plasmid of which the 5' nucleotide sequence consisted of a repeat of the dinucleotides guanine-adenine, that extended for at least 250 nucleotides.
  • These plasmids thus encoded a protein consisting of 2 alternating amino acids: arginine (R) and glutamate (E) at the N-terminus.
  • a prokaryotic expression vector encoding the cytoplasmic domain of BACE C-terminally fused to Glutathione S-Transferase (pGEX-4T-1-GST-Bcyt) was constructed.
  • FKBP38 also co-immunoprecipitates with full- length BACE1 when both proteins are overexpressed in COS cells. It also co- immunoprecipitates with BACE2, but not with Nicastrin, when both are overexpressed in COS cells.
  • FKBP38 was expressed using in vitro translation and then bound to GST or GST fused to either the BACE1 cytoplasmic tail (GST-Bcyt, last 24 amino acids), the transmembrane domain + the cytoplasmic tail of BACE1 (GST-B1TM+cyt) or the cytoplasmic tail of BACE with the leu-leu-lys motif (last 3 amino acids) deleted (GST-BcytdeltaLLK).
  • FuGene co-transfected COS cells (candidate protein + BACE1 or BACE2 or Nicastrin cDNAs) and cells transfected with empty vector, are lysed in buffers containing detergents: either directly in DIP buffer or first in 5 mM Tris pH7.4, 1 mM EGTA, 250 mM glucose, 1 % TritonX-100 and then diluted at least 1 :8 in DIP buffer. Cell lysate is centrifuged 20 minutes at -18000 x g to get rid of unbroken cells and cell debris.
  • Part of the lysate is then either immunoprecipitated with antibodies anti-BACE1 , BACE2 or nicastrin or with preimmune serum (pi) in the presence of protein G-Sepharose ON at 4°C with rotation. Beads are washed 5 times with DIP buffer and once with 0.3 x TBS and bound proteins are separated by SDS-PAGE electrophoresis, transferred to a nitrocellulose membrane and probed with anti-HA antibody.
  • Arsenite transporter AT
  • NMP35 Neural membrane protein 35/Lifegard
  • Oligonucleotides that are not commercially available can be chemically synthesized according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Letts. 22: 1859-1862 (1981 ), using an automated synthesizer, as described in Van Devanter el al., Nucleic Acids Res. 12: 6159 (1984). Purification of oligonucleotides is by either native acrylamide gel electrophoresis or by anion- exchange HPLC as described in Pearson & Reanier, J. Chrom. 255: 137 (1983).
  • COS and BHK cells were cultured in DMEM:F12 (GibcoBRL) supplemented with 10% fetal calf serum (FCS).
  • Mouse cortical neurons were cultured in neurobasal medium (GibcoBRL) supplemented with 250 ⁇ l 200mM L-glutamine (GibcoBRL) and 2ml B27 Serum-free Supplement (GibcoBRL) per 100ml neurobasal medium.
  • a transfection mix with a FuGENE:DNA ratio of 3:1 (in ⁇ l and ⁇ g respectively) was added to a culture dish containing a monolayer of COS cells that was 50-80% confluent. This cell density was obtained by plating -700.000 cells in 4ml 10% FCS- containing DMEM :F12 medium (GibcoBRL) in a 60mm culture dish one day before transfection.
  • the medium of the COS cells was changed for 4ml fresh DMEM :F12 medium containing 10% FCS and the FuGENE-DNA mixture was added to the fresh medium. To ensure even dispersal the plates were gently swirled. The cells were kept in a 37°C incubator (0,5% C0 2 ) for 48 hours, refreshing once the medium 24 hours after transfection.
  • SFV particles All handlings of SFV particles were performed under standard safety conditions in a L2 lab.
  • High-level expression of recombinant proteins in non-dividing, postmitotic cells such as cortical neurons can be achieved by infecting the neurons with Semliki Forest Virus (SFV) particles that carry recombinant-derived RNA.
  • SFV Semliki Forest Virus
  • Recombinant SFV particles were generated by introducing 2 naked RNA molecules, obtained by in vitro transcription of a recombinant pSFV1 and a pSFV-HelpeM plasmid into BHK cells by electroporation.
