WO2002032953A2 - Pregnancy-associated plasma protein-a2 (papp-a2) - Google Patents
Pregnancy-associated plasma protein-a2 (papp-a2) Download PDFInfo
- Publication number
- WO2002032953A2 WO2002032953A2 PCT/DK2001/000695 DK0100695W WO0232953A2 WO 2002032953 A2 WO2002032953 A2 WO 2002032953A2 DK 0100695 W DK0100695 W DK 0100695W WO 0232953 A2 WO0232953 A2 WO 0232953A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- papp
- polypeptide
- polynucleotide
- amino acid
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6489—Metalloendopeptidases (3.4.24)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
- A61P19/10—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4715—Pregnancy proteins, e.g. placenta proteins, alpha-feto-protein, pregnancy specific beta glycoprotein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
- C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
- C07K2319/41—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation containing a Myc-tag
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
- G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
- G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
- G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
- G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
- G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
- G01N2333/96486—Metalloendopeptidases (3.4.24)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/02—Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
Definitions
- the present invention relates to a novel polypeptide with homology to pregnancy- associated plasma protein-A (PAPP-A).
- PAPP-A pregnancy-associated plasma protein-A
- the novel polypeptide according to the invention is denoted PAPP-A2.
- the invention further relates to novel polynucleotides comprising a nucleic acid sequence encoding such a polypeptide, or a fragment thereof.
- the invention further relates to methods for using the novel polynucleotides, including fragments thereof as defined herein below, and methods for using the novel polypeptides capable of being produced from such polynucleotides.
- the invention also relates to expression and purification of recombinant PAPP-A2, and to production of polyclonal and monoclonal antibodies against PAPP-A2, and to the purification of native PAPP-A2 from human tissues or body fluids.
- the invention relates to uses of PAPP-A2 as a marker for patho- logical states, and as a therapeutic target for drugs that modify the proteolytic activity of PAPP-A2 in pregnant as well as non-pregnant individuals.
- PAPP-A Pregnancy-associated plasma protein-A
- PAPP-A was first isolated in 1974 from pregnancy serum along with other proteins believed to be of placental origin (Lin et al., 1974, Am J Obstet Gvnecol 118, 223- 36). The concentration in serum reaches about 50 mg/liter at the end of pregnancy
- PAPP-A was originally characterized as a high molecular weight homotetramer (Bischof, 1979, Arch Gvnecol 227, 315-26; Lin et al., 1974, Am J Obstet Gvnecol 118, 223-36; Sinosich, 1990, Electrophoresis 11 , 70-8), but it has now been demonstrated that PAPP-A primarily exists in pregnancy serum and plasma as a covalent, heterotetrameric 2:2 complex with the proform of eosinophil major basic protein (proMBP), PAPP-A/proMBP (Oxvig et al., 1993, J Biol Chem 268, 12243-6).
- proMBP eosinophil major basic protein
- the subunits of the PAPP-A/proMBP complex can be irreversibly separated by reduction of disulfide bonds and denaturation (Oxvig et al., 1993, J Biol Chem 268, 12243-6).
- the PAPP-A subunit In reducing SDS-PAGE, the PAPP-A subunit has an apparent molecular weight of 200 kDa (Oxvig et al., 1994, Biochim Biophvs Acta 1201, 415-23), and its 1547-residue sequence is known from cloned cDNA (Kristensen et al., 1994, Bio- chemistry 33, 1592-8).
- PAPP-A is synthesized as a pre-pro-protein (preproPAPP-A), including a 80-residue pre-pro-piece(Haaning et al., 1996, Eur J Biochem 237, 159- 63). No proteins with global homology to PAPP-A has been reported in the literature, but PAPP-A contains sequence motifs, including an elongated zinc binding motif (HEXXHXXGXXH) at position 482-492 (numbering according to Kristensen et al., 1994, Biochemistry 33, 1592-8).
- preproPAPP-A pre-pro-protein
- sequence motifs including an elongated zinc binding motif (HEXXHXXGXXH) at position 482-492 (numbering according to Kristensen et al., 1994, Biochemistry 33, 1592-8).
- proMBP subunit has a calculated peptide mass of 23 kDa (Barker et al., 1988, J Exp Med 168, 1493-8; McGrogan et al., 1988, J Exp Med 168, 2295-308). In SDS- PAGE, however, proMBP migrates as a smear of 50-90 kDa that is not visible in Coomassie-stained gels (Oxvig et al., 1993, J Biol Chem 268, 12243-6), probably due to its strong and unusual glycosylation (Oxvig et al., 1994, Biochem Mol Biol Int
- PAPP-A and proMBP are both produced in the placenta during pregnancy, but mainly in different cell types as shown by in situ hybridization (Bonno et al., 1994, Lab Invest 71 , 560- 6). Analyses by RT-PCR revealed that both PAPP-A and proMBP mRNA are pres- ent in several reproductive and non reproductive tissues, although the levels are lower than in the placenta (Overgaard et al., 1999, Biol Reprod 61 , 1083-9).
- Proteolvtic activity of PAPP-A Cleavage of IGFBP-4
- IGFBP insulin-like growth factor binding protein
- IGF-I and -II are essential polypeptides with potent anabolic and mitogenic actions both in vivo and in vitro.
- IGF bound to IGFBP-4 cannot interact with its receptor, but bioactive IGF is released once the binding protein is cleaved.
- cleavage of IGFBP-4 by PAPP-A strictly requires the presence of IGF (Conover et al., 1993, J Clin Invest 91 , 1129-37; Lawrence et al., 1999, Proc Natl Acad Sci U S A 96, 3149- 53).
- PAPP-A secretion has also been demonstrated from osteoblasts and marrow stromal cells (Lawrence et al., 1999, Proc Natl Acad Sci U S A 96, 3149-53), from granulosa cells (Conover et al., 1999, J Clin Endocrinol Metab 84, 4742-5), and from vascular smooth muscle cells (Bayes-Genis et al., 2000, Arterioscler Thromb Vase
- IGFBP-5 cleavage has been widely reported to occur by unidentified proteinases is a number of tissues and conditioned media (Hwa et al., 1999, Endocr Rev 20, 761-87).
- novel nucleic acid according to the invention has been isolated from human placenta and characterised by means of sequencing analysis.
- the novel nucleotide sequence encodes a new polypeptide, PAPP-A2.
- the amino acid sequence of PAPP-A2 is composed of a 233-residue pre-pro-piece and a 1558-residue mature portion.
- the mature portion of PAPP-A2 is homologous with the mature portion of PAPP-A (approx. 45 % identity), but the prepro-pieces do not show any similarity between the two proteins.
- PAPP-A2 contains conserved amino acid stretches that classify it as a putative metalloproteinase of the metzincin superfamily.
- PAPP-A2 has been expressed in a mammalian expression system, and it has been demonstrated that PAPP-A2 is an active enzyme. Further, it has been shown that
- PAPP-A2 cleaves IGFBP-5, Insulin Like Growth Factor Binding Protein 5. In comparison, the cleavage of IGFBP-4 by PAPP-A has previously been demonstrated.
- a complementary DNA (cDNA) which encodes the full length form of PAPP-A2 is identified, sequenced and isolated.
- the cDNA or portions of the cDNA is cloned into expression vectors for expression in a recombinant host.
- the cDNA is useful to produce recombinant full-length PAPP-A2 or fragments of PAPP-A2.
- the cDNA and the recombinant PAPP-A2 protein derived therefrom are useful in the production of antibodies, diagnostic kits, laboratory reagents and assays.
- the cDNA and the recombinant PAPP-A2 protein may also be used to identify compounds that affect PAPP-A2 function.
- PAPP-A2 antisense oligonucleotides or antisense mimetics may be clinically useful for reducing the expression of PAPP-A2 protein and thereby antagonizing the effects of PAPP-A.
- the PAPP-A2 coding sequence can be used for gene therapy to introduce PAPP-A2 into target cells thereby enhancing the effects of PAPP-A2.
- the invention furthermore pertains to PAPP-A2 for use as a therapeutic target for the reduction or elimination of IGFBP-5 proteolytic activity in a cell.
- PAPP-A2 refers to an isolated PAPP-A2 polypeptide having the amino acid sequence listed in Fig. 1 (SEQ ID NO:2), or a variant thereof as defined herein.
- the PAPP-A2 according to the invention, or a variant thereof, may be produced by recombinant DNA technology, or the PAPP-A2 may be naturally occurring.
- a PAPP-A2 encoding nucleotide sequence refers to an isolated nucleic acid having the sequence listed in Fig. 1 (SEQ ID NO:1), or a variant thereof as defined herein.
- PAPP-A2 refers to those forms of PAPP-A2 which retain the biological and/or immunological activities of any naturally occurring PAPP-A2.
- Naturally occurring PAPP-A2 refers to PAPP-A2 produced by human cells that have not been genetically engineered and specifically contemplates various PAPP- A2s arising from post-translational modifications of the polypeptide including but not limited to acetylation, carboxylation, glycosylation, phosphorylation, lipidation, acylation, or complex formation, covalent or noncovalent, with other polypeptides.
- isolated polypeptide is a protein, or a variant or fragment thereof, which constitutes 90% or more of the protein contents of a given preparation as evaluated by standard methods known in the art of protein chemistry.
- Derivative refers to polypeptides derived from naturally occurring PAPP-A2 by chemical modifications such as ubiquitination, labeling (e.g., with radionuclides, various enzymes, etc.), pegylation (derivatization with polyethylene glycol), or by insertion (or substitution by chemical synthesis) of amino acids (amino acids) such as ornithine, which do not normally occur in human proteins.
- chemical modifications such as ubiquitination, labeling (e.g., with radionuclides, various enzymes, etc.), pegylation (derivatization with polyethylene glycol), or by insertion (or substitution by chemical synthesis) of amino acids (amino acids) such as ornithine, which do not normally occur in human proteins.
- Recombinant variant refers to any polypeptide differing from naturally occurring PAPP-A2 by amino acid insertions, deletions, and substitutions, created using recombinant DNA techniques.
- Guidance in determining which amino acid residues may be replaced, added or deleted without abolishing activities of interest, such as proteolytic activity or cell adhesion, may be found e.g. by comparing parts of the sequence of PAPP-A2 with structurally similar proteins (e.g. other metzincin family proteinases), with locally homologous proteins of known disulfide structure, or by secondary structure predictions.
- amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as, but not limited to, the replacement of a leucine with an isoleucine or valine, replacement of an aspartate with a glutamate, or replacement with a threonine with a serine, i.e., conservative amino acid replacements.
- conservative amino acid replacements Further examples and definitions falling within the meaning of the term "substitutions" as applied herein are provided in the detailed description of the invention herein below.
- Amino acid "insertions” or “deletions” are typically in the range of from about about 1 amino acid to about 50 amino acids, such as from about 1 amino acid to about 20 amino acids, for example from about 1 amino acid to about 20 amino acids, such as from about 1 amino acid to about 10 amino acids.
- the variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a PAPP-A2 molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
- a "signal or leader sequence” can direct the polypeptide (full length PAPP-A2, or portions of the PAPP-A2 polypeptide) through the membrane of a cell.
- a sequence may be naturally present on the polypeptides of the present in- vention or provided from heterologous protein sources by recombinant DNA techniques.
- a polypeptide "fragment”, “portion”, or “segment” is a stretch of amino acid residues of at least about 5 amino acids, often at least about 7 amino acids, typically at least about 9 to 13 amino acids, such as at least about 17 or more amino acids in various embodiments. It may also be a longer stretch of residues up to intact PAPP-A2 in length.
- any PAPP-A2 polypeptide or PAPP-A2 polypeptide fragment must have sufficient length to display biologic and/or immunologic activity on their own, or when conjugated to a carrier protein such as keyhole limpet hemocyanin.
- oligonucleotide or polynucleotide “fragment”, “portion”, or “segment” is a stretch of the PAPP-A2 encoding sequence which is useful in the expression of PAPP-A2 polypeptide fragments. It may also be a stretch of nucleotide residues capable of being used in a polymerase chain reaction (PCR) or a hybridization procedure, typi- cally for amplifying or revealing related parts of mRNA or DNA molecules.
- PCR polymerase chain reaction
- one or both oligonucleotide probes will comprise sequence that is identical or complementary to a portion of PAPP-A2 where there is little or no identity or complementarity with any known or prior art molecule.
- such oligonucleotide probes will generally comprise between about 10 nucleotides and 50 nu- cleotides, and preferably between about 15 nucleotides and about 30 nucleotides.
- Animal as used herein may be defined to include human, domestic or agricultural (cats, dogs, cows, sheep, etc) or test species (mouse, rat, rabbit, etc).
- Recombinant may also refer to a polynucleotide which encodes PAPP-A2 and is prepared using recombinant DNA techniques. The DNAs which encode PAPP-A2 may also include allelic or recombinant variants and mutants thereof.
- Nucleic acid probes comprise portions of the sequence having fewer nucleotides than about 6 kb, usually fewer than about 1 kb. After appropriate testing to eliminate false positives, these probes may be used to determine whether mRNAs encoding PAPP-A2 are present in a cell or tis- sue or to isolate similar nucleic acid sequences from chromosomal DNA extracted from such cells or tissues as described in (Walsh et al., 1992, PCR Methods Appl 1 , 241-50). Probes may be derived from naturally occurring or recombinant single- or double-stranded nucleic acids or be chemically synthesized.
- Probes of the present invention are elaborated in (Sambrook et al., 1989); or (Ausubel et al., 1989).
