WO2002046447A2 - Procede d'identification de nucleotides a des positions determines dans des acides nucleiques cibles - Google Patents

Procede d'identification de nucleotides a des positions determines dans des acides nucleiques cibles Download PDF

Info

Publication number
WO2002046447A2
WO2002046447A2 PCT/US2001/030742 US0130742W WO0246447A2 WO 2002046447 A2 WO2002046447 A2 WO 2002046447A2 US 0130742 W US0130742 W US 0130742W WO 0246447 A2 WO0246447 A2 WO 0246447A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
target nucleic
odnp
irers
nucleotide
Prior art date
Application number
PCT/US2001/030742
Other languages
English (en)
Other versions
WO2002046447A3 (fr
Inventor
Jeffrey Van Ness
David J. Galas
Lori K. Garrison
Original Assignee
Keck Graduate Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Keck Graduate Institute filed Critical Keck Graduate Institute
Priority to US10/398,004 priority Critical patent/US20040058349A1/en
Priority to AU4146002A priority patent/AU4146002A/xx
Publication of WO2002046447A2 publication Critical patent/WO2002046447A2/fr
Publication of WO2002046447A3 publication Critical patent/WO2002046447A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Definitions

  • This invention relates to the field of molecular biology, more particularly to methods and compositions involving nucleic acids, and still more particularly to methods and compositions for identifying a particular nucleotide in a target nucleic acid.
  • Mutations occurring in somatic cells may induce disease if the mutations affect genes involved in cellular division control, resulting in, for example, tumor formation.
  • loss-of-function mutations in many genes can give rise to a detectable phenotype in humans.
  • the number of cell generations in the germline, from one gamete to a gamete in an offspring, may be around 20-fold greater in the male germline than in the female.
  • an egg is formed after a second meiotic division and lasts for 40 years. Therefore the incidence of different types of germline mutations and chromosomal aberrations depends on the parent of origin.
  • cytogenetics remains the preferred technique to investigate these important genetic mechanisms.
  • the remaining normal allele may be replaced by a second copy of the mutant allele in one cell per 10 3 -10 4 .
  • Mechanisms causing this replacement include chromosomal nondisjunction, mitotic recombination, and gene conversion.
  • independent mutations destroying the function of the remaining gene copy are estimated to occur in one cell out of 10 6 .
  • Sensitive mutation detection techniques offer extraordinary possibilities for mutation screening. For example, analyses may be performed even before the implantation of a fertilized egg. (Holding et al., Lancet 3:532 (1989)). Increasingly efficient genetic tests may also permit screening for oncogenic mutations in cells exfoliated from the respiratory tract or the bladder in connection with health checkups. (Sidransky et al., Science 252:706, 1991). Alternatively, when an unknown gene causes a genetic disease, methods to monitor DNA sequence variants are useful to study the inheritance of disease through genetic linkage analysis. Notwithstanding these unique applications for the detection of mutations in individual genes, the existing methodology for achieving such applications continues to pose technological and economic challenges.
  • allele-specific PCR methods can rapidly and preferentially amplify mutant alleles.
  • multiple mismatch primers have been used to detect H-ras mutations at a sensitivity of one mutant in 10 5 wild-type alleles and sensitivity as high as one mutant in 10 6 wild-type alleles have been reported.
  • Haliassos et al Nucleic Acids Res. 7:8093-8099 (1989) and Chen et al., Anal. Biochem 244:191-194 (1997).
  • the discriminating mismatch on the 3' primer end i.e., G:T or C:A mismatch
  • G:T or C:A mismatch the discriminating mismatch on the 3' primer end
  • RFLP detection methods are limited by the requirement that the location of the mutations must coincide with restriction endonuclease recognition sequences.
  • primers that introduce a restriction site have been employed in "primer-mediated RFLP.”
  • “primer-mediated RFLP” Jacobson et al., PCR Methods Applicat. 1:299 (1992); Chen et al., Anal. Biochem 195:51-56 (1991); Di Giuseppe et al., Am. J. Pathol. 144:889-895 (1994); Kahn et al., Oncogene 5:1079-1083 (1991); Levi et al, Res. 51 Cancer Res.
  • nucleotide analogs that are designed to base pair with more than one of the four natural bases are termed "convertides.” Base incorporation opposite different convertides has been tested. (Hoops et al., Nucleic Acids Res. 25:4866-4871 (1997)). For each analog, PCR products were generated using Taq DNA polymerase and primers containing an internal nucleotide analog. The products generated showed a characteristic distribution of the four bases incorporated opposite the analogs.
  • the present invention fulfills this and other related needs by providing methods for the detection of mutations at defined nucleotide loci in target nucleic acids that, rnter alia, display increased speed, convenience and specificity.
  • methods according to the present invention are based on the incorporation of unique restriction endonuclease restriction sites flanking and/or encompassing the mutant nucleotide loci. These methods exploit the high degree of specificity afforded by restriction endonucleases and employ readily available detection techniques.
  • the present invention provides various compounds and compositions useful for, and method of, identifying single nucleotide polymorphisms at defined positions in target nucleic acids.
  • the present invention provides a method for identifying a nucleotide at a defined position in a single-stranded target nucleic acid, comprising the following steps:
  • the first ODNP comprises a nucleotide sequence that is complementary to a nucleotide sequence of the target nucleic acid at a location 3' to the defined position
  • the second ODNP comprises a nucleotide sequence that is complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 3' to the complementary nucleotide of the nucleotide at the defined position
  • the first and second ODNPs further comprise a first constant recognition sequence (CRS) of a first strand and a second CRS of a second strand of an interrupted restriction endonuclease recognition sequence (IRERS), respectively, but not a complete IRERS, the complete IRERS being a double-stranded nucleic acid having the first and the second strands and comprising the first and the second constant recognition sequences (CRS) of a first oligonucleotide primer (ODNP), a second ODNP, and the target nucleic acid
  • the first ODNP
  • step (d) characterizing a product of step (c) to thereby determine the identity of the nucleotide at the defined position.
  • the defined position may be polymorphic or associated with a disease, including a human genetic disease (e.g., bladder carcinoma, colorectal tumors, sickle-cell anemia, thalassemias, al-antitrypsin deficiency, Lesch- Nyhan syndrome, cystic fibrosis/mucoviscidosis, Duchenne/Becker muscular dystrophy, Alzheimer's disease, X-chromosome-dependent mental deficiency, and Huntington's chorea, phenylketonuria, galactosemia, Wilson's disease, hemochromatosis, severe combined immunodeficiency, alpha- 1-antitrypsin deficiency, albinism, alkaptonuria, lysosomal storage diseases, Ehlers-Danlos syndrome, hemophilia, glucose-6-phosphate dehydrogenase disorder, agammaglobulimenia, diabetes insipidus, Wiskott-Aldrich syndrome, Fabry's
  • Willebrand's disease neurofibromatosis, tuberous sclerosis, hereditary hemorrhagic telangiectasia, familial colonic polyposis, Ehlers-Danlos syndrome, myotonic dystrophy, osteogenesis imperfecta, acute intermittent porphyria, and von Hippel-Lindau disease).
  • a mutation at the defined position is associated with drug resistance of a pathogenic microorganism.
  • the single-stranded target nucleic acid may be one strand of a denatured double-stranded nucleic acid, such as genomic nucleic acid and cDNA.
  • the single-stranded target nucleic acid may be derived from the genome of a pathogenic virus or from the genome or episome of a pathogenic bacterium.
  • the target nucleic acid is synthetic nucleic acid.
  • either the nucleotide sequence of the first ODNP complementary to the target nucleic acid, or the nucleotide sequence of the second ODNP complementary to the complement of the target nucleic acid, or both are at least
  • either the first ODNP, or the second ODNP, or both ODNPs are 8-100 nucleotides in length, more preferably 15-85 nucleotides in length.
  • the first ODNP may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the first CRS.
  • the second ODNP may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the first CRS.
  • ODNP may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the second CRS.
  • step (b) of the present method comprises performing a polymerase chain reaction.
  • step (d) may be performed at least partially by the use of mass spectrometry, liquid chromatography, fluorescence polarization, electron ionization, gel electrophoresis, or capillary electrophoresis.
  • all of steps (a) through (d) may be performed in a single vessel.
  • the IRERS is recognizable by Bsl I, Mwo I, and Xcm I.
  • Another aspect of the present invention provides an oligonucleotide primer, comprising
  • oligonucleotide sequence (b) is at least 6, 8, 10, 12, 14, or 16 nucleotides in length.
  • the primer is 8-200 nucleotides in length.
  • the primers are 15-85 or 18-32 nucleotide in length.
  • the primer may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the first CRS.
  • the IRERS is recognizable by Bsl I.
  • the defined position in the target nucleic acid is polymorphic.
  • a mutation at the defined position in the target nucleic acid is associated with a disease.
  • the target nucleic acid may one strand of a denatured double- stranded nucleic acid, including genomic nucleic acid and cDNA.
  • a primer pair for producing a portion of a single-stranded target nucleic acid containing a nucleotide to be identified at a defined position.
  • a primer pair comprise first and second ODNPs wherein (1) the first ODNP comprises a nucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 3' to the defined position; (2) the second ODNP comprises a nucleotide sequence complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 3' to the complementary nucleotide of the nucleotide to be identified; (3) the first and second ODNPs further comprise a first constant recognition sequence (CRS) of a first strand and a second CRS of a second strand of an interrupted restriction endonuclease recognition sequence (IRERS), respectively, but not a complete IRERS, the complete IRERS being a double-stranded nucleic
  • CRS constant recognition sequence
  • IRERS
  • either the nucleotide sequence complementary to the target nucleic acid of the first ODNP, or the nucleotide sequence complementary to the complement of the target nucleic acid of the second ODNP, or both are at least 6, 8, 10, 12, 14, or 16 nucleotides in length.
  • the IRERS is recognizable by Bsl I.
  • either the first ODNP, or the second ODNP, or both ODNPs are 8-100 nucleotides in length, preferably 15-85 nucleotides in length.
  • the first ODNP may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the first CRS.
  • the second ODNP may further comprise one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the second CRS.
  • the defined position in the target nucleic acid may be polymorphic or associated with a disease.
  • the target nucleic acid may be one strand of a denatured double-stranded nucleic acid, such as genomic nucleic acid and cDNA.
  • the present invention provides a composition comprising the primer and the target nucleic acid as described above. It further provides a kit comprising the above primer pair. The kit may further comprise a restriction endonuclease that recognizes the IRERS a portion of which constitutes partial sequences of the primer pair. The kit may also further comprise instruction of use thereof.
  • the present invention provides a set of two ODNP pairs, comprising first and second ODNP pairs each comprising first and second ODNPs wherein:
  • the first ODNP in the first ODNP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of a single-stranded target nucleic acid at a location 3' to a defined position in the target nucleic acid, and a first CRS of a first strand of an IRERS, but not the first strand of a complete IRERS, the complete IRERS being a double-stranded nucleic acid having first and second strands and comprising the first CRS and a second CRS linked by a VRS;
  • the second ODNP in the first ODNP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 5' to the defined position, and a second CRS of the first strand of the IRERS, but not the first strand of the complete IRERS;
  • the first ODNP in the second ODNP pair comprises an oligonucleotide sequence complementary to a nu
  • the second ODNP in the second ONDP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 3' to the position in the complement corresponding to the defined position in the target nucleic acid, and a second CRS of the second strand of the IRERS, but not the second strand of the complete IRERS;
  • a fragment resulting from an extension and ligation of the first and second ODNPs in each ODNP pair comprises the complete IRERS, wherein the nucleotide to be identified is within the VRS.
  • the present invention provides a method comprising the following steps:
  • IRERS interrupted restriction endonuclease recognition sequence
  • the IRERS comprises a first constant recognition sequence (CRS) and a second CRS linked by a variable recognition sequence (VRS), the VRS having a nucleotide of interest
  • VRS variable recognition sequence
  • step (c) characterizing at least one of the products of step (b) to determine the identity of the nucleotide of interest.
  • At least one of the products of step (b) is characterized by a technique selected from liquid chromatograph, mass spectrometiy, electron ionization, gel electrophoresis, and capillary electrophoresis.
  • the restriction endonuclease is Bsl I.
  • step (a) comprises: (i) forming a mixture of the primer pair set and the target nucleic acid as described above; (ii) extending the first and second ODNPs of the first and second ODNP pairs; (iii) ligating the extended products of step (b); and (iv) amplifying the fragments of step (c).
  • step (a) comprises: (i) forming a mixture of the primer pair described above and the target nucleic acid; and (ii) extending the first and the second ODNPs.
  • step (a) comprises: (i) forming a mixture of a first ODNP, a second ODNP and a single-stranded target, wherein (1) the first ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 3' to a defined position in the a target nucleic acid and a first CRS of a first strand of an IRERS, but not the first strand of a complete IRERS, the complete
  • IRERS being a double-stranded nucleic acid having first and second strands and comprising the first CRS and a second CRS linked by a VRS
  • the second ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 5' to the defined position and a second CRS of the first strand of the IRERS, but not the first strand of the complete IRERS; (ii) extending the first and second ODNPs; (iii) ligating the extended products of step (ii); and (iv) annealing the ligation product of step (iii) with an oligonucleotide wherein the oligonucleotide has a universe nucleotide at the position corresponding to the defined position in the target nucleic acid and the resulting double-stranded nucleic acid molecule comprising an IRERS.