  • Recombinant pSFV1 plasmid encodes non-structural viral proteins required for SFV replication, but lacks the DNA region encoding structural proteins that is replaced by the heterologous insertion of foreign DNA.
  • pSFV-Helperl contains the DNA region encoding SFV structural proteins, needed for assembly of viral particles. Translation of both recombinant SFV1 RNA and Helperl RNA within one BHK cell leads to new virus particles that carry recombinant-derived RNA that can subsequently be used to infect cortical neurons.
  • the required amount of BHK cells for infection was obtained by plating a 5 times dilution of a confluent monolayer one day before the infection in a 75cm 2 Falcon bottle. On the day of the infection, the cells were detached by adding 2,5ml trypsin-EDTA (GibcoBRL). After detaching, 7,5ml DMEM:F12 were added and the BHK cells were then harvested by centrifugation. After washing twice with 2ml PBS, the cells were resuspended in 700 ⁇ l PBS and added to a mix of 16 ⁇ l in vitro transcribed Helperl RNA and 16 ⁇ l recombinant SFV RNA.
  • RNA-BHK cell mix was transferred to an electroporation cuvette (EUROGENTEC) and electroporation was carried out twice (BIORAD gene pulser; 0,85V, 0,3-0,4s).
  • the electroporated cells were transferred to 20ml 10%FCS- containing DMEM:F12 and incubated at 37°C for 4 hours.
  • 125 ⁇ l of supernatant, containing the recombinant virus particles were added to 60mm culture dishes containing cortical neurons and 1 ,25 ml of the neurobasal medium. Infection proceeded for 1 hour at 37°C. After 1 hour the medium was changed for fresh 1 ,2ml neurobasal medium and the neurons were incubated for 2 hours at 37°C.
  • the cells were first washed with 3ml PBS and then scraped in 1 ml PBS containing a protease inhibitor cocktail (1 mM EDTA,
  • aprotinine 14 ⁇ g/ml aprotinine, 2 ⁇ g/ml pepstatin.
  • Cells were harvested at 1500xg for 10 minutes and lysed by incubating them for 20 minutes on ice in 200 ⁇ l immunoprecipitation buffer containing protease inhibitors and 1 % Triton-X-100, to solubilize membrane proteins.
  • neurons were washed in 1 ml PBS, directly scraped in 600 ⁇ l DIP buffer and incubated for 10 minutes on ice. Cellular debris were removed by centrifugation.
  • Triton-X-100 10g sodium deoxycholate 1g SDS Ox TBS, pH 7.5 1500mM NaCI 200mM Tris-HCI
  • Rabbit polyclonal B11.4 has been raised against the last 20 amino acids of APP
  • Rabbit polyclonal B45.1 has been raised against amino acids 46-61 of mouse BACE Qust C-terminal to the propeptide)
  • the yeast two-hybrid system is an eukaryotic system used to detect protein-protein interactions in vivo. This system is based on the fact that many eukaryotic transcriptional activators are modular proteins composed of 2 separable functional domains: a DNA-binding domain (BD) and a transcriptional activation domain (AD).
  • the DNA-binding domain binds a specific DNA sequence, the Gal4 Upstream Activating Sequence (UAS) and the activation domain interacts with components of the transcription machinery to initiate transcription of a gene downstream of the Gal4-UAS.
  • UAS Gal4 Upstream Activating Sequence
  • the activation domain interacts with components of the transcription machinery to initiate transcription of a gene downstream of the Gal4-UAS.
  • a protein of interest, called bait is expressed in yeast as a fusion to the DNA-binding domain of the Gal4 protein.
  • Prey proteins are expressed as a fusion to the activation domain of the Gal4 protein. Neither of the BD nor AD can initiate transcription when separated and each domain continues to function when fused to other proteins.
  • the pBD-GAL4-bait and pAD-GAL4-prey plasmids are transformed and co-expressed in a yeast host. When the bait and prey proteins interact, the Gal4 protein is reconstituted.
  • the BD localizes the complex to a reporter gene Upstream Activating Sequence and the AD directs RNA polymerase II to transcribe this reporter gene.