- recombinant variants encoding these PAPP-A2 or similar polypeptides may be synthesized or selected by making use of the "redundancy" in the genetic code.
- Various codon substitutions such as the silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system. Mutations may also be introduced to modify the properties of the polypeptide, including but not limited to activity, interchain affinities, or polypeptide degradation or turnover rate.
- One example involves inserting a stop codon into the nucleotide sequence to limit the size of PAPP-A2 so as to provide a molecule of smaller molecular weight.
- Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an ap- basementte host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria, yeast, bluegreen algae, plant cells, insect cells and animal cells.
- antibody includes both polyclonal and monoclonal anti- bodies, as well as fragments thereof, such as, Fv, Fab and F(ab)2 fragments that are capable of binding antigen or hapten. It includes conventional murine monoclonal antibodies as well as human antibodies, and humanized forms of non-human antibodies, and it also includes 'antibodies' isolated from phage antibody libraries.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage.
- engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of PAPP-A2 RNA sequences.
- Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences, GUA, GUU and GUC.
- RNA sequences of between fifteen (15) and twenty (20) ribo- nucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable.
- the suitability of candidate targets may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
- the present invention in one aspect relates to a novel cDNA sequence encoding a protein with global homology to pregnancy-associated plasma protein-A (PAPP-A).
- PAPP-A pregnancy-associated plasma protein-A
- PAPP-A2 This protein has been denoted PAPP-A2.
- the complete nucleotide sequence of PAPP-A2 has been obtained from mRNA isolated from human placenta (Example 1).
- the complete nucleotide sequence (SEQ ID NO:1) and translated amino acid sequence (SEQ ID NO:2) of PAPP-A2 are both shown in Figure 1.
- PAPP-A2 Homology of PAPP-A2 with PAPP-A is evident upon alignment of the two amino acid sequences as shown in Figure 3.
- PAPP-A2 and PAPP-A share approximately 45% of their amino acid residues. Sequence motifs known to be important for the function of PAPP-A (Kristensen et al., 1994, Biochemistry 33, 1592-8; Lawrence et al., 1999, Proc Natl Acad Sci U S A 96, 3149-53; Overgaard et al., 2000, J Biol Chem) are also found in PAPP-A2. Principally, PAPP-A2 contains an elongated zinc binding motif (HEXXHXXGXXH, amino acids shown by one letter code) at position 733-743 ( Figure 2).
- PAPP-A2 is synthesized as a prepro-protein.
- PreproPAPP-A2 has 1791 amino acids ( Figure 1). There is no homology between the prepro-portions of PAPP-A and PAPP-A2. Further, the prepro-portions of the two proteins differ signifi- cantly in length.
- the PAPP-A2 prepro-peptide has 233 residues ( Figure 3); the
- PAPP-A prepro-peptide has 80 residues (Haaning et al., 1996, Eur J Biochem 237, 159-63).
- nucleotide sequence encoding PAPP-A2 (or its complement) have numerous applications in techniques known to those skilled in the art of molecular biology. These techniques include use as hybridization probes, use in the construction of oli- gomers for PCR, use in the recombinant production of PAPP-A2 or fragments hereof, and use in generation of anti-sense DNA or RNA, their chemical analogs
- nucleotides encoding PAPP-A2 disclosed herein are exemplary of known techniques and are not intended to limit their use in any technique known to a person of ordinary skill in the art.
- nucleotide sequences disclosed herein may be used in molecular biology techniques that have not yet been developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, e.g., the triplet genetic code, specific base pair interactions, etc.
- nucleotide sequences which encode PAPP-A2 and/or its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring PAPP-A2 under stringent conditions, it may be advantageous to produce nucleotide sequences encoding PAPP-A2 or its derivatives possessing a substantially different codon usage. Codons can be selected to increase the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic expression host in accordance with the frequency with which particular codons are utilized by the host.
- RNA transcripts having more desirable properties such as a greater half-life, than transcripts produced from the naturally occurring sequence.
- Nucleotide sequences encoding PAPP-A2 may be joined to a variety of other nucleotide sequences by means of well established recombinant DNA techniques (Sambrook et al., 1989).
- Useful nucleotide sequences for joining to PAPP-A2 include an assortment of cloning vectors, e.g., plasmids, cosmids, lambda phage de- rivatives, phagemids, and the like, that are well known in the art.
- Vectors of interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and the like. In general, vectors of interest may contain an origin of replication functional in at least one organism, convenient restriction endonuclease sensitive sites, and selectable markers for the host cell.
- Another aspect of the subject invention is to provide for PAPP-A2-specific nucleic acid hybridization probes capable of hybridizing with naturally occurring nucleotide sequences encoding PAPP-A2. Such probes may also be used for the detection of similar PAPP-A2 encoding sequences and should preferably contain at least 50% of the nucleotides from the conserved region or active site.
- the hybridization probes of the subject invention may be derived from the nucleotide sequences of the SEQ ID NO:1 or from genomic sequences including promoters, enhancer elements and/or possible introns of the respective naturally occurring PAPP-A2.
- Hybridization probes may be labeled by a variety of reporter groups, including radionuclides such as 32P or 35S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
- reporter groups including radionuclides such as 32P or 35S, or enzymatic labels such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
- PCR as described provides additional uses for oligonucleotides based upon the nucleotide sequence which encodes
- Such probes used in PCR may be of recombinant origin, may be chemically synthesized, or a mixture of both and comprise a discrete nucleotide sequence for diagnostic use or a degenerate pool of possible sequences for identification of closely related genomic sequences.
- RNA polymerase as T7 or SP6 RNA polymerase and the appropriate radioactively labeled nucleotides.
- the nucleotide sequence can be used in an assay to detect disease associated with abnormal levels of expression of PAPP-A2.
- the nucleotide sequence can be labeled by methods known in the art and added to a fluid or tissue sample from a patient under hybridizing conditions. After an incubation period, the sample is washed with a compatible fluid which optionally contains a dye (or other label requiring a devel- oper) if the nucleotide has been labeled with an enzyme. After the compatible fluid is rinsed off, the dye is quantitated and compared with a standard.
- levels of PAPP-A2 mRNA can be measured by micro array techniques using immobilized probes.
- Expression in samples can also be evaluated by (semi-quantitative) RT- PCR.
- Expression in samples can alternatively be evaluated by techniques based on hybridization. For example, in situ hybridization can be used to detect PAPP-A2 mRNA. This technique has the advantage that it locates the cells that synthesize the mRNA, but also is less sensitive than RT-PCR.
- oligoribonucleotide sequences that in- elude antisense RNA and DNA molecules and ribozymes that function to inhibit translation of PAPP-A2.
- Antisense techniques are known in the art and may be applied herein. Both antisense RNA and DNA molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonu- cleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule.
- DNA sequences may be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase pro- maters.
- RNA polymerase promoters such as the T7 or SP6 polymerase pro- maters.
- antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
- the invention also relates to unknown PAPP-A2 genes isolated from other species and alleles of the PAPP-A2 gene, in which PAPP-A2 orthologues or homologues exists.
- a bacteriophage cDNA library may be screened, under conditions of reduced stringency, using a radioactively labeled fragment of the human PAPP-A2 clone described herein.
- the human PAPP-A2 sequence can be used to design degenerate or fully degenerate oligonucleotide probes which can be used as PCR probes or to screen bacteriophage cDNA libraries.
- the PCR product may be sub- cloned and sequenced to insure that the amplified sequences represent the PAPP- A2 sequences.
- the PCR fragment may be used to isolate a full length PAPP-A2 clone by radioactively labeling the amplified fragment and screening a bacteriophage cDNA library.
- the labeled fragment may be used to screen a genomic library.
- the nucleotide sequence coding for the protein, or a functional equivalent can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- an appropriate expression vector i.e., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
- recombinant protein can be used for immunization to obtain antibodies, as a laboratory reagent, and in diagnostic kits.
- expression vectors containing fragments of the PAPP-A2 encoding sequence may also be constructed. In particular, this may be relevant for the use of portions of the PAPP-A2 polypeptide as an antigen for immunization.
- the coding sequence of PAPP-A2 or fragments hereof may be cloned in frame with a coding nucleotide sequence present in the vector to result in a fusion protein or a 'tagged' PAPP-A2 protein.
- a fusion protein may be composed of
- PAPP-A2 and GST and such tag may be a c-myc tag (for detection) and/or a histidine tag(for purification).
- a variety of host-expression vector systems may be utilized to express the PAPP-A2 coding sequence or fragments hereof. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing the PAPP-A2 coding sequence; yeast transformed with recombinant yeast expression vectors containing the PAPP-A2 coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the PAPP-A2 coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing the PAPP-A2 coding sequence; or animal cell systems infected with recombinant virus expression vectors (e.g., adenovi s, vaccini
- any of a number of suitable transcription and translation elements may be used in the expression vector.
- inducible promoters such as pL of bacteriophage lambda, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used; when cloning in insect cell systems, pro- moters such as the baculovirus polyhedron promoter may be used; when cloning in plant cell systems, promoters derived from the genome of plant cells (e.g., heat shock prompters; the promoter for the small subunit of RUBISCO; the promoter for the chlorophyll a/b binding protein) or from plant viruses (e.g., the 35S RNA promoter of CaMV; the coat protein promoter of TMV) may be used; when cloning in ma
- the expression vector may be introduced into host cells via any one of a number of techinques including but not limited to transformation, transfection, infection, protoplast fusion, and electroporation.
- the expression vector-containing cells are clonally propagated and individually analyzed to determine whether they produce PAPP-A2 protein. Identification of PAPP-A2 expressing host cell clones may be done by several means, including but not limited to immunological reactivity with anti-PAPP-A2 antibodies, and the presence of host cell-associated PAPP-A2 activity.
- a number of expression vectors may be advantageously se- lected depending upon the use intended for the PAPP-A2 expressed.
- vectors which direct the expression of high levels of fusion protein products that are readily purified may be de- sirable.
- Such vectors include but are not limited to the E. coli expression vector pUR278 (Ruther and Muller-Hill, 1983, Embo J 2, 1791-4), in which the PAPP-A2 coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid AS-lac Z protein is produced.
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety.
- yeast a number of vectors containing constitutive or inducible promoters may be used. For a review, see (Ausubel et al., 1989; Bitter et al., 1987, Methods Enzvmol 153, 516-44; Rosenfeld, 1999, Methods Enzvmol 306, 154-69).
- the expression of the PAPP-A2 coding sequence may be driven by any of a number of promoters.
- viral promoters such as the 35S RNA and 19S RNA promoters of CaMV may be used (Gmunder and Kohli, 1989, Mol Gen Genet 220, 95-101 ); alternatively, plant promoters such as the small subunit of RUBISCO (Broglie et al., 1984, Science 224, 838-43).
- An alternative expression system which could be used to express PAPP-A2 is an in- sect system.
- Baculovirus is used as a vector to express foreign genes. The virus then grows in the insect cells.
- the PAPP-A2 coding sequence may be cloned into non-essential regions (for example the polyhedron gene) of the virus and placed under control of a Baculovirus promoter. These recombinant viruses are then used to infect insect cells in which the inserted gene is expressed. For exam- pie, see (Smith et al., 1983, Mol Cell Biol 3, 2156-65).
- mammalian expression vectors may be used to express recombinant PAPP-A2 in mammalian cells.
- Commercially-available mammalian expression vectors which may be suitable for recombinant PAPP-A2 expression, include but are not limited to, pMCI neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO- pSV2-neo (ATCC 37593), pBPV-1 (8-2) (ATCC 37110), pcDNA3.1 and its derivatives (Stratagene).
- Cell lines derived from mammalian species which may be suitable and which are commercially available, include but are not limited to, CV-1 , COS-1, COS-7, CHO-K1, 3T3, NIH3T3, HeLa, C127I, BS-C-1, MRC-5, and 293. Further, in mammalian host cells, a number of viral based expression systems may be utilized. In cases where an adenovims is used as an expression vector, the PAPP-A2 coding sequence may be ligated to an adenovims transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
- an adenovims transcription/translation control complex e.g., the late promoter and tripartite leader sequence.
- This chimeric gene may then be inserted in the adenovims genome by in vitro or in vivo recombi- nation. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing PAPP-A2 in infected hosts. See for example (Logan and Shenk, 1984, Proc Natl Acad Sci U S A 81 , 3655-9). Alternatively, the vaccinia 7.5K promoter may be used. See for example (Mackett et al., 1982, Proc Natl Acad Sci U S A 79, 7415-9).
- cell lines which stably express PAPP-A2 may be engineered.
- host cells can be transformed with PAPP-A2 DNA controlled by appropriate ex- pression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- ex-pression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
- Some applications of the recombinant PAPP-A2 may require the protein to be in purified or partially purified form.
- Recombinantly expressed PAPP-A2 or fragments of the PAPP-A2 polypeptide can be isolated by liquid chromatography.
- Various methods of protein purification well known in the art include those described in for example (Scopes, 1987).
- recombinant PAPP-A2 fusion proteins or 'tagged' PAPP-A2 may be purified by affinity chromatography.
- antibodies raised against PAPP-A2 may be used for purification by immunoaffinity chromatography.
- Recombinant variant of PAPP-A2 may be produced by site directed mutagenesis. In some applications of PAPP-A2 such variants may be preferred due to for example increased protein stability, or changes in activity. Production and uses of antibodies against PAPP-A2
- the recombinant protein may be used to generate antibodies.
- Monospecific antibodies to PAPP-A2 can be purified from mammalian antisera containing antibodies reactive against PAPP-A2 or can be prepared as monoclonal antibodies reactive with PAPP-A2 using standard techniques.