  • the present invention provides a method comprising
  • the first ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 3' to a defined position in the a target nucleic acid and a first CRS of a first strand of an IRERS, but not the first strand of a complete IRERS, the complete IRERS being a double-stranded nucleic acid having first and second strands and comprising the first CRS and a second CRS linked by a VRS
  • the second ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 5' to the defined position and a second CRS of the first strand of the IRERS, but not the first strand of the complete IRERS;
  • step (d) characterizing at least one of the products of step (c) by a technique selected from liquid chromatography, mass spectrometry, electron ionization, gel electrophoresis, and capillary eletrophoresis.
  • step (b) comprises performing a polymerase chain reaction.
  • the target nucleic acid is genomic DNA or cDNA.
  • all of steps (a) through (c) are performed in a single vessel.
  • the restriction endonuclease is Bsl I.
  • Figure 1 is a diagram of major steps in a method of the present invention for identifying a nucleotide at a defined position in a target nucleic acid using an ONDP pair and an exemplary restriction endonuclease recognition sequence for Bsl I.
  • Figure 2 is a schematic diagram of the major components of the ODNPs and a resulting amplicon of the present invention.
  • Figure 3 is a schematic diagram of the major components of an interrupted restriction endonuclease recognition sequence.
  • a A ...A m is a specific nucleotide sequence consisting of m nuleotides, whereas A'j A' 2 ... A' m is the complement sequence of A 1 A ...A m .
  • the double-stranded fragment comprised of A]A 2 ...A m and
  • a ⁇ AA.A' m forms the first CRS (also referred to as "Region A").
  • N]N 2 ...N n is a variable nucleotide sequence consisting of n nucleotides where any one of the nucleotide can contain any of the four bases (a, c, t, or g).
  • N' ⁇ N' 2 ...N' n is the complement of N ⁇ N ...N n and forms a VRS (also referred to "Region B" where the number n is equal to the number B) in combination of N ⁇ N 2 ...N n .
  • C]C ...
  • FIG. 4 is a schematic diagram of a set of two ODNP pairs.
  • Figure 5 is a schematic diagram of major steps in the present method for identifying a nucleotide at a defined position in a target nucleic acid using a set of two ODNP pairs and the exemplary restriction endonuclease recognition sequence for Bsl I.
  • Figure 6 is a schematic diagram of major steps of one embodiment of the present method for providing a double-stranded nucleic acid molecule containing an IRERS.
  • Figure 7 shows the UV chromatograms.
  • the top panel shows the genotyping fragment with an M/Z value of 1246 (8 charges) representing a wild type allele of cytochrome 2D6 gene.
  • the second panel is the positive control of 1232 for (8 charges) to calibrate the M/Z measurements.
  • the third panel is the UV trace and the bottom panel shows the total ion current.
  • the present invention provides methods, compositions, and kits for determining sequence information at a defined genetic locus in a target nucleic acid.
  • the invention provides for the design, preparation and use of oligonucleotide primers (ODNPs) that can be extended in a manner that incorporates information about the nucleotide of interest into the extension product.
  • ODNPs oligonucleotide primers
  • the resulting product e.g., amplicon
  • This information is advantageously utilized in a variety of applications, as described herein, such as genetic analysis for hereditary diseases, tumor diagnosis, disease predisposition, forensics or paternity, crop cultivation and animal breeding, expression profiling of cell function and/or disease marker genes, and identification and/or characterization of infectious organisms that cause infectious diseases in plants or animals and/or that are related to food safety.
  • the ODNPs of the present invention each contain part of an interrupted restriction endonuclease recognition sequence (IRERS), defined in detail below.
  • the interrupted segment of the restriction endonuclease recognition site also referred to as “variable recognition sequence (VRS)
  • VRS variable recognition sequence
  • the interrupted segment of the restriction endonuclease recognition site may be one or more nucleotides in length and the sequence is variable (each position can contain any of the four bases (a, c, t, or g)).
  • VRS variable recognition sequence
  • the primers are designed such that the nucleotide of interest in a target nucleic acid is located in the amplicon within the variable segment of the restriction endonuclease recognition site.
  • the amplicon can then be digested to generate small fragments of nucleic acid that can be analyzed to determine the nucleotide of interest with great accuracy and sensitivity.
  • the oligonucleotide primers of the present invention are shown schematically in Figure 2.
  • Figure 1 a diagram of the present invention is shown using the exemplary restriction endonuclease recognition sequence for Bsl I.
  • any interrupted restriction endonuclease recognition sequence may be used (see Table 2).
  • the present invention provides assays for determining the identity of a base at a predetermined location in a target nucleic acid molecule.
  • provided herein are compounds and compositions that are useful in performing such assays.
  • the present invention provides compounds and compositions that, upon suitable characterization, identify the base at a predetermined location in a target nucleic acid. Still further aspects of the present invention are described hereinbelow.
  • nucleic acid when a location in a nucleic acid is "5' to" or “5' of a nucleotide of interest, this means that it is between the nucleotide of interest and the 5' phosphate of that strand of nucleic acid.
  • a refers to one or more of the indicated items.
  • a polymerase refers to one or more polymerases.
  • the identity of a nucleotide of interest in a target nucleic acid molecule is determined by combining the target with two primers, where the first primer hybridizes to and extends from a location 3' of the nucleotide of interest in the target, so as to incorporate the complement of the nucleotide of interest in a first extension product.
  • the second primer then hybridizes to and extends based on the first extension product, at a location 3' of the complement of the nucleotide of interest, so as to incorporate the nucleotide of interest in a second extension product.
  • the first primer then hybridizes to and extends from a location 3' of the nucleotide of interest in the second extension product, so as to form, in combination with the second extension product, a nucleic acid fragment.
  • the first and second primers are designed to incorporate a portion of the recognition sequence of a restriction endonuclease that recognizes a partially variable interrupted base sequence, i.e., a sequence of the form A-B-C where A and C are a number and sequence of bases essential for RE recognition, and B is a number of bases essential for RE recognition.
  • the first primer incorporates the sequence A
  • the second primer incorporates the sequence C
  • they are designed, in view of the target, to product a nucleic acid fragment where sequences A and C are separated by the bases B, where the nucleotide of interest is within region B.
  • Sequences in regions A, B and C are also referred to as "the first constant recognition sequence (CRS),” “variable recognition sequence,” and “the second CRS,” respectively.
  • Action of the RE on the nucleic acid fragment provides a small nucleic acid fragment that is amendable to characterization, to thereby reveal the identity of the nucleotide of interest.
  • the use of short nucleic acid (e.g., DNA) fragments is advantageous for numerous readout systems because amplicons produced during, e.g., a PCR amplification reaction, need not be tagged or labeled to facilitate detection.
  • a nucleotide at a defined position in a target nucleic acid is identified by combining the target with a set of two primer pairs.
  • the first and second primers of the first primer pair hybridize to the target at a location 3' and 5' to the defined position, respectively.
  • the first and second primers of the second primer pair hybridize to the complement of the target at a location 5' and 3' to the defined position, respectively.
  • Each ODNP of the primer pair set is designed to incorporate a portion of an IRERS (i.e., CRS) so that the extension and/or amplification product of the primer pair set with the target as a template in the presence of a DNA polymerase and a DNA ligase contains the complete IRERS.
  • the extension and/or amplification product is then digested with a RE that recognizes the IRERS and the resulting small fragment is characterized.
  • the nucleotide at the defined position is thereby identified.
  • Target Nucleic Acid Molecules typically involve or include a target nucleic acid molecule.
  • the target nucleic acid of the present invention is any nucleic acid molecule about which base information is desired, and which can serve as a template for a primer extension reaction, i. e. , can base pair with a primer.
  • nucleic acid refers generally to any molecule, preferably a polymeric molecule, incorporting units of ribonucleic acid or an analog thereof.
  • the template nucleic acid can be either single-stranded or double-stranded.
  • a single- stranded template nucleic acid may be one strand nucleic acid of a denatured double- stranded DNA. Alternatively, it may be a single-stranded nucleic acid not derived from any double-stranded DNA.
  • the template nucleic acid is DNA.
  • the template is RNA.
  • Suitable nucleic acid molecules are DNA, including genomic DNA, ribosomal DNA and cDNA.
  • RNA RNA
  • mRNA RNA
  • rRNA RNA
  • tRNA RNA
  • the nucleic acid molecule may be naturally occurring, as in genomic DNA, or it may be synthetic, i.e., prepared based up human action, or may be a combination of the two.
  • a naturally occurring nucleic acid is obtained from a biological sample.
  • Preferred biological samples include one or more mammalian tissues, (for example blood, plasma/serum, hair, skin, lymph node, spleen, liver, etc) and/or cells or cell lines.
  • the biological samples may comprise one or more human tissues and/or cells.
  • Mammalian and/or human tissues and/or cells may further comprise one or more tumor tissues and/or cells.
  • a synthetic nucleic acid is produced by human intervention.
  • many companies are in the business of making and selling synthetic nucleic acids that may be useful as the template nucleic acid molecule in the present invention. See, e.g., Applied Bio Products Bionexus (www.bionexus.net); Commonwealth Biotechnologies, Inc.
  • the synthetic nucleic acid template may be prepared using an amplification reaction.
  • the amplification reaction may be, for example, the polymerase chain reaction.
  • the synthetic nucleic acid template may be prepared using recombinant DNA means through production in one or more prokaryotic or eukaryotic organism such as, e.g., E. coli, yeast, Drosophila or mammalian tissue culture cell line.
  • prokaryotic or eukaryotic organism such as, e.g., E. coli, yeast, Drosophila or mammalian tissue culture cell line.
  • the nucleic acid molecule may, and typically will, contain one or more of the 'natural' nucleotides, i.e., adenine (A), guanine (G), cytosine (C), thymine (T) and, in the case of an RNA, uracil (U).
  • the target nucleic acid may include "unnatural" nucleotides.
  • Unnatural nucleotides are chemical moieties that can be substituted for one or more natural nucleotides in a nucleotide chain without causing the nucleic acid to lose its ability to serve as a template for a primer extension reaction.
  • the substitution may include either sugar and/or phosphate substitutions, in addition to base substitutions.
  • Such moieties are very well known in the art, and are known by a large number of names including, for example, abasic nucleotides, which do not contain a commonly recognized nucleotide base, such as adenine, guanine, cytosine, uracil or thymine (see, e.g., Takeshita et al. "Oligonucleotides containing synthetic abasic sites" The Journal of Biological Chemistry, vol. 262, pp. 10171-10179 1987; Iyer et al. "Abasic oligodeoxyribonucleoside phosphorothioates: synthesis and evaluation as anti- HIV-1 agents" Nucleic acids Research, vol. 18, pp.
  • nucleotide mimetics nucleic acid related compounds
  • spacers see, e.g., Nielsen et al. Science, 254:1497-1500 (1991); and specificity spacers (see, e.g., PCT International Publication No. WO 98/13527).
  • base-pair mismatch refers to all single and multiple nucleotide substitutions that perturb the hydrogen bonding between conventional base pairs, e.g., G:C, A:T, or A:U, by substitution of a nucleotide with a moiety that does not hybridize according to the standard Watson-Crick model to a corresponding nucleotide on the opposite strand of the oligonucleotide duplex.
  • Such base-pair mismatches include, e.g., G:G, G:T, G:A, G:U, C:C, C:A, C:T, C:U, T:T, T:U, U:U and A:A.
  • base-pair mismatches are single or multiple nucleotide deletions or insertions that perturb the normal hydrogen bonding of a perfectly base-paired duplex.
  • base-pair mismatches arise when one or both of the nucleotides in a base pair has undergone a covalent modification (e.g., methylation of a base) that disrupts the normal hydrogen bonding between the bases.
  • Base-pair mismatches also include non-covalent modifications such as, for example, those resulting from incorporation of intercalating agents such as ethidium bromide and the like that perturb hydrogen bonding by altering the helicity and/or base stacking of an oligonucleotide duplex.
  • intercalating agents such as ethidium bromide and the like that perturb hydrogen bonding by altering the helicity and/or base stacking of an oligonucleotide duplex.
  • the template in addition to containing nucleic acids or analogs thereof, also contains one or more natural bases of unknown identity.
  • the present invention provides compositions and methods whereby the identity of the unknown nucleotide(s) becomes known.
  • the base(s) of unknown identity is present at the "nucleotide loci" (or the “defined position"), refers to a specific nucleotide or region encompassing one or more nucleotides having a precise location on a target nucleic acid.
  • the base(s) to be identified in the target nucleic acid may be a mutation.
  • mutation refers to an alteration in a wild-type nucleic acid sequence. Mutations may be in regions encoding proteins (exons) or may be in non-coding regions (introns or 5' and 3' flanking regions) of a target nucleic acid. Exemplary mutations in non-coding regions include regulatory mutations that alter the amount of gene product, localization of protein and/or timing of expression.
  • point mutations refers to mutations in which a wild-type base (i.e., A, C, G, or T) is replaced with one of the other bases at a defined nucleotide locus within a nucleic acid sample.
  • a "frameshift mutation” is caused by a small deletion or insertion that, in turn, causes the reading frame to be shifted and, thus, a novel peptide to be formed.
  • a "regulatory mutation” is a mutation in a region(s) of the gene not coding for protein, e.g., intron, 5'- or 3'-flanking, but affecting correct expression (e.g., amount of product, localization of protein, timing of expression).
  • a "nonsense mutation” is a single nucleotide change resulting in a triplet codon (where mutation occurs) being read as a "STOP" codon causing premature termination of peptide elongation, i.e., a truncated peptide.