  • the YRG-2 host strain is used.
  • This host strain contains two reporter genes under the control of the Gal4-UAS: a nutritional HIS3 gene and an enzymatic reporter gene, lacZ, encoding ⁇ -galactosidase.
  • a nutritional HIS3 gene a nutritional HIS3 gene and an enzymatic reporter gene, lacZ, encoding ⁇ -galactosidase.
  • lacZ an enzymatic reporter gene
  • the yeast transformants are plated on histidine-negative SD plates. Induction of HIS3 gene enables yeast transformants to grow on medium lacking histidine. Because the Gall promoter, which governs the expression of the HIS3 reporter gene, is a bit leaky, the expression of the second reporter gene lacZ, under the control of the iso-1 -cytochrome c promoter, is subsequently tested with a filter lift assay, to confirm the bait-prey protein interaction.
  • plasmid pBD-GAL4-Bt/c encoding the Gal4 protein fused to the transmembrane and cytoplasmic domains of BACE and as prey plasmid pAD-GAL4- mouse cDNA hippocampal library, encoding the Gal4 activation domain fused to proteins of a mouse hippocampal cDNA library.
  • Plasmid DNA was introduced in YRG-2 using a lithium acetate treatment.
  • a single YRG-2 yeast-colony ( ⁇ 3mm diameter) was picked from a fresh YPAD-plate and grown in 2ml of YPAD medium at 30°C with shaking at 250rpm (InnovaTM 4900, New Brunswick Scientific) for 8 hours. 25 ⁇ l of this starter culture were transferred to 50ml of YPAD broth and grown at 30°C, until the culture reached an OD600 (GeneQuantpro, Pharmacia Biotech) of 0,8-1 ,0, which corresponds approximately to 2.10 7 cells per ml ( ⁇ 18 hours).
  • yeast cells were then harvested by centrifuging at 800xg for 5 minutes at room temperature, washed with 25ml sterile water, washed with 1 ml 0,1 M LiAc and resuspended in 0,1 M LiAc (YEASTMAKERTM Yeast Transformation System, Clontech) to a final volume of 500 ⁇ l.
  • the cells were divided into 10 microcentrifuge tubes, with each tube containing about 50 ⁇ l of the cell suspension. After pelleting the yeast at 800xg for 5 minutes at room temperature, the LiAc solution was aspirated. Competent YRG-2 cells were then transformed as follows: 240 ⁇ l 50% PEG (Clontech), 36 ⁇ l 1 M LiAc and 25 ⁇ l 2mg/ml denatured carrier DNA (Salmon Sperm DNA, Sigma) were added in this order. The PEG solution was added first, because it shields the cells from the detrimental effects of the concentrated LiAc. The carrier DNA was denatured by boiling at 99 °C (Thermomixer compact, Eppendorf) for 10 minutes and immediately chilled on ice.
  • PEG Polyethylene glycol
  • the carrier DNA was denatured by boiling at 99 °C (Thermomixer compact, Eppendorf) for 10 minutes and immediately chilled on ice.
  • the pBD pBD-GAL4-Bt c vector and pAD-GAL4-cDNA library vector contain the TRP1 and LEU2 gene, respectively, to select for double transformant on SD media lacking W and L. Histidine was omitted to select for yeast transformants that express the HIS3 reporter gene and therefore encode candidate BACEt/c interacting proteins. The plates were incubated for a maximum of 14 days at 30°C.
  • X-gal (Stratagene)
  • X-gal is a chromogenic substrate of ⁇ -galactosidase which produces a dark blue precipitate on enzymatic hydrolysis.
  • the petri dish was sealed with parafilm and incubated colony side up for up to 24 hours at 30°C.
  • the amplified PCR fragments were purified and directly used in the TNT Coupled Reticulocyte Lysate System (Promega). For this, the DNA template and the reaction components were assembled in an RNase-free microcentrifuge tube, gently mixed by pipetting and the reaction proceeded for 90 minutes at 30°C. Reaction mixture:
  • 5' primer 5' AAGCTCGAAATTAACCCTCACTAAAGGGAAGTTTAAGTTTAATA CCACTACAATGGATGATG 3'
  • Glutathione S-Transferase is a protein that strongly interacts with reduced glutathione, even when it is N-terminally fused to a protein.