- Monospecific antibody as used herein is defined as a single antibody species or multiple antibody species with homogenous binding characteristics for PAPP-A2.
- Homogenous binding refers to the ability of the antibody species to bind to a specific antigen or epitope, such as those associated with the PAPP-A2, as described above.
- PAPP-A2 specific antibodies are raised by immunizing animals such as mice, rats, guinea pigs, rabbits, goats, horses and the like, with rabbits or mice being preferred, with an appropriate concentration of PAPP-A2 either with or without an immune adjuvant.
- antibodies specific against PAPP-A2 can be used for the purification of native and recombinant PAPP-A2, as a laboratory reagent, and in antibody based diagnostic kits.
- Monoclonal antibodies (mAb) reactive with PAPP-A2 can be prepared by conven- tional methods, such as by immunizing inbred mice with PAPP-A2.
- the mice are immunized with about 0.1 mg to about 10 mg, preferably about 1 mg, of PAPP-A2 in about 0.5 ml buffer or saline incorporated in an equal volume of an acceptable adjuvant. Freund's complete adjuvant is preferred.
- the mice receive an initial immuniza- tion on day 0 and are rested for about 3 to about 30 weeks.
- Immunized mice are given one or more booster immunizations of about 0.1 to about 10 mg of PAPP-A2 in a buffer solution such as phosphate buffered saline (PBS) by the intravenous (IV) route.
- Lymphocytes from antibody-positive mice are obtained by removing spleens from immunized mice by standard procedures known in the art.
- Hybridoma cells are produced by mixing the splenic lymphocytes with an appropriate fusion partner un- der conditions which will allow the formation of stable hybridomas.
- Fused hybridoma cells are selected by growth in hypoxanthine, thymidine and aminopterin supplemented Dulbecco's Modified Eagles Medium (DMEM) by procedures known in the art.
- DMEM Dulbecco's Modified Eagles Medium
- Supernatant fluids are collected form growth positive wells on about days 14, 18, and 21 and are screened for antibody produciton by an immunoassay such as solid phase immunoradioassay (SPIRA) using PAPP-A2 as the antigen.
- SPIRA solid phase immunoradioassay
- the culture fluids are also tested in the Ouchteriony precipitation assay to determine the isotype of the mAb.
- Hybridoma cells from antibody positive wells are then cloned. For details, see (Peters and Baumgarten, 1992).
- DMEM fetal calf serum
- the mAb are purified by techniques known in the art.
- Antibody titers of ascites or hybridoma culture fluids are determined by various se- rological or immunological assays which include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent antibody (ELISA) technique (Crowther, 1995).
- ELISA enzyme-linked immunosorbent antibody
- the "monoclonal antibodies” may also be isolated from phage antibody libraries us- ing the techniques described in (Clackson et al., 1991 , Nature 352, 624-8; Marks et al., 1991 , J Mol Biol 222, 581-97), for example. Identified phage antibodies can be produced by expression in bacteria.
- Methods such as those described above may be used to produce monospecific an- tibodies specific for PAPP-A2 polypeptide fragments or full-length nascent PAPP-A2 polypeptide.
- PAPP-A2 antibody affinity columns can be made by adding the antibodies to a gel support, such as Affigel-10 (Biorad), a gel support which is pre-activated with N- hydroxysuccinimide esters such that the antibodies form covalent linkages with the agarose gel bead support.
- the antibodies are then coupled to the gel via amide bonds with the spacer arm.
- the remaining activated esters are then quenched with 1 M ethanolamine HCl (pH 8).
- the column is washed with water followed by 0.23 M glycine HCl (pH 2.6) to remove any non-conjugated antibody or extraneous protein.
- the column is then equilibrated in phosphate buffered saline (pH 7.3) and the cell culture supernatants or cell extracts containing PAPP-A2 or PAPP-A2 fragments are slowly passed through the column.
- the column is then washed, and the protein is eluted.
- the purified PAPP-A2 protein is then dialyzed against phosphate buffered saline.
- Native PAPP-A2 from sources such as human plasma or serum, tissue extracts, or media from nontransfected cell lines (that endogenously secrete PAPP-A2) may also be purified by use of an antibody affinity column.
- kits based on antibodies may be used for diagnostic purposes.
- the assays include, but are not limited to, precipitation, passive agglutination, enzyme-linked immunosorbent assay (ELISA) techniques, and radioimmunoassay (RIA) techniques.
- a sandwich assay can be constructed where antigen present in an sample is caught by immobilized polyclonal anti(PAPP-A2). Detection is then performed by the use of one or more monoclonal PAPP-A2 antibod- ies and peroxidase conjugated anti(murine IgG).
- antigen present in an sample is caught by immobilized polyclonal anti(PAPP-A2), and detected using biotinylated polyclonal anti(PAPP-A2).
- Assays can be calibrated using purified PAPP-A2 to construct a standard curve by serial dilution. The concentration of PAPP-A2 in solution in a puri- fied form can be accurately measured by amino acid analysis (Sottrup-Jensen, 1993, Biochem Mol Biol Int 30, 789-94).
- Polyclonal antibodies may be used to inhibit the biological activity of PAPP-A2. Specifically, in analogy with the inhibition of the IGFBP-4 proteolytic activity of PAPP-A by polyclonal PAPP-A antibodies (Lawrence et al., 1999, Proc Natl Acad Sci U S A
- anti(PAPP-A2) may be used to inhibit the proteolytic activity of PAPP- A2.
- Certain monoclonal antibodies may also be inhibitory towards the activity of PAPP-A2. Such monoclonal antibodies are likely to recognize an epitope in close proximity to the active site of PAPP-A2, but the inhibitory activity may also be based on binding to epitopes other than those close to the active site.
- Inhibitory monoclonal antibodies can be obtained by immunization with PAPP-A2, PAPP-A2 fragments, with peptides derived from PAPP-A2.
- Inhibitory (monoclonal) antibodies may have therapeutic value in conditions of pa- thologies in which it may be desirable to decrease the activity of PAPP-A2.
- PAPP-A2 contains conserved amino acid stretches that classify it as a putative metalloproteinase of the metzincin superfamily (Stocker et al., 1995, Protein Sci 4, 823-40). It has been experimentally verified that PAPP-A2 does exhibit pro- teolytic activity by demonstrating its cleavage of insulin-like growth factor binding protein (IGFBP)-5 (Example 6.7).
- IGFBP insulin-like growth factor binding protein
- proteolytic activity of PAPP-A2 against potential protein substrates may be evaluated by the incubation of purified or partially purified PAPP-A2 with the po- tential substrate under a variety of experimental conditions (such as for example temperature, buffer composition, ionic strength, and pH). Enzymatic activity of PAPP-A2 against the protein in question can be evaluated by SDS-PAGE (in which degradation or release of well defined proteolytic fragment(s) will be evident), or by high-pressure liquid chromatographic detection of released peptide(s). By means of such procedures, other substrate targets of PAPP-A2 may be identified. Incubation with a variant of PAPP-A2 where, for example, a residue in the active site has been substituted to obtain an inactive enzyme, serves as a proper negative control.
- Random peptide libraries consisting of all possible combinations of amino acids at- tached to a solid phase support may be used to identify peptides that can be cleaved by PAPP-A2. Identification of such peptides may be accomplished by screening a peptide library with recombinant soluble PAPP-A2. Methods for expression and purification of the enzyme are described above and may be used to express recombinant full length PAPP-A2 or fragments, analogs, or derivatives thereof depending on the functional domains of interest. For further details, see (Meldal,
- peptide substrates may be derived from identified protein substrates of PAPP-A2.
- phage display of peptide libraries may be used to identify peptides that can be cleaved by PAPP-A2 (Matthews and Wells, 1993, Science 260, 1113-7).
- Peptides that function as PAPP-A2 substrates may function in assays for the detec- tion of PAPP-A2 proteolytic activity in body fluids or tissue and cell extracts.
- Substrate peptides may be derivatized to function in an assay based on quenched- fluorescence (Meldal, 1998, Methods Mol Biol 87, 65-74). Kits based on such, or other, techniques may be used for diagnostic purposes in pathologies where measurement of PAPP-A2 activity is relevant.
- An assay for the detection of PAPP-A2 proteolytic activity provides a method for the identification of molecules that modify the activity of PAPP- A2.
- Such molecules may be, for example, peptides, derivatized peptides, hydrox- amic acid derivatized peptides, small organic molecules, or antibodies.
- the screening of peptide libraries can be used to discover pharmaceutical agents that act to modulate and/or inhibit the biological activity of PAPP-A2.
- Methods for expression and purification of the enzyme are described above and may be used to express recombinant full length PAPP-A2 or fragments, analogs, or derivatives thereof depending on the functional domains of interest.
- Random peptide libraries consisting of all possible combinations of amino acids attached to a solid phase support may be used to identify peptides that are able to modulate and/or inhibit PAPP-A2 activity by binding to the active site or other sites of PAPP-A2. For example, see (Meldal, 1998, Methods Mol Biol 87, 75-82).
- combinatorial chemistry may be used to identify low molecular weight organic molecules that affect the activity of PAPP-A2.
- PAPP-A primarily exists in pregnancy serum as a disulfide bound 2:2 complex with the proform of eosinophil major basic protein (proMBP), PAPP-A proMBP.
- proMBP exists in the circulation as a disulfide bound 2:2 complex with angiotensin (ANG), proMBP/ANG, and a fraction of this complex is further complexed to a fragment of complement component C3dg (PROMBP/ANG/C3dg) (Oxvig, 1995; Christiansen, 2000).
- the level of complexes comprising PAPP-A and/or PAPP-A2 and/or proMBP in body fluids of an individual may be indicative of predisposition to a clinical condition or indicative of the presense of a clinical condition. Accordingly, the present invention in one embodiment is directed towards a method of diagnosing a clinical condition or diagnosing predisposition to said clinical condition in an individual comprising the steps of
- the levels of complexes comprising PAPP-A and/or PAPP-A2 and/or proMBP in body fluids of a mammalian mother may be indicative of predisposition to a clinical condition or indicative of the presense of a clinical condition in a fetus of said mother.
- the present invention provides methods of diagnosing a clinical condition or diagnosing predisposition to said clinical condition in a mammalian fetus comprising the steps of
- PAPP-A/proMBP PAPP-A2/proMBP
- PAPP-A/PAPP-A2 PAPP-A/PAPP- A2/proMBP
- proMBP/ANG proMBP/ANG/C3dg in said body fluid sample
- the level of one or more of the follow- ing complexes may be determined:
- PAPP-A2 and proMBP PAPP-A2/proMBP
- PAPP-A2 and PAPP-A PAPP-A2 and PAPP-A
- PAPP-A/PAPP-A2 with proMBP PAPP-A/PAPP-A/proMBP
- the level of complexes comprising PAPP-A and/or PAPP-A2 and/or proMBP in a body fluid sample may be determined by any conventional method known to the person skilled in the art.
- the level can be measured by a method comprising the use of immunospecific reagents specifically interacting with one or more components of the complex desirable to measure, such as immunospecific reagents specifically interacting with PAPP-A, PAPP-A2, proMBP, ANG or C3gd.
- Immunospecific reagents may for example bemonoclonal antibodies, polyclonal antibodies and/or antigen binding fragments thereof, specific towards the individual components of the complex.
- Such methods include but are not limited to sandwich ELISA, wherein an immunospecific reagent specifically recognising one component of the complex is employed as catching antibody and another immunospecific reagent specifically recognising another component if the complex is employed as detection antibody.
- the detection antibody is preferably either directly or indirectly detectable, for example the detec- tion antibody may be directly coupled to a detectable label or the detection antibody may be capable of interacting with another agent which is coupled to a detectable label.
- a detectable label may for example be a fluorescent label, a chromatophore, a ra- dioactive label, a heavy metal or an enzyme.
- the level of PAPP-A/proMBP complexes in a body fluid sample may be determined by sandwich ELISA using a PAPP-A specific monoclonal or polyclonal antibody for catching and a proMBP specific monoclonal or polyclonal antibody for detection or the level of proMBP/ANG in a body fluid sample may be determined by sandwich ELISA using a proMBP specific monoclonal or polyclonal antibody for catching and a ANG specific monoclonal or polyclonal antibody for detection.
- the clinical condition may be any clinical condition which may be diagnosed by the level of complexes comprising PAPP-A and/or PAPP-A2 and/or proMBP or wherein predisposition may be diagnosed by the level of complexes comprising PAPP-A and/or PAPP-A2 and/or proMBP.
- the clinical condition may for example be selected from the group comprising Down's syndrome, preeclampsia and acute coronary syndrome, including unstable angina and myocadial infarction.
- the body fluid sample may be any usefull body fluid sample, such as a blood sample including a serum sample, a urine sample, a saliva sample or an amniotic fluid sample.
- the level of PAPP-A/proMBP may be determined when the clinical condition is selected from the group consisting of Down's syndrome, and acute coronary syndrome including unstable angina and myocardial infarction.
- diagnosing Down's syndrome or diag- nosing predisposition to Down's syndrome comprises determining the level of
- PAPP-A/proMBP wherein the level of PAPP-A/proMBP below a predetermined value is indicative of the Down's syndrome or predisposition to Down's syndrome.
- diagnosing acute coronary syn- drome, including unstable angina and myocardial infarction or diagnosing predisposition to acute coronary syndrome, including unstable angina and myocardial infarction comprises determining the level of PAPP-A/proMBP, wherein the level of PAPP-A/proMBP above a predetermined value is indicative of the acute coronary syndrome, including unstable angina and myocardial infarction or predisposition to acute coronary syndrome, including unstable angina and myocardial infarction.
- the level of proMBP/ANG may be determined to diagnose predisposition to Down's syndrome or to diagnose Down's syndrome.
- All the above mentioned methods of diagnosis may also be performed in combina- tion with one or more other methods of diagnosis.
- more than one different diagnosis according to the present invention may be performed, for example it is possible to measure the level of more than one complex or to measure the level of one complex in different body samples.
- PAPP-A2 may be used to generate natural fragments of proteins that are specifically cleaved by PAPP-A2. As in the case of IGFBP-5 (see Examples 6.7 and 6.9), such fragments may have biological effects different from intact IGFBP-5. Fragments can be purified by standard chromatography after cleavage with purified PAPP-A2 (see
- PAPP-A2 (see Figure 3), the pattern of disulfide bonds can be assumed to be the same for PAPP-A2 for those common cysteine residues. Therefore, knowledge of the disulfide structure of the PAPP-A subunit (see Figure 8) can be used to rationally design fragments of PAPP-A2 in which pairing of all cysteine residues is possible. Putative domain boundaries of PAPP-A2 can be defined based on the disulfide structure shown in Figure 8. Those domains can be expressed separately or in combination.
- a domain contains a cysteine residue known to form an inter-chain disulfide bridge to another PAPP-A subunit or to proMBP (see Figure 8), it may be required that this cysteine is mutated to for example a serine or an ala- nine residue
- possible boundary regions are between Cys-403 arid Cys-499, between Cys- 828 and Cys-881 , between Cys-1048 and Cys-1115, between Cys-1390 and Cys- 1396, between Cys-1459 and Cys-1464, between Cys-1521 and Cys-1525, between Cys-1590 and Cys-1595, between Cys-1646 and Cys-1653, and between Cys-1729 and Cys-1733 (numbering of preproPAPP-A2, as in Figure 1 and 3).
- Identification of PAPP-A2 as the IGFBP-5 protease provides methods for affecting growth and differentiation in vivo by using PAPP-A2 as a therapeutic target.
- Inhibitors of PAPP-A2 is believed to decrease the amount of bioavailable IGF-I and IGF-II.
- inhibition of PAPP-A2 activity can be useful in disorders such as restenosis, atherosclerosis, and fibrosis.
- Activators, or agents that increase the activity of PAPP-A2 is believed to increase the amount of bioavailable IGF-I and IGF-II.
- Agents that alter PAPP-A2 activity or that alter adherence of PAPP-A2 to cell surfaces can be incorporated into pharmaceutical compositions. Such agents may be incorporated together with agents that alter PAPP-A activity or that alter adherence of PAPP-A to cell surfaces.
- a combination of PAPP-A2 specific agents and PAPP-A specific agents may be more effective than traditional agents directed against PAPP-A.
- a method of treatment comprising the step of administreing to an individual in need thereof a combination of PAPP-A2 specific agents and PAPP-A specific agents in pharmaceutically effective amounts.
- an antibody such as anti-PAPP-A2 polyclonal or monoclonal
- a pharmaceutical composition by admixture with pharmaceutically acceptable non-toxic excipients or carriers.
- Such compounds and compositions may be prepared for parenteral administration, particularly in the form of liquid solutions or suspensions in aqueous physiological buffer solutions; for oral administration, particularly in the form of tablets or capsules; or for intranasal administration, particularly in the form of powders, nasal drops, or aerosols.
- Compositions for other routes of administration may be prepared as desired using standard methods.
- Formulations for parenteral administration may contain as common excipients (i.e., pharmaceutically acceptable carriers) sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like.
- excipients i.e., pharmaceutically acceptable carriers
- polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and the like.
- biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxethylene-polyoxypropylene copolymers are examples of excipients for controlling the release of a compound of the invention in vivo.
- suitable parenteral delivery systems include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
- Formulations for inhalation administration may contain excipients such as lactose, if desired.
- Inhalation formulations may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or they may be oily solutions for administration in the form of nasal drops. If desired, the compounds can be formulated as gels to be applied intranasally.
- Formulations for parenteral administration may also include glycocholate for buccal administration
- the invention also features a medical device for placement in a patient (e.g., an im- plant) that includes an agent that inhibits or activates PAPP-A2 protease activity.
- Suitable agents are readily identified using the methods described herein.
- the device can be impregnated with the agent or can be coated with the agent.
- Non- limiting examples of inhibitors include an antibody such as anti-PAPP-A2 polyclonal or monoclonal, or a metalloprotease inhibitor such as 1 ,10-phenanthroline.
- IGFBP-5 protease activity of PAPP-A2 is potently inhibited by 1 ,10-phenanthroline, but is not inhibited by tissue inhibitors of matrix metalloproteases (TIMP'S).
- Other inhibitors include small molecules such as derivatives of hydroxamic acid.
- Anti- PAPP-A2 polyclonal IgG may also inhibit IGF-dependent - or IGF-independent - IGFBP-5 specific PAPP-A2 protease activity in HFCM in a dose-dependent manner.
- polypeptides i.e., any chain of amino acids, regardless of length or post- translational modification
- modified polypeptides can function as inhibitors.
- Any inhibitor of the IGFBP-5 protease activity of PAPP-A2 can be used for coating or impregnating a medical device according to the invention.
- Modified polypeptides include amino acid substitutions, deletions, or insertions in the amino acid sequence as compared with a corresponding wild-type sequence, as well as chemical modifications.
- protease-resistant IGFBP-5 is not an inhibitor per se of the IGFBP-5 protease activity of PAPP-A2, similar results are expected when it is used for coating or impregnating a medical device.
- coating or impregnating the medical device with a PAPP-A2 inhibitor can help prevent the development of restenosis following balloon angioplasty, or can prevent a further increase in size of an atherosclerotic plaque.
- Coronary angioplasty with stent placement is currently the leading therapeutic approach for coronary atherosclerosis.
- An important goal of angioplasty of coronary artery disease is to prevent both acute and chronic complications. Modern procedures are quite successful in eliminating immediate problems. Unfortunately, restenosis still occurs in 20-30% of stented patients. No known pharmacological intervention is available to prevent the restenosis.
- enhanced PAPP-A2 activity can be useful for wound healing, fractures, osteoporosis, or ovulation. Osteoporosis or other conditions of bone loss may benefit from increased bone formation and decreased bone resorption.
- Agents that enhance PAPP-A2 activity can be, for example, a modified IGF, i.e., an IGF analog.
- Analogs include IGF polypeptides containing amino acid insertions, deletions or substitutions, as well as chemical modifications.
- Amino acid substitutions can include conservative and non-conservative amino acid substitutions.
- Conservative amino acid substitutions replace an amino acid with an amino acid of the same class, whereas non-conservative amino acid substitutions replace an amino acid with an amino acid of a different class.
- Non-conservative substitutions result in a change in the hydrophobicity of the polypeptide or in the bulk of a residue side chain.
- non-conservative substitutions can make a substantial change in the charge of the polypeptide, such as reducing electropositive charges or introducing electronegative charges.
- non-conservative substitutions include a basic amino acid for a non-polar amino acid, or a polar amino acid for an acidic amino acid.
- Amino acid insertions, deletions and substitutions can be made using random mutagenesis, site-directed mutagenesis, or other recombinant techniques known in the art.
- the medical device can be, for example, bone plates or bone screws that are used to stabilize bones, or a stent, which typically is used within the body to restore or maintain the patency of a body lumen. Blood vessels, for example, can become obstructed due to an atherosclerotic plaque that restricts the passage of blood.
- a stent typically has a tubular structure defining an inner channel that accommodates flow within the body lumen.
- the outer walls of the stent engage the inner walls of the body lumen. Positioning of a stent within an affected area can help prevent further occlusion of the body lumen and permit continued flow.
- a stent typically is deployed by percutaneous insertion of a catheter or guide wire that carries the stent.
- the stent ordinarily has an expandable structure. Upon delivery to the desired site, the stent can be expanded with a balloon mounted on the catheter.
- the stent may have a biased or elastic structure that is held within a sheath or other restraint in a compressed state. The stent expands voluntarily when the restraint is removed. In either case, the walls of the stent expand to engage the inner wall of the body lumen, and generally fix the stent in a desired position.
- the present invention relates to a purified polynucleotide selected from the group consisting of
- a polynucleotide comprising nucleotides 1 to 5376 of SEQ ID NO:1 , corresponding to the coding sequence of PAPP-A2, as deposited with DSMZ under accession number DSM 13783;
- a polynucleotide encoding a fragment of a polypeptide encoded by polynucleotides (i) or (ii), wherein said fragment
- a) has a proteolytic activity specific for Insulin Like Growth Factor Binding Protein 5 (IGFBP-5), or a derivative thereof, or any other sub- strate; and/or b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising a polypeptide having the amino acid sequence as shown in SEQ ID NO:2; and/or
- IGFBP-5 Insulin Like Growth Factor Binding Protein 5
- c) competes with a polypeptide having the amino acid sequence as shown in SEQ ID NO:2 for binding to a cell surface receptor having an affinity for said polypeptide;
- a polynucleotide a polynucleotide, the complementary strand of which hybridizes, under stringent conditions, with a polynucleotide as defined in any of (i), (ii) and (iii), said polynucleotide encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO:2, or a fragment thereof, wherein said fragment
- a) has a proteolytic activity specific at least for Insulin Like Growth Factor Binding Protein 5 (IGFBP-5); and/or
- b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising a polypeptide having the amino acid sequence as shown in SEQ ID NO:2;
- c) competes with a polypeptide having the amino acid sequence as shown in SEQ ID NO:2 for binding to a cell surface receptor having an affinity for said polypeptide;
- a polynucleotide comprising a nucleotide sequence which is degenerate to the nucleotide sequence of a polynucleotide as defined in any of (iii) and (iv),
- a polynucleotide as used herein shall denote any naturally occurring polynucleotide having any naturally occurring backbone structure, as well as nucleotides known in the art as LNA (locked nucleic acid) and PNA (peptide nucleic acid).
- the purified polynucleotide comprises the coding sequence of PAPP-A2, nucleotides 1 to 5376, as shown in SEQ ID NO:1 , or a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO:2.
- polynucleotide comprises a nucleotide sequence encoding a fragment of the polypeptide having the amino acid sequence as shown in SEQ ID NO:2, wherein said fragment
- a) has a proteolytic activity specific for Insulin Like Growth Factor Binding Protein 5 (IGFBP-5), or a derivative thereof, or any other substrate; and/or
- b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising a polypeptide having the amino acid sequence as shown in SEQ ID NO:2;
- c) competes with a polypeptide having the amino acid sequence as shown in SEQ ID NO:2 for binding to a cell surface receptor having an affinity for said polypeptide
- Stringent conditions as used herein shall denote stringency as normally applied in connection with Southern blotting and hybridization as described e.g. by Southern E. M., 1975, J. Mol. Biol. 98:503-517. For such purposes it is routine practise to include steps of prehybridization and hybridization.
- Such steps are normally performed using solutions containing 6x SSPE, 5% Denhardt's, 0.5% SDS, 50% formamide, 100 ⁇ g/ml denaturated salmon testis DNA (incubation for 18 hrs at 42°C), followed by washings with 2x SSC and 0.5% SDS (at room temperature and at 37°C), and a washing with 0.1x SSC and 0.5% SDS (incubation at 68°C for 30 min), as described by Sambrook et al., 1989, in "Molecular Cloning/A Laboratory Manual", Cold Spring Harbor), which is incorporated herein by reference.
- the DNA sequences are used in a variety of ways.
- Mammalian homologs may be used as probes for identifying homologs of uHAse (e.g., homologs of huHAse).
- Mammalian homologs have substantial sequence similarity to one another, i.e. at least 75%, usually at least 90%, more usually at least 95% sequence identity.
- Sequence similarity is cal- culated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc.
- a reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared.
- Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al. 1990 J Mol Biol 215:403-10.
- Nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50.degree. C. and 10.times.SSC (0.9 M sa- line/0.09 M sodium citrate) and remain bound when subjected to washing at 55.degree. C. in times.SSC.
- Sequence identity may be determined by hybridization under high stringency conditions, for example, at 50.degree. C. or higher and O. times.SSC (9 mM saline/0.9 mM sodium citrate).
- probes, particularly labeled probes of DNA sequences one can isolate homologous or related genes.
- the source of homologous genes may be any species, e.g. Primate species, par- ticularly human; rodents, such as rats and mice, canines, felines, bovine, opines, equine, yeast, Drosophila, Caenhorabditis, etc.
- a polynucleotide comprising a nucleotide sequence which is degenerate to a polynucleotide capable of hybridising to SEQ ID NO:1 , or a fragment thereof.
- Degeneracy as used herein is defined in terms of the activity or functionality associated with the polypeptide expressed from said degenerate polynucleotide, said polynucleotide is either i) comprising a proteolytic activity specific at least for Insulin Like Growth Factor Binding Protein 5 (IGFBP-5); and/or ii) recognised by an antibody, or a binding fragment thereof, which is capable of recognising a polypeptide having the amino acid sequence as shown in SEQ ID NO:2; and/or iii) competing with a polypeptide having the amino acid sequence as shown in SEQ ID NO:2 for binding to a cell surface receptor having an affinity for said polypeptide.
- IGFBP-5 Insulin Like Growth Factor Binding Protein 5
- the polynucleotide according to the invention may be operably linked to a further polynucleotide comprising nucleic acid residues corresponding to the 3' untranslated region of PAPP-A2, or a fragment thereof.