  • a “missense mutation” is a mutation that results in one amino acid being exchanged for a different amino acid. Such a mutation may cause a change in the folding (3 -dimensional structure) of the peptide and/or its proper association of other peptides in a multimeric protein.
  • trinucleotide repeat refers to a class of mutations that overlap with the chromosomal disorders, since large deletions in the "trinucleotide repeat" can be seen using cytological methods.
  • a trinucleotide repeat is a 3 -base-pair sequence of nucleic acid (typically DNA) in or around the gene which is reiterated tandemly (one directly adjacent to the next) multiple times.
  • the mutation is observed when abnormal expansion of the repeat at variable levels results in the abnormal phenotype.
  • the severity of the disorder can sometimes be correlated with the number of repeats in the expanded region, e.g., fragile X mental retardation syndrome, Huntington Disease, and myotonic dystrophy.
  • the base of interest i.e., the base to be identified, may be a "single- nucleotide polymorphism” (SNP), which refers to any nucleotide sequence variation, preferably one that is common in a population of organisms and is inherited in a SNP.
  • SNP single- nucleotide polymorphism
  • the SNP is either of two possible bases, and there is no possibility of finding a third or fourth nucleotide identity at an SNP site.
  • a defined nucleotide locus within the target nucleic acid that comprises a base to be identified may contain a point mutation, single nucleotide polymorphism, deletion and/or insertion mutation.
  • the target nucleic acid may also be a complement of such a mutated allele.
  • polymorphism or “genetic variation,” as used herein, refers to the occurrence of two or more genetically determined alternative sequences or alleles in a small region (i.e., one to several (e.g., 2, 3, 4, 5, 6, 7, or 8) nucleotides in length) in a population.
  • the allelic form occurring most frequently in a selected population is referred to as the wild type form. Other allelic forms are designated as variant forms. Diploid organisms may be homozygous or heterozygous for allelic forms.
  • the genetic variation may be associated with or cause diseases or disorders.
  • diseases or disorders may be human genetic diseases or disorders and include, but are not limited to, bladder carcinoma, colorectal tumors, sickle-cell anemia, thalassemias, al-antitrypsin deficiency, Lesch-Nyhan syndrome, cystic fibrosis/mucoviscidosis, Duchenne/Becker muscular dystrophy, Alzheimer's disease, X-chromosome-dependent mental deficiency, and Huntington's chorea, phenylketonuria, galactosemia, Wilson's disease, hemochromatosis, severe combined immunodeficiency, alpha- 1-antitrypsin deficiency, albinism, alkaptonuria, lysosomal storage diseases, Ehlers-Danlos syndrome, hemophilia, glucose-6-phosphat
  • Target nucleic acids may be amplified before being combined with ODNPs as described below. Any known methods for amplifying nucleic acids may be used. Exemplary methods, such as the use of Qbeta Replicase, Strand Displacement Amplification, transcription-mediated amplification, RACE, and one-sided PCR, are described in detail below.
  • ODNPs typically involve or include one or more ODNPs which generally contain a partial IRERS and a region of complementarity with a target nucleic acid.
  • the target nucleic acid is described as a single-stranded nucleic acid below.
  • oligonucleotide refers to a nucleic acid fragment
  • oligonucleotide refers to any polymer having two or more nucleotides used in a hybridization, extension, and/or amplification reaction.
  • the ODNP may be comprised of deoxyribonucleotides, ribonucleotides, or an analog of either.
  • ODNPs are generally between 8 and 200 bases in length.
  • the present invention provides an ODNP useful for producing a portion of a target nucleic acid containing a nucleotide of interest at a defined position.
  • the ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of a target nucleic acid at a location 3' to the defined position.
  • the ODNP further comprises a first CRS of a first strand of an IRERS at a location 3' to the oligonucleotide sequence complementary to a portion of the target.
  • a complete IRERS is a double-stranded oligonucleotide sequence comprising a first CRS and a second CRS linked with a VRS ( Figure 3).
  • the ODNP is so designed that when it anneals to the target, the distance between the nucleotide corresponding to the 3' terminal nucleotide of the ODNP and the defined position is within the range 0 to n-1 where n is the number of variable nucleotides in the IRERS.
  • n is the number of variable nucleotides in the IRERS.
  • the ODNP further comprises one or more nucleotides complementary to the target nucleic acid at the 3' terminus of the first CRS.
  • the presence of such nucleotides facilitates extension of the primer as the sequence of the first CRS in the ODNP may or may not be exactly complementary to the corresponding nucleotide sequence of the target.
  • the present invention provides an ODNP pair for producing a portion of a target nucleic acid containing a nucleotide to be identified at a defined position.
  • One primer of the ODNP pair (“the first ODNP” or “the forward primer”) comprises a nucleic acid sequence complementary to a nucleotide sequence of a target nucleic acid at a location 3' to the defined position ("the first region of the target nucleic acid”)
  • the other primer (“the second ODNP” or “the reverse primer”) comprises a nucleic acid sequence complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 3' to the complementary nucleotide of the nucleotide at the defined position ("the first region of the complemenf).
  • each ODNP contains at least 6, preferably 8, more preferably 10, most preferably 12, 14, or 16 nucleotides that are complementary to the target nucleic acid or the complement thereof.
  • each ODNP of the ODNP pair hybridizes to a target nucleic acid, or the complement thereof, at a location 3' to the defined position in the target or the complementary position in the complement of the target, the resulting extension and/or amplification products from the ODNP pair contains the nucleotide to be identified at the defined position.
  • Each ODNP in the ODNP pair of the present invention further comprises a partial IRERS, but not a complete IRERS, at a location 3' to, or preferably at the 3' terminus of, its nucleic acid sequence described above (i.e., the sequence complementary to the target nucleic acid or the complement thereof).
  • the first ODNP and the second ODNP comprise the first CRS of the first strand of the IRERS and the second CRS of the second strand of the IRERS, respectively.
  • the first ODNP and the second ODNP are so spaced that (1) the extension and/or amplification product with the ODNP pair as primers and the target nucleic acid as a template contains a complete IRERS and (2) the nucleic acid to be identified is within the VRS.
  • the number of nucleotides between the first and the second CRS is the exact number of nucleotides in the VRS so that the extension and/or amplification product from both ODNP can be digested by a RE that recognizes the complete IRERS.
  • the partial IRERS in each ODNP may or may not be complementary to the target nucleic acid.
  • each ODNP of the ODNP pair further contains one or more nucleotides that is complementary to the target nucleic acid or the complement thereof ("the second region of the target nucleic acid” and “the second region of the complement,” respectively) at a location 3' to, or preferably the 3' terminus of, the CRS.
  • Such nucleotides are a portion of the VRS ( Figure 2).
  • the number of the nucleotides between first and second regions of the target nucleic acid or the complement thereof may be larger or smaller, but preferably equal to, the number of nucleotides of ODNPs between their two regions that are complementary to the target nucleic acids or the complement thereof.
  • the present invention provides a set of two ODNP pairs for producing a portion of a target nucleic acid containing a nucleotide to be identified at a defined position ( Figure 4).
  • Each pair of the set contain a first ODNP and a second ODNP.
  • the first ODNP of the first ODNP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 3' to the defined position. It further comprises a first CRS of a first strand of an IRERS at a location 3' to, preferably at the 3' terminus of, the above oligonucleotide sequence.
  • the second ODNP of the first ODNP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 5' to the defined position. It further comprises a second CRS of the first stand of the IRERS at a location 5' to, preferably at the 5' terminus, of the above oligonucleotide sequence.
  • the first ODNP of the second ODNP pair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 5' to the position in the complement corresponding to the defined position in the target nucleic acid.
  • the second ODNP of the second ODNP riair comprises an oligonucleotide sequence complementary to a nucleotide sequence of the complement of the target nucleic acid at a location 3' to the position in the complement corresponding to the defined position in the target. It further comprises the sequence of the second CRS of the second strand of the IRERS at a location 3' to, preferably at the 3' terminus of, the above oligonucleotide sequence.
  • the first ODNP of the first ODNP pair and the second ODNP of the second ODNP pair each further contains one or more nucleotides that are complementary to a nucleotide sequence of the target nucleic acid or the complement thereof at the 3' terminus of the first or the second CRS.
  • Such complementarity at the 3' termini of the ODNPs increases the extension and/or amplification efficiency from the ODNPs.
  • Methods, kits and compositions of the present invention may involve or include ODNP that are hybridized to the target nucleic acid, where the ODNP facilitates the production and/or amplification of a defined nucleotide locus within the target nucleic acid.
  • the ODNP and target nucleic acid are thus preferably combined under base-pairing condition. Selection of suitable nucleic acid hybridization and/or amplification conditions are available in the art by, e.g., reference to the following laboratory research manuals: Sambrook et al., "Molecular Cloning” (Cold Spring Harbor Press, 1989) and Ausubel et al., "Short Protocols in Molecular Biology” (1999) (incorporated herein by reference in their entirety).
  • hybrids may vary conditions of hybridization to achieve desired degrees of selectivity of ODNP towards target sequence.
  • relatively stringent conditions may be employed to form the hybrids, such as e.g., low salt and/or high temperature conditions, such as from about 0.02 M to about 0.15 M salt at temperatures of from about 50°C to about 70°C.
  • selective conditions are relatively intolerant of large mismatches between the ODNP target nucleic acid.
  • hybridization of the ODNPs may be achieved under moderately stringent buffer conditions such as, for example, in 10 mM Tris, pH 8.3; 50 mM KC1; 1.5 mM MgCl 2 at 60°C which conditions permit the hybridization of ODNP comprising nucleotide mismatches with the target nucleic acid.
  • moderately stringent buffer conditions such as, for example, in 10 mM Tris, pH 8.3; 50 mM KC1; 1.5 mM MgCl 2 at 60°C which conditions permit the hybridization of ODNP comprising nucleotide mismatches with the target nucleic acid.
  • the ODNPs After being hybridized to the target, the ODNPs are extended with the target or the complement thereof as a template using various methodologies known in the art, such as the polymerase chain reaction (PCR) and modified ligase chain reaction (LCR).
  • PCR polymerase chain reaction
  • LCR modified ligase chain reaction
  • the target nucleic acid is described as a single- stranded nucleic acid below.
  • the target nucleic acid are double- stranded ( Figures 12 and 22).
  • the first run of extension is for the first primer having a first CRS to incorporate the complement of the nucleotide of interest in the first extension product.
  • the second primer having a second CRS then hybridizes to and extends using the first extension product as a template and thereby incorporate the nucleotide of interest and the first CRS in a second extension product.
  • the first primer then hybridizes to and extends using the second extension product as a template and thereby form, in combination with the second extension product, a double- stranded nucleic acid fragment.
  • the double-stranded nucleic acid fragment resulting from the three runs of extensions contains a complete IRERS.
  • the first primer can hybridize to and extend using any of the target nucleic acid, the second extension product, and the complement of the third extension product as a template, as a template.
  • the second primer can hybridize to and extend using either the first extension product or the third extension product as a template.
  • the third extension product and the complement thereof are shorter than any of the target nucleic acid, the first extension product and the second extension product, they are the prefe ⁇ ed templates for subsequent extension reactions from either the first or the second ODNPs. This is because the extension efficiency with a short fragment as a template is higher than that with a large fragment as a template. With the increase of the number of extension reactions, the double stranded fragment containing both the nucleotide to be identified and a complete IRERS accumulates quickly than other molecules in the reaction mixture. Such accumulation increases the sensitivity of subsequent characterization of the fragment after being digested with a RE that recognizes the complete IRERS.
  • the extension/amplification reaction can be carried out known in the art, including PCR methods.
  • U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159 all describe PCR methods.
  • PCR methods are also described in several books, e.g., Gelfand et al., "PCR Protocols: A Guide to Methods and Application” (1990); Burke (ed), “PCR: Essential Techniques”; McPherson et al. "PCR (Basic: From Background to Bench).”
  • PCR Two ODNPs are prepared that are complementary to regions on opposite complementary strands of the target nucleic acid sequence.
  • An excess of deoxynucleoside triphosphates is added to a reaction mixture along with a DNA polymerase (e.g., Taq or Pfu polymerase). If the target nucleic acid sequence is present in a sample, the ODNPs will bind to the target and the polymerase will cause the ODNPs to be extended along the target nucleic acid sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, the extended ODNPs will dissociate from the target to form reaction products, excess ODNPs will bind to the target and to the reaction product and the process is repeated.
  • a DNA polymerase e.g., Taq or Pfu polymerase
  • Exemplary PCR conditions according to the present invention may include, but are not limited to, the following: 100 ⁇ l PCR reactions comprise 100 ng target nucleic acid; 0.5 ⁇ M of each first ODNP and second ODNP; 10 mM Tris, pH 8.3; 50 mM KC1; 1.5 mM MgCl 2; 200 ⁇ M each dNTP; 4 units TaqTM DNA Polymerase (Boehringer Mannheim; Indianapolis, IN), and 880 ng TaqStartTM Antibody (Clontech, Palo Alto, CA).
  • Exemplary thermocycling conditions may be as follows: 94°C for 5 minutes initial denaturation; 45 cycles of 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute; final extension at 72°C for 5 minutes.
  • Exemplary nucleic acid polymerases may include one of the thermostable DNA polymerases that are readily available in the art such as, e.g., TaqTM , VentTM or PFUTM. Depending on the particular application contemplated, it may be " preferred to employ one of the nucleic acid polymerases having a defective 3' to 5' exonuclease activity.
  • LCR uses both a nucleic acid polymerase enzyme and a nucleic acid ligase enzyme to drive the reaction.
  • exemplary nucleic acid polymerases may include one of the thermostable DNA polymerases that are readily available in the art such as, e.g., Taq , VentTM or PFUTM.
  • Exemplary nucleic acid ligases may include T4 DNA ligase, or the thermostable Tsc or Pfu DNA ligases.
  • T4 DNA ligase or the thermostable Tsc or Pfu DNA ligases.
  • U.S. Patent No. 4,883,750 incorporated herein by reference in its entirety, describes an alternative method of amplification similar to LCR for binding ODNP pairs to a target sequence.
  • Exemplary gap-LCR conditions may include, but are not limited to, the following: 50 ⁇ l LCR reactions comprise 500 ng DNA; a buffer containing 50 mM EPPS, pH 7.8, 30 mM MgCl 2 , 20 mM K + , 10 ⁇ M NAD, 1-10 ⁇ M gap filling nucleotides, 30 nM each oligonucleotide primer, 1 U Thermusflavus DNA polymerase, lacking 3'-- 5' exonuclease activity (MBR, Milwukee, WI), and 5000 U T. thermophilus DNA ligase (Abbott Laboratories). Cycling conditions may consist of a 30 s incubation at 85°C and a 30 s incubation at 60°C for 25 cycles and may be carried out in a standard PCR machine such as a Perkin Elmer 9600 thermocycler.
  • the first ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of a target nucleic acid at a location 3' to a nucleotide of interest in the target nucleic acid and a first CRSD of a first strand of an IRERS.
  • the second ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target at a location 5' to the nucleotide of interest and a second CRS of the first strand of the IRERS.
  • a DNA polymerase and a DNA ligase the two ODNPs extend and ligate with each other and the resulting product incorporates a nucleotide complementary to the nucleotide of interest in the target.
  • Such a product is then annealed to a single-stranded oligonucleotide having a sequence complementary to the amplification and ligation product at least within the region from the 5' terminus of the first ODNP and 3' terminus of the second ODNP and a universal nucleotide at the position complementary to the nucleotide of interest.
  • Another way to provide a double-stranded nucleic acid fragment containing a nucleotide to be identified at a defined location in a target nucleic acid and a complete IRERS is illustrated in Figure 6.
  • a primer pair is mixed with the target.
  • the first ODNP comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target nucleic acid at a location 3' to the defined position in the target and a first CRS of a first stand of an IRERS
  • the other primer (“the second ODNP”) comprises an oligonucleotide sequence complementary to a nucleotide sequence of the target 1 at a location 5' to the defined position and a second CRS of the first strand of the IRERS.
  • the two primers are then extended using the target as the template to incorporate the complement of the nucleotide to be identified (also referred to as "nucleotide of interest").
  • the extension products from the two primers are ligated and subsequently disassociated from the target.
  • the disassociated, ligated extension product is then annealed to another nucleic acid molecule that contains the sequence complementary to the ligated extension product in the region from the 5' terminus of the first ODNP to the 3' terminus of the second ODNP.
  • This nucleic acid molecule contains a universal nucleotide at a position corresponding to the complement of the nucleotide of interest in the ligated extension product.
  • Such annealing produces a double stranded nucleic acid containing a complete IRERS and the complement of the nucleotide of interest.
  • a number of other template dependent methodologies may be used either to amply target nucleic acids before combining the target nucleic acids with the ODNPs of the present invention.
  • such methodologies may be used, in combination of the ODNP pair or the set of two ODNP pairs described above, to produce a fragment containing a portion of a target nucleic acid with a defined nucleotide locus and a complete IRERS.
  • Qbeta Replicase described in PCT Intl. Pat. Appl. Publ. No. PCT/US87/00880, incorporated herein by reference in its entirety, may alternatively be used with methods of the present invention.
  • RNA polymerase a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase.
  • the polymerase will copy the replicative sequence that can then be detected.
  • Strand Displacement Amplification SDA
  • SDA Strand Displacement Amplification
  • RCR Repair Chain Reaction
  • nucleic acid amplification procedures include transcription-based amplification systems (TAS) (also refe ⁇ ed to as transcription-mediated amplification, or TMA) (Kwoh et al, 1989; PCT Intl. Pat. Appl. Publ. No. WO 88/10315, incorporated herein by reference in its entirety), including nucleic acid sequence based amplification (NASBA) and 3SR.
  • TAS transcription-based amplification systems
  • NASBA nucleic acid sequence based amplification
  • 3SR nucleic acid sequence based amplification
  • the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA.
  • RNAs are reverse transcribed into DNA, and transcribed once again with a polymerase such as T7 or SP6.
  • a polymerase such as T7 or SP6.
  • ssRNA single-stranded RNA
  • dsDNA double-stranded DNA
  • the ssRNA is a first template for a first ODNP, which is elongated by reverse transcriptase (RNA-dependent DNA polymerase).
  • RNA-dependent DNA polymerase reverse transcriptase
  • the RNA is then removed from resulting DNA:RNA duplex by the action of ribonuclease H (RNase H, an RNase specific for RNA in a duplex with either DNA or RNA).
  • RNase H ribonuclease H
  • the resultant ssDNA is a second template for a second ODNP, which also includes the sequences of an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5' to its homology to its template.
  • This ODNP is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of E. coli DNA polymerase I), resulting as a double-stranded DNA (“dsDNA”) molecule, having a sequence identical to that of the original RNA between the ODNPs and having additionally, at one end, a promoter sequence.
  • This promoter sequence can be used by the appropriate RNA polymerase to make many RNA copies of the DNA. These copies can then re-enter the cycle leading to very swift amplification. With proper choice of enzymes, this amplification can be done isothermally without addition of enzymes at each cycle. Because of the cyclical nature of this process, the starting sequence can be chosen to be in the form of either DNA or RNA.
  • Methods, kits and compositions of the present invention typically involve or include one or more interrupted restriction endonucleases.
  • the term "restriction endonuclease” refers to the class of nucleases that bind to unique double stranded nucleic acid sequences and that generate a cleavage in the double stranded nucleic acid that results in either blunt, double stranded ends, or single stranded ends with either a 5' or a 3' overhang.
  • the “restriction endonuclease recognition sequence (RERS)” is a nucleotide sequence within the double stranded DNA molecule to which the RE binds.
  • the "cleavage site” is the position at which the RE cuts the double stranded DNA molecule.
  • IRERS interrupted restriction endonuclease recognition sequence
  • first CRS also refe ⁇ ed to as “Region A”
  • second CRS also refe ⁇ ed to as "Region A”
  • “Second CRS” (also refe ⁇ ed to as “Region C”) is defined as that region of the IRERS that contains the constant (not variable) nucleotides of the IRERS that are located 3' of the VRE of the IRERS.
  • the "VRE” (also refe ⁇ ed as “Region B”) is defined as the stretch of one or more variable nucleotides that are located between the first and second CRSs.
  • Bsl I refers to an exemplary RE that binds to a unique nucleic acid sequence that is composed of 5'-CCNNNNNNNGG-3' where N is an undefined nucleotide base or analog thereof, and that cleaves double-stranded nucleic acid.
  • the cleavage site is as follows:
  • the base to be identified e.g., the mutation or SNP
  • the base to be identified is positioned within the middle three "Ns" comprising the 3 'overhang.
  • the base to be identified is positioned within the 6 th nucleotide from the 5' end of the top strand.
  • the base to be identified may be at any other positions within the variable recognition sequence. Any restriction endonuclease that recognizes an interrupted restriction endonuclease recognition sequence can be used in the present invention.
  • Non-commercially available restriction enzymes may be isolated and/or purified based on the teaching available in the art. For instances, the following articles describe the isolation and/or purification of several non- commercially available restriction enzymes suitable for the present invention and are incorporated herein in their entirety by reference: for restriction enzyme ApaB I, Grones and Turna, Biochim. Biophys.
  • Ava il G/GWCC (SEQ ID NO. 5)
  • Dra III CACNNN/GTG (SEQ ID NO. 10)
  • a nucleic acid fragment containing a portion of target nucleic acid with a defined nucleotide locus and a complete IRERS is digested (or cleaved) by a RE that recognizes the IRERS.
  • Conditions for storage and use of restriction endonucleases used according to the present invention are readily available in the art, for example, by reference to one of the laboratory manuals such as Sambrook et al., supra and Ausubel et al., supra. Briefly, the number of units of RE added to a reaction may be calculated and adjusted according to the varying cleavage rates of nucleic acid substrates. 1 unit of restriction endonuclease will digest 1 ug of substrate nucleic acid in a 50 ⁇ l reaction in 60 minutes.
  • fragments may require more than 1 unit/ug to be cleaved completely.
  • the restriction enzyme buffer is typically used at IX concentration in the reaction.
  • Some restriction endonucleases require bovine serum albumin (BSA) (usually used at a final concentration of 100 ⁇ g/ml for optimal activity). Restriction endonucleases that do not require BSA for optimal activity are not adversely affected if BSA is present in the reaction.
  • BSA bovine serum albumin
  • restriction enzymes are stable when stored at -20°C in the recommended storage buffer. Exposure to temperatures above -20°C should be minimized whenever possible. All restriction endonucleases should be kept on ice when not otherwise being stored in the freezer. Enzymes should always be the last component added to a reaction.
  • the recommended incubation temperature for most restriction endonucleases is about 37°C. Restriction endonucleases isolated from thermophilic bacteria require higher incubation temperatures, typically ranging from 50°C to 65°C. Incubation time may often be shortened if an excess of restriction endonuclease is added to the reaction. Longer incubation times are often used to allow a reaction to proceed to completion with fewer units of restriction endonuclease.
  • the present invention provides methodology whereby a fragment is cleaved using a restriction endonuclease, so as to generate a short (also refe ⁇ ed to as "small") nucleic acid fragment.
  • This short nucleic acid fragment contains information that, upon characterization of the fragment, allows one to determine the identity of the nucleotide(s) of interest in the target nucleic acid.
  • the present invention transfers information about the nucleotide(s) of interest from a relatively large target nucleic acid into a relatively small nucleic acid fragment.
  • the nucleotide(s) of interest is made to constitute a relatively large portion of the bases in a nucleic acid, such that characterization of the nucleic acid (fragment) is more readily able to reveal information about the nucleotide(s) of interest.
  • a direct and complete characterization of the small nucleic acid fragment can be obtained (which is often practically impossible for a large target nucleic acid) which will reveal the identity of the nucleotide(s) of interest.
  • methods according to the present invention employ, inter alia, the steps of using appropriate primer(s) and a target nucleic acid to prepare an intermediate structure (e.g., an amplicon) that is digested with a suitable RE (with or without a NE) to produce one or more small nucleic acid fragments.
  • an intermediate structure e.g., an amplicon
  • RE with or without a NE
  • One or more of these fragments that contain either nucleotides of interest or their complement nucleotides are then characterized to obtain partial or complete base sequence information about the fragment to determine the identification of the nucleotides of interest.
  • characterization of a nucleic acid fragment can be done directly, that is, without the need to incorporate a tag or label into the fragment. Alternatively, in some embodiments, it may be advantageous to add one or more detectable labels. a. Direct Characterization
  • the present invention transfers information about nucleotide(s) of interest from a relatively large target nucleic acid into a relatively small nucleic acid fragment. Such information transfer allows direct characterization of the small fragment in many instances. For example, small nucleic acid fragments are amenable to direct detection by a variety of mass spectrometric methodologies (as discussed herein below) as well as by ultraviolet (UV) absorption.
  • mass spectrometric methodologies as discussed herein below
  • UV absorption ultraviolet
  • the complete nucleotide sequence will be known for the short nucleic acid fragment even before it is formed.
  • the issue then becomes detecting the nucleotide of interest over the "noise" created while concurrently detecting the other bases.
  • this signal can be subtracted from the overall signal for the fragment, to leave information about the nucleotide of interest.
  • This approach is essentially adopted in using mass spectrometry to characterize the small nucleic acid fragment.
  • Other suitable methods include determining the mass-to-charge ratio of the small nucleic acid fragment(s), by measuring fluorescence polarization and/or by quantifying ultraviolet (UV) absorption.
  • characterizing a small nucleic acid fragment may entail simply determining the sizes of these single-strand fragments, and from this information the skilled artisan can deduce whether a target nucleic acid contains one or more mutations at a defined nucleotide locus. It will be apparent that the size of a single- strand fragment may be determined by numerous methods that are readily available in the art.
  • Exemplary methods disclosed herein including methods for measuring the size and/or molecular weight of a single-strand nucleic acid fragment, include, but are not limited to fluorescence including fluorescence polarization (FP), mass spectrometry (MS), ultraviolet (UV) absorption, cleavable mass tags, TaqMan (homogeneous), fluorescence resonance energy transfer (FRET), colorimetric, luminescence and/or fluorescence methodologies employing substrates for horseradish peroxidase (HRP) and/or alkaline phosphatase (AP), as well as methods employing radioactivity.
  • fluorescence including fluorescence polarization (FP), mass spectrometry (MS), ultraviolet (UV) absorption, cleavable mass tags, TaqMan (homogeneous), fluorescence resonance energy transfer (FRET), colorimetric, luminescence and/or fluorescence methodologies employing substrates for horseradish peroxidase (HRP) and/or alkaline phosphatase (AP), as well as methods employ
  • Mass Spectrometry may be employed for characterizing a strand of a small (short) nucleic acid fragments comprising the nucleotide locus of the target nucleic acid.
  • MS may be particularly advantageous in those applications in which it is desirable to eliminate a fractionation step prior to detection.
  • MS may also be employed in conjunction with a fractionation methodology, as discussed herein below, such as, for example, one of the liquid chromatography methodologies including HPLC and DHPLC.
  • MS detection does not require the addition of a tag or label to the small nucleic acid fragment. Instead, the nucleic acid fragment can be identified directly in the mass spectrometer.
  • MS may be particularly suitable to the detection of small nucleic acid fragments from as small as 1 nucleic acid to as large as several hundred nucleotides. More preferable are fragments of 1 to 50 nucleotides, still more preferable are fragments of from 1 to 14 nucleotides.
  • Sensitivities may be achieved to at least to 1 amu.
  • the smallest mass difference in nucleic acid bases is between adenine and thymidine, which is 9 Daltons.
  • LC-TOF-MS Chromatography-Time-of-Flight Mass Spectrometry
  • LC-TOF-MS is composed of an orthogonal acceleration Time-of-Flight (TOF) MS detector for atmospheric pressure ionization (API) analysis using electrospray (ES) or atmospheric pressure chemical ionization (APCI).
  • TOF-MS provides high mass resolution (5000 FWHM), high mass measurement accuracy (to within 5ppm) and very good sensitivity (ability to detect picomolar amount of DNA polymer) compared to scanning quadrupole instruments.
  • TOF instruments are generally more sensitive than quadrupoles, but co ⁇ espondingly more expensive.
  • LC-TOF-MS has a more efficient duty cycle since the cu ⁇ ent instruments can sequentially analyze one mass at a time while rejecting all others (this is refe ⁇ ed to as single ion monitoring (SIM)).
  • LC-TOF-MS samples all of the ions passing into the TOF analyzer at the same time. This results in higher sensitivity and provides quantitative data which improves the sensitivity between 10 and 100 fold.
  • Enhanced resolution (5000 FWHM) and mass measurement accuracy of better than 5 ppm imply that differences between nucleosides as small as 9 amu (Daltons) can be accurately measured.
  • the TOF mass analyzer performs very high frequency sampling (10 spectra/sec) of all ions simultaneously across the full mass range of interest.
  • the duty cycle of the LC-TOF-MS allows high sensitivity spectra to be recorded in quick succession making the instrument compatible with more efficient separation techniques such as narrow bore LC, capillary chromatography (CE) and capillary electrochromatography (CEC).
  • CE capillary chromatography
  • CEC capillary electrochromatography
  • aerosol spray is directed perpendicularly past the sampling cone, which is displaced from the central axis of the instrument. Ions are extracted orthogonally from the spray into the sampling cone aperture leaving large droplets, involatile materials, particulates and other unwanted components to collect in the vent port that is protected with an exchangeable liner.
  • the second orthogonal step enables the volume of gas (and ions) sampled from atmosphere to be increased compared with conventional API sources. Gas at atmospheric pressure sampled through an aperture into a partial vacuum forms a freely expanding jet, which represents a region of high performance compared to the surrounding vacuum. When this jet is directed into the second aperture of a conventional API interface it increases the flow of gas through the second aperture.
  • Maintaining a suitable vacuum in the MS- TOF therefore places a restriction on the maximum diameter of the apertures in such an LC interface. Ions in the partial vacuum of the ion block are extracted electrostatically into the hexapole ion bridge which efficiently transports ions to the analyzer.
  • the coupling of the TOF mass analyzers with MUX-technology allows the connection of up to 8 HPLC columns in parallel to a single LC-TOF-MS. (Micromass, Manchester UK).
  • a multiplexed electrospray (ESI) interface is used for on-line LC-MS utilizing an indexed stepper motor to sequentially sample from up to 8 HPLC columns or liquid inlets operated in parallel.
  • LC-TOF-MS is a quantitative method for analysis of the molecular weight of polymers.
  • LC-TOF-MS does not fragment the polymers and it employs a very gentle ionization process compared to matrix-assisted-lazer-desorption-ionization (MALDI). Because every MALDI blast is different, the ionization is not quantitative.
  • LC-TOF-MS does, however, produce different m/z values for polymers, but, as disclosed in Example 1 and Figures 1-9, this property provides the additional advantage of reducing background and providing complementary information. Tandem MS or MS/MS is used for structure determination of molecular ions or fragments.
  • Tandem MS the ion of interest is selected with the first analyzer (MS-1), collided with inert gas atoms in a collision cell, and the fragments generated by the collision are separated by a second analyzer (MS-2).
  • MS-1 first analyzer
  • MS-2 second analyzer
  • Ion Trap and Fourier transform experiments the analyses are ca ⁇ ied out in one analyzer, and the various events are separated in time, not in space. The information can be used to sequence peptides and small DNA/RNA oligomers.
  • Exact mass measurements are used for elemental-composition dete ⁇ nination of the sample molecular ion or an ionic fragment.
  • the basis of the method is that each element has a unique mass defect (deviation from the integer mass).
  • the measurement is carried out by scanning with an internal calibrant (in EI or CI mode) or by peak matching (in FAB mode).
  • the elemental composition is determined by comparing the masses of many possible compositions to the measured one. The method is very reliable for samples having masses up to 800 Da. At higher masses, higher precision or knowledge of expected composition are required to dete ⁇ nine the elemental composition unambiguously.
  • Electron ionization is widely used in mass spectrometry for relatively volatile samples that are insensitive to heat and have relatively low molecular weight.
  • the spectra usually containing many fragment-ion peaks, are useful for structural characterization and identification. Small impurities in the sample are easy to detect.
  • Chemical ionization is applied to similar samples; it is used to enhance the abundance of the molecular ion.
  • the molecular weight range is 50 to 800 Da. In rare cases it is possible to analyze samples of higher molecular weight. Accuracy of the mass measurement at low resolving power is ⁇ 0.1 Dalton and in the high resolution mode, ⁇ 5 ppm.
  • FAB Fast atom bombardment ionization
  • MS liquid secondary ionization MS
  • LSIMS liquid secondary ionization MS
  • the spectrum often contains peaks from the matrix, which is necessary for ionization, a few fragments and a peak for a protonated or deprotonated sample molecule.
  • FAB is used to obtain the molecular weight of sensitive, nonvolatile compounds. The method is prone to suppression effects by small impurities. The molecular weight range is 100 to 4000 Da.
  • Exact mass measurement is usually done by peak matching. The accuracy of the mass is the same as obtained in EI, CI.
  • Matrix-assisted laser desorption has been used to determine the molecular weight of peptides, proteins, oligonucleotides, and other compounds of biological origin as well as of small synthetic polymers.
  • the amount of sample needed is very low (pmoles or less).
  • the analysis can be performed in the linear mode (high mass, low resolution) up to a molecular weight of m/z 300,000 (in rare cases) or reflection mode (lower mass, higher resolution) up to a molecular weight of 10,000.
  • the analysis is relatively insensitive to contaminants, and accordingly a purification step is not necessarily a part of the characterization process when characterization includes MS. Mass accuracy (0.1 to 0.01%) is not as high as for other mass spectrometry methods. Recent development in Delayed Extraction TOF allows higher resolving power and mass accuracy.
  • Electrospray ionization allows production of molecular ions directly from samples in solution. It can be used for small and large molecular-weight biopolymers (peptides, proteins, carbohydrates, and DNA fragments), and lipids. Unlike MALDI, which is pulsed, it is a continuous ionization method that is suitable for using as an interface with HPLC or capillary electrophoresis. Multiply charged ions are usually produced. ESI should be considered a complement to MALDI. The sample must be soluble, stable in solution, polar, and relatively clean (free of nonvolatile buffers, detergents, salts, etc.). Electron-capture (sometimes called negative ion chemical ionization or
  • NICI is used for molecules containing halogens, NO 2, CN, etc, and it usually requires that the analyte be derivatized to contain highly electron-capturing moieties (e.g., fluorine atoms or nitrobenzyl groups). Such moieties are generally inserted into the target analyte after isolation and before mass spectrometric analysis.
  • the sensitivity of NICI analyses is generally two to tliree orders of magnitude greater than that of PCI or EI analyses. Little fragmentation occurs during NICI.
  • Indirect characterization hi some embodiments of the present invention, it may be advantageous to add one or more detectable labels to a short nucleic acid fragment or the reaction product thereof (e.g., a portion or the whole complementary strand of the short nucleic acid fragment). Such labels facilitate the characterization of the fragment and thereby the identification of nucleotide(s) of interest and/or genetic variations within the fragment.
  • Tables 2 and 3 summarize exemplary labels and detectors, respectively, that are generally suitable for use in methodologies for detecting small nucleic acid fragments.
  • Detectors for these tags and labels are available in generic and non- generic instruments.
  • the generic instruments are the plate readers that usually read micro-plates in 96-well or 384-well formats, and are capable of reading multiple colors (4-6 fluorescent tags). These instruments can be found in customized versions to perform more specialized measurements like time-resolved-fluorescence (TFR) or fluorescence polarization.
  • TFR time-resolved-fluorescence
  • the detectors for PAGE sequencing and bundled capillary instruments are highly dedicated and non-generic.
  • the generic mass spectrometers MALDI-TOF, electrospray-TOF and APCI-quadrupole (and combinations thereof including ion-trap instruments) are opened-ended instruments with versatility. Suitable software packages have been developed for combinatorial chemistry applications. Scintillation counters are dedicated in that they need to be used with radioisotopes, but can accommodate a wide range of assays formats.
  • the present invention is not limited to these examples. Any techniques known in the art suitable for characterizing small nucleic acid fragments and thereby determining the identity of nucleotide(s) at a defined location may be used in the present invention.
  • a nucleic acid fragment i.e., a digestion product described above
  • a nucleic acid fragment is characterized by performing a complete nucleotide sequence analysis.
  • Many techniques are known in the art for identifying each of the bases in a nucleic acid fragment, so as to obtain base sequence information. For instance, two different DNA sequencing methodologies that were developed in 1977, and are commonly known as “Sanger sequencing” and “Maxam Gilbert sequencing,” among other names, are still in wide use today and are well known to those of ordinary skill in the art. See, e.g., Sanger, Proc. Natl. Acad. Sci. (USA) 74:5463, 1977) and Maxam and Gilbert, Proc. Natl. Acad. Sci. (USA) 74:560, 1977).
  • Both methods produce populations of shorter fragments that begin from a particular point and terminate in every base that is found in the nucleic acid fragment that is to be sequenced.
  • the shorter nucleic acid fragments are separated by polyacrylamide gel electrophoresis and the order of the DNA bases (adenine, cytosine, thymine, guanine; also known as A,C,T,G, respectively) is read from a autoradiograph of the gel.
  • Automated DNA sequencing methods may also be used. Such methods are in wide-spread commercial use to sequence both long and short nucleic acid molecules. In one approach, these methods use fluorescent-labeled primers or ddNTP- terminators instead of radiolabeled components. Robotic components can utilize polymerase chain reaction (PCR) technology which has lead to the development of linear amplification strategies. Current commercial sequencing allows all 4 dideoxy- terminator reactions to be run on a single lane. Each dideoxy-terminator reaction is represented by a unique fluorescent primer (one fluorophore for each base type: A, T, C, G). Only one template DNA (i.e., DNA sample) is represented per lane.
  • PCR polymerase chain reaction
  • Cu ⁇ ent gels pe ⁇ nit the simultaneous electrophoresis of up to 64 samples in 64 different lanes. Different ddNTP-terminated fragments are detected by the i ⁇ adiation of the gel lane by light followed by detection of emitted light from the fluorophore. Each electrophoresis step is about 4-6 hours long. Each electrophoresis separation resolves about 400-600 nucleotides (nt), therefore, about 6000 nt can be sequenced per hour per sequencer.
  • Gilbert has described an automated DNA sequencer (EPA, 92108678.2) that consists of an oligomer synthesizer, an a ⁇ ay on a membrane, a detector which detects hybridization and a central computer.
  • the synthesizer synthesizes and labels multiple oligomers of arbitrary predicted sequence.
  • the oligomers are used to probe immobilized DNA on membranes.
  • the detector identifies hybridization patterns and then sends those patterns to a central computer which constructs a sequence and then predicts the sequence of the next round of synthesis of oligomers.
  • a DNA sequence can be obtained in an automated fashion. This approach may be used to characterize a short nucleic acid fragment (either double or, more commonly single stranded) according to the present invention.
  • Sequencing nucleic acids with ⁇ 100 bases by the common enzymatic ddNTP technique is more complicated than it is for larger nucleic acid templates, so that chemical degradation is sometimes employed.
  • the chemical decomposition method requires about 50 pmol of radioactive P end-labeled material, 6 chemical steps, electrophoretic separation, and film exposure.
  • ESI electrospray ionization
  • FT Fourier transform
  • MS mass spectrometry
  • Dissociation products of multiply-charged ions measured at high (105) resolving power represent consecutive backbone cleavages providing the full sequence in less than one minute on sub-picomole quantity of sample (Little et al., J. Am. Chem. Soc. 116:4893, 1994).
  • ESI/MS has been extended to larger fragments (Potier et al., Nuc. Acids Res. 22:3895, 1994).
  • ESI/FTMS appears to be a valuable complement to classical methods for sequencing and pinpoint mutations in nucleotides as large as 100-mers.
  • Spectral data have recently been obtained loading 3 x 10-13 mol of a 50-mer using a more sensitive ESI source (Valaskovic, Anal. Chem. 68:259, 1995).
  • Fluid Handling refers to those assays that are microtiter-plate based and use fluorescence, fluorescence-polarization, luminescence, radioactivity (scintillation counters), or colorimetric readouts. Fluid handling may be useful when the characterization method employs modification of the short nucleic acid fragment, e.g., when a tag or label is incorporated into the short nucleic acid fragment.
  • These assays can be amplified by the use of enzymes such as horseradish peroxidase or alkaline phosphatase that can generate soluble or insoluble colorimetric products from soluble substrates or sensitive luminescent products.
  • the small nucleic acid fragment(s) may, optionally, undergo a step of fractionation prior to a step of detection.
  • the fractionation step may simply remove undesired impurities from the small fragment of interest, to allow more convenient and/or more accurate characterization of the fragment.
  • This type of fractionation step may be refe ⁇ ed to as purification.
  • the fractionation may separate nucleic acids from one another (such as in chromatography) and the detection technique is simply determining whether the nucleic acid is, or is not, present at a particular time and space (e.g., using ultraviolet detection to determine whether a nucleic acid is eluting from a chromatography column).
  • a detection methodology may be advantageous to couple a detection methodology with one or more methodologies for the fractionation of small nucleic acid fragments.
  • such fractionation methodologies include, but are not limited to, electrophoresis including polyacrylamide or agarose gel electrophoresis and capillary electrophoresis, and liquid chromatography (LC) including high pressure liquid chromatography (HPLC) and denaturing high pressure liquid chromatography (DHPLC).
  • electrophoresis including polyacrylamide or agarose gel electrophoresis and capillary electrophoresis
  • LC liquid chromatography
  • HPLC high pressure liquid chromatography
  • DPLC denaturing high pressure liquid chromatography
  • electrophoresis refers generally to those separation techniques based on the mobility of nucleic acid in an electric field. Negatively charged nucleic acid migrates towards a positive electrode and positively charged nucleic acid migrates toward a negative electrode. Charged species have different migration rates depending on their total charge, size, and shape, and can therefore be separated.
  • An electrophoresis apparatus consists of a high-voltage power supply, electrodes, buffer, and a support for the buffer such as a polyacrylamide gel, or a capillary tube.
  • a support for the buffer such as a polyacrylamide gel, or a capillary tube.
  • Open capillary tubes are used for many types of samples and the other gel supports are usually used for biological samples such as protein mixtures or nucleic acid fragments.
  • the most powerful separation method for nucleic acid fragments is PAGE, generally in a slab gel format.
  • the major limitation of the cu ⁇ ent technology is the relatively long time required in performing the gel electrophoresis of nucleic acid fragments produced in sequence reactions. An increased magnitude (10-fold) can be achieved with the use of capillary electrophoresis which utilize ultrathin gels.
  • CE Capillary electrophoresis in its various forms, including free solution, isotachophoresis, isoelectric focusing, PAGE, and micellar electrokinetic "chromatography,” is a suitable technology for the rapid, high resolution separation of very small sample volumes of complex mixtures.
  • CE-MS mass spectrometry
  • CE may be employed in conjunction with electrospray ionization (ESI) flow rates.
  • ESI electrospray ionization
  • Polyacrylamide gels such as those discussed above, may be applied to CE methodologies. Remarkable plate numbers per meter have been achieved with cross-linked polyacrylamide. (See, e.g., Cohen et al., Proc. Natl. Acad. Sci., USA 85:9660 (1988) reporting 10 +7 plates per meter).
  • Such CE columns as described can be employed for nucleic acid (particularly DNA) sequencing.
  • the CE methodology is in principle 25 times faster than slab gel electrophoresis in a standard sequencer. For example, about 300 bases can be read per hour. The separation speed is limited in slab gel electrophoresis by the magnitude of the electric field that can be applied to the gel without excessive heat production.
  • the capillary format reduces the amperage and thus power and the resultant heat generation.
  • multiple capillaries may be used in parallel to increase throughput and may be used in conjunction with high throughput sequencing.
  • the major disadvantage of capillary electrophoresis is the limited volume of sample that can be loaded onto the capillary. This limitation may be circumvented by concentrating large sample volumes prior to loading the capillary with the accompanying benefit of > 10-fold enhancement in detection.
  • sample stacking The most popular method of preconcentration in CE is sample stacking. (Chien et al., Anal. Chem. 64:489A (1992)). Sample stacking depends on the matrix difference (i.e., pH and ionic strength) between the sample buffer and the capillary buffer, so that the electric field across the sample zone is more than in the capillary region. In sample stacking, a large volume of sample in a low concentration buffer is introduced for preconcentration at the head of the capillary column. The capillary is filled with a buffer of the same composition, but at higher concentration. When the sample ions reach the capillary buffer and the lower electric field, they stack into a concentrated zone. Sample stacking has increased detectability by 1-3 orders of magnitude.
  • preconcentration may be achieved by applying isotachophoresis (ITP) prior to the free zone CE separation of analytes.
  • ITP is an electrophoretic technique that allows microliter volumes of sample to be loaded onto the capillary, in contrast to the low nL injection volumes typically associated with CE. This technique relies on inserting the sample between two buffers (leading and trailing electrolytes) of higher and lower mobility followed by the analyte.
  • the technique is inherently a concentration technique, where the analytes concentrate into pure zones migrating with the same speed.
  • the technique is currently less popular than the stacking methods described above because of the need for several choices of leading and trailing electrolytes, and the ability to separate only cationic or anionic species during a separation process.
  • nucleic acid sequencing process Central to the nucleic acid sequencing process is the remarkably selective electrophoretic separation that may be achieved with nucleic acid and/or ODN fragments. Separations are routinely achieved with fragments differing in sequence by only a single nucleotide. This methodology is suitable for separations of fragments up to 1000 bp in length.
  • a further advantage of sequencing with cleavable tags is that there is no requirement to use a slab gel format when nucleic acid fragments are separated by PAGE. Since numerous samples are combined (4 to 2000) there is no need to run samples in parallel as is the case with cu ⁇ ent dye-primer or dye-terminator methods (i.e., ABI 373 sequencer). Since there is no reason to run parallel lanes, there is no reason to use a slab gel.
  • a tube gel format for the electrophoretic separation method. It has been shown that considerable advantage is gained when a tube gel format is used in place of a slab gel format. (Grossman et al., Genet. Anal. Tech. Appl. 9:9 (1992)). This is due to the greater ability to dissipate Joule heat in a tube format compared to a slab gel which results in faster run times (by 50%), and much higher resolution of high molecular weight nucleic acid fragments (greater than 1000 nt). Long reads are critical in genomic sequencing. Therefore, the use of cleavable tags in sequencing has the additional advantage of allowing the user to employ the most efficient and sensitive nucleic acid separation method that also possesses the highest resolution.
  • CE is a powerful method for nucleic acid sequencing, particularly DNA sequencing, forensic analysis, PCR product analysis and restriction fragment sizing.
  • CE is faster than traditional slab PAGE since with capillary gels a higher 6+potential field can be applied, but has the drawback of allowing only one sample to be processed per gel.
  • micro-fabricated devices MFDs are employed to combine the faster separations times of CE with the ability to analyze multiple samples in parallel.
  • MFDs permit an increase in information density in electrophoresis by miniaturizing the lane dimension to about 100 micrometers.
  • the current density of capillary arrays is limited to the outside diameter of the capillary tube.
  • Microfabrication of channels produces a higher density of arrays. Microfabrication also permits physical assemblies not possible with glass fibers and links the channels directly to other devices on a chip.
  • a gas chromatograph and a liquid chromatograph have been fabricated on silicon chips, but these devices have not been widely used.
  • Several groups have reported separating fluorescent dyes and amino acids on MFDs. (Manz et al., J. Chromatography 593:253 (1992); Effenhauser et ⁇ .,Anal. Chem. 65:2637 (1993)).
  • Photolithography and chemical etching can be used to make large numbers of separation channels on glass substrates.
  • the channels are filled with hydroxyethyl cellulose (HEC) separation matrices.
  • HEC hydroxyethyl cellulose
  • Liquid Chromatography Liquid Chromatography (LC) Liquid chromatography, including HPLC and DHPLC, may be used in conjunction with one of the detection methodologies discussed above such as, for example, fluorescence polarization, mass spectrometry and/or electron ionization. Alternatively LC, HPLC and/or DHPLC may be utilized in conjunction with a UV detection methodology. Regardless of the detection methodology employed, a fractionation step provides the separation of complex mixtures of non-volatile compounds prior to detection.
  • LC may be used for compounds that have a high molecular weight or are too sensitive to heat to be analyzed by GC.
  • the most common ionization methods that are interfaced to LC are ESI and Atmospheric Chemical Ionization (APCI) in positive and negative-ion modes.
  • the LC is done in most cases by RP-HPLC, and the buffer system should not contain involatile salts (e.g., phosphates).
  • ESI can be used for m/z 500-4000 and is done at low resolving power.
  • LC-MS can be used to look at a wide variety of biologically important compounds including, peptides, proteins, oligonucleotides, and lipids.
  • the chromatography for gene expression profiling or genotyping by LC/MS can be performed using a ProStar Helix System (catalog # HelixsysOl) which is composed of two pumps, a column oven, a UV detector, a degasser, a mixer and an autoinjector.
  • the column is like a Varian Microsorb MV (catalog number R0086203F5), C18 packing with 5 uM particle size, with 300 Angstroms pore size, 4.6 mm x 50 mm.
  • the column can be run at 30°C to 40°C with a gradient of acetonitrile in 100 mM Triethylamine acetate (TEAA) and 0.1 mM EDTA.
  • the following HPLC method can be used to separation the fragments on the column: Buffer A is 100 mM TEAA with 0.1 mM EDTA, Buffer B is 100 mM TEAA with 0.1 mM EDTA and 25% (VV) acetonitrile, 0-3 minutes there is a gradient of 20% B to 25% B, at 3.01 minutes to 4 minutes, there is a ramp to 45% B, at 4.01 to 4.5 minutes there is a ramp to 95% B, at 4.51 minutes there is 1 minutes hold at 20% B to re-equilibrate the column.
  • the column can be run at 30-50C by adjusting the column oven to 30C to 50C.
  • the flow rate can be 0.5 to 1.5 ml per minute. About 1 to 200 nanogram of fragment can be injected per 10-50 microliter volume.
  • the UN detector measures the effluent of the column.
  • HPLC High-Performance Liquid Chromatography
  • HPLC instruments consist of a reservoir of mobile phase, a pump, an injector, a separation column, and a detector. Compounds are separated by injecting an aliquot of the sample mixture onto the column. The different components in the mixture pass through the column at different rates due to differences in their partitioning behavior between the mobile liquid phase and the stationary phase.
  • the pumps provide a steady high performance with no pulsating, and can be programmed to vary the composition of the solvent during the course of the separation.
  • Exemplary detectors useful within the methods of present invention include UN-NIS absorption, or fluorescence after excitation with a suitable wavelength, mass spectrometers and IR spectrometers.
  • Oligonucleotides labeled with fluorochromes may replace radio-labeled oligonucleotides in semi-automated sequence analysis, minisequencing and genotyping. (Smith et al., Nature 321 :674 (1986)).
  • IP-RO-HPLC on non-porous PS/DNB particles with chemically bonded alkyl chains may be employed in the analysis of both single and double-strand nucleic acids. (Huber et al., Anal. Biochem.
  • IP-RP-HPLC enables a strictly size-dependent separation.
  • Denaturing HPLC is an ion-pair reversed-phase high performance liquid chromatography methodology (IP-RP-HPLC) that uses a non-porous C-18 column as the stationary phase.
  • the column is comprised of a polystyrene- divinylbenzene copolymer.
  • the mobile phase is comprised of an ion-pairing agent of triethylammonium acetate (TEAA), which mediates binding of DNA to the stationary phase, and acetonitrile (ACN) as an organic agent to achieve subsequent separation of the DNA from the column.
  • TEAA triethylammonium acetate
  • ACN acetonitrile
  • a linear gradient of acetonitrile allows separation DHPLC identifies mutations and polymorphisms based on detection of heteroduplex formation between mismatched nucleotides in double stranded PCR amplified DNA. Sequence variation creates a mixed population of heteroduplexes and homoduplexes during reannealling of wild type and mutant DNA of fragments based on size and/or presence of heteroduplexes (this is the traditional use of the DHPLC technology). When this mixed population is analyzed by HPLC under partially denaturing temperatures, the heteroduplexes elute from the column earlier than the homoduplexes because of their reduced melting temperature. Analysis can be performed on individual samples to determine heterozygosity, or on mixed samples to identify sequence variation between individuals.
  • the non-denaturing mode may be applicable where, for example, a 6-mer contains a C -_> T single nucleotide polymorphism (SNP) such as where the wild-type single strand DNA fragment has the nucleotide sequence 5 ⁇ ACCCC-3' and where the mutant single strand DNA fragment has the nucleotide sequence 5'-AATCCC-3'.
  • SNP single nucleotide polymorphism
  • Fragments as short as 1-mers, 2-, 3-, 4-, 5-, 6-, 7-, 8-, to 16-mers show different mobilities (retention times) on the DHPLC instrument.
  • HPLC as both sizing and DHPLC applications work on a wide pore silica based material. Porous materials have the advantage of high sample capacity for semipreparative work. This is marketed by HP as Eclipse dsDNA columns.
  • Detection methodologies employed in the methods of the present invention may optionally employ one or more computer algorithms for analyzing the derived sequence information.
  • Algorithms of the present invention may be encompassed within software packages that convert a detection signal, such as a mass- to-charge ratio of a given small nucleic acid fragment, to a genotyping call.
  • Exemplary software packages may comprise the following: a peak identification algorithm which identifies peaks above a certain threshold of intensity (area under the curve), an algorithm that identifies and records the mass to charge ratio of the peaks between the scan intervals, an algorithm that calculates the intensity of peaks by measuring the area under the curve, an algorithm that calculates the number of peaks during a scan interval, an algorithm that calculates the ratio of each set of two peaks, an algorithm that calculates the allele calling from the ratiometric values.
  • the software package and algorithms may record the sample identification (sample ID), source, primer name and sequence, mass to charge ratio of expected fragment, estimation of expected mass to charge ratio, mass spectrometry details, sample plate ID, sample well ID, date and time, number of peaks observed, observed mass to charge ratio, and calculated allele call.
  • the algorithms may also download the data to existed databases and check for accuracy of recording.
  • a complete genotyping system for use with a mass spectrometry detection system can comprise one or more components listed in the following: A computer (e.g., a Dell Optiplex Gx 110, with a CD-ROM), a software package to control the mass spectrometry, a thermocycler, and a robot that moves microtiter plates on and off the autoinjector, a simple HPLC to desalt the PCR or amplification reaction, the mass spectrometer such as an Agilent LC-quadrupole, ES-TOF, a Micromass ES- TOF or APCI-quadrupole, and a software program to call the alleles.
  • a computer e.g., a Dell Optiplex Gx 110, with a CD-ROM
  • a software package to control the mass spectrometry e.g., a thermocycler, and a robot that moves microtiter plates on and off the autoinjector
  • a simple HPLC to desalt the PCR or amplification reaction
  • the software package that converts the mass to charge ratio of the fragment to a genotyping call is composed of the following: an algorithm that records the temporal parameter of the chromatography, a peak identification algorithm which identifies peaks above a certain threshold of intensity (area under the curve), an algorithm that identifies and records the mass to charge ratio of the peaks between the scan intervals, an algorithm that calculates the intensity of peaks by measuring the area under the curve, an algorithm that calculates the number of peaks during a scan interval, an algorithm that calculates the ratio of each set of two peaks, an algorithm that calculates the allele calling from the ratiometric values.
  • the software package and algorithms record the sample identification (sample ID), source, primer name and sequence, mass to charge ratio of expected fragment, estimation of expected mass to charge ratio, chromatography details, elution time of each fragments, mass spectrometry details, sample plate ID, sample well ID, date and time, number of peaks observed, observed mass to charge ratio, and calculated allele, sequence identity, or gene identity call.
  • the algorithms will also download the data to existed databases and check for accuracy of recording.
  • the present invention provides methodology for the detection of mutations at defined nucleotide loci within target nucleic acids and/or measurement of genetic variations in parallel.
  • various "readout" technologies that may be employed with the methodologies of the present invention for detecting, for example, the size and/or molecular weight of one or more single-strand fragment comprising the mutations and/or genetic variations. Methods according to the present invention will find utility in a wide variety applications wherein it is necessary to identify such a mutation at a defined nucleotide locus or measure genetic variations.
  • Such applications include, but are not limited to, genetic analysis for hereditary diseases, tumor diagnosis, disease predisposition, forensics or paternity, crop cultivation and animal breeding, expression profiling of cell function and/or disease marker genes, and identification and/or characterization of infectious organisms that cause infectious diseases in plants or animals and/or that are related to food safety.
  • the present methods may be utilized to greatly increase the specificity, sensitivity and throughput of the assay while lowering costs in comparison to conventional methods cu ⁇ ently available in the art. Described below are certain exemplary applications of the present invention.
  • mRNAs are transcribed from single copy sequences.
  • Another property of cDNAs is that they represent a longer region of the genome because of the introns present in the chromosomal version of most genes. The representation varies from one gene to another but can be very significant as many genes cover more than 100 kb in genomic DNA, represented in a single cDNA.
  • molecular profiling is the use of probes from one species to find clones made from another species. Sequence divergence between the mRNAs of mouse and man permits specific cross-reassociation of long sequences, but except for the most highly conserved regions, prevents cross-hybridization of PCR primers.
  • the methods of the present invention are useful for determining whether a particular cDNA molecule is present in cDNAs from a biological sample and further determine whether genetic variation(s) exist in the cDNA molecule.
  • NNTR probes identify single sequences in the genome, but these sequences may be present in up to 30 different forms in the human population as distinguished by the size of the identified fragments.
  • the probability that unrelated individuals will have identical hybridization patterns for multiple NNTR or minisatellite probes is very low. Much less tissue than that required for DNA blots, even single hairs, provides sufficient DNA for a PCR-based analysis of genetic markers. Also, partially degraded tissue may be used for analysis since only small DNA fragments are needed.
  • the methods of the present invention are useful in characterizing polymorphism of sample DNAs, therefore useful in forensic DNA analyses. For example, the analysis of 22 separate gene sequences in a sample, each one present in two different forms in the population, could generate 1010 different outcomes, permitting the unique identification of human individuals. 5. Genome Diagnostics
  • hereditary diseases have long since been diagnosed by phenotypic analyses (anamneses, e.g., deficiency of blood: thalassemias), chromosome analyses (karyotype, e.g., mongolism: trisomy 21) or gene product analyses (modified proteins, e.g., phenylketonuria: deficiency of the phenylalanine hydroxylase enzyme resulting in enhanced levels of phenylpyruvic acid).
  • phenotypic analyses anamneses, e.g., deficiency of blood: thalassemias
  • chromosome analyses karyotype, e.g., mongolism: trisomy 21
  • gene product analyses modified proteins, e.g., phenylketonuria: deficiency of the phenylalanine hydroxylase enzyme resulting in enhanced levels of phenylpyruvic acid.
  • the additional use of nucleic acid detection methods considerably increases the range
  • the modification of just one of the two alleles is sufficient for disease (dominantly transmitted monogenic defects); in many cases, both alleles must be modified (recessively transmitted monogenic defects).
  • the outbreak of the disease is not only determined by the gene modification but also by factors such as eating habits (in the case of diabetes or arteriosclerosis) or the lifestyle (in the case of cancer). Very frequently, these diseases occur in advanced age. Diseases such as schizophrenia, manic depression or epilepsy should also be mentioned in this context; it is under investigation if the outbreak of the disease in these cases is dependent upon environmental factors as well as on the modification of several genes in different chromosome locations.
  • bladder carcinoma bladder carcinoma, colorectal tumors, sickle-cell anemia, thalassemias, al-antitrypsin deficiency, Lesch-Nyhan syndrome, cystic fibrosis/mucoviscidosis, Duchenne/Becker muscular dystrophy, Alzheimer's disease, X- chromosome-dependent mental deficiency, and Huntington's chorea, phenylketonuria, galactosemia, Wilson's disease, hemochromatosis, severe combined immunodeficiency, alpha- 1-antitrypsin deficiency, albinism, alkaptonuria, lysosomal storage diseases, Ehlers-Danlos syndrome, hemophilia, glucose-6-phosphate dehydrogenase disorder, agammaglobulimenia, diabetes insipidus, Wiskott-Aldrich syndrome, Fabry's disease, fragile X-synd
  • the present invention is useful to detect and/or measure genetic variations that are involved in infectious diseases, especially those in drug resistance genes.
  • the present invention facilitates the characterization and classification of organisms that cause infectious diseases and consequently the treatment of such diseases caused by these organisms.
  • Viral oncogenes are transmitted by retroviruses while their cellular counterparts (c-oncogenes) are already present in normal cells.
  • the cellular oncogenes can, however, be activated by specific modifications such as point mutations (as in the c-K-ras oncogene in bladder carcinoma and in colorectal tumors), small deletions and small insertions.
  • point mutations as in the c-K-ras oncogene in bladder carcinoma and in colorectal tumors
  • small deletions small insertions.
  • point mutations, small deletions or insertions may also inactivate the so-called “recessive oncogenes” and thereby leads to the formation of a tumor (as in the retinoblastoma (Rb) gene and the osteosarcoma).
  • the present invention is useful in detecting or identifying the point mutations, small deletions and small mutations that activate oncogenes or inactivate recessive oncogenes, which in turn, cause cancers.
  • HLA histocompatibility antigens
  • variable, antigen-specific regions of the T-cell receptor - analogous to the antibody reaction In a graft rejection, the T-cells expressing a specific T-cell receptor which fits to the foreign antigen, could therefore be eliminated from the T-cell pool.
  • Such analyses are possible by the identification of antigen-specific variable DNA sequences which are amplified by PCR and hence selectively increased.
  • the specific amplification reaction permits the single cell-specific identification of a specific T-cell receptor. Similar analyses are presently performed for the identification of autoimmune disease like juvenile diabetes, arteriosclerosis, multiple sclerosis, rheumatoid arthritis, or encephalomyelitis.
  • the present invention is useful for determining gene variations in T-cell receptor genes encoding variable, antigen-specific regions that are involved in the recognition of various foreign antigens.
  • the following example describes the amplification of a specific sequence from the human genome in which the primers contain the Bsl I restriction endonuclease recognition sequence.
  • the resulting amplicon contains a cutting site that liberates a two double-strand oligonucleotide fragments, which is then subjected to a chromatography step and identified by mass to charge ratio.
  • the 50 ⁇ l PCR reactions were composed of 25 ng genomic DNA, 0.5 ⁇ M each forward and reverse primers, 10 mM Tris pH 8.3, 50 mM KCl, 1.5 mM MgCl 2 , 200 ⁇ M each dNTP, 1 Unit DNA Polymerase (MasterAmp TM Taq DNA Polymerase from Epicentre Technologies, Madison WI or Vent exo- Polymerase New England BioLabs, Beverly MA). Thermocycling conditions were as follows: 95°C for 3 minutes followed by 30 cycles of 92°C for 40 seconds, 60°C for 30 seconds, 72°C for 30 seconds. A MJ Research PTC- 100 thermocycler (MJ Research, Watertown, MA) was used for all PCR reactions. Primers were purchased from MWG Biotech (High Point, NC).
  • thermocycling After the thermocycling was complete, an enzyme mixture was prepared containing Bsl I and lOx Bsl I buffer (New England BioLabs Beverly, MA). The mixture was added to each well to make final concentrations of 150 mM KCl, 10 mM Tris-HCl, 2 mM MgCl 2 , 1 mM DTT, pH 7.5. The reaction was carried out at 55°C for more than 60 minutes. The reaction mixture was injected directly without any further manipulation.
  • the chromatography system is an Varian Prostar Helix system composed of a binary pump, degasser, a column oven, a diode a ⁇ ay detector, and thermostatted microwell plate autoinjector (Varian Inc. Walnut Creek, CA).
  • the column is a Varian Microsorb MV, incorporating C18 packing with 3 uM particle size, with 300 Angstrom pore size, 2.1 mm x 50 mm (Varian Inc. Walnut Creek, CA).
  • the column was run at 30C with a gradient of acetonitrile in 5 mM Triethylamine acetate (TEAA). Buffer A is 5 mM TEAA, buffer B is 5 mM TEAA and 25% (V/V) acetonitrile.
  • TEAA Triethylamine acetate
  • the gradient begins with a hold at 10%B for one minute, then ramps to 50%B over 4 minutes followed by 30 seconds at 95%B and finally returning to 10%B for a total run time of six minutes.
  • the column temperature was held constant at 30°C.
  • the flow rate was 0.416 ml per minute.
  • the injection volume was 10 microliters.
  • the flow rate into the mass spectrometer was 200ul/min, and half of the LC flow was diverted to waste using a tee.
  • the mass spectrometer is a Micromass LCT Time-of-Flight with an electrospray inlet (Micromass Inc. Manchester UK). The samples were run electrospary negative mode with a scan range from 700 to 2300 amu using an one second scan time.
  • Instrument parameters were: TDC start voltage 700, TDC stop voltage 50, TDC threshold 0, TDC gain control 0, TDC edge control 0, Lteff 1117.5, Neff 4600.
  • Source parameters are desolvation gas 862 L/hr, capillary 3000N sample cone 25N, RF lens 200N extraction cone 2N, desolvation temperature 250C, source temperature 150C, RF DC offset 1 4N, FR DC offset 2 IN Aperture 6V, accelaration 200V, focus ION steering ON MCP detector 2700N pusher cycle time (manual) 60, ion energy 40N, tube lens ON, grid 2 74V, TOF flight tube 4620V, and reflectron 1790V.
  • the cytochrome 2D6 gene containing a specific Single Nucleotide Polymorphism (T- deletion) was tested and successfully separated and identified.
  • a partial sequence of the gene su ⁇ ounding the SNP is shown below with the location of the polymorphism italicized and in bold face and the region that functions as a template in an amplification reaction using a pair of internal primers (described below) underlined:
  • Two primer pairs are used for amplifying the region of cytochrome 2D6 gene containing the SNP.
  • the external primers are designed to amplify only cytochrome 2D6 gene, not its pseudogenes.
  • the internal primers are designed to have a partial Bsl I recognition sequence and to amplify a small region of cytochrome 2D6 gene containing the SNP.
  • the sequences of these two primer pairs as well as that of the final amplification product are shown below with the bases that will form the restriction sites highlighted in bold face. Some or all the bases in the restriction sites may be mismatched with the template sequence.
  • the final amplification product is then digested by Bsl I and denatured.
  • One of the digestion product has the sequence tgggcctggatgctaagtcgctggcccagtg (SEQ ID NO. 27).
  • the mass of this sequence, including a 3* OH and 5' PO4 is 9993.2 amu.
  • the UV chromatogram is shown.
  • the top panel shows the genotyping fragment with an M/Z value of 1246 (8 charges) representing the wild type allele.
  • the TOF was calibrated to a +2 amu the day of the measurement giving the ionized fragment a mass of 1248. Since the MS is run in negative mode, an M/Z value of 1248 is observed for a mass of 1249. The extracted mass of the fragment is 9993 daltons.
  • the second panel is the positive control of 1232 for (8 charges) to calibrate the M/Z measurements.
  • the third panel is the UV trace and the bottom panel shows the total ion cu ⁇ ent.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)

Abstract

La présente invention concerne un procédé permettant de déterminer l'identité d'un nucléotide d'intérêt dans une molécule d'acide nucléique cible par la combinaison de la cible avec deux amorces, où la première amorce opère une hybridation à un emplacement 3' du nucléotide d'intérêt et s'étend à partir de celui-ci dans la cible, afin d'incorporer le complément du nucléotide d'intérêt dans un premier produit d'extension. La deuxième amorce opère ensuite une hybridation à un emplacement 3' du complément du nucléotide d'intérêt et s'étend en fonction du premier produit d'extension, afin d'incorporer le nucléotide d'intérêt dans un deuxième produit d'extension. Ensuite, la première amorce opère une hybridation à un emplacement 3' du nucléotide d'intérêt dans le deuxième produit d'extension et s'étend à partir de celui-ci, afin de constituer, en combinaison avec le deuxième produit d'extension, un fragment d'acide nucléique. Les première et deuxième amorces sont destinées à incorporer une portion de la séquence de reconnaissance d'une endonucléase de restriction qui reconnaît une séquence de base interrompu partiellement variable, c'est à dire, une séquence de formule A-B-C dans laquelle A et C sont un nombre et une séquence de bases essentielles à la reconnaissance RE, et B est un nombre de bases essentielles à la reconnaissance RE. La première amorce incorpore la séquence A, la deuxième amorce incorpore la séquence C, et elles sont destinées, par rapport à la cible, de produire un fragment d'acide nucléique où les séquences A et C sont séparées par les bases B, où le nucléotide d'intérêt se trouve au sein de la région B. L'action de la reconnaissance sur le fragment d'acide nucléique fournit un petit fragment d'acide nucléique qui peut faire l'objet d'une caractérisation, permettant ainsi de révéler l'identité du nucléotide d'intérêt.
PCT/US2001/030742 2000-10-02 2001-10-01 Procede d'identification de nucleotides a des positions determines dans des acides nucleiques cibles WO2002046447A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US10/398,004 US20040058349A1 (en) 2001-10-01 2001-10-01 Methods for identifying nucleotides at defined positions in target nucleic acids
AU4146002A AU4146002A (en) 2000-10-02 2001-12-05 Methods for identifying nucleotides at defined positions in target nucleic acids

Applications Claiming Priority (22)

Application Number Priority Date Filing Date Title
US23740900P 2000-10-02 2000-10-02
US60/237,409 2000-10-02
US24716600P 2000-11-10 2000-11-10
US24716700P 2000-11-10 2000-11-10
US24717200P 2000-11-10 2000-11-10
US24717300P 2000-11-10 2000-11-10
US24727500P 2000-11-10 2000-11-10
US60/247,173 2000-11-10
US60/247,166 2000-11-10
US60/247,167 2000-11-10
US60/247,275 2000-11-10
US60/247,172 2000-11-10
US26397101P 2001-01-24 2001-01-24
US60/263,971 2001-01-24
US26924401P 2001-02-15 2001-02-15
US60/269,244 2001-02-15
US30031901P 2001-06-21 2001-06-21
US30035001P 2001-06-21 2001-06-21
US60/300,319 2001-06-21
US60/300,350 2001-06-21
US30139401P 2001-06-27 2001-06-27
US60/301,394 2001-06-27

Publications (2)

Publication Number Publication Date
WO2002046447A2 true WO2002046447A2 (fr) 2002-06-13
WO2002046447A3 WO2002046447A3 (fr) 2003-12-24

Family

ID=27582742

Family Applications (4)

Application Number Title Priority Date Filing Date
PCT/US2001/030743 WO2002040126A2 (fr) 2000-10-02 2001-10-01 Procedes d'identification de nucleotides dans des positions definies dans des acides nucleiques cibles au moyen de la polarisation de fluorescence
PCT/US2001/030742 WO2002046447A2 (fr) 2000-10-02 2001-10-01 Procede d'identification de nucleotides a des positions determines dans des acides nucleiques cibles
PCT/US2001/030828 WO2002028501A1 (fr) 2000-10-02 2001-10-01 Genotypage par chromatographie en phase liquide de fragments d'acides nucleiques courts
PCT/US2001/042432 WO2002029006A2 (fr) 2000-10-02 2001-10-01 Procédé pour le mesurage parallèle des variations génétiques

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2001/030743 WO2002040126A2 (fr) 2000-10-02 2001-10-01 Procedes d'identification de nucleotides dans des positions definies dans des acides nucleiques cibles au moyen de la polarisation de fluorescence

Family Applications After (2)

Application Number Title Priority Date Filing Date
PCT/US2001/030828 WO2002028501A1 (fr) 2000-10-02 2001-10-01 Genotypage par chromatographie en phase liquide de fragments d'acides nucleiques courts
PCT/US2001/042432 WO2002029006A2 (fr) 2000-10-02 2001-10-01 Procédé pour le mesurage parallèle des variations génétiques

Country Status (2)

Country Link
AU (4) AU3922802A (fr)
WO (4) WO2002040126A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003008642A2 (fr) * 2001-07-15 2003-01-30 Keck Graduate Institute Amplification de fragments d'acide nucleique au moyen d'agents de coupure

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7560254B2 (en) 2001-08-29 2009-07-14 Ge Healthcare Bio-Sciences Corp. Allele specific primer extension
US7033762B2 (en) 2001-08-29 2006-04-25 Amersham Biosciences Corp Single nucleotide amplification and detection by polymerase
US7256019B2 (en) 2001-08-29 2007-08-14 Ge Healthcare Bio-Sciences Corp. Terminal phosphate blocked nucleoside polyphosphates
AU2002324827B2 (en) 2001-08-29 2007-11-29 Global Life Sciences Solutions Usa Llc Labeled nucleoside polyphosphates
US7052839B2 (en) * 2001-08-29 2006-05-30 Amersham Biosciences Corp Terminal-phosphate-labeled nucleotides and methods of use
US7223541B2 (en) 2001-08-29 2007-05-29 Ge Healthcare Bio-Sciences Corp. Terminal-phosphate-labeled nucleotides and methods of use
GB0228614D0 (en) * 2002-12-07 2003-01-15 Fu Guoliang Oligonucleotide guided analysis of gene expression
WO2004083432A1 (fr) 2003-03-21 2004-09-30 Academisch Ziekenhuis Leiden Modulation de la reconnaissance d'exons dans le pre-arnm par interference avec la structure d'arn secondaire
EP2614827B1 (fr) 2007-10-26 2017-06-28 Academisch Ziekenhuis Leiden Moyens et procédé de compensation des troubles musculaires
USRE48468E1 (en) 2007-10-26 2021-03-16 Biomarin Technologies B.V. Means and methods for counteracting muscle disorders
EP2119783A1 (fr) 2008-05-14 2009-11-18 Prosensa Technologies B.V. Procédé pour l'omission efficace de l'exon (44) dans la dystrophie musculaire de Duchenne et moyens connexes
EP2421971B1 (fr) 2009-04-24 2016-07-06 BioMarin Technologies B.V. Oligonucléotides comportant une inosine pour le traitement de dmd
EP4043039A1 (fr) 2012-01-27 2022-08-17 BioMarin Technologies B.V. Oligonucléotides de modulation arn ayant des caractéristiques améliorées pour le traitement de la dystrophie musculaire de duchenne et becker

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6040166A (en) * 1985-03-28 2000-03-21 Roche Molecular Systems, Inc. Kits for amplifying and detecting nucleic acid sequences, including a probe
WO1993017126A1 (fr) * 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Nouvelles configurations d'oligonucleotides et utilisation de ces configurations pour le tri, l'isolement, le sequençage et la manipulation des acides nucleiques
JPH09503641A (ja) * 1992-05-22 1997-04-15 アメリカ合衆国 人体の多剤耐性遺伝子の発現およびそれら遺伝子によって形質導入された細胞の選択
US5284758A (en) * 1992-08-14 1994-02-08 Merck & Co., Inc. Process for forming cholesterol lowering compound using pseudodiplodia sp.
JPH078289A (ja) * 1993-06-29 1995-01-13 Osaka Gas Co Ltd リボソームを用いたペプチドおよびタンパク質の合成法
US6110709A (en) * 1994-03-18 2000-08-29 The General Hospital Corporation Cleaved amplified modified polymorphic sequence detection methods
US6027898A (en) * 1997-08-18 2000-02-22 Transgenomic, Inc. Chromatographic method for mutation detection using mutation site specifically acting enzymes and chemicals
US6180408B1 (en) * 1998-08-21 2001-01-30 Washington University Fluorescence polarization in nucleic acid analysis

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HATCHER ET AL.: 'Prenatal diagnosis by enzymatic amplification and restriction endonuclease digestion for detection of haemoglobin A, S and C' MOLECULAR AND CELLULAR PROBES vol. 6, 1992, pages 343 - 348, XP002971461 *
NAKAHORI ET AL.: 'Detection of hepatitis B virus precore stop codon mutants by selective amplification method: Frequent detection of precore mutants in hepatitis B antigen positive healthy carriers' JOURNAL OF GASTROENTEROLOGY AND HEPATOLOGY vol. 10, 1995, pages 419 - 425, XP002971462 *
SAILS ET AL.: 'A reverse transcriptase polymerase chain reaction assay for the detection of thermophilic campylobacter Spp' MOLECULAR AND CELLULAE PROBES vol. 12, 1998, pages 317 - 322, XP004450135 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003008642A2 (fr) * 2001-07-15 2003-01-30 Keck Graduate Institute Amplification de fragments d'acide nucleique au moyen d'agents de coupure
WO2003008642A3 (fr) * 2001-07-15 2003-07-31 Keck Graduate Inst Amplification de fragments d'acide nucleique au moyen d'agents de coupure

Also Published As

Publication number Publication date
AU2002239228A8 (en) 2006-11-02
AU3922802A (en) 2002-05-27
AU4146002A (en) 2002-06-18
WO2002029006A3 (fr) 2002-08-29
WO2002046447A3 (fr) 2003-12-24
WO2002040126A2 (fr) 2002-05-23
AU1183902A (en) 2002-04-15
AU2001296491A1 (en) 2002-04-15
WO2002040126A3 (fr) 2006-04-06
WO2002028501A1 (fr) 2002-04-11
WO2002029006A2 (fr) 2002-04-11

Similar Documents

Publication Publication Date Title
Pusch et al. MALDI-TOF mass spectrometry-based SNP genotyping
WO2003080645A2 (fr) Amplification de fragments d'acides nucleiques au moyen d'agents de coupure simple brin
US5869242A (en) Mass spectrometry to assess DNA sequence polymorphisms
Griffin et al. Direct genetic analysis by matrix-assisted laser desorption/ionization mass spectrometry
US6361940B1 (en) Compositions and methods for enhancing hybridization and priming specificity
Tost et al. Genotyping single nucleotide polymorphisms by mass spectrometry
US6235476B1 (en) Process for detecting nucleic acids by mass determination
EP1297181B1 (fr) Generation d'echantillons pour genotypage par spectrometrie de masse
JP5382802B2 (ja) 質量分析法を用いた生体分子の検出および定量
US20110160093A1 (en) Detection and quantification of biomolecules using mass spectrometry
Fei et al. Analysis of single nucleotide polymorphisms by primer extension and matrix‐assisted laser desorption/ionization time‐of‐flight mass spectrometry
US20040058349A1 (en) Methods for identifying nucleotides at defined positions in target nucleic acids
Oefner et al. A decade of high-resolution liquid chromatography of nucleic acids on styrene–divinylbenzene copolymers
US20040019005A1 (en) Methods for parallel measurement of genetic variations
WO2002046447A2 (fr) Procede d'identification de nucleotides a des positions determines dans des acides nucleiques cibles
Guo Mass spectrometry in DNA analysis
WO2002034883A2 (fr) Dosage biologique a un puits destine a la detection a debit eleve de polymorphismes de nucleotides individuels
WO2005100594A1 (fr) Procede permettant la detection selective de sous-groupes d'acide nucleique
US6312904B1 (en) Characterizing nucleic acid
EP1303638B1 (fr) Methode d'haplotypage par spectrometrie de masse
WO2004067764A2 (fr) Sequençage d'acide nucleique a l'aide d'agents de coupure de brin
Oberacher et al. Liquid chromatography–electrospray ionization mass spectrometry for simultaneous detection of mtDNA length and nucleotide polymorphisms
WO2003002752A2 (fr) Methodes d'utilisation de bibliotheques de translation de coupure pour analyse du polymorphisme de nucleotide simple
US20090258354A1 (en) Methods for DNA Length and Sequence Determination
ZA200401157B (en) Amplification of nucleic acid fragments using nicking agents.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 10398004

Country of ref document: US

122 Ep: pct application non-entry in european phase
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
NENP Non-entry into the national phase in:

Ref country code: JP