  • GST-fusion protein When a GST-fusion protein is incubated with glutathione molecules, that are immobilized on sepharose beads, the chimeric protein will bind to glutathione and can subsequently be purified. Proteins that interact with the GST-fusion protein can be pulled down, when incubated with GST- fusion protein bound to glutathione sepharose beads.
  • Plasmids encoding GST fusion proteins were introduced in BL21 competent cells (Merck Eurolab). Expression of the GST-fusion proteins can be induced by IPTG, a lactose analogue. A colony of the transformed BL21 cells was picked and grown in 20ml LB-ampicillin overnight at 30°C with shaking at 250rpm (InnovaTM 4900, New Brunswick Scientific). This starter culture was transferred to 500ml LB-ampicillin. The culture was incubated at 37°C until the OD600 (GeneQuant pro, Pharmacia Biotech) reached 0,4-0,5. To induce expression of GST fusion proteins, IPTG (Promega) was added to the culture to a final concentration of 0,5mM.
  • the culture was centrifuged for 15 minutes at 2500xg.
  • the bacterial pellet was resuspended in 10ml TS buffer, containing a protease inhibitor cocktail (1 mM EDTA, 14 ⁇ g/ml aprotinine, 2 ⁇ g/ml pepstatin).
  • Triton-X-100 was added to 1 % final concentration and the cell lysate was incubated for 15 minutes at 4°C with rotation. The insoluble debris was removed by centrifugating twice at 12500rpm for 20 minutes (Beckman J2-21 M/E).
  • pSG5 ** derives from the commercially available pSG5 (Stratagen), but the MCS was modified to: EcoRI, Spel, Sstll, Hindlll, Notl, Xhol, Smal, Sstl, BamHI, Bglll This was done by cloning synthetical synthesized oligonucleotides.
  • the sequence encoding mouse BACE ectodomain and transmembrane domain was PCR amplified using pSG5 ** -mBACE as template and primers 27 (sense) and 132 (antisense).
  • the PCR fragment was directly ligated to pGEM-T vector (PROMEGA).
  • PGEM-T multiple cloning site Apal, Aatll, Sphl, Ncol, Sacll, Spel, Notl, Pstl, Sail,
  • Ncol-Spel fragment of pGEM-T-mB ⁇ cyt (after Klenow treatment) was cloned into the Smal site of the pSG ⁇ " vector.
  • Ncol-Spel fragment of pGEM-T-mB ⁇ cyt (after Klenow treatment) was cloned into the Smal site of pSFV1 vector.
  • Annealed oligonucleotides (encoding nucleotides 1432 to 1506 of mBACE cDNA) were inserted into the EcoRI-Sall site of the pBD-GAL4-Cam vector.
  • sense oligo153 5' AATTCTGTCAGTGGCGCTGCCTGCGTTGCCTGCGCCACCAG
  • a PCR fragment encoding BACE transmembrane and cytoplasmic domains was amplified using pSG5"mBACE as template and primers 199 and 200.
  • sense primer 199 5' CGGAATTCGTCATGGCGGCCATCTGCGCC 3'
  • antisense primer 200 5' TCCCCCGGGTTACTTGAGCAGGGAGATGTCATC 3'
  • the PCR fragment was digested with EcoRI and Smal and ligated to an EcoRI- Smal digested pBD-GAL4-Cam vector.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention se rapporte au domaine de la maladie d'Alzheimer. Elle concerne l'identification, l'isolement et le séquençage de différents gènes codant pour des protéines qui interagissent avec la b-sécrétase (BACE). Ces protéines interagissant avec BACE pourraient être impliquées dans les mécanismes conduisant au développement de la maladie d'Alzheimer. Les acides nucléiques et protéines comprenant ces protéines interagissant avec BACE, ou dérivées de celles-ci, sont utiles pour le dépistage et le diagnostic de la maladie d'Alzheimer, pour l'identification et la mise au point d'agents thérapeutiques permettant de traiter la maladie d'Alzheimer, et pour la production de lignées cellulaires et d'animaux transgéniques pouvant servir de modèles pour la maladie d'Alzheimer.
PCT/EP2002/006667 2001-06-12 2002-06-07 Proteine interagissant avec bace WO2002101232A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002345051A AU2002345051A1 (en) 2001-06-12 2002-06-07 Bace interacting proteins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP01202228.1 2001-06-12
EP01202228 2001-06-12