- the 3' untranslated region comprises nucleic acid residues 5377 to 8527 of SEQ ID NO:1.
- a recombinant DNA molecule in the form of an expression vector comprising an expression signal operably linked to a polynucleotide according to the invention.
- a host organism transfected or transformed with the polynucleotide according to the invention, or the vector according to the invention.
- the host organism is preferably a mammalian organism such as e.g. a mammalian cell line.
- a microbial eukaryote such as yeast or fungi may also be used, as may a microbial prokaryote such as Bacillus or E. coli.
- the person skilled in the art will know how to select expression signals, including leader sequences and/or signal peptides suitable for expression in a given cell.
- the person skilled in the art will also know how to determine the level of expression in a given cell by using standard molecular biology techniques.
- the invention relates to an isolated polypeptide comprising or essentially consisting of the amino acid sequence of SEQ ID NO:2, or a fragment thereof, wherein said fragment
- a) has a proteolytic activity specific at least for Insulin Like Growth Factor Binding Protein 5 (IGFBP-5); and/or
- b) is recognised by an antibody, or a binding fragment thereof, which is capable of recognising a polypeptide having the amino acid sequence as shown in SEQ ID NO:2; and/or c) competes with a polypeptide having the amino acid sequence as shown in SEQ ID NO:2 for binding to a cell surface receptor with an affinity for said polypeptide.
- variants of fragments thereof are determined on the basis of their degree of identity or their homology with a predetermined amino acid sequence, said predetermined amino acid sequence being SEQ ID NO:2, or, when the variant is a fragment, a fragment of SEQ ID NO:2.
- variants preferably have at least 75% sequence identity, for example at least 80% sequence identity, such as at least 85 % sequence identity, for example at least 90 % sequence identity, such as at least 91 % sequence identity, for example at least 91% sequence identity, such as at least 92 % sequence identity, for example at least 93 % sequence identity, such as at least 94 % sequence identity, for example at least 95 % sequence identity, such as at least 96 % sequence identity, for example at least 97% sequence identity, such as at least 98 % sequence identity, for example 99% sequence identity with the predetermined sequence.
- sequence identity for example at least 85 % sequence identity
- at least 90 % sequence identity such as at least 91 % sequence identity, for example at least 91% sequence identity, such as at least 92 % sequence identity, for example at least 93 % sequence identity, such as at least 94 % sequence identity, for example at least 95 % sequence identity, such as at least 96 % sequence identity, for example at least 97% sequence identity, such as
- Variants are also determined based on a predetermined number of conservative amino acid substitutions as defined herein below.
- Conservative amino acid substitution as used herein relates to the substitution of one amino acid (within a predetermined group of amino acids) for another amino acid (within the same group), wherein the amino acids exhibit similar or substantially similar characteristics.
- Amino acids having polar side chains (Asp, Glu, Lys, Arg, His, Asn, Gin, Ser,
- a variant or a fragment thereof according to the invention may comprise, within the same variant of the sequence or fragments thereof, or among different variants of the sequence or fragments thereof, at least one substitution, such as a plurality of substitutions introduced independently of one another.
- the same variant or fragment thereof may comprise more than one conservative amino acid substitution from more than one group of conservative amino acids as defined herein above.
- the addition or deletion of an amino acid may be an addition or deletion of from 2 to 10 amino acids, such as from 10 to 20 amino acids, for example from 20 to 30 amino acids, such as from 40 to 50 amino acids.
- additions or deletions of more than 50 amino acids such as additions from 10 to 100 amino acids, addition of 100 to 150 amino acids, addition of 150-250 amino acids, are also comprised within the present invention.
- polypeptide fratments according to the present invention may in one embodiment comprise less than 250 amino acid residues, such as less than 240 amino acid residues, for example less than 225 amino acid residues, such as less than 200 amino acid residues, for example less than 180 amino acid residues, such as less than 160 amino acid residues, for example less than 150 amino acid residues, such as less than 140 amino acid residues, for example less than 130 amino acid residues, such as less than 120 amino acid residues, for example less than 110 amino acid residues, such as less than 100 amino acid residues, for example less than 90 amino acid residues, such as less than 85 amino acid residues, for example less than 80 amino acid residues, such as less than 75 amino acid residues, for example less than 70 amino acid residues, such as less than 65 amino acid residues, for example less than 60 amino acid residues, such as less than 55 amino acid residues, for example less than 50 amino acid residues.
- “Functional equivalency” as used in the present invention is according to one preferred embodiment established by means of reference to the corresponding functionality of a predetermined fragment of the sequence. More specifically, functional equivalency is to be understood as the ability of a polypeptide fragment to exert IGFBP-5 specific protease activity and/or to be recognised by an antibody capable of recognising PAPP-A2 and/or to compete with PAPP-A2 for binding to a receptor having affinity for PAPP-A2.
- Functional equivalents or variants of PAPP-A2 will be understood to exhibit amino acid sequences gradually differing from the preferred predetermined PAPP-A2 sequence, as the number and scope of insertions, deletions and substitutions including conservative substitutions increases. This difference is measured as a reduction in homology between the preferred predetermined sequence and the fragment or functional equivalent. All fragments or functional equivalents of SEQ ID NO:2 are included within the scope of this invention, regardless of the degree of homology that they show to a preferred predetermined sequence of PAPP-A2 as reported herein. The reason for this is that some regions of PAPP-A2 are most likely readily mutatable, or capable of being completely deleted, without any significant effect on the binding activity of the resulting fragment.
- a functional variant obtained by substitution may well exhibit some form or degree of native PAPP-A2 activity, and yet be less homologous, if residues containing functionally similar amino acid side chains are substituted.
- Functionally similar in this respect refers to dominant characteristics of the side chains such as hydrophobic, basic, neutral or acidic, or the presence or absence of steric bulk. Accordingly, in one embodiment of the invention, the degree of identity is not a principal measure of a fragment being a variant or functional equivalent of a preferred predetermined fragment according to the present invention.
- the homology between amino acid sequences may be calculated using well known algorithms such as BLOSUM 30, BLOSUM 40, BLOSUM 45, BLOSUM 50, BLOSUM 55, BLOSUM 60, BLOSUM 62, BLOSUM 65, BLOSUM 70, BLOSUM 75, BLOSUM 80, BLOSUM 85, or BLOSUM 90.
- Fragments sharing at least some homology with fragments of SEQ ID NO:2 are to be considered as falling within the scope of the present invention when they are at least about 90 percent homologous, for example at least 92 percent homologous, such as at least 94 percent homologous, for example at least 95 percent homologous, such as at least 96 percent homologous, for example at least 97 percent homologous, such as at least 98 percent homologous, for example at least 99 percent homologous with said fragments of SEQ ID NO:2.
- the homology percentages refer to identity percentages.
- Additional factors that may be taken into consideration when determining functional equivalence according to the meaning used herein are i) the ability of antisera to detect a PAPP-A2 fragment according to the present invention, or ii) the ability of the functionally equivalent PAPP-A2 fragment to compete with PAPP-A2 in a binding assay.
- One method of determining a sequence of immunogenically active amino acids within a known amino acid sequence has been described by Geysen in US 5,595,915 and is incorporated herein by reference.
- Conservative substitutions may be introduced in any position of a preferred predetermined fragment of SEQ ID NO:2, and it may also be desirable to introduce non-conservative substitutions in any one or more positions.
- a non-conservative substitution leading to the formation of a functionally equivalent fragment of PAPP-A2 would for example i) differ substantially in polarity, for example a residue with a non-polar side chain (Ala, Leu, Pro, Trp, Val, lie, Leu, Phe or Met) substituted for a residue with a polar side chain such as Gly, Ser, Thr, Cys, Tyr, Asn, or Gin or a charged amino acid such as Asp, Glu, Arg, or Lys, or substituting a charged or a polar residue for a non-polar one; and/or ii) differ substantially in its effect on polypeptide backbone orientation such as substitution of or for Pro or Gly by another residue; and/or iii) differ substantially in electric charge, for example substitution of a negatively charged residue such as Glu or Asp for a positively charged residue such as Lys, His or Arg (and vice versa); and/or iv) differ substantially in steric bulk, for example substitution of a bulk
- Variants obtained by substitution of amino acids may in one preferred embodiment be made based upon the hydrophobicity and hydrophilicity values and the relative similarity of the amino acid side-chain substituents, including charge, size, and the like.
- Exemplary amino acid substitutions which take various of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
- sterically similar variants may be formulated to mimic the key portions of the variant structure and that such compounds may also be used in the same manner as the variants of the invention. This may be achieved by techniques of modelling and chemical designing known to those of skill in the art. It will be understood that all such sterically similar constructs fall within the scope of the present invention.
- the present invention relates to functional comprising substituted amino acids having hydrophilic or hydropathic indices that are within +/-2.5, for example within +/- 2.3, such as within +/- 2.1 , for example within +/- 2.0, such as within +/- 1.8, for example within +/- 1.6, such as within +/- 1.5, for example within +/- 1.4, such as within +/- 1.3 for example within +/- 1.2, such as within +/- 1.1 , for example within +/- 1.0, such as within +/- 0.9, for example within +/- 0.8, such as within +/- 0.7, for example within +/- 0.6, such as within +/- 0.5, for example within +/- 0.4, such as within +/- 0.3, for example within +/- 0.25, such as within +/- 0.2 of the value of the amino acid it has substituted.
- hydrophilic and hydropathic amino acid indices in conferring interactive, biologic function on a protein is well understood in the art (Kyte & Doolit- tie, 1982 and Hopp, U.S. Pat. No. 4,554,101 , each incorporated herein by reference).
- amino acid hydropathic index values as used herein are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2;5); methionine (+1.9); alanine (+ .8); glycine (-0.4 ); threonine (-0.7 ); serine (-0.8 ); tryptophan (-
- amino acid hydrophilicity values are: arginine (+3.0); lysine (+3.0); aspartate
- sterically similar compounds may be formulated to mimic the key portions of the peptide structure and that such compounds may also be used in the same manner as the peptides of the invention. This may be achieved by techniques of modelling and chemical designing known to those of skill in the art. For example, esterification and other alkylations may be employed to modify the amino terminus of, e.g., a di-arginine peptide backbone, to mimic a tetra peptide structure. It will be understood that all such sterically similar constructs fall within the scope of the present invention.
- Functional equivalents also comprise glycosyl- ated and covalent or aggregative conjugates formed with the same or other PAPP- A2 fragments and/or PAPP-A2 molecules, including dimers or unrelated chemical moieties.
- Such functional equivalents are prepared by linkage of functionalities to groups which are found in fragment including at any one or both of the N- and C- termini, by means known in the art.
- Functional equivalents may thus comprise fragments conjugated to aliphatic or acyl esters or amides of the carboxyl terminus, alkylamines or residues containing car- boxyl side chains, e.g., conjugates to alkylamines at aspartic acid residues; O-acyl derivatives of hydroxyl group-containing residues and N-acyl derivatives of the amino terminal amino acid or amino-group containing residues, e.g. conjugates with fMet-Leu-Phe or immunogenic proteins.
- Derivatives of the acyl groups are selected from the group of alkyl-moieties (including C3 to C10 normal alkyl), thereby forming alkanoyl species, and carbocyclic or heterocyclic compounds, thereby forming aroyl species.
- the reactive groups preferably are difunctional compounds known per se for use in cross-linking proteins to insoluble matrices through reactive side groups.
- Covalent or aggregative functional equivalents and derivatives thereof are useful as reagents in immunoassays or for affinity purification procedures.
- a fragment of PAPP-A2 according to the present invention may be insolubilized by'co- valent bonding to cyanogen bromide-activated Sepharose by methods known per se or adsorbed to polyolefin surfaces, either with or without glutaraldehyde cross- linking, for use in an assay or purification of anti-PAPP-A2 antibodies or cell surface receptors.
- Fragments may also be labelled with a detectable group, e.g., radioiodi- nated by the chloramine T procedure, covalently bound to rare earth chelates or conjugated to another fluorescent moiety for use in e.g. diagnostic assays.
- a detectable group e.g., radioiodi- nated by the chloramine T procedure, covalently bound to rare earth chelates or conjugated to another fluorescent moiety for use in e.g. diagnostic assays.
- Mutagenesis of a preferred predetermined fragment of PAPP-A2 can be conducted by making amino acid insertions, usually on the order of about from 1 to 10 amino acid residues, preferably from about 1 to 5 amino acid residues, or deletions of from about from 1 to 10 residues, such as from about 2 to 5 residues.
- the fragment of PAPP-A2 is synthesised by automated synthe- sis. Any of the commercially available solid-phase techniques may be employed, such as the Merrifield solid phase synthesis method, in which amino acids are sequentially added to a growing amino acid chain. (See Merrifield, J. Am. Chem. Soc. 85:2149-2146, 1963).
- Solid phase synthesis will enable the incorporation of desirable amino acid substitutions into any fragment of PAPP-A2 according to the present invention. It will be understood that substitutions, deletions, insertions or any subcombination thereof may be combined to arrive at a final sequence of a functional equivalent. Insertions shall be understood to include amino-terminal and/or carboxyl-terminal fusions, e.g. with a hydrophobic or immunogenic protein or a carrier such as any polypeptide or scaffold structure capable as serving as a carrier.
- Oligomers including dimers including homodimers and heterodimers of fragments of PAPP-A2 according to the invention are also provided and fall under the scope of the invention.
- PAPP-A2 functional equivalents and variants can be produced as homodimers or heterodimers with other amino acid sequences or with native PAPP-A2 sequences.
- Heterodimers include dimers containing immunoreactive PAPP-A2 fragments as well as PAPP-A2 fragments that need not have or exert any biological activity.
- PAPP-A2 fragments according to the invention may be synthesised both in vitro and in vivo. Method for in vitro synthesis are well known, and methods being suitable or suitably adaptable to the synthesis in vivo of PAPP-A2 are also described in the prior art.
- a host cell is transformed with vectors containing DNA encoding PAPP-A2 or a fragment thereof.
- a vector is defined as a replicable nucleic acid construct. Vectors are used to mediate expression of PAPP-A2.
- An ex- pression vector is a replicable DNA construct in which a nucleic acid sequence encoding the predetermined PAPP-A2 fragment, or any functional equivalent thereof that can be expressed in vivo, is operably linked to suitable control sequences capable of effecting the expression of the fragment or equivalent in a suitable host.
- suitable control sequences are well known in the art.
- Cultures of cells derived from multicellular organisms represent preferred host cells. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI38, BHK, COS-7, 293 and MDCK cell lines. Preferred host cells are eukaryotic cells known to synthesize endogenous PAPP-A2. Cultures of such host cells may be isolated and used as a source of the fragment, or used in therapeutic methods of treatment, including therapeutic methods aimed at promoting or inhibiting a growth state, or diagnostic methods carried out on the human or animal body.
- useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI38, BHK, COS-7, 293 and MDCK cell lines.
- Preferred host cells are eukaryotic cells known to synthesize endogenous PAPP-A2. Cultures of such host cells may be isolated and
- the present invention relates to a polypeptide fragment according to the invention, wherein the PAPP-A2 fragment comprises or essentially consists of amino acid residues 234 to 1791 corresponding to the mature part of PAPP-A2, including any processing variants thereof.
- Processing variants are variants resulting from alternative processing events, possibly processing events catalysed by any protease including, but not limited to, a signal peptidase and a furin.
- One putative cleavage site is located after position 233 is described herein below in detail.
- Another putative cleavage site is located after the motif RQRR (position 196 - 199 in the amino acid sequence of PAPP-A2).
- Process- ing variants shall be understood to comprise variants arising from processing in vivo when PAPP-A2 is expressed in human or animal tissue, sera or body fluids.
- Mature PAPP-A2 amino acids sequences essentially consisting of the mature sequence designated in SEQ ID NO:2 (amino acid residues 234 to 1791) shall be un- derstood in one embodiment to comprise this part of the sequence lacking between 1 to about 10 N-terminal amino acids or C-terminal amino acids, preferably 1 to 10 N-terminal amino acids, such as 2 to 8 N-terminal acids, for example 3 to 6 N- terminal amino acids.
- Also included in the definition of essentially consisting of as used herein shall be the mature sequence designated in SEQ ID NO:2 (amino acid residues 234 to 1791) having in addition thereto an additional 1 to about 10 N-terminal amino acids or C- terminal amino acids, preferably 1 to 10 N-terminal amino acids, such as 2 to 8 N- terminal acids, for example 3 to 6 N-terminal amino acids.
- This definition of essen- tially consisting of shall also apply in other aspects and is not restricted to being used in connection with a particular part of PAPP-A2.
- the definition shall also apply to other processes PAPP-A2 polypeptides including polypeptides arising from alternative processing in tissue, sera or body fluids other than the ones from where the processed PAPP-A2 has originally been isolated.
- fragments comprise or essentially consists of amino acid residues 1 to 233 corresponding to the prepro part of PAPP-A2, of amino acid residues 23 to 233 corresponding to the pro part of PAPP-A2, of amino acid residues 1 to 22 corresponding to the signal peptide or leader sequence of PAPP-A2, and to such sequences operably linked to the mature part of PAPP-A2 corresponding to amino acid residues 234 to 1791 of SEQ ID NO:2.
- PAPP-A2 polypeptide or a fragment thereof, wherein preferably the polypeptide is free of human proteins, or other proteins natively associated with said polypeptide.
- composition comprising i) a polynucleotide according to the invention, and/or ii) a vector according to the invention, and/or iii) a host organism according to the invention, and/or iv) a polypeptide according to the invention, in combination with a physiologically acceptable carrier.
- a pharmaceutical composition comprising i) a polynucleotide according to the invention, and/or ii) a vector according to the invet- nion, and/or iii) a host organism according to the invention, and/or iv) a polypeptide according to the invention, in combination with a pharmaceutically acceptable carrier.
- the invention further pertains to a method for producing an antibody with specificity for a PAPP-A2 polypeptide according to the invention, or a fragment thereof, said method comprising the steps of
- the antibody is preferably a monoclonal.
- step ii) transfecting or transforming the host organism provided in step i) with a polynucleotide according to the invention, or a vector according to the invention
- step iii) culturing the host organism obtained in step ii) under conditions suitable for expression of the polypeptide encoded by the polynucleotide or the vector; and optionally
- step ii) transfecting or transforming a cell capable of expressing PAPP-A2 with said anti-sense polynucleotide provided in step i),
- step iii) culturing the cell obtained in step ii) under conditions suitable for hybridization of the polynucleotide provided in step i) to a complementary polynucleotide in said cell involved in the expression of PAPP-A2, and
- the antisense polynucleotide and the complementary polynucleotide may be co- expressed from distinct polynucleotide molecules or they may be expressed from the same molecule.
- the method may include the use of reverse transcriptase PCR technology (rt PCT technology).
- the method may comprise the further step of comparing the PAPP-A2 or the level of PAPP-A2 detected in step ii) with a predetermined value selected from the group consisting of
- the predetermined value in one embodiment will be indicative of a normal physiological condition of said individual.
- the biological sample is preferably selected from the group consisting of blood, urine, pleural fluid, oral washings, tissue biopsies, and follicular fluid.
- the level of PAPP-A2 is measured as an amount of PAPP-A2 protein
- the PAPP-A2 protein is preferably measured by immunochemical analysis wherein
- PAPP-A2 protein is detected by at least one monoclonal antibody.
- PAPP-A2 protein may also be detected in a complex comprising at least one additional component, preferably a polypeptide such as, but not limited to, pro-MBP (pro-Major-Basic Protein).
- PAPP-A2 may also be detected as a PAPP-A2 monomer or as a PAPP-A2 dimer.
- Futher aspects of the invention relates to a method of diagnosing a clinical condition in an individual, said method comprising the steps of
- the clinical condition is preferably a fetal abnormality such as, but not limited to, a fetal abnormality selected from the group consisting of Trisomy 21 , Trisomy 18, Trisomy 13, and Open Spina Bifida.
- Additional fetal abnormalities capable of being diagnosed according to the invention is ectopic pregnancy, open spina bifida, neural tube defects, ventral wall defects, Edwards Syndrome, Pateaus Syndrome, Turner Syndrome, Monosomy X or Klein- felter's Syndrome.
- the clinical condition is an altered growth state selected from the group consisting of a growth promoting state and a growth inhibiting state, including, but not limited to, restenosis, atherosclerosis, wound healing, fibrosis, myocardial infarction, osteoporoses, rheumatoroid arthritis, multiple myeloma, or cancer.
- the substrate preferably comprises comprises a polypeptide that may be an internally quenched fluorescent peptide.
- One preferred substrate comprises or essentially consists of IGFBP-5, or a fragment thereof.
- the invention also pertains to an inhibitory agent obtainable according to such a method for identifying an agent inhibiting the protease activity of PAPP-A2.
- inhibitory agents in the manufacture of a medicament for treating a clinical condition in an individual in need of such treatment.
- the invention pertains to a method for identifying an agent capable of enhancing the protease activity of PAPP-A2, said method comprising the steps of
- the substrate preferably comprises a polypeptide including an internally quenched fluorescent peptide.
- IGFBP-5, or a fragment thereof, is particularly preferred as a substrate.
- an enhancing agent obtainable according to the method for identifying an agent capable of enhancing the protease activity of PAPP-A2, and the invention also pertains to the use of such enhancing agents in the manufacture of a medicament for treating a clinical condition in an individual in need of such treat- ment.
- a method of treatment by therapy of an individual comprising the step of administrating to said individual i) a pharmaceutical composition according to the invention, and/or ii) the inhibitory agent according to the invention, and/or the enhancing agent according to the invention.
- Figure 1 shows the cDNA sequence (in 5' ⁇ 3' orientation) corresponding to the mRNA that encodes preproPAPP-A2. Only the coding part of the sequence and the terminal stop codon (*) is shown and is numbered 1-5376.
- the translated polypeptide sequence, of preproPAPP-A2 is also shown.
- the signal peptide cleavage site was predicted using SignalP V2.0 to be after the alanine residue encoded by nt. 64- 66 ((Nielsen et al., 1997, Protein Eng 10, 1-6), WWW prediction server is located at http://genome.cbs.dtu.dk/).
- the signal peptide of preproPAPP-A2 (nt. 1-66, 22 residues) is shown in bold.
- the nucleotide sequence of this figure represents nt. 1 to 5376 of SEQ ID NO:1.
- the protein sequence of this figure is illustrated as SEQ ID NO:2.
- Figure 2 is a schematic drawing of the relationship between PAPP-A (Kristensen et al., 1994, Biochemistry 33, 1592-8), and sequence stretches contained within two genomic clones with homology to the N-terminal end (hom-N, coding portion of ac- cession number AL031734) and the C-terminal end (hom-C, coding portion of accession number AL031290) of PAPP-A, when translated into amino acid sequence.
- This figure also illustrates the method by which a cDNA sequence with homology to the midregion of PAPP-A was obtained. Hom-N, hom-C, and the midregion together encodes the complete sequence of a novel protein, PAPP-A2, which is a homolog of PAPP-A.
- the midregion was obtained by PCR using specifically primed (primer RT-
- Figure 3 shows the amino acid sequence of preproPAPP-A2 (SEQ ID NO:2) aligned with preproPAPP-A.
- the deduced amino acid sequence of preproPAPP-A2 (PA2) was aligned with the sequence of preproPAPP-A (PA) ((Haaning et al., 1996, Eur J Biochem 237, 159-63), AAC50543) using CLUSTAL W (Thompson et al., 1994, jvkt cleic Acids Res 22, 4673-80). Because the prepro-portion of PAPP-A did not show significant identity with the corresponding region of PAPP-A2, the alignment was manually adjusted to emphasize difference in length of pro-peptides.
- PAPP-A2 The sequence motifs of PAPP-A (Kristensen et al., 1994, Biochemistry 33, 1592-8) are also found in PAPP- A2: The catalytic zinc binding motif and residues of the putative Met-tum are underlined and bolded in both sequences. Lin-notch motifs (LNR1-3) and short consensus repeats (SCR-1-5) are boxed. Cysteine residus are shaded. All cysteines of mature PAPP-A are also found in PAPP-A2. In addition, the secreted form of PAPP-A2 has four cysteine residues (Cys-343, Cys-533, Cys-618, and Cys-1268) with no counter- part in PAPP-A.
- Figure 4 shows PAPP-A2 by Western blotting and Coomassie staining.
- Medium from transfected 293T cells was Western blotted using monoclonal anti-c-myc.
- Lane 1 cells transfected with empty vector; lane 2, cells transfected with cDNA encoding wild-type PAPP-A2 C-terminally tagged with the c-myc peptide (pPA2-mH), non- reduced; lane 3, cells transfected with or cDNA encoding PAPP-A2 with an inactivating E734Q mutation (pPA2-KO-mH), non-reduced; lane 4, as lane 2, but reduced.
- Recombinant PAPP-A2 was purified by nickel affinity chromatography from serum free medium of cells transfected with pPA2-KO-mH, to eliminate possible autocatalysis (lane 5, reduced).
- Figure 5 shows the activity of PAPP-A2 against IGFBP-1-6.
- Medium from 293T cells transfected with empty vector (-), or cDNA encoding PAPP-A2 (pPA2) (+) was incubated with each of the six IGFBPs (BP1-BP6), and the activity was assessed by li- gand blotting using radiolabeled IGF-II.
- Complete cleavage of IGFBP-5 is evident from the absence of a signal in the BP5+ lane. Partial degradation of IGFBP-3 is also evident.
- Figure 6 shows proteolytic activity of PAPP-A2 against IGFBP-5.
- Medium from 293T cells transfected with empty vector (lane 1), cDNA encoding PAPP-A2 with an inactivating E734Q mutation (pPA2-KO) (lane 2), or cDNA encoding wild-type PAPP-A2 (pPA2) (lanes 3-6) was incubated with C-terminally c-myc tagged rlGFBP-5.
- Proteolytic activity was assessed by Western blotting using anti-c-myc.
- 'i' denotes intact rlGFBP-5;
- 'c' denotes the detectable C-terminal c-myc tagged cleavage product.
- Figure 7 shows the cDNA sequence of the PAPP-A2 mRNA coding region directly followed by the sequence of the 3'UTR.
- the sequence of the 3'UTR was obtained as detailed in Example 6.3
- the first 5376 nucleotides of this sequence represents the coding sequence as illustrated in Figure 1 and SEQ ID NO:1 (nt. 1 - 5376).
- Nucleotides 5377 - 8527 of this sequence corresponds to the 3'UTR of the PAPP-A2 mRNA as illustrated in SEQ ID NO:3 (nt. 5377 - 8527).
- Figure 8 shows the disulfide structure of the PAPP-A subunit in the PAPP-A/proMBP complex (upper bar). Cysteine containing peptides originating from the PAPP- A/proMBP complex were isolated by degrading PAPP-A/proMBP complex with proteinases and cyanogen bromide followed by standard HPLC. Peptides were identified by amino acid analysis, N-terminal sequence analysis, and by mass spec- trometry (Overgaard, M. T., Oxvig, C, unpublished). Disulfide bonds are shown by thin lines. Two cysteine residues form inter-chain disulfide bridges to proMBP, and one forms an inter-chain bridge to PAPP-A causing it to be a dimer (as indicated).
- the cysteine residues present in mature PAPP-A is also present in mature PAPP-A2 (see Figure 3). It is reasonable to assume that the disulfide pairing of PAPP-A2 is the same. Thus, this information is valuable in determination of boundary regions for expression of isolated domains (fragments) of PAPP-A2.
- the gene structure of PAPP-A is also show (lower bar). Exon/intron boundaries are based on comparison of PAPP-A cDNA (AN X68280) with genomic sequences (ANs AB020878, AL353141 , and AL137024). The central bar shows putative domains of PAPP-A based on information of the upper and lower bars.
- ANs Accession numbers (ANs) given in this text refer to sequences deposited in Gen- Bank or other biological sequence databases. ANs are used interchangeable with the protein or nucleotide sequences deposited under the given AN.
- the sequence reported in AL031734 contains 168835 base pairs. Two noncontiguous sequence stretches (nt. 103432-103566, and 140846-141919) of the total sequence together aligned with residues 16-59, and 59-413 of the PAPP-A polypep- tide sequence when translated.
- the sequence reported in AL031290 contains
- cDNA was synthesized using human placental mRNA as a template and a primer, RT-N-mid, derived from AL031290 (Table 1 , Figure 2). This cDNA was used as a template in a PCR to obtain a cDNA corresponding to the midregion of the hypothesized PAPP-A2.
- PCR primers were PR-mid5 and PR-mid3 (Table 1 , Figure 2).
- the coding sequence of the midregion obtained corresponds to residues 665-1572 of Figure 3 (SEQ ID NO:1), a total of 908 amino acids.
- NUMBERS 0 SEQUENCE 0
- RT-N-mid AL031290 10262-10281, (4770-4789) GCTCACACACCACAGGAATG*
- PR-mid5 AL031734 141874-141894, (1947-1967) GGCTGATGTGCGCAAGACCTG PR-mid3: AL031290 10208-10229, (4716-4737) GCATTGTATCTTCAGGAGCTTG*
- PR-N5 AL031734 102606-102628, (-) GAAGTTGACTTCTGGTTCTGTAG
- PR-N3 - -, (2380-2400) CCCTGGGAAGCGAGTGAAGCC*
- RT-C AL031290 62982-63006, (-) GCATTTCTTATAAGATCCTTCATGC*
- PR-C5 - -, (4180-4201) GACAGCTGTCCGTCATTGCTGC
- PR-C3 AL031290 62876-62897, (-) CTTACTGCCTCTGAGGCAGTGG* a Accession numbers of the relevant genomic clones are given. Primers PR-N3 and PR-C5 were located in the sequence connecting hom-N and hom-C, and are therefore not represented in the databases.
- Nucleotide numbers refer to the numbering of the sequences as reported in the file with the relevant accession number. In parentheses are given the corresponding numbers of SEQ ID NO:1 ( Figure 1), except for primers PR-N5, RT-C and PR-C3, not within this sequence.
- Sequences are actual primer sequences (orientation 5'-to-3'). Sequences marked with an asterisk are complementary to the database sequences or the sequence given in Figure 1.
- this EST sequence When translated into polypeptide sequence, this EST sequence showed homology to the C-terminal end of PAPP-A. Further, a stop codon was present within the coding sequence corresponding to amino acid 1537 of PAPP-A. That is, PAPP-A2 does not extend C-terminally beyond PAPP-A when the two sequences are aligned.
- cDNA was synthesized using human placental mRNA as a template and a primer originating from AL031290 (Table 1). This cDNA was used as a tem- plate in a PCR to obtain the contiguous cDNA of hom-C using PCR primers PR-C5 and PR-C3 (Table 1 , Figure 2).
- PAPP-A is numbered according to ((Haaning et al., 1996, Eur J Biochem 237, 159-63), AAC50543).
- PAPP-A2 An elongated zinc binding consensus sequence, three lin-notch repeats (LNR1-3), and five short consensus repeats (SCR1- 5) ( Figure 3). Further, all 82 cysteine residues of PAPP-A are conserved between the two proteins, and an additional 4 cysteines are present in the PAPP-A2 polypeptide sequence.
- a cluster of EST sequences matching the genomic sequence of AL031290 were identified around nt 64000-66000 of AL031290, starting approximately 1.2 kb from the end of the PAPP-A2 encoding sequence. The existence of mRNA connecting the coding region of PAPP-A2 and this cluster was verified in a PCR using primers from AL031290 (5'-GGAAAGAGCAGAGTTCACCCAT-3', nt. 64900-64879 of
- CCGTCTTAGTCCACTGCATCC-3' nt. 20499-20519 of AL031290, nt 5171-5191 of AF311940), and oligo-dT primed placental cDNA as a template (Overgaard et al., 1999, Biol Reprod 61 , 1083-9).
- the size of the resulting product was 2.2 kb, further demonstrating the existence of a PAPP-A2 mRNA with a 3'UTR of about 3 kb.
- the distribution among tissues is shown in Table 2.
- b EST sequences originated from pools of tissue, or from tissue represented by only one EST sequence.
- pPA2 The cDNA sequence of pre-pro-PAPP-A2 encoding amino acids 1-1791 in expression vector pcDNA3.1 +.
- pPA2-KO As pPA2, but Glu-734 of the active site of PAPP-A2 substituted with a Gin residue (E734Q).
- pPA2-mH The expression vector pcDNA3.1/Myc-His(-)A containing the cDNA • sequence of pre-pro-PAPP-A2 encoding amino acids 1-1791 , not followed by a stop codon, but rather a c-myc and a His tag.
- pPA2-KO-mH As pPA2-mH, but with the E734Q substitution of pPA2-KO.
- pPA2 Construction of pPA2: The Notl-BamHI fragment was excised from p2C and cloned into pBluescriptllSK+ (Stratagene) to obtain p2CBIue. The Notl-Spel fragment was excised from p2N, and the Spel-Bcll fragment was excised from p2Mid. Those two fragments were ligated into the Notl/Bcll sites of p2CBIue in one reaction to obtain p2NMidCBIue, containing the entire PAPP-A2 cDNA.
- the Notl-Apal fragment of pBIuescriptllSK+ was excised and ligated into the Notl/Apal sites of the mammalian expression vector pcDNA3.1+ (Invitrogen) to obtain a modified version of this vector, pcDNA-NA.
- the full length cDNA was then excised from p2NMidCBIue with Notl and Xhol and cloned into pcDNA-NA to obtain pPA2. All restriction sites used are in the multi cloning sites of the vectors, except for Spel and Bell, both located in each of the two overlapping regions of the coding PAPP-A2 sequence stretches of p2N, p2Mid, and p2C (nt. 2365 and nt. 4203, respectively, of Figure 3).
- the construct pPA2-KO is a variant of the pPA2 expression construct in which residue Glu-734 of the active site of PAPP-A2 was substituted with a Gin residue. Thus, the mutant is E734Q.
- the pPA2-KO construct was made by site directed mutagenesis using the method of overlap extension PCR (Ho et al., 1989, Gene 77, 51-9) with pPA2 as the template.
- outer primers were 5'-CGCTCAGGGAAGGACAAGGG-3' (5' end primer, nt. 976-995 of SEQ ID NO:1) and 5'-CTAGAAGGCACAGTCGAGGC-3' (3' end primer, nt.
- GACGTAAAGCTTCTGATTTTCTTCTGCCTTGG-3', nt. 5373-5354 of SEQ ID NO:1 , preceded by a Hindlll site, AAGCTT, and nt. GACGTA to facilitate cleavage of the PCR product) were used in a PCR with pPA2 as the template to generate a nucleotide fragment encoding the C-terminal 156 residues of PAPP-A2 with the stop codon replaced by a Hindlll site for in-frame ligation to expression vector.
- the PCR product was digested with EcoRI and Hindlll and cloned into the EcoRI/Hindlll sites of the vector pcDNA3.1/Myc-His(-)A to generate pPA2C-mH.
- the Notl-Xbal frag- ment (encoding the N-terminal portion of PAPP-A2), and the Xbal-EcoRI fragment
- pPA2-KO-mH A variant of pPA2-mH was constructed with residue Glu-734 substituted into a Gin residue: The Notl-Kpnl fragment of pPA2-KO was excised and swapped into the Notl-Kpnl sites of pPA2-mH, to generate pPA2-KO-mH.
- a metal chelate affinity colum (2 ml, Pharmacia) was charged with nickel ions and loaded with serum-free medium (50 ml) from cells transiently transfected with pPA2- KO-mH (see example 6.4). After washing in PBS containing 1M NaCI, bound protein was eluted with 10 mM EDTA in PBS in fractions of 0.5 ml. PAPP-A2 containing fractions were located by SDS-PAGE ( Figure 4, lane 5). This protein was not seen from medium of cells transfected with empty vector (mock transfectants) and treated in a parallel manner.
- proPAPP-A2 The absence of an arginine residue in the P1 position, indicates that the proprotein processing enzyme responsible for this cleavage is not furin, but likely another proprotein convertase (Nakayama, 1997, Biochem J 327, 625-35). Cleavage of proPAPP-A2 might have been predicted after R(196)QRR, which archetypi- caly markes furin cleavage (Nakayama, 1997, Biochem J 327, 625-35). We cannot exclude that cleavage occurred at this site, and that the observed N-terminus results from further processing.
- IGFBP insulin-like growth factor binding protein
- IGFBP-5 recombinant IGFBP-5 was produced in mammalian cells.
- human placental oligo-dT primed cDNA (Overgaard et al., 1999, Biol Reprod 61, 1083-9) was used as a template to amplify cDNA encoding human IGFBP-5 (Accession number M65062).
- CGATAAGCTTCTCAACGTTGCTGCTGTCG-3' were used, and the resulting PCR product was digested and cloned into the Xholl Hindlll sites of pcDNA3.1/Myc-His(- )A (Invitrogen).
- reaction mixture was separated by reducing 16% SDS- PAGE, blotted onto a PVDF membrane, and the C-terminal cleavage product was detected with monoclonal anti-c-myc (clone 9E19, ATTC) using peroxidase- conjugated secondary antibodies (P260, DAKO), and enhanced chemiluminescence (ECL, Amersham).
- rlGFBP-5 (Fig. 6, lane 7) was digested with purified PAPP-A2 and analyzed by SDS-PAGE (Fig. 6, lane 8). Edman degradation of blotted material showed that both distinct, visible degradation products (fig. 6, lane 8) contained the N-terminal sequence K(144)FVGGA (IGFBP-5 is numbered with the N-terminal Leu of the mature protein as residue 1). The two bands both represent intact C-terminal cleavage fragments, because they also contain the C- terminal c-myc tag (Fig. 6, lane 9); they are likely to be differently glycosylated, in accordance with the heterogeneity of purified rlGFBP-5 ( Figure 6, lane 7).
- Proteolyctic activity against IGFBP-5 has been widely reported from several sources, e.g. pregnancy serum (Claussen et al., 1994, Endocrinology 134, 1964-6), seminal plasma (Lee et al., 1994, J Clin Endocrinol Metab 79, 1367-72), culture me- dia from smooth muscle cells (Imai et al., 1997, J Clin Invest 100, 2596-605), granulosa cells (Resnick et al., 1998, Endocrinology 139, 1249-57), osteosarcoma cells (Conover and Kiefer, 1993, J Clin Endocrinol Metab 76, 1153-9), and also from osteoblasts (Thrailkill et al., 1995, Endocrinology 136, 3527-33), and fibroblasts (Busby et al., 2000, J Biol Chem).
- Insulin-like growth factor binding protein-4 protease produced by arterial smooth muscle cells in vitro is increased in the coronary artery following angioplasty. Arterioscler Thromb Vase Biol, in press.
- the Complement Component C1s is the Protease That Accounts for Cleavage of Insulin-like Growth Factor Binding Protein-5 in Fibroblast Medium.
- IGFBP insulin-like growth factor-binding protein
- Protease-resistant form of insulin-like growth factor-binding protein 5 is an inhibitor of insulin-like growth factor-l actions on porcine smooth muscle cells in culture. J Clin Invest 100, 2596-605.
- Adenovims tripartite leader sequence enhances translation of mRNAs late after infection. Proc Natl Acad Sci U S A 81, 3655-9.
- Vaccinia virus a selectable eukaryotic cloning and expression vector. Proc Natl Acad Sci U S A 79, 7415-9.
- Substrate phage selection of protease substrates by monovalent phage display. Science 260, 1113-7.
- Circulating human pregnancy-associated plasma protein-A is disulfide- bridged to the proform of eosinophil major basic protein. J Biol Chem 268, 12243-6.
- Pregnancy-associated plasma protein A a possible marker in the classification and prenatal diagnosis of Cornelia de Lange syndrome. Prenat Diagn 3, 225-32.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Urology & Nephrology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Hematology (AREA)
- Reproductive Health (AREA)
- Pregnancy & Childbirth (AREA)
- Gynecology & Obstetrics (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2464121A CA2464121C (en) | 2000-10-20 | 2001-10-19 | Pregnancy-associated plasma protein-a2 (papp-a2) |
| AU2002210403A AU2002210403A1 (en) | 2000-10-20 | 2001-10-19 | Pregnancy-associated plasma protein-a2 (papp-a2) |
| JP2002536334A JP4460829B2 (ja) | 2000-10-20 | 2001-10-19 | 妊娠関連血漿蛋白−a2(papp−a2) |
| EP01978230.9A EP1346061B1 (en) | 2000-10-20 | 2001-10-19 | Pregnancy-associated plasma protein-a2 (papp-a2) |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US24184000P | 2000-10-20 | 2000-10-20 | |
| DKPA200001571 | 2000-10-20 | ||
| DKPA200001571 | 2000-10-20 | ||
| US60/241,840 | 2000-10-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2002032953A2 true WO2002032953A2 (en) | 2002-04-25 |
| WO2002032953A3 WO2002032953A3 (en) | 2003-01-09 |
Family
ID=44063430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2001/000695 Ceased WO2002032953A2 (en) | 2000-10-20 | 2001-10-19 | Pregnancy-associated plasma protein-a2 (papp-a2) |
Country Status (6)
| Country | Link |
|---|---|
| US (6) | US7083940B2 (https=) |
| EP (2) | EP2339020B1 (https=) |
| JP (3) | JP4460829B2 (https=) |
| AU (1) | AU2002210403A1 (https=) |
| CA (2) | CA2464121C (https=) |
| WO (1) | WO2002032953A2 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AT500321A1 (de) * | 2003-12-30 | 2005-11-15 | Red Bull Gmbh | Verfahren zur diagnose des down-syndroms |
| WO2011144999A1 (en) * | 2010-05-17 | 2011-11-24 | Sandra Reznik | Plasma protein-a2 (papp-a2) as a marker for detecting risk of chromosomal abnormalities |
| WO2013053359A1 (en) * | 2011-10-14 | 2013-04-18 | Aarhus Universitet | Diagnostic and prognostic use of prombp-complexes |
| EP2612928A3 (en) * | 2005-03-18 | 2013-09-11 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis and monitoring |
| CN110194801A (zh) * | 2018-02-26 | 2019-09-03 | 张灏 | 一种融合蛋白和多克隆抗体及其应用 |
| US10670610B2 (en) | 2012-06-15 | 2020-06-02 | Wayne State University | Biomarker test for prediction or early detection of preeclampsia and/or HELLP syndrome |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2464121C (en) * | 2000-10-20 | 2013-08-13 | Como Biotech Aps | Pregnancy-associated plasma protein-a2 (papp-a2) |
| ATE412181T1 (de) * | 2004-01-28 | 2008-11-15 | Turun Yliopisto | Verbessertes verfahren zur diagnose des akuten koronarsyndroms |
| US20050277147A1 (en) * | 2004-06-11 | 2005-12-15 | Ameet Patki | Identifying chromosomal abnormalities in cells obtained from follicular fluid |
| US20060205651A1 (en) * | 2005-02-25 | 2006-09-14 | Royal College Of Surgeons In Ireland | Method of treating cancer |
| AU2009207645B2 (en) * | 2008-01-25 | 2014-11-13 | Aarhus Universitet | Selective exosite inhibition of PAPP-A activity against IGFBP-4 |
| GB0910751D0 (en) | 2009-06-23 | 2009-08-05 | Procure Therapeutics Ltd | Prostate cancer vaccine |
| WO2011137266A1 (en) * | 2010-04-28 | 2011-11-03 | Watlow Electric Manufacturing Company | Flow through heater |
| EP2890816B1 (en) * | 2012-08-30 | 2019-06-05 | Ansh Labs LLC | Papp-a2 as a marker for monitoring, predicting and diagnosing preeclampsia |
| US9616114B1 (en) | 2014-09-18 | 2017-04-11 | David Gordon Bermudes | Modified bacteria having improved pharmacokinetics and tumor colonization enhancing antitumor activity |
| US10543259B2 (en) * | 2015-03-02 | 2020-01-28 | Children's Hospital Medical Center | Methods and compositions for the identification and treatment of individuals having or likely to develop short stature |
| US10676723B2 (en) | 2015-05-11 | 2020-06-09 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11129906B1 (en) | 2016-12-07 | 2021-09-28 | David Gordon Bermudes | Chimeric protein toxins for expression by therapeutic bacteria |
| US11180535B1 (en) | 2016-12-07 | 2021-11-23 | David Gordon Bermudes | Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria |
| US11988674B2 (en) | 2018-08-07 | 2024-05-21 | University Of South Carolina | Methods for measuring gene expression levels to identify viable oocytes |
| EP4070113A4 (en) | 2019-12-04 | 2023-12-20 | Biora Therapeutics, Inc. | ASSESSMENT OF PREECLAMPSIA USING FREE AND DISSOCIATE PLACENTAL GROWTH FACTOR TESTS |
| TW202432584A (zh) * | 2022-11-15 | 2024-08-16 | 美商嘉來克生命科學有限責任公司 | 抗papp-a抗體及其使用方法 |
| TW202528331A (zh) * | 2023-11-13 | 2025-07-16 | 美商嘉來克生命科學有限責任公司 | 關於基於肽之papp-a調節劑之組合物及方法 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5595915A (en) | 1983-03-08 | 1997-01-21 | Chiron Mimotopes Pty. Ltd | Method of determining antigenically active amino acid sequences |
| US6013478A (en) | 1988-10-28 | 2000-01-11 | Genentech, Inc. | Method for identifying active domains and amino acid residues in polypeptides and hormone variants |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL63224A (en) | 1980-07-17 | 1985-05-31 | Scripps Clinic Res | Synthetic peptide specific antigenic determinant and method of manufacturing antigenic materials therefrom |
| US4554101A (en) | 1981-01-09 | 1985-11-19 | New York Blood Center, Inc. | Identification and preparation of epitopes on antigens and allergens on the basis of hydrophilicity |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| GB9614615D0 (en) | 1996-07-11 | 1996-09-04 | Isis Innovation | Diagnosis of pre-eclampsia |
| US6432628B1 (en) * | 1997-08-26 | 2002-08-13 | Thomas Jefferson University | Caspase-14, an apoptotic protease, nucleic acids encoding and methods of use |
| DE60034779T2 (de) * | 1999-03-15 | 2008-01-17 | Mayo Foundation For Medical Education And Research, Rochester | Insulinartiger-wachstumsfaktorbindungsprotein-4-protease |
| US6436703B1 (en) * | 2000-03-31 | 2002-08-20 | Hyseq, Inc. | Nucleic acids and polypeptides |
| US6656700B2 (en) | 2000-05-26 | 2003-12-02 | Amersham Plc | Isoforms of human pregnancy-associated protein-E |
| AU7410701A (en) * | 2000-06-16 | 2001-12-24 | Martin Farr | Pregnancy-associated plasma protein-e (papp-e) |
| CA2464121C (en) * | 2000-10-20 | 2013-08-13 | Como Biotech Aps | Pregnancy-associated plasma protein-a2 (papp-a2) |
| US6500630B2 (en) * | 2001-01-12 | 2002-12-31 | Mayo Foundation For Medical Education And Research | Marker for inflammatory conditions |
| WO2006138696A2 (en) * | 2005-06-17 | 2006-12-28 | Genizon Biosciences, Inc. | Genemap of the human genes associated with longevity |
| US20080071151A1 (en) * | 2006-06-30 | 2008-03-20 | Sogin David C | Method and Apparatus for Diagnosing Pre-eclampsia |
| ES2587077T3 (es) * | 2008-01-25 | 2016-10-20 | Wallac Oy | Métodos para determinar el riesgo de anomalías cromosómicas en un feto |
-
2001
- 2001-10-19 CA CA2464121A patent/CA2464121C/en not_active Expired - Lifetime
- 2001-10-19 JP JP2002536334A patent/JP4460829B2/ja not_active Expired - Fee Related
- 2001-10-19 AU AU2002210403A patent/AU2002210403A1/en not_active Abandoned
- 2001-10-19 WO PCT/DK2001/000695 patent/WO2002032953A2/en not_active Ceased
- 2001-10-19 EP EP10183761.5A patent/EP2339020B1/en not_active Expired - Lifetime
- 2001-10-19 EP EP01978230.9A patent/EP1346061B1/en not_active Expired - Lifetime
- 2001-10-19 CA CA2818654A patent/CA2818654A1/en not_active Abandoned
- 2001-10-22 US US09/983,025 patent/US7083940B2/en not_active Expired - Lifetime
-
2006
- 2006-06-13 US US11/451,495 patent/US20070141669A1/en not_active Abandoned
-
2009
- 2009-12-22 JP JP2009291514A patent/JP5072950B2/ja not_active Expired - Fee Related
-
2010
- 2010-10-28 US US12/914,312 patent/US20110091920A1/en not_active Abandoned
-
2012
- 2012-06-29 JP JP2012147230A patent/JP2012229235A/ja active Pending
- 2012-09-24 US US13/625,088 patent/US9005949B2/en not_active Expired - Fee Related
- 2012-09-24 US US13/625,261 patent/US20130095482A1/en not_active Abandoned
-
2014
- 2014-08-22 US US14/466,055 patent/US10392610B2/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5595915A (en) | 1983-03-08 | 1997-01-21 | Chiron Mimotopes Pty. Ltd | Method of determining antigenically active amino acid sequences |
| US6013478A (en) | 1988-10-28 | 2000-01-11 | Genentech, Inc. | Method for identifying active domains and amino acid residues in polypeptides and hormone variants |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AT500321A1 (de) * | 2003-12-30 | 2005-11-15 | Red Bull Gmbh | Verfahren zur diagnose des down-syndroms |
| AT500321B1 (de) * | 2003-12-30 | 2006-02-15 | Red Bull Gmbh | Verfahren zur diagnose des down-syndroms |
| EP2612928A3 (en) * | 2005-03-18 | 2013-09-11 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis and monitoring |
| WO2011144999A1 (en) * | 2010-05-17 | 2011-11-24 | Sandra Reznik | Plasma protein-a2 (papp-a2) as a marker for detecting risk of chromosomal abnormalities |
| WO2013053359A1 (en) * | 2011-10-14 | 2013-04-18 | Aarhus Universitet | Diagnostic and prognostic use of prombp-complexes |
| US10670610B2 (en) | 2012-06-15 | 2020-06-02 | Wayne State University | Biomarker test for prediction or early detection of preeclampsia and/or HELLP syndrome |
| CN110194801A (zh) * | 2018-02-26 | 2019-09-03 | 张灏 | 一种融合蛋白和多克隆抗体及其应用 |
| CN110194801B (zh) * | 2018-02-26 | 2022-06-14 | 张灏 | 一种融合蛋白和多克隆抗体及其应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2339020A1 (en) | 2011-06-29 |
| US20070141669A1 (en) | 2007-06-21 |
| US20130095569A1 (en) | 2013-04-18 |
| JP2010222341A (ja) | 2010-10-07 |
| JP5072950B2 (ja) | 2012-11-14 |
| EP2339020B1 (en) | 2017-03-08 |
| CA2464121C (en) | 2013-08-13 |
| WO2002032953A3 (en) | 2003-01-09 |
| US20130095482A1 (en) | 2013-04-18 |
| CA2818654A1 (en) | 2002-04-25 |
| US20150132770A1 (en) | 2015-05-14 |
| JP2012229235A (ja) | 2012-11-22 |
| EP1346061B1 (en) | 2014-12-17 |
| US7083940B2 (en) | 2006-08-01 |
| US9005949B2 (en) | 2015-04-14 |
| AU2002210403A1 (en) | 2002-04-29 |
| EP1346061A2 (en) | 2003-09-24 |
| JP2004511253A (ja) | 2004-04-15 |
| US10392610B2 (en) | 2019-08-27 |
| JP4460829B2 (ja) | 2010-05-12 |
| US20110091920A1 (en) | 2011-04-21 |
| CA2464121A1 (en) | 2002-04-25 |
| US20030124529A1 (en) | 2003-07-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10392610B2 (en) | Pregnancy-associated plasma protein-A2 (PAPP-A2) polypeptides | |
| US5424205A (en) | Amyloidin protease and uses thereof | |
| SK8022003A3 (en) | Von Willebrand Factor (vWF) cleaving protease polypeptide, nucleic acid encoding the polypeptide and use of polypeptide | |
| US20020110894A1 (en) | Nucleic acids encoding zinc metalloproteases | |
| JPH10501962A (ja) | マトリックス金属プロテアーゼのdna配列、その調製および使用 | |
| JPH11507823A (ja) | 新規なヒト視床下部由来セルピン | |
| JP4488140B2 (ja) | セリンプロテアーゼであるコリン | |
| AU2005244559B2 (en) | Use of insulin-like growth factor binding protein-4 protease | |
| CA2461543C (en) | Sperm factor sequences | |
| JP4201712B2 (ja) | Gip、グッドパスチャー抗原結合タンパク質と相互作用する転写因子活性を備えたポリペプチドのファミリー | |
| US6806075B1 (en) | Corin, a serine protease | |
| EP1142993B1 (en) | Method for detecting pancreatitis | |
| JPH10117788A (ja) | ヒト・myt−1キナーゼクローン | |
| JP2002186492A (ja) | ヒトrce1 | |
| JPH11186A (ja) | Frzbファミリーのメンバー、frazzled | |
| CN1978642A (zh) | 人hLDP基因序列、其编码蛋白及制备方法 | |
| JPWO2003062429A1 (ja) | 新規セリンプロテアーゼ | |
| EP1683865A2 (en) | Mammalian proteins and in particular CD200 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ CZ DE DE DK DK DM DZ EC EE EE ES FI FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2002536334 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2001978230 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 2001978230 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2464121 Country of ref document: CA |