Publications (2)

Publication Number Publication Date
WO2002101232A2 true WO2002101232A2 (fr) 2002-12-19
WO2002101232A3 WO2002101232A3 (fr) 2003-12-31

Family

ID=8180458

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/006667 WO2002101232A2 (fr) 2001-06-12 2002-06-07 Proteine interagissant avec bace

Country Status (2)

Country Link
AU (1) AU2002345051A1 (fr)
WO (1) WO2002101232A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120015884A1 (en) * 2009-01-19 2012-01-19 Alain Prochiantz Polypeptides for Specific Targeting to Otx2 Target Cells
US11773185B2 (en) 2017-11-08 2023-10-03 Denali Therapeutics Inc. Anti-BACE1 antibodies and methods of use thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002010354A2 (fr) * 2000-08-01 2002-02-07 Institut De Recherche Cliniques De Montreal (Ircm) Secretase/sheddase avec activite d'asp-ase sur l'enzyme de clivage app du site beta (bace asp2, memepsine 2)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002010354A2 (fr) * 2000-08-01 2002-02-07 Institut De Recherche Cliniques De Montreal (Ircm) Secretase/sheddase avec activite d'asp-ase sur l'enzyme de clivage app du site beta (bace asp2, memepsine 2)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ABBENANTE G ET AL: "Inhibitors of beta-amyloid formation based on the beta-secretase cleavage site." BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 268, no. 1, 5 February 2000 (2000-02-05), pages 133-135, XP001122396 ISSN: 0006-291X *
DATABASE SWALL [Online] 1 May 1999 (1999-05-01) ROWEN: "Large prolin-rich BAT3" retrieved from EBI Database accession no. Q9Z1R2 XP002230520 *
SKOVRONSKY D M ET AL: "beta-Secretase revealed: starting gate for race to novel therapies for Alzheimer's disease" TRENDS IN PHARMACOLOGICAL SCIENCES, ELSEVIER TRENDS JOURNAL, CAMBRIDGE, GB, vol. 21, no. 5, May 2000 (2000-05), pages 161-163, XP004198178 ISSN: 0165-6147 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120015884A1 (en) * 2009-01-19 2012-01-19 Alain Prochiantz Polypeptides for Specific Targeting to Otx2 Target Cells
US20170080060A1 (en) * 2009-01-19 2017-03-23 Centre National De La Recherche Scientifique Polypeptides for Specific Targeting to Otx2 Target Cells
US10842852B2 (en) 2009-01-19 2020-11-24 Centre National De La Recherche Scientifique Methods of delivering a polypeptide molecule to Otx2 target cells using an Otx2 targeting peptide
US11773185B2 (en) 2017-11-08 2023-10-03 Denali Therapeutics Inc. Anti-BACE1 antibodies and methods of use thereof

Also Published As

Publication number Publication date
AU2002345051A1 (en) 2002-12-23
WO2002101232A3 (fr) 2003-12-31

Similar Documents

Publication Publication Date Title
Wang et al. C/EBPα arrests cell proliferation through direct inhibition of Cdk2 and Cdk4
Buller et al. Molecular effects of Eya1 domain mutations causing organ defects in BOR syndrome
Mizuki et al. Functional modules and expression of mouse p40 phox and p67phox, SH3‐domain‐containing proteins involved in the phagocyte NADPH oxidase complex
KR100404011B1 (ko) 세포-주기조절단백질및그것의사용방법
JPH10501135A (ja) 免疫抑制剤標的蛋白質
JP2004530422A (ja) 急速なアポトーシスを誘導するｊｆｙ１蛋白質
Lebre et al. Ataxin-7 interacts with a Cbl-associated protein that it recruits into neuronal intranuclear inclusions
WO2005023858A1 (fr) Complexes proteiniques associes au traitement de la proteine precurseur amyloide
Flores et al. Nuclear localization of the PEP protein tyrosine phosphatase
JP2006518214A (ja) 神経障害および疾患の診断および処置のための遺伝子マーカー、組成物およびその利用
JP4499414B2 (ja) 免疫系に関する疾病を治療するためのｃｒｍｐファミリーのタンパク質の使用
Nitsch et al. WBP-2, a WW domain binding protein, interacts with the thyroid-specific transcription factor Pax8
US7070940B2 (en) Method for determining the ability of a compound to modify the interaction between parkin and the p38 protein
JP2004536552A (ja) フォン・ヒッペル・リンドウ腫瘍抑制タンパク質による低酸素誘導因子−１の条件付き調節のメカニズム
Fujimoto et al. Dystroglycan regulates proper expression, submembranous localization and subsequent phosphorylation of Dp71 through physical interaction
WO2002101232A2 (fr) Proteine interagissant avec bace
JP2006515159A (ja) Ｍｋ２相互作用タンパク質
JP2002530076A (ja) 神経病及び細胞変性の予防又は治療の方法
Sakai et al. Interaction of a paraneoplastic cerebellar degeneration-associated neuronal protein with the nuclear helix-loop-helix leucine zipper protein MRG X
Xu et al. Identification of Rgl3 as a potential binding partner for Rap-family small G-proteins and profilin II
EP1227106A1 (fr) Protéines proapoptotiques et de molécules d'ADN codant ces protéines
JP2004500111A (ja) ヒトサバイビン相互作用タンパク質１（ｓｉｐ−１）
Rivera Reyes Two complementary proteomic analyses uncover new regulators of TBX18 transcriptional function
JP4635218B2 (ja) 神経細胞において物質の核内移行に関与する新規タンパク質、および当該タンパク質をコードする遺伝子、並びにその利用
JP2004137207A (ja) 細胞毒性を抑制する蛋白質

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP