WO2002031168A2 - Vaccins de recombinaison a mediation par adenovirus minimal - Google Patents

Vaccins de recombinaison a mediation par adenovirus minimal Download PDF

Info

Publication number
WO2002031168A2
WO2002031168A2 PCT/US2001/031842 US0131842W WO0231168A2 WO 2002031168 A2 WO2002031168 A2 WO 2002031168A2 US 0131842 W US0131842 W US 0131842W WO 0231168 A2 WO0231168 A2 WO 0231168A2
Authority
WO
WIPO (PCT)
Prior art keywords
minimal
vector
cells
gene
vectors
Prior art date
Application number
PCT/US2001/031842
Other languages
English (en)
Other versions
WO2002031168A3 (fr
Inventor
Xiangming Fang
Scott Gallichan
Wei-Wei Zhang
Flossie Wong-Staal
Sybille Sauter
Original Assignee
Genstar Therapeutics
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genstar Therapeutics filed Critical Genstar Therapeutics
Priority to AU2002211654A priority Critical patent/AU2002211654A1/en
Publication of WO2002031168A2 publication Critical patent/WO2002031168A2/fr
Publication of WO2002031168A3 publication Critical patent/WO2002031168A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/108—Plasmid DNA episomal vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C12N2830/003—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor tet inducible
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/38—Vector systems having a special element relevant for transcription being a stuffer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
    • C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • This invention is related to adenoviral (Ad) vectors and their applications in the field of genetic medicine, including gene vaccination, gene therapy, and/or gene transfer. More specifically, this invention is related to Ad vectors that carry minimal cw-elements of the Ad genome (called MAXIMUM-Ad TM , Max-Ad, Maxi-Ad, or minimal Ad) and are capable of delivering transgenes and/or heterologous DNA up to approximately 36 kb.
  • the generation and propagation of MAXIMUM-Ad TM vectors may require tr ⁇ ns-complementation of a packaging- attenuated and replication-defective helper Ad (helper) in an Ad helper cell line.
  • This invention further comprises a methodology for generating minimal adenoviral vectors for use in the treatment of infection, including, but not limited to BQN and or HPN infection.
  • the invention further comprises animal test systems for in vivo evaluation of such Ad vectors. More specifically, this invention describes HIN and/or HPN Ad vectors that may comprise minimal ⁇ ' s-elements of the Ad genome and comprise HIV and/or HPN D ⁇ A sequences with other supporting D ⁇ A elements up to 36 kb.
  • the vectors of the present invention may further comprise immuno-modulatory D ⁇ A sequences.
  • the HJN and/or HPN minimal Ad may be generated and may be further amplified through the assistance of a packaging-attenuated helper Ad and/or a helper cell line. This invention also discloses designs and methods for testing the minimal Ad vectors in vivo.
  • a preferred system of gene delivery must possess several properties that are currently unavailable in a single gene therapy vector.
  • a preferred vector must retain adequate capacity to accommodate large or multiple transgenes including regulatory elements and be amenable to simple manipulation and scale-up for manufacturing.
  • Such a vector must also be safe and demonstrate low toxicity as well as demonstrate highly efficient and selective delivery of transgenes into target cells or tissues.
  • Such a vector must be capable of supporting appropriate retention, expression, and regulation of the transgenes in target cells.
  • the present invention encompasses a novel design of a high-capacity and highly- efficient Ad vector system and is focused on resolving the issues and concerns of those skilled in the art regarding an preferred gene delivery system.
  • Retroviral vectors were among the first to be studied for use in gene therapy (Miller, A.D. & Rosman, G.J. (1989) "Improved retroviral vectors for gene therapy and expression” BioTechniques, vol. 7, pp. 980-990; Mulligan, R.C. (1993) "The basic science of gene therapy” Science, vol. 260, pp. 926-932).
  • the size capacity for insertion of exogenous D ⁇ A into retroviral vectors is limited to approximately 7.5 kb.
  • Adenoviral vectors may also used in gene therapy and genetic vaccination protocols.
  • Adenoviral vectors are preferred for delivery of proteins, peptides, or non-coding nucleic acid sequences due to their large capacity for exogenous D ⁇ A (up to about 36 kb).
  • Ad does not normally integrate into the host cell genome.
  • an Ad vector may preferably include elements required for integration into the host cell genome or other mechanisms of D ⁇ A retention.
  • the immune response mediated against the adenoviral vector makes re-administration of the vector difficult (Yang, Y. et al. (1994) "Cellular immunity to viral antigen limits El-deleted adenoviruses for gene therapy" Proc. Natl. Acad Sci. USA, vol. 91, pp. 4407-4411).
  • the minimal Ad vectors of the present invention have eliminated most adenovirus D ⁇ A sequences from the adenoviral vector carrying the transgene. Thus, at least partially eliminating a detrimental immune response that may be raised by Ad gene expression in the host cell, which may contribute to the decline of transgene expression.
  • adenoviral vector that allows for a large heterologous D ⁇ A insert has been described in international patent application WO 96/33280 (International Patent Application number PCT/US96/05310, published October 24, 1996 as WO 96/33280). That vector, however, does not provide elements for integration into the target cell genome or for episomal maintenance of the vector upon entry into a target cell.
  • the present invention provides elements that allow for retention of the delivered transgene in the host cell, either by integration into the target cell genome or by maintenance as an episomal nucleic acid.
  • One method by which this may be accomplished by the present invention includes facilitation of integration of the transgene into the host cell genome using viral integration mechanisms.
  • the adeno-associated virus (AAN) genome has the capability of integrating into the D ⁇ A of cells which it infects and is the only example of an exogenous D ⁇ A that integrates at a specific site, AAVS1 at 19ql3.3-qter, in the human genome (Kotin, R.M. et al.
  • the present invention also provides an adenoviral vector capable of homologous recombination into the genome of a target cell, another significant advantage over adenoviral vectors currently available to one skilled in the art.
  • the present invention also provides elements that allow episomal replication of the transgene.
  • the minimal Ad vector system of the present invention was developed based on two major findings: 1) the discovery of an Ad-SN40 hybrid (Gluzman, Y. & Nan Doren, K. (1983) "Palindromic adenovirus type 5-simian virus 40 hybrid". J. Virol, vol. 45, pp.
  • Ad packaging may be attenuated by partial deletion of the packaging signal (Grable, M., & Hearing, P. (1992) "Cis and trans requirements for the selective packaging of adenovirus type 5 D ⁇ A" J. Virol, vol. 66, pp. 723-731).
  • Ad packaging systems based on incorporation of minimal cis elements for packaging and genome replication are under development (Fisher, K.J. et al.
  • modified adenoviral vectors comprising: 1) a large capacity for insertion of approximately 36 kb heterologous DNA, wherein such sequences may include, but are not limited to, one or more coding and/or non- coding sequences, one or more elements for controlling transgene expression, one or more elements for assisting in integration of exogenous DNA into a target cell genome, and/or one or more elements for the maintenance of a vector in an episomal form within a target cell; 2) cognate helper Ad vectors designed to support propagation of the minimal Ad vectors and having a manipulated packaging signal such that within a host producer cell the minimal Ad vector is packaged at a greater frequency than the helper Ad vector; and, 3) helper cell lines designed to support propagation of both the minimal Ad vectors and the helper Ad vectors that may also serve to control transgene expression during viral propagation and selectively attenuate packaging of the helper Ad genome.
  • the present invention provides minimal Ad vectors as an isolated DNA molecule having the elements necessary for rephcation, packaging and sustained gene expression such as an inverted terminal repeat (ITR), a packaging signal, a transcriptional control region, an effector or reporter gene, and either a genomic integration sequence or an episomal maintenance sequence, all operatively associated for generating an infectious, replication-defective recombinant adenoviral vector wherein the remaining portion of said DNA molecule does not encode an adenoviral protein.
  • ITR inverted terminal repeat
  • a packaging signal a transcriptional control region
  • an effector or reporter gene a genomic integration sequence or an episomal maintenance sequence, all operatively associated for generating an infectious, replication-defective recombinant adenoviral vector wherein the remaining portion of said DNA molecule does not encode an adenoviral protein.
  • a minimal Ad vector comprising HTV and/or HPN D ⁇ A sequences is provided.
  • the present invention provides a vector having the elements required to extend the duration of expression of a transgene following introduction into a target cell.
  • the present invention thus provides a vector having an element that may aid in stabilization of transgene expression in the target cell as an episome or by facilitating integration of the introduced gene into the cell genome.
  • the present invention provides either a genomic integration element or an episomal maintenance element within the minimal Ad vector.
  • An example of such a system provides a minimal Ad vector including integration elements of AAN.
  • Another example of such a system provides a homologous recombination arm within the minimal Ad vector.
  • an El -deleted helper Ad genome having an altered packaging signal such that the El -deleted helper Ad genome is packaged at a lower frequency than the wild-type helper Ad genome is provided.
  • a helper or producer cell is provided as a cell stably transfected with an Ad El gene sequence that has no overlapping sequence with the genome of an El -deleted helper Ad genome is provided.
  • a method of generating a recombinant adenoviral vector by co-transfecting the helper or producer cell with a minimal Ad vector and an Ad-helper genome and/or infecting the cell with an Ad helper virus, and preparing a cell-free lysate of said producer cell is provided.
  • the cell-free lysate thus prepared contains infective, replication-impaired recombinant adenoviral vector particles, the majority of which include the minimal Ad vector DNA.
  • the present invention provides an animal model system for assessment of targeted integration as directed by the AAV integration mechanisms incorporated into the minimal Ad vectors of the present invention.
  • the present invention provides a methodology for the generation of transgenic mice harboring the human AAVSl integration sequence within their genome. Following injection of a minimal Ad vector into such an animal, targeted integration of the transgene into the AAVSl site may be evaluated.
  • Another object of the present invention is to provide minimal adenovirus vectors comprising HIV and/or HPV sequences, non-coding sequences, immunomodulatory sequences, and/or other nucleic acid sequences.
  • the present invention therefore, provides the reagents and methodologies needed to overcome many of the difficulties associated with gene therapy vectors that have been encountered by those skilled in the art.
  • the objectives described above as well as other objectives of the present invention will be understood in light of the detailed description of the invention provided below.
  • Figure 1 Protypical minimal adenoviral vaccine vectors: shown is a possible prototype minimal adenoviral vector useful for vaccine applications.
  • FIG. 1 Minimal Ad/HTV Constructs: shown are embodiments of minimal adenoviral vectors comprising HTV sequences.
  • the present invention comprises three components useful in generating adenoviral vectors capable of delivering prophylactic and/or therapeutic nucleic acid sequences including, but not limited to, HTV and/or HPV sequences to a target cell or tissue in vivo.
  • the components consist of a minimal viral genome, a helper virus, and a helper cell line.
  • the helper virus and helper cell line are utilized to package a minimal viral genome into viral particles for use in genetic medicine applications, including, but not limited to, genetic vaccination, gene therapy and/or gene delivery.
  • the minimal viruses generated using such a system have similar tropism and host range as the adenoviral strain from which the helper virus was derived.
  • the present invention further provides modifications of a minimal Ad vector to comprise elements derived from the adeno-associated virus (AAV).
  • the elements are those having the ability to promote integration of genetic material into a host cell genome.
  • the elements are utilized to promote integration of a reporter or effector gene of a minimal Ad vector into a host cell genome. In this manner, expression of the gene is observed in the host cell or tissue for a longer period of time than that of a conventional adenoviral vector.
  • the present invention further provides minimal Ad vectors that comprise elements for maintaining such vectors as an episome in a host cell or tissue to prolong expression of the delivered gene or genes. It has been determined that limited replication of the viral genome of El -deleted viruses in a host cell allows for longer term expression of a gene of interest as compared to those genomes that are not able to replicate (Lieber, et al (1996) "Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo" J. Virol, vol. 70, pp. 894-8960).
  • an object of this invention to incorporate into minimal Ad vectors of the present invention DNA sequences derived from the normal cellular genome or equivalent sequences that will facilitate DNA replication of the minimal Ad genome in the target cell.
  • DNA sequences derived from the normal cellular genome or equivalent sequences that will facilitate DNA replication of the minimal Ad genome in the target cell.
  • One such sequence that facilitates DNA replication is alphoid DNA.
  • a 16.2 kb sequence of alphoid DNA repeats allows DNA replication but not segregation of the DNA as an artificial chromosome (Calos, M.P. (1996) "The potential of extrachromosomal replicating vectors for gene therapy" Trends in Genetics, vo. 12, pp.
  • the present invention provides for the incorporation of the 16.2 kb sequence into the minimal Ad vector. Replication of the minimal Ad vector containing these sequences may extend the persistence of the minimal Ad vector DNA and expression of the gene of interest within the target cell.
  • Animal model test systems for evaluating the modified vectors of the present invention are also provided.
  • Animal models provided by the present invention include, but are not limited to: 1) transgenic mice comprising the AAVSl sequence incorporated into their genome for evaluating AAV-based integration mechanisms; and, 2) non-human transgenic animals comprising particular gene sequences operably linked to a developmentally-regulated promoter inserted into their genome.
  • a "transcriptional regulatory region or transcriptional control region” is defined as any nucleic acid element involved in regulating transcription of a gene, including but not limited to promoters, enhancers, silencers and repressors.
  • a "DNA fragment” is defined as a segment of a single- or double-stranded DNA derived from any source.
  • a “DNA construct” is defined as a plasmid, virus, autonomously replicating sequence, phage or linear segment of a single- or double-stranded DNA or RNA derived from any source.
  • An “expression cassette” is a DNA fragment comprising a coding sequence for a reporter or effector gene operably linked to a transcriptional regulatory region or a transcriptional control region sufficient for expression of the encoded protein in an appropriate cell type.
  • a “reporter construct” is defined as a subchromosomal and purified DNA molecule comprising a gene encoding an assayable product.
  • An “assayable product” includes any product encoded by a gene that is detectable using an assay. Furthermore, the detection and quantitation of the assayable product is anticipated to be directly proportional to the level of expression of the gene.
  • An “effector gene” is defined as any gene that, upon expression of the polypeptide encoded by the gene, confers an effect on an organism, tissue or cell.
  • a “transgene” is defined as a gene that has been inserted into the genome of an organism other than that normally present in the genome of the organism.
  • “Stable gene expression” is defined as gene expression that may be consistently detected in a host for at least a period of time greater than seven days.
  • a gene expressed in a "tissue-specific manner" is that which demonstrates a greater amount of expression in one tissue as opposed to one or more second tissues in an organism.
  • a “recombinant adenoviral vector” is defined as a adenovirus having at least one segment of heterologous DNA included in its genome.
  • “Adenoviral particle” is defined as an infectious adenovirus, including both wild type or recombinant.
  • the adenovirus may include, but is not limited to, a DNA molecule encapsidated by a protein coat encoded within an adenoviral genome.
  • a “recombinant adenoviral particle” is defined as an infectious adenovirus having at least one portion of its genome derived from at least one other source, including both adenoviral genetic material as well as genetic material other than adenoviral genetic material.
  • “Heterologous DNA” is defined as DNA introduced into an adenoviral construct that was isolated from a source other than an adenoviral genome.
  • a “treatable condition” is defined as a condition of an organism that may be altered by administration of a form of treatment including but not limited to those treatments commonly defined as being of medicinal origin.
  • a “genetic condition” is defined as a condition of an organism that is a at least partially the result of expression of at least one specific gene including but not limited to the wild-type form of that gene and any mutant form of that gene.
  • an “antigen” is defined as any molecule capable of inducing an immune response.
  • An “immunomodulatory gene” is defined as any gene that, upon expression of its nucleic acid or protein product, serves to alter an immune response, including both activation and repression or suppression of an immune response.
  • a “tumor suppressor gene” is defined as a gene that, upon expression of its protein product, serves to suppress the development of a tumor including but not limited to growth suppression or induction of cell death.
  • a “growth suppressor gene” is defined as a gene that, upon expression of its protein product, serves to suppress the growth of a cell.
  • An “oncogene” is defined as a cancer-causing gene.
  • a “ribozyme” is defined as an RNA molecule that has the ability to degrade other nucleic acid molecules.
  • the minimal Ad vector system consists of three major parts: 1) a packaging-attenuated helper Ad; 2) a cognate Ad vector having a minimal amount of the viral genome; and, 3) an Ad helper cell line that provide functions of El tr ns-activation like 293 cells and/or regulation of packaging signal for the helper Ad.
  • the packaging- attenuated helper Ad comprises the viral genetic material required for self -replication as well as trans-complementation of minimal Ad vector replication.
  • the helper Ad retains wild-type Ad genetic material except for an El deletion or substitution and a manipulated packaging signal useful in controlling or discriminating against packaging of the helper Ad in favor of packaging a minimal Ad vector of the present invention.
  • the minimal Ad vector comprises minimal Ad genetic material including only the inverted terminal repeats (ITRs) and a wild-type packaging signal as m-elements that serve to promote replication and packaging of the minimal Ad vector.
  • the remainder of the minimal Ad vector comprises transgene or heterologous DNA.
  • the Ad helper cell lines of the present invention are similar to A549 cells and the like in that the cell lines comprise Ad El genes and provide Ad El gene products that support replication of the helper Ad.
  • the cell lines may further comprise a control mechanism for attenuating packaging of the helper Ad.
  • the packaging protein of Ad is a tr ⁇ ns-acting factor present in low amounts in an infected cell and serves as the rate-limiting factor in the packaging of Ad.
  • the wild-type packaging signal possessed by the minimal Ad vector of the present invention, is recognized by the packaging protein with higher affinity than the manipulated packaging signal of the helper Ad, packaging of the helper Ad genetic material is partially or completely suppressed in the presence of the minimal Ad vector. This results in preferential packaging of the minimal Ad vector.
  • the proteins for viral DNA replication and those for capsid assembly must be provided in adequate amounts.
  • the proteins may be provided from several different sources, including but not limited to a plasmid, a cell line, or a virus.
  • the proteins are provided by the helper Ad.
  • the present invention allows for the helper Ad to remain fully functional in replicating itself within a helper cell such that large quantities of Ad structural proteins are available to the minimal Ad vector. In the absence of the minimal Ad vector, and without selection pressure of the packaging attenuation, the helper Ad is packaged, albeit slowly or ineffectively.
  • Viral DNA replication proteins are also required to amplify the minimal Ad vector DNA for generation of multiple copies of the minimal Ad vector.
  • the replication proteins may be provided from any of several different sources, including but not limited to a plasmid, a cell line, or a virus.
  • the proteins are provided by the helper Ad.
  • the minimal Ad vector comprising the wild-type packaging signal, is packaged into Ad virions as infective, replication-competent Ad particles.
  • helper Ad DNA is competed off by poor recognition or low affinity of the packaging protein for the manipulated packaging signal, and thus remains completely or partially free within the helper cells.
  • the minimal Ad vector system of the present invention makes it unique, sophisticated, and significantly advanced over Ad vectors that are currently available to one skilled in the art. These features include but are not limited to the following: 1) the minimal Ad vector exhibits minimal immunogenicity; 2) the minimal Ad vector is virtually incapable of generating replication competent adenovirus (RCA); and, 3) the minimal Ad vector may comprise much larger segments of heterologous DNA than conventional Ad vectors. Reduced immunogenecity and RCA generation (a major safety concern in the field of gene therapy) is possible because the minimal Ad vectors carry only a minimal amount of viral cis -element (ITRs and packaging signal), and as such, do not encode Ad proteins. A major source of immunogenicity and cytotoxicity of the currently available Ad vectors has thus largely been removed. The cytotoxic, inflammatory, and immunogenic responses normally resulting from expression of Ad viral proteins within a host cell or upon its cell surface are thus reduced.
  • the minimal Ad vector of the present invention further provides increased capacity for heterologous DNA than convention Ad vectors.
  • Wild-type Ad has an average genome size of 36 kb.
  • the maximal packaging capacity of Ad is roughly 105% of the genome, i.e. approximately 38 kb.
  • the minimal Ad vector of the present invention may comprise less than 1 kb of Ad genetic material; therefore, the capacity of the minimal Ad vector for heterologous DNA may be about 36 kb to about 37 kb.
  • the heterologous DNA may include but is not limited to a transgene expression cassette, a regulatory element, or a transcriptional control region operatively linked to a reporter or effector gene.
  • the expression cassette may include but is not limited to single or multiple expression cassettes.
  • the regulatory element may include but is not limited to a DNA sequence for controlling transgene retention, integration, transcription, and / or vector targeting.
  • the helper Ad vector comprises a wild-type Ad genome having a manipulated packaging signal and an altered El gene.
  • the helper Ad must be defective in replication, such as the currently available El-deleted or substituted viral constructs.
  • the helper For the purpose of controlling packaging in the presence of the minimal Ad vector, the helper must be also defective in packaging (detailed below). Therefore, the general structure of the helper can be summarized as an Ad vector having a wild-type genome except that the El region and packaging signal are manipulated. However, the other essential regulatory genes of Ad such as E2 and E4 may also be manipulated.
  • the viral genome may be split into fragments in order to further disable the replication competence of the helper Ad or to reduce the genome size of the helper Ad in order to separate it from the minimal Ad vector using a biological, biochemical, or physical method including but not limited to ultracentrifugation through a CsCl gradient.
  • a biological, biochemical, or physical method including but not limited to ultracentrifugation through a CsCl gradient.
  • both a defect in viral replication and attenuation in packaging of the helper Ad may be included in the design of the helper Ad.
  • the general function of the helper Ad The primary function of the helper Ad is to supply the capsid proteins required to package the minimal Ad vector. In order to provide the proteins, the helper Ad must be able to replicate within the host cell, although less efficiently than wild-type Ad.
  • DNA replication and transcription of the helper genome is not affected. If synthesis of the helper Ad genome were inhibited, the yield of the late gene products (the capsid proteins) would be altered and may adversely affect the titer of the minimal Ad vector (i.e., the titer will be reduced). For certain applications, removal of the helper Ad from the minimal Ad may not be necessary. In such situations, the stringency of packaging attenuation of the helper Ad may be greatly reduced.
  • Designs for packaging attenuation The purpose for attenuation of packaging the helper Ad is to reduce the potential for helper Ad contamination in preparations of the minimal Ad vector. This is especially important when a relatively pure batch of the minimal Ad vector is required for a particular application.
  • the packaging function of the helper Ad is designed to be defective but not completely disabled, because the helper Ad must be able to propagate, albeit slowly, in the absence of a minimal Ad vector.
  • the following genetic manipulations may be utilized to generate a packaging-attenuated helper Ad.
  • Packaging signal mutation The Ad5 packaging signal is composed of a repeated element that is functionally redundant (18). Partial deletions of the packaging signal elements have been shown to reduce the yield of mutant Ad from several fold to approximately a hundred fold as compared to that of Ad having a wild-type packaging signal (18).
  • the design of the packaging signal mutation of the present invention may therefore incorporate a partial deletion of the consensus adenosine-enriched motif (e.g., "A-repeat”: TAAATTTG) from the wild-type Ad packaging signal.
  • Ad5 packaging signal has a consensus A (adenosine) enriched motif (e.g. A-repeat: TAAATTTG), incorporation of an array of tandem repeats including but not limited to a selected A-repeat or any synthetic DNA motifs that may alter the affinity of the packaging protein for the artificial packaging signal.
  • A-repeat TAAATTTG
  • the Ad packaging signal is a specific DNA sequence that is recognized and bound by the packaging proteins. In order to interfere with the effective binding of the packaging proteins to the signal, other DNA sequences may be placed in proximity to or within the A-repeat array of the helper Ad packaging signal. The inserted DNA sequences allow binding by their cognate DNA binding proteins that may positionally compete off the binding of the Ad packaging proteins to the Ad packaging signal.
  • Packaging signal relocation The wild-type Ad packaging signal is positioned at the left end of the wild-type Ad genome. Investigators have found that the packaging signal may be located at the right end and retain its function (75) indicating that the packaging signal may be relocated. Positioning the manipulated packaging signal in a location other than wild-type may be useful to further attenuate the packaging efficiency of the helper Ad. In addition, relocation of the packaging signal to another region of the Ad genome may be helpful in minimizing the possibility of reversion of the helper Ad back to wild-type Ad through homologous recombination between the engineered packaging signal of the helper Ad and the wild-type packaging signal of the minimal Ad vectors (i.e., generation of RCA).
  • c-s-elements and trans-acting factors. Therefore, other possible designs may be oriented towards manipulation of either or both of these two factors.
  • An example of cis- elements that may be manipulated is the A-repeat motif.
  • An example of a trans-acting factor that may be manipulated is a packaging protein. Further consideration should be a controllable mechanism of packaging without sacrificing the high titer output of the minimal Ad vectors by the system.
  • Ad vectors may be utilized as circularized plasmids by fusion of the Ad ITRs (54).
  • the simplest plasmid form of the minimal Ad vector of the present invention is a circular DNA molecule comprising an ITR fusion sequence (comprising an Ad ITR having a wild-type packaging signal), a plasmid DNA replication origin, and a polycloning site consisting of one or multiple restriction enzyme sites.
  • the ITR fusion sequence includes the left end of the wild-type Ad, preferably from map unit 0 to 1, and the right end, preferably from map unit 99 to 100.
  • An Ad DNA replication origin is located in each ITR and the wild-type packaging signal is located adjacent to the left ITR.
  • the structural and functional possibilities of the minimal Ad vectors Other DNA sequences and elements including, but not limited to, those listed below may be included in a minimal Ad vector:
  • An expression cassette is a basic transcription unit.
  • a simple expression cassette of a given gene generally comprises a transcriptional control region, a gene of interest (i.e., heterologous DNA, insert DNA), and a polyadenylation (poly A) signal.
  • a gene of interest i.e., heterologous DNA, insert DNA
  • poly A polyadenylation
  • two or more genes may be included as bi- or polycistronic units, as long as additional elements for translation or splicing of RNA are provided between the genes.
  • minimal Ad vectors comprise one or multiple expression cassettes.
  • Functional elements for vector DNA retention Elements that may assist in integration of the expression cassette into target cell genome (i.e., AAV integration elements) or maintain the minimal Ad vector as an episomal form in a host cell. Elements that have been shown to assist in integration are the inverted terminal repeats (ITRs) and the Rep78/68 proteins of the adeno-associated virus (AAV). AAV utilizes these elements to achieve specific integration of its genome in human chromosome 19 (19ql3.3-qter) at a site named AAVSl.
  • ITRs inverted terminal repeats
  • AAV adeno-associated virus
  • AAV has been considered as a candidate vector for gene therapy, several limitations have been identified by investigators. AAV is limited by: 1) low capacity for exogenous DNA (4.3 kb); 2) difficulty in achieving high titers in large-scale preparations; and, 3) loss of specific integration of the recombinant AAV. Each of these have proven to be difficult challenges to those skilled in the art.
  • the present invention combines the advantages of the minimal Ad vector with the integration capacity of AAV by incorporating the AAV-ITR sequences and Rep 78/68 expression cassette (Rep expression cassette) into the vector.
  • Mechanisms that may also be included in the minimal Ad genome include extrachromosomal replication sequences (Calos, M.P. (1996) "The potential of extrachromosomal replicating vectors for gene therapy” Trends Genet., vol. 12, pp. 463-466).
  • Such sequences comprised of either chromosomal or viral sequences, serve to enable the vector to efficiently replicate and be retained within a mammalian cell.
  • the sequences may include a replication component such as human genomic DNA and/or a retention component such as human centromere sequence or sequence derived from the Epstein-Barr virus (EBV) such as the oriP family of repeats and / or EBNA-1 (Calos, M.P. (1996) supra).
  • EBV Epstein-Barr virus
  • the human human genomic DNA may comprise a telomere and / or alphoid DNA (Calos, M.P. (1996) supra).
  • telomere and / or alphoid DNA Calos, M.P. (1996) supra.
  • these sequences serve to lengthen the duration of expression of the effector or reporter gene within the host cell. Such functions would be useful in utilization of the minimal Ad vector for gene therapy.
  • Regulatory elements for control of DNA transcription Elements having transcriptional regulatory function including but not limited to enhancers, repressors, activator- binding sites, introns, and 5' or 3 '-untranslated regions. Various combinations of such elements may be incorporated into the minimal Ad to enhance or control expression of a gene of interest.
  • Targeting can be achieved by several methods including but not limited to vector surface modification and tissue-specific expression. Tissue specific promoters may be utilized to drive gene expression in a specific cell type or tissue. Many such promoters are available to one of skill in the art.
  • Further supporting elements may include but are not limited to DNA replication origins for prokaryotic or eukaryotic cells, plasmid or vector selection markers, and vectors backbones. The skilled artisan would understand the need to incorporate one or more of such supporting elements into the minimal Ad vector as necessary.
  • Designs for high titer production of the minimal Ad vectors High-titer production of the minimal Ad vectors is another major aspect of this invention.
  • One advantage of Ad vectors over other viral vectors is that Ad particles are conducive to preparation of high-titer preparation stocks (Hitt, et al In Methods in Molecular Genetics, Adolph, K.W., Ed., vol. 7, pp. 13-30, Academic Press: San Diego, CA).
  • High-titer propagation of Ad is possible due mainly to the large quantity of viral capsid proteins and viral genome copies produced wtihin a host cell such as a 293 cell during infection. Listed below are some of the factors that may be considered in designing methods for generating high-titer minimal Ad vectors:
  • Ad has its own enzymatic system for DNA replication.
  • the E2 region proteins are the major trans-acting elements responsible for viral DNA replication.
  • the replication origins are the ' s-elements located at the either or both ends of the viral genome.
  • a sufficient quantity of E2 proteins must be provided by the helper virus.
  • High-level expression of E2 proteins (encoded within the E2 region of Ad) is ensured by proper design of the helper virus genome.
  • Other such mechanisms for increase in copy numbers of the minimal Ad genome may also be considered. Such mechanisms may include but are not limited to insertion of the the SV40 origin of DNA replication (McGrory, et al.
  • a higher number or more efficient packaging sequences may be utilized by, for example, incorporating a greater number of tandem repeats at one or both ends of the minimal Ad genome, or by incorporation of one or multiple synthetic packaging signals that function in a more efficient manner than the wild-type packaging signal.
  • the cell line of the present invention (that serves as the host cell) provides several important modifications that improve upon conventionally utilized cell lines, (e.g., A549 cells, 293 cells (ATCC# CRL1573) and the like).
  • the host cell comprises a nucleic acid sequence encoding an Ad-El fragment for trans-activation of the transcription program of the helper Ad genome.
  • a cell line of present invention may comprise nucleic acid sequence encoding the El fragment having no overlapping nucleic acid sequence with the helper Ad genome.
  • the present invention therefore, eliminates one of the current difficulties associated with Ad vectors: generation of wild-type Ad or replication-competent Ad (RCA) through homologous recombination.
  • Other elements may include, but are not limited to, genes involved in the support of high copy- number production of the minimal Ad vector, enhancing packaging of the minimal Ad vector, and/or attenuating the packaging of the helper Ad.
  • Assistance mechanisms for packaging attenuation of the helper Ad may include interference with the binding site for the packaging protein by placement of a binding site for a different protein nearby the packaging protein binding site within the helper Ad genome.
  • Such a system may include but is not limited to utilization of the tetracycline-repressor (Tet-R), a recombinase, and / or an altered packaging protein.
  • Tet-R tetracycline-repressor
  • the different protein is expressed within a host cell.
  • Tet-R may bind to a manipulated packaging signal of a helper virus comprising a binding site for Tet-R, the tet-operon (Tet-O), and thereby repress packaging by inhibiting binding of the packaging protein. Binding of Tet-R to Tet-O is controlled by tetracycline. Addition of tetracycline into the cell culture medium results in binding of tetracycline to the Tet-R and prevents it from binding tet-O. Removal of the tetracycline frees Tet-R for binding to the engineered packaging signal and serves to further attenuate packaging of the helper virus.
  • a recombinase such as Cre or Flp may also inhibit packaging provided the packaging signal of the helper virus is flanked by a recombination site, such as lox-p or FRP, respectively (Parks, et al (1996) "A helper-dependent adenovirus helper system: Removal of helper virus by cre-mediated excision of the viral packaging signal” Proc. Natl. Acad. Sci. USA, vol. 93, pp. 13565-13570; Broach, et al. (1982) "Recombination within the yeast plasmid 2mu circle is site-specific" Cell, vol. 29, pp. 227-234).
  • Other genetic modifications within the helper virus genome may also be provided separately or in addition to those listed above to further attenuate helper virus replication.
  • the packaging protein may be altered by any of several methods including but not limited to utilization of a specific serotype or species difference in the packaging signal to differentiate packaging of the minimal Ad from the helper Ad provided the specific packaging protein of Ad is identified. Additionally, the packaging protein may be altered by genetic modification of the gene encoding the packaging protein. The modification may alter the packaging protein such that its binding preference for the wild-type packaging signal is increased. The modified packaging protein, then, may further provide preferred packaging of the minimal Ad genome.
  • a. Delivery of genes for therapy of genetic diseases in vivo Large capacity for exogenous nucleic acid is necessary for delivery of a large therapeutic gene or multiple genes as well as for transfer of regulatory elements and/or other related genes along with the primary therapeutic genes that will determine controllable or tissue-specific expression and may result in a more effective therapeutic effect.
  • An example includes but is not limited to cystic fibrosis in which controllable expression of several genes is required to optimize cystic fibrosis gene therapy.
  • Gene therapy of Duchenne muscular dystrophy (DMD) is another example of a condition for which treatment would require a large capacity vector.
  • Ad vectors demonstrate high levels of infectivity in cultured tumor cells and different types of solid tumor models in vivo. This characteristic of the Ad vector has been utilized in the treatment of cancer. The efficacy of treatment depends upon the genes that are delivered by the vectors. Multiple genes including but not limited to those having combined functions of tumor suppression and immunomodulation are utilized to optimize the anti-cancer effect.
  • the minimal Ad vector has the capacity to deliver multiple genes and is useful in constructing anti- cancer Ad vectors for intratumoral injection.
  • Transplantation requires transient or permanent suppression of the host immunity.
  • immune suppression genes into cells or tissues including, but not limited to, graft cells or graft tissues may be an alternative approach to the administration of immunosuppressive agents.
  • genes encoding immune suppression proteins useful in the present invention may include, but are not limited to, TGF-B, EL-10, viral proteins HSV-ICP47 and CMV-USll, and secretable Fas-ligand proteins that may be delivered alone or in combination by the minimal Ad vectors of the present invention. d.
  • Ad vectors have a distinct advantage over other viral vectors in that production of high titer stocks is possible, which is useful for in vivo gene therapy. Because the minimal Ad vectors contain only minimal amounts of ' s-elements of the Ad genome, the immunogenicity of minimal Ad is minimized. Therefore, the minimal Ad vector will be useful for modifying target cell function or regulating target cell growth in vivo by genetic modification. e.
  • transgenes to target cells or tissues in vivo by surface modification of the vectors:
  • the genes encoding the adenoviral hexon and fiber proteins are engineered to fuse with certain epitopes or ligands (e.g., the protein A that binds to Fc fragment of IgG) present on the target cell surface.
  • These modified genes are incorporated into the recombinant viral genome for generation of the viruses having surface sites that interact with ligands that function as targeting agents on the target cell surface.
  • the viral particles thus produced have tissue or cell recognition capabilities.
  • the immunogenicity of the El-substituted Ad vectors may provide benefits, and has been used in development of Ad-based recombinant vaccines.
  • Minimal Ad vectors utilized in this type of application use the helper virus including but not limited to El- substituted Ad vectors as well as co-delivery of genes encoding antigens and immunogens that provide immunization.
  • minimal Ad vectors comprising large portions of the genome of an infectious agent (e.g., HJN, HPV, and the like) that will direct expression of most proteins expressed by the infectious agent without replication or growth of the agent.
  • an infectious agent e.g., HJN, HPV, and the like
  • HPV Human Papilloma Virus
  • nucleic acid encoding immunogens from multiple pathogens into a single vector.
  • HJN antigens and HPV antigens into a single minimal Ad, thus providing a method for immunizing a host against both pathogens using a single vector.
  • an expression cassette encoding an immunomodulating protein such as a cyto ine (e.g., GM-CSF) in order to enhance the immune response.
  • an immunomodulating protein such as a cyto ine (e.g., GM-CSF)
  • cyto ine e.g., GM-CSF
  • One of skill in the art would understand the various combinations of such immunogens and/or immunomodulating proteins may be incorporated into a single minimal Ad for administration to a host.
  • Transient gene retention and expression associated with the use of conventional Ad vectors has prevented Ad from being widely used in ex vivo gene delivery protocols.
  • the minimal Ad vectors having DNA retention mechanisms, are useful for this purpose. Also, the high infectivity of Ad in cultured cell lines make the minimal Ad vectors very effective gene delivery system for ex vivo approaches toward gene therapy.
  • the minimal Ad vector system itself has a great value for basic adenovirology studies. The construction and demonstration of the feasibility and operation are already a breakthrough in the field.
  • the helper Ad and the minimal Ad provide convenient tools for study of the Ad and its potential applications. This is particularly true for the minimal Ad vector. The characterization of the replication, packaging, and propagation efficiency of the minimal Ad will provide the field with important new information, which was previously unavailable. i.
  • Ad vectors have been used together with polylysine, liposome, and other conjugation materials as a gene delivery complex.
  • the minimal Ad vectors can also be used with these compounds as well as any other copound that comprise the ability to serve as a gene delivery complex.
  • the minimal A vector system has a great potential to be used for gene transfer and therapy in addition to what have been discussed above. Such possibilities will arise with further developments in the field of genetic medicine, including, but not limited to, genetic vaccination, gene therapy, gene transer, and/or gene delivery.
  • Non-limiting examples of diseases and genes that may be treated or utilized, respectively, using minimal adenoviral vectors of the invention are summarized in Table 1. Table 1.”
  • ⁇ -VLDL nicotmic dysbetahpoproteinemia
  • fructose causes the Elimination from the diet of all tolerance d aldolase B accumulation of fructose 1- sources of sucrose and fructose, phosphate and hence multiple with supplement of vitamin C dysfunctions m small testing, liver, and kidney lycogen storage disease ⁇ 1 100,000 Glucose 6-phosphatase Hypoglycemia, hyperhpidemia, Dietary restriction, nocturnal pe la (von Gierke hyperu ⁇ cemia, and hyperlactic nasogast ⁇ c infusion in early sease) acidemia Glycogen accumulation infancy portacaval shunts, Liver in liver and kidney transplantation lycogen storage disease ⁇ 1 125,000 Amylo-1, 6-glucos ⁇ dase A glycogen with shorter outer Dietary restriction pe HI (debrancher enzyme) chains (limit dext ⁇ ) in liver and/or muscle Moderate hypogly
  • compositions comprising minimal Ad vectors of the present invention.
  • the pharmaceutical compositions may be made up m a solid form (including granules, powders or suppositories) or m a liquid form (e.g., solutions, suspensions, or emulsions).
  • Solid dosage forms for oral administration may include capsules, tablets, pills, powders, and granules.
  • compositions may also comprise adjuvants, such as wetting sweetening, flavoring, and perfuming agents
  • adjuvants such as wetting sweetening, flavoring, and perfuming agents
  • the compounds of the present invention can be used in the form of salts derived from inorganic or organic acids. Numerous references that further teach pharmaceutical
  • compositions and/or practices are known to those skilled in the art, including, but not limited to: Remington: The Science and Practice of Pharmacy (formerly Remington's Pharmaceutical Sciences), Mack Publishing Co.; Delgado & Remers, Wilson and Grisvold's Textbook of Organic, Medicinal and Pharmaceutical Chemistry, Lippincott-Raven; Bolton, Pharmaceutical Statistics, M. Dekker Publishing; Tietz's Fundamentals of Clinical Chemistry, Burtis, Ed., W.B.
  • vectors of the invention can be administered as the sole active pharmaceutical composition, they can also be used in combination with one or more vectors of the invention or other agents.
  • the therapeutic agents can be formulated as separate compositions that are given at the same time or different times, or the therapeutic agents can be given as a single composition.
  • Example 1 Construction and Characterization of A Packaging-Signal Mutated Helper Ad and Minimal Ad Vectors That Carry Green Fluorescence Protein (GFP) Reporter Gene
  • Mutant dllO/28 (also described as dl309-194/243:274/358) contains a deletion between nt 194 to 243 and between 274 to 358 of Ad5.
  • dllO/28 virus was generated by the method of Stow (89) by ligation of a plasmid containing the left end of Ad5 with this double mutation (pElA-10/28) and the rest of Ad5 genome (90).
  • dllO/28 showed a 143-fold decrease in virus yield in a single virus infection and, when co-infected with wild type virus, was not detected.
  • helper virus containing the same mutation as dllO/28 it should be possible to amplify the virus, although at low yields, and in the presence of mini-viral vector containing the wild type packaging signal the helper virus should remain unpacked.
  • the packaging signal was amplified by PCR from pElA-10/28 using the following primers:
  • R7 5'- GGAACACATGTAAGCGACGG (SEQ LD NO: 3) (nt 137 to 163 of Ad5 with AflLII site underlined)
  • R8 5'- CCATCGATAATAATAAAACGCCAACTTTGACCCG (SEQ LD NO: 4) (nt 449 to 421 with Cla I site attached).
  • GT4004 derives from pXCX2 (91) by extending the Ad5 left region from Xhol site (nt 5792, 16 mu) until SnaBI site (nt 10307, 28 mu), therefore GT4004 contains the left end of Ad5 from 0 mu to 1.2 mu with the Afl III site at 0.38 mu, an El deletion from 1.2 mu to 9.2 mu with Cla I site in this deletion point and the rest of the left arm of Ad5 until 28 mu. This extended left arm increases the frequency of homologous recombination used to generate recombinant virus.
  • GT4004 with the wild type packaging signal substituted by the deleted one was named as GT5000.
  • the ⁇ -gal expression cassette from pTk ⁇ (Clontech, Ca.) was cut as a Sail fragment, blunted with Klenow enzyme and inserted into the blunted Clal site of GT5000.
  • the resulting plasmid, GT5001 contains therefore the double-deleted packaging signal and the El region of Ad5 replaced by the ⁇ -gal gene driven by the Tk promoter. This construct allows for detection of helper virus by X-gal staining.
  • helper virus To generate the helper virus the method described by Graham and Prevec was used (91). An early passage of 293 cells obtained from ATCC, were grown in MEM-10% Horse Serum and seeded in 60 mm plates. At 30% confluence cells were cotransfected by CaPO 4 using 2 mg of GT5001 and 4 mg of pJM17 (91) per plate. Three days after cotransfection cells were overlaid with medium containing 0.5 % agarose and thereafter the medium above the overlay was changed every-other day. When plaques became visible, X-gal (40 mg/ml in DMSO) was directly added to the medium to 100 mg/ml an let incubating overnight. Plaques producing the desired helper virus were identified by the blue color.
  • DNase I was inactivated and viral capsids were opened by adding: 32 ml EDTA (0.25 M), EGTA (0.25 M), 10 ml SDS (20%), 5 ml Proteinase K (16 mg/ml) and incubating at 56°C for 2h. After one phenol:chlorophorm:isoamyl alcohol (1:1:1/24) extraction, 1 ml of yeast tRNA (lOmg/ml) was added to help precipitation of viral DNA which was collected by centrifugation at 12000 rpm in a microcentrifuge and resuspended in 20 ml of HO. 5 ml were used for a PCR reaction with primers R7 and R8.
  • AdHelper- ⁇ gal AdH ⁇
  • the virus was extracted at 48 h post-infection by centrifugation of the collected cells at 800 g for 5 min and three cycles of quick freeze and thaw of the cell pellet.
  • This crude extract from X cells was used to infect 3X cells (amplification scale was 1 to 3 in contrast to 1 to 20 for a virus with wild type packaging signal) and plaques identified by staining with X-gal.
  • the deleted size of the packaging signal was verified by PCR of the supernatant. This deletion and the ⁇ -gal expression were stable in all the passages analyzed.
  • AdH ⁇ was purified by CsCl. Purification was done by three cycles of freeze-thawing, layering the lysate onto a step gradient of 0.5 ml CsCl 1.5 mg/ml + 2.5 ml CsCl 1.35 mg/ml + 2.5 ml CsCl 1.25 mg/ml, and centrifuging in a SW41 Beckman rotor at 10°C, 35000 rpm, lh. The collected virus band was mixed with CsCl 1.35 mg/ml and centrifuged for 18 h as before. The virus band was dialyzed twice against PBS and once against PBS-10% glycerol, and stored at -80 '°C.
  • the virus-containing solution was serially diluted in D-MEM 10% FBS (1:10 dilution until 10 "12 ) and used to infect 293 cells at 90% confluence (0.5 ml/well in 6 well-plates). After 1 h infection at 37°C, the viral suspension was replaced by fresh medium. The next day, cells were overlaid with medium containing 0.5% agarose, 0.025% yeast extract and 5 mM Hepes pH 7.4. Plaques were counted after 6 to 10 days.
  • PFU plaque forming units
  • the titer obtained after amplification and purification of AdH ⁇ was about 10 9 PFU/ml (virus purified from 20 plates of 150 mm 2 and resuspended in a final volume of 1 ml). This titer is about lOOx lower than that obtained with a similar viral vector containing the wt packaging signal.
  • the basic minivirus structure is therefore a plasmid that contains the left end of Ad5 (including the 103 nt-ITR and the packaging signal until nt 358) fused to the right end of Ad5 (at least including the 103 nt-ITR).
  • the initial approach used to test the mini- viral vector system included the generation of progressive deletions in plasmid pJM17 that contains a functional ITR fusion.
  • pJM17 is a plasmid that contains the entire genome of Ad5 as a DNA molecule circularized at the ITR sequences and a pBR322 derivative, pBRX, inserted in E1A (providing the bacterial replication origin and ampicilin and tetracycline resistant genes) (93).
  • E1A providing the bacterial replication origin and ampicilin and tetracycline resistant genes
  • pJM17 was cut with Ascl and religated obtaining pBRX-AscI. This removed from mu 43.5 to 70.2 of Ad5 which completely deletes E2A (DNA binding protein) and L3 (hexon, hexon-associated proteins and 23K protease), and partially deletes L2 (penton base and core proteins) and L4 (hexon-associated protein, hexon-trimer scaffold protein, and 33K protein). This deletion abrogates replication and capsid formation from the circular viral DNA, rendering it completely dependent on a helper virus that provides in trans a sufficient quantity of the required replication proteins.
  • E2A DNA binding protein
  • L3 hexon, hexon-associated proteins and 23K protease
  • L2 penton base and core proteins
  • L4 hexon-associated protein, hexon-trimer scaffold protein, and 33K protein
  • pBRX-AscI contains a unique Spe I site at 75.2 mu (L4) into which a 2.7 kb DNA fragment comprising a green fluorescence-protein (GFP) expression cassette was inserted to give M32 (Minivirus of 32 kB).
  • This GFP-cassette is composed of a CMN enhancer/ ⁇ -actin promoter (CA promoter), the Aequorea victoria GFP cD ⁇ A, and a SN40 polyA signal.
  • CA promoter CMN enhancer/ ⁇ -actin promoter
  • the use of GFP in the mini-viral vector constructs was utilized in order to determine the presence of the vector in cells using the fluorescence microscopy. Fluorescent microscopy represents one of several methods including but not limited to flow cytometry that may be utilized to detect cells expressing GFP.
  • AdH ⁇ AdH ⁇ can be detected by the blue color of X-gal staining.
  • M32 was cut with Mlul and religated, this removes from 31.4 to 34.5 mu which partially deletes LI (52K, 55K and penton-associated proteins).
  • M28 M32 was cut with Mlul and Ascl and religated, this removes from 31.4 to 43.5 mu which completely deletes LI and the L2 portion that still remained in M32.
  • M28 M28 was cut with Rsr II and Spe I and religated, this removes from 30.9 to 75.2 mu extending the LI and L4 deletions.
  • M32 was digested with ⁇ si I and religated.
  • the ⁇ si I fragment from 32.2 mu to the CA promoter (with a ⁇ sil site next to the fusion with 75.2 mu), containing the GFP cassette, was religated so the ⁇ si I site of the CA promoter ligated to 5.5 mu and the ⁇ si I site at 32.2 ligated at 75.3 mu. This abrogates expression of all proteins between 5.5 to 75.3 mu including E2b (terminal protein, DNA polymerase) and IVa2 proteins.
  • M23 was cut with Mlu I and Asc I, which removes the region from 34.5 to 43.5 mu of the Nsi I fragment of M23, and religated,.
  • mini-viral vectors were constructed by subcloning the minimal cis elements necessary for replication and packaging, including the ITR sequences and the packaging signal, into a small plasmid such as pBluescript (Stratagene) and progressively adding the transgene cassettes and other elements that could improve the therapeutic potential of the viral vector such as elements for episomal maintenance or chromosomal integration.
  • pBluescript Stratagene
  • the head-to-tail fused ITRs and the packaging signal next to the left ITR (ITR/ITR+pac)were cut from pBRX-AscI with Eco47IIJ (98.7 mu) and PvuII (1.26 mu) blunted and subcloned into Smal - EcoR V of pBluescript, respectively.
  • the resulting plasmid, pBS/MinilTR or GT4007 is a 3.8 minivirus plasmid with no expression cassette and several unique restriction sites flanking the ITR/ITR+pac.
  • the GFP-expression cassette described above was subcloned into pBS/MinilTR to generate M6.5.
  • An internal ribosome entry site (IRES) and a neomycin (neo) cDNA were then subcloned between the CA promoter and the GFP gene to produce M7.9.
  • a similar minivirus was generated comprising neo and GFP in two separate cassettes, M8.5: the Nru I-BstE II fragment from pREP9 (Invitrogen) containing the Tk promoter, neo cDNA and Tk pA, was blunted and subcloned into Stu I- EcoR I of M6.5.
  • M8.5 was used to construct a larger miniAd plasmid in order to test the packaging of miniAd vector with a complete substitution of the adenoviral genome by exogenous DNA.
  • AdH ⁇ was utilized to support the replication and packaging of the various minimal Ad plasmids. It was important to determine whether the minivirus could be packaged. It was also important to determine whether the size of the minivirus affected the packaging efficiency.
  • adenovirus 100% of the wild type length of DNA is most efficiently packaged, and as the genomic size increases to a maximum of 105% or decreases below 100%, packaging becomes less efficient.
  • a lower limit of 69% (25 kb) has been suggested (94) when wild type adenovirus was used to complement the defective minivirus, but the use of an attenuated helper virus allowed the amplification of a shorter minivirus.
  • a CsCl-purified minivirus plasmid was cotransfected with the linear viral DNA extracted from purified AdH ⁇ . Note that the method utilized to purify the viral DNA is subjected to SDS and Proteinase K which destroys the terminal protein responsible for priming replication. This method was utilized to avoid giving the helper virus a replicative advantage over the minivirus plasmid which also lacks the terminal protein. Accordingly, complementation by direct infection with AdH ⁇ did not rescue minivirus.
  • Cotransfection was accomplished using Ca.PO 4 and 2 mg of mini-viral plasmid and 1 mg of viral DNA per well in a 6 well-plate with 293 cells at 50% confluence. After an overnight incubation in the transfection mixture, the medium was changed and the efficiency of transfection was assessed by examination of cells using fluorescence microscopy. With CsCl-purified plasmids this efficiency reached 100% irrespective of the size of the plasmids. Six days post-cotransfection, CPE was observed and virus was harvested from the cells by three cycles of freeze and thaw.
  • the minivirus plasmid was cotransfected with pBHGlO, a circularized adenovirus plasmid similar to pJM17 incapable of being packaged due to a complete deletion of the packaging signal (95).
  • This plasmid produces all the early proteins necessary for replication as well as the late proteins that form the capsid.
  • the miniviral vector will be the major nucleic acid encapsidated. However, when the minivirus is released to the neighbor cells it will not be amplified because is defective.
  • the cell monolayer was infected with AdH ⁇ at a multiplicity of infection (moi) of 10 plaque forming units (pfu)/cell.
  • moi multiplicity of infection
  • pfu plaque forming units
  • the lysate (passage 0 of the produced minivirus) was used to infect a fresh monolayer of 90% confluent 293 cells (using 1 to 3 amplification scale). The day after infection, the presence of minivirus was observed by fluorescence and the presence of helper confirmed by X-gal staining. If any helper virus was present in the lysate, further incubation of the cells would lead to the amplification of the mini- virus + helper mixture with the appearance of CPE (the new lysate of this monolayer will be considered as passage 1 of the minivirus). If no helper was present in the lysate, the minivirus alone would not be packaged and only by the addition of new helper would the CPE appear. Therefore, the presence of the helper was assessed by X-gal staining and, with much higher sensitivity, by the appearance of CPE.
  • M6.5, M7.9 and M8.5 no fluorescent plaques were found, indicating very inefficient or absent packaging. This could reflect a packaging lower limit somewhere between 8.5 Kb and 20 Kb.
  • the titer increased until all cells became fluorescent following infection. This occurred, for example, at passage 4 of M32.
  • passage 8 was reached by continuously passing M32 at 1 to 3 amplification scale, enough virus was obtained to infect 75 plates of 150 mm 2 .
  • CPE CsCl gradient as described above. In the gradient four bands were observed, three upper (and therefore lighter) bands and one thicker band in the middle of the centrifuge tube. Every band was collected separately by aspiration from the top of the tube, and dialyzed.
  • the results indicate that the helper used with the partial deletion in the packaging signal taken from the dll8/28 virus is able to complement the large deletions in the mini-viral vector system but it is still packaged in the presence of minivirus.
  • This helper can be used when a pure population of minivirus is not critical, for example in an antitumoral vector system where a minivirus containing several therapeutic genes (for example, interleukins and tumor-suppresser genes) can be combined with this helper containing another therapeutic gene. When higher minimal Ad to helper ratio is required, this helper needs to be further attenuated in its packaging.
  • GAL4 is a sequence-specific DNA-binding protein that activates transcription in the yeast Saccharomyces cerevisiae.
  • tetO comes from the TnlO -specified tetracycline-resistance operon of E. coli, in which transcription of resistance- mediating genes is negatively regulated by the tetracycline repressor (tet R) which binds a 19- bp inverted repeat sequence 5'-TCCCTATCAGTGATAGAGA-3' in tet O (98, 99).
  • a synthetic sequence has been utilized to replace the sequence between Xho I and Xba I (nt 194, 0.5 mu to nt 452, 1.25 mu ) of GT5000.
  • Four synthetic sequences have been designed. All four synthetic sequence contain the Ad5 packaging element ( A repeats ) I, II, VI and VII.
  • Three or four repeats of 17-mer GAL4 binding sequences (5'-CGGAGTACTGTCCTCCG-3') (97) or 19-mer tetO sequences ( 5'-TCCCTATCAGTGATAGAGA-3') (100, 102) were introduced around or between these A repeats.
  • adenoviral vectors used in gene therapy applications were designed to have deletions in the El region of the adenovirus 5 (Ad5) genome.
  • the El region, not including region IX, consists of 9% of the left end of Ad5 (1.2 - 9.8 map units), and encodes two early region proteins, El A and E1B.
  • E1A/E1B is required for virus replication and for expression of all other Ad5 proteins such as E2-E4 and late proteins (100).
  • Deletion of El creates a replication-incompetent virus that, in theory, is silent for expression of all Ad5 proteins and expresses only the transgene of interest.
  • E1A and E1B are also of interest for safety reasons, since these two proteins, in combination, have been implicated in oncogenic transformation of mammalian cells (101-103). All of the Class I adenovirus vectors used to date in human clinical trials, as well as, the novel packaging-deficient helper virus described in Example 1 are deleted for El.
  • El-deficient adenoviral vectors are propagated in an Ad5 helper cell line called 293 (104).
  • 293 cells were derived by transforming human embryonic kidney cells with sheared fragments of Ad5 DNA. Genomic analysis revealed that 293 cells contain four to five copies per cell of the left 12% of the viral genome (including the entire El region) and approximately one copy per cell of 9% of the right end, the E4 region (105).
  • recombination in 293 cells can also cause deletions and rearrangements that effect transgene expression, thereby decreasing the titer of functional adenovirus particles.
  • cell lines have been developed using defined Ad5 DNA fragments, including the El region, however these cell lines retain significant sequence overlap with homologous sequences in the El -deleted adenovirus vectors, which allows for undesirable homologous recombination events and the possibility for generation of RCA (107, 108).
  • Ad5 helper cell line which harbors only the E1A/E1B sequences required for complementation, and does not contain any homologous sequences that overlap with regions in the El-deficient adenovirus.
  • a contiguous 2194 bp Xbal to Afl II (Ad5 bp 1343-3537) was cloned from pBRXad5XhoICl into the same vector.
  • the resultant 3075 bp El fragment (in pSL301) contains the TATA box and RNA cap site for EIA, EIA coding sequence, complete E1B promoter, and E1B coding sequence, including the stop codon for E1B p55 protein, but not including region IX.
  • Ad5 El A/E1B fragment (Ad5 bp 462-3537) was isolated, blunted with Klenow enzyme, and blunt-end ligated into the EcoRV site of the mammalian expression vector, pCDNA3 (Invitrogen), under control of the CMV promoter/enhancer. This process generated an Ad5El expression vector, CMV-E1.
  • the CMV-E1 expression vector (including the G418 resistance gene, neo) was transfected using Lipofectamine (Gibco/BRL) into A549 human lung carcinoma cells and G418 R colonies were isolated. Single-cell clones were screened for functional E1A/E1B expression.
  • CPE cytopathic effect
  • A549E1-68 displayed 100% CPE in 3 days (similar to that observed for 293 cells). This clone also showed high infectivity, in that virtually 100% of the cells fluoresced green, as determined microscopically, 24 hrs. post-infection. Infection with the El-deleted adenovirus, Ad5CA-GFP generated a clear area in the center of its plaque, which is evidence of the CPE caused by El- complemented virus amplification.
  • A549 cells at sub-confluent density, grow as distinct single cells with an elongated, fibroblast-like morphology, whereas, the El cell line, A549E1-68, grows as colonies of cells with a more cuboidal morphology.
  • A549E1-68 was compared with 293 cells for production of El-deleted adenovirus (Ad5CA-GFP) by plaque assay and found to produce an equivalent titer of complemented virus (7 x 10 9 PFU for A549E1-68 vs. 9 x 10 9 PFU for 293).
  • A549E1-68 produced a band of approximately 55 kd using a monoclonal Ab specific for E1B p55. This 55 kd, ElB-specific band, as well as secondary background bands, were observed in 293 cells also. Extra “background” bands found in both experimental and control lanes have been observed by other authors and have been attributed to co-immunoprecipitation of a variety of proteins including, cyclins, p53, and Rb. Unlike A549E1-68 and 293 cells, the parental A549 cell line showed no expression of 46 kd, 42 kd, or 55 kd EIA EIB proteins.
  • A549E1-68 not only expresses EIA and E1B, but that they are functional, since this cell line can complement for production of high titer, El -deleted, recombinant adenovirus.
  • this new Ad5 helper cell line can complement without production of RCA, one may serially pass El-deleted adenovirus on A549E1-68 cells and test the virus amplified during passage, on parental A549 cells for production of El-containing, replication-competent adenovirus (RCA) by CPE, as well as use PCR primers specific for El A/E1B sequences.
  • This cell line may be used during propagation and scale-up of all El -deleted adenovirus vectors, to ensure that production lots are free of RCA.
  • Example 4 Expression cassette comprising an FVUI cDNA
  • the large capacity of minimal Ad vectors of the present invention for the gene of interest allows for insertion of large promoter and protein coding regions that far exceed the size capacity of the conventional Ad vector. It is preferred, for the purposes of the present invention, that the FVUI minimal Ad vector deliver the FVUI gene to the liver. It is, therefore, important to utilize a highly active promoter that functions in the liver.
  • One such promoter is the human albumin gene promoter (32). A 12.5 kb region of the human albumin promoter was obtained from the Dr. Tamaoki from the University of Calgary.
  • Three regions within the 12.5 kb promoter segment have been determined to significantly influence promoter activity (32): 1.) the proximal region comprising the TATA box (550 bp); 2.) an enhancer region at -1.7 kb; and, 3.) a second enhancer region at -6.0 kb. Combined, these regions approximate the strength of the entire 12.5 kb human albumin promoter.
  • the 10.5 kb EcoRI / Aval fragment of pAlbl2.5CAT was co-ligated with the Aval / HindUI proximal human albumin promoter fragment into the EcoRI / HindLU site of the pBluescript-KS + vector, to generate the recombinant plasmid GT4031.
  • the 7.2 kb full-length human FVUI cDNA with a 5' flanking SV40 immediate early intron and a 3' flanking SV-40 poly-adenylation signal was excised from plasmid GT2051 by Xhol / Sail digestion and was cloned into the Sail site of GT4031 to generate plasmid GT2053.
  • the Xhol fragment derived from plasmid GT2033 containing the minimal TR region and Ad packaging signal was then cloned into the Sail site of GT2053 in either the forward or reverse orientation to generate the albumin/hFVIU minivirus plasmids GT2059 and GT2061, respectively.
  • the restriction enzyme digest patterns of the GT2059 and GT2061 minivirus plasmids are shown in related patent applications (see Related Applications, supra).
  • the FVUI cDNA may be operably linked to a promoter or transcriptional control element that may be synthetic, controllable or regulatable, or tissue / cell type specific.
  • a promoter or transcriptional control element that may be synthetic, controllable or regulatable, or tissue / cell type specific.
  • expression of the FVUI cDNA in the producer or helper cell is suppressed during viral production and activated following delivery to a target cell. In this manner, differential expression of the reporter or effector gene of the minimal Ad vector is achieved.
  • Such differentiated expression is accomplished by constructing a DNA molecule having the FVUI cDNA under the transcriptional control of a synthetic promoter such as one having a liver- specific enhancer operably linked to an ⁇ -antitrypsin (0.1-AT) promoter or one in which the tetracycline operon (tetO) is operably linked to the cytomegalovirus (CMV) promoter (tetO- CMV), in which case a cell line is utilized that expresses the tet-KRAB transcriptional repressor protein.
  • a synthetic promoter such as one having a liver- specific enhancer operably linked to an ⁇ -antitrypsin (0.1-AT) promoter or one in which the tetracycline operon (tetO) is operably linked to the cytomegalovirus (CMV) promoter (tetO- CMV), in which case a cell line is utilized that expresses the tet-KRAB transcriptional repressor protein.
  • Homologous recombination may be employed to insert an exogenous gene into a the genome of a target cell resulting in stable gene expression.
  • the human FVUI cDNA may be targeted to the genomic DNA of a target cell.
  • Large segments of cellular DNA derived from the human albumin gene or human ⁇ -fetoprotein were utilized (32, 33).
  • the 12.5 kb albumin promoter in the FVUI minimal Ad vector functions as the upstream homologous recombination arm while a number of downstream fragments of greater than 6 kb were prepared as potential 3' recombination arms.
  • the albumin gene, an intergenic region and the ⁇ -fetoprotein gene regions useful in the present invention are shown in related applications (see Related Applications, supra).
  • GT2061 The structure of the expression cassette in plasmid GT2061 comprising the 12.5 kb albumin promoter at the 5' end and several regions serving as 3' homologous recombination arms are shown in related applications (see Related Applications, supra). These vectors serve as homologous recombination replacement vectors since the orientation of the arms are in identical orientation as the sequences in the normal human genome.
  • a construct (GT2063) comprising the 3' Xhol recombination arm derived from the human albumin gene and the pAlb-E5 segment cloned into the unique Sail site of GT2061 is shown in related applications (see Related Applications, supra).
  • Plasmid GT2063 was constructed by insertion of the Xhol albumin gene fragment of plasmid pE5 into the unique Sal I site of GT2061.
  • the 12.5 kb EcoRI / HindUI human albumin promoter fragment was inserted into pBluescriptKS + (Stratagene, La Jolla, CA).
  • the human albumin promoter vector, GT4031 thus contains a unique Sail site into which the human FVUI cDNA (the region in GT2051 from Xhol to Sail comprising the SV40 early intron at the 5' end and the SV40 polyadenylation signal at the 3' end) was inserted.
  • the resulting plasmid, GT2053, contains unique Sal I and Xhol sites located 3' to the polyadenylation site.
  • the Ad minimal ITR and wild type packaging sequence was excised from plasmid GT2033 by Xhol digestion and cloned into the Sail site of plasmid GT2053 to generate plasmid GT2061.
  • the 6.8 kb arm of the albumin gene was isolated from pAlb-E5 and cloned into the unique Sail site of GT2061 to generate plasmid GT2063.
  • GT2063 was transfected into 293 cells together with the helper virus DNA to generate the minimal Ad FVUI minivirus designated GTV2063.
  • the helper- virus genome (2 ⁇ g) was purified from virus particles and co-transfected with the helper Ad genome (0.2 ⁇ g) into 293 cells by calcium phosphate-mediated transfection (81).
  • the adenoviral helper plasmid, pBHGlO which lacks the Ad packaging signal and El region but encodes the remainder of the Ad proteins, was cotransfected with the minimal Ad clone GT2063 into 293 cells.
  • Rescue of the Ad-minivirus genome was achieved following infection of 293 cells with an El -substituted helper virus having attenuated packaging function.
  • Both the Ad-helper and minimal Ad genomes may be packaged, and adenoviral particles carrying either genome may be generated using the methodologies of the present invention, although the helper Ad / minimal Ad ratios is variable.
  • helper plasmid pBHGlO 0.2 ⁇ g
  • the minimal Ad vector comprising the human FVUI gene GT2063; 2 ⁇ g
  • Transfection into 293 cells may be performed using any of the well-known and widely available techniques such as lipofection (i.e., using Lipofectamine from GLBCO/BRL) or electroporation (i.e., using reagents and electroporator available from Bio-Rad). Infection of the transfected 293 cells with an attenuated helper virus was performed three days after transfection.
  • CPE cytopathic effect
  • hFVUI in 293 cells was expected to be minimal because the human albumin promoter is not very active in these cells. This has been determined using both CAT assays (69) and an FVUI chromogenic assay (Helena Laboratories, Pharmacia) following transfection of 293 cells with GT2061 using the calcium phosphate precipitation transfection method.
  • Example 7 Amplification and purification of the minimal AdFVLU
  • PCR was performed using primers specific to human FVLU cDNA and amplifications were performed on virus subjected to DNAse treatment prior to DNA extraction to remove any residual non-viral contaminating plasmid DNA.
  • PCR was performed using isolated viral DNA as template (1/20 of the viral DNA isolated), FVUI primer #1 at a final concentration of 1 ⁇ M (SEQ ID NO:l; ACCAGTCAAAGGGAGAAAGAAGA), FVUI primer #2 at a final concentration of 1 ⁇ M (SEQ ID NO:2; CGATGGTTCCTCACAAGAAATGT), and the following conditions: annealing for one minute at 55°C, polymerization for one minute at 72°C, denaturation for one minute at 94°C for a total of 35 cycles. The results indicated that the FVUI minivirus was present in early passages (passage 3).
  • PCR was also performed on the packaging signal region. Briefly, PCR was performed using isolated viral DNA (1/20 of the total viral DNA isolated) as template, packaging signal primer #1 (SEQ ID NO:3; GGAACACATGTAAGCGACGG) at a final concentration of 1 ⁇ M, packaging signal primer #2 (SEQ ID NO:4; CCATCGATAATAATAAAACGCCAACTTTGACCCG) at a final concentration of 1 ⁇ M and the following conditions: annealing for one minute at 55°C, polymerization for one minute at 72°C, denaturation for one minute at 94°C for a total of 35 cycles.
  • packaging signal primer #1 SEQ ID NO:3; GGAACACATGTAAGCGACGG
  • packaging signal primer #2 SEQ ID NO:4; CCATCGATAATAATAAAACGCCAACTTTGACCCG
  • the packaging signal of the helper Ad is partially deleted, the PCR product from the packaging signal deleted helper is shorter (177 bp) than that of the minimal Ad having a wild-type packaging signal (approximately 310 bp).
  • the FVUI miniAd was not detected but its presence was increasingly detected in passages 3 to 6.
  • Identical results were obtained using Southern blot analysis.
  • an Ad DNA fragment adjacent to the right ITR present in both the FVLU minimal Ad and the helper Ad was used.
  • the expected length of the detected fragments after Pst I digestion of the minimal Ad GT2063 and the AdH ⁇ is 3.3 and 2.2 Kb, respectively.
  • the intensity of the bands from equal amounts of marker (1 Kb ladder marker from Gibco, Gaithersburg, MD) were used to normalize the results of the different blots.
  • the observed cycles match with the well known dynamics of a virus population generated in association with a defective interfering virus (in the system of the present invention, the virus population comprises the FVUI minimal Ad) and a helper virus.
  • the understanding and control of these cycles is important to determine at which passage the minimal Ad vectors should be purified to obtain optimal titers.
  • Passages such as #18 (P18) result in a vector preparation enriched for the FVUI minimal Ad (i.e., P18 appears to contain 10 times more FVIU minimal Ad than helper Ad), albeit at a low titer.
  • Passages such as #20 (p20) comprise high levels of FVIU minimal Ad and helper Ad, although at an undesirable FVUI minimal Ad to helper Ad ratio of 1:1.
  • a large scale amplification was performed at p20.
  • One hundred 15-cm dishes, each comprising approximately approximate 10 9 infected 293 cells (ATCC# CRL1573) were harvested upon completion of the CPE.
  • a crude lysate was then prepared by three freeze/thaw cycles to extract the virus.
  • the crude lysate was cleared by centrifugation, loaded onto a step density gradient of CsCl (three layers of 1.5, 1.35, and 1.25 g/ml) and centrifuged at 35000 x g for 1 h.
  • the band corresponding to the mixture of minimal Ad and helper Ad was further purified using a second continuous CsCl gradient of 1.35 g/ml.
  • the FVUI minimal Ad (GT2063) was purified by CsCl as described above and utilized to demonstrate production of FVIU in host cells infected with the vector. To this end, 293 and HepG2 cells were utilized due to their known ability to utilize the albumin promoter. FVUI production in these cells was assayed by immunohistochemistry and functional assays 24 h after infection. Purified FVIU minimal Ad vector was added to 0.5 ml of medium and used to infect 6xl0 5 293 and HepG2 cells in a 4cm 2 well. After a 4 h incubation to allow for adsorption of the viral particles to the host cells, the infection medium was replaced with fresh medium.
  • 293 cells were grown in chamber slides and infected with a diluted (1/100) 1 ⁇ l aliquot of the upper or lower fractions. Twenty-four hours following infection, the cells were fixed and stained with a FVUI specific mAb (Cedar Lane Sheep anti-human FVUIC, #CL20035A, Accurate Chemical and Scientific Corporation, Westbury, NY) and subsequently a secondary antibody (biotinylated donkey anti-sheep IgG, Jackson Immunoresearch, #713-065-147) and DAB (resulting in a reddish-brown color; SIGMA Cat. No. D7679). Transduction with two independent preparations of the upper fraction (minimal Ad FVLU enriched). Ten percent of the cells stained positively for FVUI expression. Transduction with the lower fraction (helper virus enriched) resulted in 0.1 % of the cells staining positive for FVUI expression.
  • FVUI specific mAb Chip Lane Sheep anti-human FVUIC, #CL20035A
  • the estimated titer in transducing units per milliliter was determined to be 6xl0 9 transducing units/ml. f an adsorption time of 4h, an adsorption volume of 0.5 ml in 4 cm 2 , and a non-rocking adsorption are taken into account, the estimated titer may be reduced by a factor of 0.42, 0.56, and 0.53, respectively (49). The actual titer of minimal AdFVLU vector would therefore be estimated to be 4.6xl0 10 transducing units/ml.
  • the amount of functional FVUI in the supernatant of transduced cells was determined using the chromogenic Coatest FV U Test (Pharmacia, Piscataway, NJ).
  • a Coatest chromogenic assay for functional FVIU was performed.
  • a standard curve in triplicate from 4000 ng/ml to 62.5 ng/ml was plotted to obtain the equation to extrapolate the readings from the samples.
  • a standard human plasma sample was serially diluted in cell culture medium to obtain a final FVLU concentration range from 62.5 to 4000 ng/ml.
  • the results are shown in Figure 41.
  • the amount of FVLU detected in HepG2 and 293 supernatants were 0.8 and 0.23 ng/ml respectively. Therefore, the total amount of FVIU produced in 24 h was 1.6 ng per million HepG2 cells and 0.46 ng per million 293 cells.
  • Improvements in the vector system were accomplished by generation of a vector into which various expression cassettes may be cloned.
  • the vector GT2063 was modified by excising the proximal albumin promoter region and human FVLU gene localized between the Pme I and Sal I sites. This was accomplished by first converting the Pme I site of GT2063 to a Sal I site by ligating a Sail linker to the Pme site. The resulting clone, GT2072, was treated with Sal I and religated to remove the proximal albumin promoter/hFVH- gene region thereby creating a minimal Ad vector having a unique Sal I cloning site for insertion of various expression cassettes. The expression from such cassettes may be affected by albumin gene enhancers located upstream. Each clone was analyzed to determine the level of expression of the transgene.
  • Expression cassettes were prepared for insertion into the improved vector, GT2072.
  • the expression cassettes of this example comprises the cytomegalovirus (CMN) immediate early promoter, the elongation factor I (EF-I) promoter (which are known to function in a wide variety of cell types) or the liver-specific promoter for the phosphoenol pyruvate carboxykinase (PEPCK) gene.
  • CPN cytomegalovirus
  • EF-I elongation factor I
  • PEPCK liver-specific promoter for the phosphoenol pyruvate carboxykinase
  • the EF-I and CMN promoters were each separately utilized to drive expression of either the full length FVUI cD ⁇ A or the B-domain deleted (BDD) factor VQT cD ⁇ A.
  • An EF- I BDD FVLU cassette flanked by Sal I sites was then cloned into the Sal I site of GT2073 resulting in generation of the plasmid.
  • An expression vector comprising the full length human FVLU coding region under control of the CMV promoter was also constructed.
  • Example 10 Construction of an integratable AAV-ITR/Rep system-based vector
  • Adeno-associated virus is a human non-pathogenic single-stranded linear parvovirus that replicates only in the presence of a helper virus like adenovirus or herpes virus. However, in the absence of helper, AAV can integrate specifically in the host genome and be maintained as a latent pro virus (34). The particular locus where AAV integrates has been located to chromosome 19ql3.3-qter and named AAVSl (22-25, 35).
  • AAV ITRs Inverted Terminal Repeats
  • Rep78/68 proteins are palindromic sequences present in both ends of the AAV genome, that fold into hairpin structures and function as origins of replication.
  • Rep78/68 proteins include sequence-specific D ⁇ A binding (36, 37), sequence and strand-specific endonuclease activity (38), and ATP-dependent helicase activity (38-40). These proteins can bind to a specific sequence in the ITR D ⁇ A and promote the process named terminal resolution by which the ITR hairpin is nicked and replicated.
  • a Rep-binding motif and a terminal resolution site have been identified in both the AAV ITR and AAVSl and demonstrated to promote in vitro DNA replication in the presence of Rep (28). It has also been shown that Rep68 protein can mediate complex formation between the AAV ITR DNA and AAVSl site in vitro (41).
  • AAV has been considered as a candidate vector for gene therapy.
  • the limited size of exogenous DNA that it can accept (4.2 Kb)
  • the difficulty in getting high titers in large- scale preparations and the loss of specific integration of the recombinant AAV have posed problems for the use of this virus as a gene therapy vector.
  • the inventors Towards the incorporation of the AAV integration machinery in a minimal Ad vector, the inventors have developed and tested a plasmid vector that contains the adeno-associated viral elements necessary for integration.
  • the vector consists of a Rep expression cassette (containing the viral endogenous promoter), as well as a cassette for expression of a reporter gene flanked by two AAV ITRs.
  • the Rep expression cassette was obtained after PCR amplification of sequences 193 to 2216 in the AAV genome from plasmid pSUB201 (41). This fragment starts right after the ITR and extends through the p5 promoter and the Rep78 coding sequence.
  • a control plasmid was constructed by removing the Rep expression cassette, but keeping the reporter gene expression cassette placed between two AAV ITRs.
  • 293 cells were transfected with plasmids GT9003 or GT9004 and then selected for 12 days with G418 (0.5 mg/ml).
  • G418-resistant colonies were isolated, expanded, and genomic DNA was extracted from different colonies by the salt precipitation method (125).
  • Genomic DNA was digested with EcoRI and analyzed by Southern blot with a probe for AAVSl. EcoRI was chosen because the AAVSl locus is contained within an 8Kb EcoRI-EcoRI fragment.
  • neo e.g., clone 2L2
  • the reporter gene is GFP (Aequorea victoria green fluorescent protein).
  • GFP Aequorea victoria green fluorescent protein
  • This reporter makes cells suitable for isolation using methods including but not limited to sorting and single-cell cloning by flow cytometry, thereby eliminating effects of selective pressure imparted by the neo expression cassette.
  • 293 cells were transfected with either plasmid.
  • cells falling into a given range of fluorescence were sorted by flow cytometry and single-cell cloned in 96-well plates. Two to three weeks after sorting, colonies were scored for fluorescence.
  • U.S. Patent App. No. 08/658,961 filed on May 31, 1996) that introduction of ITR DNA sequences in a plasmid coupled with Rep78 expression enhances the integration of DNA sequences of interest into the cellular genome (56).
  • the invention described in U.S. Patent App. No. 08/658,961 comprises multiple plasmids comprising an expression cassette having a reporter gene [i.e., neo or the gene encoding green fluorescent protein (GFP)] flanked by AAV ITR sequence (hereafter referred to as the integration cassette), in combination with an upstream Rep expression cassette.
  • a reporter gene i.e., neo or the gene encoding green fluorescent protein (GFP)
  • the present invention provides a hybrid vector that combines the advantages of the Ad vector (high titer preparation, large capacity for exogenous DNA, high level infectivity of multiple cell types) and the integration capabilities of AAV.
  • This hybrid virus of the present invention replicates as an adenovirus and comprises the AAV elements sufficient for integration.
  • the present invention comprises a minimal Ad vector having a Rep expression cassette and a FVUI expression cassette flanked by AAV ITRs. Additional exogenous DNA (up to 36 kb) may be inserted into the vector. Additional exogenous DNA of this vector corresponds to human albumin genomic sequences (non-coding).
  • the Rep expression cassette encompasses bp 193 to 2216 bp of the AAV genome. This fragment originates immediately following the ITR and extends through the p5 promoter and the Rep78 coding sequence. For the reasons listed below, a fragment comprising seven tet operators was introduced upstream of the p5 promoter was included to allow for transcriptional repression of the rep gene by the tet-KRAB repressor (42).
  • the tet-KRAB repressor may be provided as a transcriptional switch in order inhibit expression of Rep during viral vector generation.
  • the present invention provides a 293 cell line stably expressing the tet-KRAB repressor protein. Upon entry of virus into the host cell that does not express the tet-KRAB repressor protein, Rep expression occurs due to the absence of the repressor in those cells, thus promoting integration of the sequences flanked by AAV ITRs into the cellular genome.
  • the viral vector thus generated may be tested in vitro and in vivo for the frequency and specificity of integration.
  • Example 12 AAVSl cloning and vector construction
  • An embodiment of the present invention is a methodology for the generation of a transgenic mouse harboring the human AAVSl integration site for use as an in vivo animal model.
  • the animal model is to be used for testing site-specific integration of a viral vector containing the AAV integration mechanism described above.
  • the first step towards development of the animal model was cloning of the AAVS 1 site and insertion of the sequence into a mammalian expression vector.
  • the AAVSl human integration site was originally cloned by Kotin et.al. (50) as an 8.2 kb EcoRI fragment, of which the first 4067 bp have been sequenced. This DNA sequence information was used to design two oligonucleotide primers, which were subsequently used to generate a 253 bp PCR product for use as an AAVSl -specific probe.
  • the upper primer, U2492 (SEQ ID NO:5: GCTGTCTGGTGCGTTTCACTGAT), is a 23-mer that extends from basepairs 2492-2515 of the AAVSl sequence and the lower primer, L2722 (SEQ ID NO:6: TCACAAAGGGAGTTTTCCACACG), also a 23-mer extends from basepairs 2722-2745 of the AAVSl sequence.
  • PCR amplification was performed using 100 ng human genomic DNA as template and a 1 ⁇ M final concentration of the U2492 and L2722 primers (SEQ ID NO: 5 and SEQ ID NO;6, respectively) as follows : 95° C, 4 min - 1 cycle; 95° C, 0.5 min, 55°C, 0.5 min, 72°C, lmin - 35 cycles; 72°C, 7min - 1 cycle.
  • the 253 bp AAVSl -specific PCR product was sent to Genome Systems (St.Louis, MO) where it was used to screen a human PI genomic DNA library.
  • mice embryonic stem (ES) cell line comprising the AAVSl sequence for use in the generation of an AAVSl transgenic mouse
  • the pAAVSl-Neo plasmid was transfected into mouse ES cells (129 Sv agouti, Genome Systems). 25 ug of pAAVSl-Neo plasmid DNA was linearized with Xbal and transfected by electroporation (975 uFd, 252 v.) into ES cells using a Biorad Gene Pulser. Transfected cells were selected for one week in 250 ug/ml G418.
  • Neo R neo-resistant colonies were isolated, expanded, and characterized by morphology to obtain clones which were >95% "un-differentiated” in order to enrich for cell lines that maintained a totipotent phenotype.
  • Genomic DNA was isolated from 17 Neo R ES clones, as well as from the untransfected, parental ES cell line, and 100 ng of the DNA utilized as template using primers U2492 and L2722 (SEQ LD NO:5 and SEQ ID NO;6, respectively; final concentration of 1 ⁇ M) for AAVSl -specific PCR.
  • PCR DNA from 17/17 Neo R ES clones generated the expected 253 bp AAVSl PCR product, while PCR analysis of DNA from the untransfected control ES cells did not generate detectable PCR product. Southern blot analysis was performed on control and AAVSl (+) ES cell lines to confirm that a functional AAVSl sequence had been preserved following transfection and genomic integration.
  • Genomic DNA from each of the AAVS 1 positive (as assessed by PCR) ES cell lines was digested with EcoRI in combination with EcoRV, electrophoresed, blotted, and hybridized with an 8.2 kb AAVSl probe.
  • Both ES#4 and ES#3.16 cell lines contained the expected 5.2 kb and 3.0 kb EcoRL/EcoRV fragments, indicating integration of the entire 8.2 kb AAVSl sequence.
  • the untransfected parental ES cells showed no hybridizing bands using this human AAVSl -specific probe.
  • AAVSl -positive ES clones ES#4 and ES#3.16, were grown on 1° murine embryonic fibroblast feeder layers, in the presence of Leukemic Inhibitory Factor (LLF - an anti- differentiation factor), and maintained at very low passage (P.2 - P.7) in order to preserve an undifferentiated, totipotent phenotype.
  • LEF Leukemic Inhibitory Factor
  • Blastocyst-stage embryos were collected at Day 3.5 p.c. from superovulated, C57BL/6 mice, maintained in Ml 6 embryo medium. 15-20 ES cells (AAVSl ES#4 or ES#3.16) and microinjected into the blastocoel cavity of the 3.5 day embryos using a Leitz DM-LLB Microinjection Workstation.
  • the embryos were returned to M16 medium and incubated in 5% CO 2 , 37°C for 2 hours to allow the blastocysts to re-cavitate. 10-15 injected blastocysts were subsequently transferred into the uterus of Day 2.5 post-coitus (p.c), pseudopregnant, CB6F1 foster mothers. Following uterus transfer, the blastocysts implant into the uterine wall, the AAVSl-positive ES cells become incorporated into the embryo's inner cell mass, and contribute their genetic information to the developing embryo, resulting in the birth of transgenic (chimeric) progeny approximately 17 days later.
  • the conditions for PCR were: 95° C, 4 min - 1 cycle; 95° C, 0.5 min, 55°C, 0.5 min, 72°C, lmin - 35 cycles; 72°C, 7min - 1 cycle.
  • the correct 253 bp AAVSl PCR product was indeed detected in tail DNA from a high-percentage chimera, but was not detected in the tail DNA of a non- chimeric littermate or in a low percentage chimera with less than 10% agouti coat color chimerism.
  • human AAVSl integration sequence has been successfully cloned, and transfected into mouse embryonic stem ("ES") cells.
  • transfected ES cells were then microinjected into blastocyst-stage embryos, and demonstrated the presence of this human transgene in the genome of the resultant transgenic mice.
  • These chimeric founders are then bred with wild-type C57BL 6 females to obtain germline transmission of the human AAVSl transgene. Once germline transmission is achieved, the Fi heterozygote progeny are bred resulting in a homozygous AAVS 1 transgenic mouse line.
  • This homozygous line may then be used to test AAVSl site-specific integration of either AAV viral vectors, hybrid adenovirus/ AAV viral vectors, or any other plasmid vector comprising the AAV LTRs and Rep 78/68 genes necessary for integration at the AAVSl site.
  • the AAV transgene vectors may be delivered in vivo to the AAVSl transgenic mice either by viral infection (following intravenous injection) or by using ligand-mediated DNA/liposome complexes.
  • the frequency of site- specific integration, stability of the integrated transgene and the duration of stable protein expression i.e., human Factor VUI, Factor IX, and the like) may then be assessed following integration into the target cells.
  • a viral vector of the present invention is injected into the intravenous or portal vein of the transgenic mouse.
  • the vector may be part of a pharmaceutical composition and may or may not be complexed with lipid such as Lipofectamine (GLBCO/BRL) and / or a liver-specific ligand (79, 80).
  • lipid such as Lipofectamine (GLBCO/BRL) and / or a liver-specific ligand (79, 80).
  • the level of expression of the effector or reporter gene of the viral vector is measured using a technique such as northern blot, RNase protection analysis, or PCR. Ln testing the FVLU minimal Ad, FVUI is detected by ELIS A assay. The level of expression of the effector or reporter gene in each blood sample is compared to one another in order to determine the duration of transgene expression. Also, in order to determine site-specific integration of the vector, genomic DNA is isolated from the liver tissue of the animal. PCR analysis of the genomic DNA using an AAVS1- specific primer and a primer containing sequence homologuos to sequence of the vector is then performed.
  • Site-specific integration of the vector at the AAVSl site of the genome of the transgenic animal produces a product containing both AAVSl and vector sequences.
  • the amplified PCR product provided the viral vector integrated into the AAVSl site of the animal, includes vector sequence.
  • Example 15 FVUI transgenic mouse harboring the human AAVSl integration sequence and a transgenic mouse tolerized to human FVLU
  • An AAV/ITR-Rep vector comprising either the neo or GFP reporter gene (GT9003 and GT9012, respectively) was transfected into human 293 cells. Extracts of these cells were then assayed by Southern blot for site-specific integration of the vector at the endogenous AAVSl site. Integration at AAVSl was observed at a frequency of 50% in samples obtained following transfection for either the neo or GFP version of the AAV-LTPJRep vector (GT9003 or GT9012, respectively). These results indicate that the AAV ITRs and Rep coding sequences are sufficient to direct high-efficiency, site-specific integration at AAVSl (56).
  • transgenic mouse harboring the human AAVSl integration site within its genome.
  • the transgenic mouse is generated using embryonic stem cell manipulation technology (43).
  • An expression vector comprising the entire 8.2 kb human AAVSl sequence and neo (or Neo) selection marker is constructed.
  • the AAVSl / Neo vector is transfected into totipotent mouse embryonic stem (ES) cells to obtain Neo R , AAVS1 + ES cell clones that are subsequently microinjected into mouse blastocyst-stage embryos and implanted into the uterus of a foster mother.
  • ES mouse embryonic stem
  • AAVS1 + ES cell clones that are subsequently microinjected into mouse blastocyst-stage embryos and implanted into the uterus of a foster mother.
  • the AAVS1 + ES cells resume normal embryonic development and contribute their genetic information (including the human AAVSl sequence) to the developing embryo.
  • Chimeric (transgenic) progeny are identified by the presence of ES cell-derived agouti-brown coat color. Chimeric founders are then bred with wild-type C57BLJ6 mice to obtain germline transmission of the transgene. FI heterozygotes are bred to obtain a homozygous mouse line which has stably incorporated the human AAVSl integration sequence into its genome. This mouse model is then injected, via the tail vein or portal vein, with the AAV-ITR / miniAd-FVUI vector to assess in vivo transduction efficiency, integration at the human AAVSl sequence, and duration of transgene expression.
  • a transgenic mouse tolerized to human FVUI is then injected, via the tail vein or portal vein, with the AAV-ITR / miniAd-FVUI vector to assess in vivo transduction efficiency, integration at the human AAVSl sequence, and duration of transgene expression.
  • the present invention is a FVLU-tolerized mouse model system. Ln the past, FVLU tolerization has been achieved by transient injection of FVUI into neo-natal mice (44).
  • the present invention comprises a mouse having the human FVUI gene under the control of a promoter that functions in a developmental stage-specific manner.
  • a promoter may include but is not limited to that of the ⁇ -fetoprotein gene or the embryonic globin gene, epsilon.
  • the ⁇ -fetoprotein promoter is an example of an early developmental stage-specific promoter that is inactive in the mature animal (45).
  • the embryonic globin gene, epsilon is another example of a developmentally regulated gene that may be utilized in the present invention.
  • gene expression is limited to the liver and is dependent upon liver specific transcription factors for activation (46, 47).
  • a liver specific promoter element that is also developmentally regulated would be preferred.
  • the ⁇ -fetoprotein promoter (AFP) meets both of these criteria.
  • the ⁇ -fetoprotein promoter does not function in undifferentiated ES cells but is induced during differentiation (48); as such, it may be utilized to control hFVUI expression in transgenic mice.
  • transgenic mouse that has been tolerized to the xenogenic human FVIU protein.
  • the transgenic mouse may be utilized to test delivery of human FVUI in vivo using adenoviral or AAV vector systems, or using FVLU-secreting cells in an immunoisolation device.
  • human FVUI is expressed embryonically in the developing transgenic mouse under control of the AFP promoter.
  • HFVUI then, is seen as "self by the mouse and tolerance occurs.
  • an immune reaction does not occur toward the xenogenic human FVUI transgene product when it is delivered by the therapeutic vector (i.e., the AAV-minimal Ad-FV U).
  • Example 16 Construction of AFP-FVUI-Neo vector
  • AFP mouse ⁇ -fetoprotein
  • GT2057 comprises a 7.5 kb AFP promoter sequence originally characterized by Urano et al (33).
  • the cassette containing the AFP promoter and the hFVUI gene was subsequently cloned as an Aat U / Sal I fragment into the Neo expression vector, pGKNeo, at Aat U / Xho I.
  • the resultant 20.2 kb vector, mAFP-hFVUI-pGKNeo harbors the hFVLU gene under control of an embryonic promoter (AFP), and has a Neo expression cassette for selection in mammalian cells.
  • ES mouse embryonic stem
  • the mAFP-hFVUI-pGKNeo vector was stably transfected into mouse ES cells.
  • 20 ug of AFP-FV-U-Neo DNA was linearized with Aat U and electroporated into ES cells (975uFd, 252v.) using a BioRad Gene Pulser.
  • ES cells were propagated on embryonic fibroblast feeder layers in 250 ug/ml G418 to select for Neo R clones. 48 Neo R clones were picked, expanded, and analyzed for functional Factor VIH protein using a Coatest kit.
  • the AFP promoter was cloned as an EcoRI /Sal I fragment into the reporter plasmid, pEGFP-l(Clontech), to drive expression of the Green Fluorescence Protein (GFP).
  • the pAFP-EGFP-1 plasmid was transiently transfected into both ES cells and HepG2 cells (a liver cell line known to express high levels of ⁇ -fetoprotein), and examined by direct visualization using a Nikon Diaphot broad range microscope with a FLTC filter after 24 hours for green fluorescent cells.
  • the n ⁇ -AFP-hFV U-pGKNeo vector was transfected into HepG2 cells and lOX-concentrated supernatants were analyzed for hFVUI protein expression using the chromogenic Coatest FVUI assay (Pharmacia, Piscataway, NJ). Human FVJJf was detected at the level of 3.0 ng/ 10 6 cells/ 24 hrs., confirming that the AFP-FVUI construct was functional and that the tissue-specific and developmental-specific expression pattern of the 7.5 kb AFP promoter / enhancer element was preserved.
  • AFP-FVUI (+) ES clones clone #22
  • clone #22 was chosen, based on its un-differentiated growth phenotype, to use for blastocyst microinjection experiments.
  • This example describes transgenic mice that have been tolerized in utero to the xenogeneic human Factor VLU protein.
  • This transgenic mouse is used to test delivery of human FVUI in vivo using adenoviral or AAV vector systems, or using FVIU-secreting cells in the TheraCyte immunoisolation device such as that described in U.S. Patent Nos. 5,314,417; 5,344,454; 5,421923; 5,453,278; 5,545,223; or 5,569,462.
  • hFVUI is expressed embryonically in the developing transgenic mouse under the control of the AFP promoter, hFVUI as delivered by the therapeutic vector (i.e.
  • the AAV-miniAd-hFVIU is recognized by the immune system of the mouse to a "self antigen. As such, tolerance to the hFVUI protein results.
  • the transgenic mouse is tolerized to hFVUI, an immune reaction to the "xenogeneic" human FVUI protein will not occur, and an accurate assessment of antigenicity of the viral vector backbone and a realistic measurement of the duration of gene expression in vivo may be determined.
  • the AFP-FVUI transgene is expressed mainly during embryogenesis, the amount of hFVUI protein expressed by the liver as a result of transduction by the vector in mature transgenic mice may be accurately quantitated.
  • ES cells from the AFP- FVUI (+) ES clone #22 were microinjected into C57BLJ6 blastocysts, and implanted into the uterus of foster mothers.
  • ES clone #22 four chimeric progeny have been produced using ES clone #22. They are mated with wild-type C57BL/6 mice to test for germline transmission, and germline founders bred to obtain a homozygous AFP-hFVLU transgenic mouse line.
  • chimeric progeny since the chimeric progeny, by definition, have mosaic expression of the AFP-hFVLU transgene in all of their tissues, they are also used directly for in vivo gene delivery experiments, without having to wait for production of a homozygous line.
  • Transgenic animals produced by this scheme are initially challenged by an injection of hFVLU protein, bled, and screened for antibodies to the human protein, to ensure tolerization to hFVLU.
  • the AFP-hFVUI-tolerized transgenic mice will also be tested for "leaky" expression of hFVUI in the adult animal.
  • hFVUI protein If a small amount of hFVUI protein is produced in adult transgenic animals, it is accurately quantitated so that it can be subtracted from the levels of hFVUI delivered by the therapeutic vector or protein delivery device.
  • the transgenic animal is tolerized to hFVUI and expresses insignificant levels of endogenous human protein, it can be used to test the efficiency of in vivo delivery of hFVUI, the duration of gene expression, tissue distribution, and immune reactions to elements of the delivery system, other than the transgene (i.e., vector backbone, viral coat proteins) may be analyzed. Other parameters may also be tested using the transgenic animal.
  • a transgenic mouse strain with a targeted disruption (gene knockout) of the mouse Factor VIU gene has been obtained through a non-exclusive, restricted-use license agreement with John Hopkins University and The University of Pennsylvania.
  • This mouse line has severe mFVIU deficiency and thus is a useful model for hemophilia A (51).
  • By crossing our transgenic mouse tolerized to human Factor VHI with a mouse that is totally deficient for mouse Factor Vm it is possible to produce a "clean" model for testing in vivo delivery of hFVUI.
  • an accurate quantitation of hFVUI In addition, this doubly-transgenic mouse provides a useful model for the phenotypic correction of hemophilia A using gene therapy.
  • a further embodiment of this invention involves the crossing of all three above- mentioned transgenic animals to produce a "triple-transgenic" mouse model.
  • the mouse described in the previous section which is tolerized to human FVUI and deficient in mouse FVUI, is cross bred with the AAVS 1 transgenic mouse line.
  • This triple transgenic mouse model is preferredly suited for testing all aspects of our AAV-miniAd-hFV ⁇ i vector system including: site-specific integration at AAVSl via the AAV ITR Rep integration system; delivery and long- term expression of the human FVIU transgene without immune reaction to the tolerized transgene; accurate quantitation of delivered hFVUI due to a lack of adult expression of human FVUI as well as a lack of cross-reacting mouse FVUI protein; and, finally, genetic and phenotypic correction of severe FVIU deficiency (hemophilia A).
  • GFP green fluorescence protein
  • GFP expression cassette into the various virus vectors as a reporter gene in new minimal Ad vectors, AAV vectors, and novel versions of helper virus are developed. Viral infection, expansion, helper complementation and in vivo delivery to target cells is easily followed by visual detection of green fluorescence. It has been shown that immune responses to transgene-encoded proteins can negatively impact the stability of gene expression following injection of adenovirus vectors (30). Ln order to eliminate immune responses to the GFP transgene incorporated into the vector, which could shorten the duration of GFP expression after injection into mice, a GFP-tolerized transgenic mouse is developed. The AFP-EGFP-1 vector or a similar vector comprising the Rat Insulin Promoter (RIP) for pancreas-specific expression of GFP could be used for this purpose.
  • RIP Rat Insulin Promoter
  • a RLP-EGFP-l vector was used to transfect mouse ES cells in order to develop a stable, Neo R RIP-GFP ES cell line [RLP-GFP(+) ES].
  • R-P-GFP(+)ES cells are utilized to generate a GFP-tolerized transgenic mouse, in a manner identical to that described for the generation of an AFP-hFVTH tolerized mouse model, substituting the RIP-EGFP-1 vector for the AFP-hFVUI vector.
  • the RLP-GFP tolerized mouse thus produced provides a useful research tool for the development of novel adenovirus vectors or other delivery systems that utilize the GFP transgene as a reporter.
  • transgenic animal models including the AAVSl transgenic mouse provided in Example 12, the hFVUI-tolerized transgenic mouse of Example 15, and the GFP-tolerized transgenic mouse of Example 19C, may be alternatively generated by direct DNA injection of the transgene (pAAVSl-Neo, mAFP-hFVUI-pGKNeo and RIP-EGFP-1, respectively). This is accomplished by injection of the transgene into the male pro-nucleus of mouse single cell ova to produce transgenic mice, as an alternative to using the ES cell technology descirbed above. To one skilled in the art, this is an obvious alternative method for producing a transgenic mouse. The present inventions, therefore, may be produced by either of the methods discussed in this application (57-61).
  • the present invention provides designs for a site- specific recombinase-based system that permits excision of an auto-replicative episome from the mini-viral sequences upon infection of target cells.
  • Site-specific recombinases have been extensively used to manipulate DNA. Site- specific recombinases catalyze precise recombination between two appropriate target sequences, cleaving DNA at a specific site and ligating it to the cleaved DNA of a second site (reviewed in ref. 111).
  • Several systems have been identified and characterized such as the cre/loxP system from bacteriophage PI (111) or FLP/FRT from yeast (112).
  • the recognition sites (loxP and FRT) for both recombinases (ere and FLP) share a common structure: they have two inverted repeat elements (recombinase binding site) flanking a central core region (site of crossing-over).
  • the orientation of the target sites (as defined by the core region) is responsible for the final outcome: recombination between two parallel sites on the same molecule results in excision of intervening sequences generating two molecules, each one with a target site. Recombination between two antiparallel sites results in inversion of the intervening sequence. Recombination between two parallel sites in diferent molecules results in the integration of sequences flanked by target sites. Since excision is an intramolecular event, it is favored over integration.
  • recombinases will be used to excise sequences having an eukaryotic origin of replication (ori).
  • Mammalian ori sequences and binding factors have not been characterized to date.
  • some viral ori sequences and viral proteins required for initiation of replication have been characterized and incorporated in plasmid vectors, some examples of which including but not limited to S V40 ori/T-Ag from simian virus 40 (113) and oriP/EBNA-1 from Epstein-Barr virus (114). These elements have allowed the generation of plasmids that replicate autonomously in eukaryotic cells and are stably maintained upon selective pressure.
  • Plasmids containing oriP and expressing EBNA-1 protein replicate once per cell cycle (115, 116) and are lost when selective pressure is removed from cells in culture.
  • nondividing cells such as hepatocytes.
  • an episome could remain stable for a long period of time. It is believed by the inventors of the present invention that the incorporation of ori sequences in the mini-viral DNA will permit a extended expression of the transgene in nondividing cells.
  • the episomal minivirus elements include, but are not limited to: a) Recombinase expression cassette: recombinase must be expressed only in target cells, because inappropriate expression in the cells used to generate the virus will promote the excision of the sequences contained between two recombination sites. For this reason, expression is tightly controlled by either adding binding sequences for transcriptional repressors upstream of the promoter (for instance, tetO ) or through the use of tissue-specific promoters (e.g., albumin promoter, factor V ⁇ i promoter, and the like).
  • Origin of replication ori
  • Transgene may be any therapeutic or reporter gene flanked by a recombination site (5') and a poly A signal sequence (3'). It will be expressed only in target cells upon circularization of the DNA.
  • Recombinase target sites two sites are necessary in parallel orientation, one being placed between the promoter and the recombinase cDNA and the other upstream of the therapeutic gene cDNA.
  • Adenovirus ITRs necessary for replication and packaging of the minivirus.
  • Stuffer DNA sequence if necessary to increase the size of the minivirus up to a packageable length.
  • the stuffer DNA sequence may be any DNA fragment of any length.
  • the recombinase is not expressed while amplifying the minivirus.
  • the promoter is functional, recombinase is expressed and the sequences contained between two recombinase target sites are excised and circularized.
  • the recombinase promoter turns into the transgene promoter and the presence of the origin of replication allows stable maintenance of the plasmid, therefore assuring stable expression of the transgene.
  • Example 21 Design of The Minimal Ad for Treatment of Cancer
  • TGF ⁇ secretion by tumor cells may be a significant approach to cancer gene therapy (120, 121).
  • Fakhrai et al used antisense to TGF ⁇ to inhibit the expression of that cytokine in a rat gliosarcoma cell line. Immunization of tumor-bearing rats with the antisense modified tumor cells resulted in significant survival of animals compared to animal's immunization with tumor cells modified with control vectors.
  • Isaka et al was able reduce the amount fibrotic disease in rats, by transfecting skeletal muscle with a cDNA encoding decorin.
  • Decorin is a small proteoglycan that inhibits the expression of TGF ⁇ .
  • CTLA- 4 a molecule also expressed on T cells, binds B7-1 and B7-2 with much higher affinities than CD28.
  • CTLA-4 acts as a negative regulator of T cell responsiveness, and raises the possibility that blocking the inhibition delivered by the CTLA-4-B7 interaction might augment the T cell response to tumor cells and enhance antitumor activity. It has been demonstrated that injecting antibodies to CTLA-4 resulted in the rejection of tumors including pre-established tumors in a mouse model (124). This demonstrates the care must be used in designing gene transfer experiments such that the desired effects are not masked by other potential deleterious effects.
  • the genetic basis of cancer includes abnormalities in oncogenes and/or tumor suppressor genes. Both types have been the targets of cancer gene therapy. Because the cancer- related defects of tumor suppressor genes are usually mutations or deletions, the strategy in tumor suppressor gene therapy thus far developed has been gene replacement therapy, in which a wild-type tumor suppressor gene is transferred into cancer cells to restore the normal function of the defective gene or induce tumoricidal effect (124).
  • the human tumor suppressor genes that have been cloned and characterized include Rb, Wilms tumor (WTl), and neurofibromatosis (NF1), which are involved in pediatric cancers; adenomatosis polyposis coli (APC) and deleted in colon cancer (DCC), which contribute to colorectal cancer; and p53, which is found in mutated forms in a wide range of human cancers (reviewed in ref. 125).
  • cdk cyclin-dependent kinase inhibitor family
  • MTS1 major tumor suppressor 1
  • MTS2 pl5
  • p!6 was shown to be deleted or mutated in a wide range of cancer cell lines
  • p!5 was shown to be a potential effector of TGF- ⁇ -induced cell cycle arrest (130).
  • the p53 gene is the one that has thus far been utilized for gene therapy of cancer (131).
  • a current effort on gene therapy of cancer is to combine tumor suppresser gene and immunomodulation gene therapy of cancer with the introduction of other molecules such as, tumor antigens, MHC molecules, cell adhesion molecules and other immunomodulating factors.
  • the following is a general description of two designs of anticancer super- Ad vectors.
  • anticancer super-Ad vectors Several combinations of immune molecules and genes may be utilized in the constrcution of anti-cancer super Ad vectors.
  • the minimal Ad vectors may carry of the multiple genes that function to suppress tumor growth or induce host anticancer immune responses. This type of vectors is called anticancer super-Ad vectors.
  • the first version of the super-Ad vector will carry four double expression cassettes for human p53 cDNA, GFP marker gene, human IL2 cDNA, human GM-CSF cDNA, human B7-1 cDNA, human IL7 cDNA and human LL12 p35 and p40 cDNA.
  • Cassette 1 includes a CMV promoter, a Human p53 cDNA, an EMC-IRES, a GFP gene and a SV40 pA.
  • Cassette 2 includes an EF promoter, a human GM-CSF cDNA, an EMC-IRES, a human LL 12 cDNA and a bovine growth hormone pA.
  • Cassette 3 comprises an SV40 promoter, human B7-1 cDNA, an EMC-IRES, human IL7 cDNA and SV40 pA.
  • Cassette 4 includes a tk promoter, a Human LL12 p35 cDNA, an EMC- IRES, a human IL12 p40 cDNA and a bovine growth hormone A.
  • a second version of the anti-cancer super Ad vectors has a similar structure to that of the first version, including adenovirus inverted terminal repeats at both the 5' and 3' ends and four discrete expression cassettes.
  • Several combinations of regulatory molecules and genes may be utilized in the constrcution of anti-cancer super Ad vectors. The examples described below are not in any way limiting to the types of minimal Ad vectors that may be constructed to regulate the growth of a tumor cell.
  • Each expression cassette is flanked at the 5' end by a unique promoter.
  • each expression cassette incorporates two genes linked by the encephalomyocarditis virus internal ribosome entry site sequence for cap independent translation of the "distal" gene.
  • the genes shown for this vector include cytokine genes as represented by LL-2, LL-7, and GM-CSF; a tumor suppresser gene as represented by p53; immune cell co-stimulatory molecules as represented by B7-1 and ICAM-1; and molecules that can reverse the immune suppression often associated with cancers, anti-TGF ⁇ and SCA to CTLA-4.
  • cytokine genes as represented by LL-2, LL-7, and GM-CSF
  • a tumor suppresser gene as represented by p53
  • immune cell co-stimulatory molecules as represented by B7-1 and ICAM-1
  • molecules that can reverse the immune suppression often associated with cancers, anti-TGF ⁇ and SCA to CTLA-4 to increase the size of the vector so that the vector will be efficiently packaged into progeny virus.
  • the stuffer DNA may include any DNA fragment of any length.
  • Minimal Ad vectors for Immunization to Treat or Prevent Disease or other Medical Conditions
  • Minimal Ad vectors may be engineered to drive expression of certain antigens or immunogens that will serve to generate immunity in the organism in which expression takes place.
  • Minimal Ad vectors may be designed that drive expression of bacterial, fungal, parasitic, viral, receptor or ligand genes that induce an immune reaction for the treatment or prevention of disease or other medical condition.
  • a coat protein from a retrovirus such as HIV may be encoded by a minimal Ad vector.
  • a recombinant adenoviral particle comprising such a minimal Ad vector, immunity to the H V virus may ensue.
  • Minimal Ad vectors may also be designed to drive expression of cancer-specific antigens.
  • minimal Ad vectors may be designed that encode antigenic molecules derived from one or more parasites.
  • Other minimal Ad vectors may be designed that encode antigenic molecules derived from receptors or ligands.
  • a pharmaceutical composition comprising such minimal Ad vectors
  • immunity to such antigens, receptors or ligands can inhibit their function and can be useful clinically by blocking autoimmune reactions in the case of antigen receptors or for birth control by blocking the ligand beta-human chorionic gonadotropin, as examples.
  • An exemplary minimal adenoviral vaccine vector is shown in Figure 1.
  • the HIN-1 derived immunogen lUVgag/pol/tat ⁇ /rev generates viral particles, mimicking attenuated virus vaccines without the risk of infection. Safety regarding the emergence of an infectious virus is assured by deleting the accessory genes vif, vpr, vpu and nef as well as the envelope gene env. Additionally, both HLV LTRs and the packaging signal may be deleted. Removing these accessory proteins is of further advantage since, for example, the ⁇ ef and Vpr proteins are known to cause neuronal damage (Trillo-Pazos, et al (2000) "Recombinant nef H-N-ULB protein is toxic to human neurons in culture" Brain Res. vol. 864, pp.
  • HJNgag/pol/tat nf /rev encodes for the regulatory protein HJN Rev, which ensures export of mR ⁇ A into the cytoplasm. Rev is not known to be toxic.
  • HLV Rev itself can elicit immune responses to help combat HJN infection (Chan, et al (1998) "Genetic vaccination-induced immune responses to the human immunodeficiency virus protein Rev: emergence of the interleukin 2- producing helper T lymphocyte" Hum. Gene Titer., vol. 9, pp. 2187-; Blazevic, et al. (1996) "Lnterleukin-10 gene expression induced by HIN-1 Tat and Rev in the cells of HLV-l infected individuals" J. Acquir. Immune Defic. Syndr. Hum. Retrovirol, vol. 13, pp. 208-).
  • HLV Rev/RRE export system An alternative to the HLV Rev/RRE export system is provided with other lentiviral export elements such as, for example, the FLV Rev/RRE element, or export elements that do not require the expression of an additional protein such as WPRE (Pre element from Woodchuck Hepatitis Virus) (Donello, et al. (1998) "Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element" J. Virol, vol. 72, pp. 5085-) or CTE (cytoplasma transport element from Mason Pfizer Monkey virus (Ernst, et al. (1997) "Secondary structure and mutational analysis of the Mason-Pfizer monkey virus R ⁇ A constitutive transport element" RNA, vol. 3, pp. 210-).
  • WPRE Pre element from Woodchuck Hepatitis Virus
  • CTE cytoplasma transport element from Mason Pfizer Monkey virus
  • Tat is a transactivator and known to be a powerful immunogen (Cafaro, et al. (1999) "Control of SHJV- 89.6P-infection of cynomolgus monkeys by HLV-l Tat protein vaccine” Nat. Med, vol. 5, pp. 643-). Therefore, Tat is retained in Minimal Ad HIN. However, it is believed that Tat protein can also synergize with inflammatory cytokines to promote angiogenesis and Kaposi' s sarcoma (Barillari, et al.
  • the minimal Ad/HIV vector expresses a nonfunctional form of Tat (Caselli, et al (1999) "D ⁇ A immunization with HLV-l tat mutated in the trans activation domain induces humoral and cellular immune responses against wild-type Tat" J. Immunol, vol. 162, pp. 5631-) that retains the immunogenic potential of wild-type Tat.
  • Cytokines are also useful for stimulating the immune responses and may be included in the minimal Ad HLV vector. It is also possible to configure the vector to encode other antigens (including, but not limited to, envelope proteins of different clades of H V) or to be equipped with the mechanisms to enhance the induction and response of the host immune system to the immunogens.
  • DCs dendritic cells
  • HLVgag/pol/tat/rev a primary antiviral cytotoxic T cell response in vitro.
  • HLN transactivator Tat encoded by the vector is nonfunctional (tat nf ) but retains all known antigenic epitopes.
  • the multiprotein HLV gag/pol/tat/rev (4.6 Kb) is derived from the molecular clone HTN- 1-M ⁇ (WO 97/36481) and encoded in a single expression cassette regulated by the CMV promoter (0.8 Kb) at the 5' end and the poly A signal of the bovine growth hormone (0.23 Kb) at the 3' end.
  • Expression of murine GM-CSF (0.8 Kb) is regulated by the RSV promoter (0.7 Kb) at the 5' end and the SV40 poly A signal (0.2 Kb) at the 3' end.
  • a schematic of exemplary adenoviral constructs is shown in Figure 2.
  • the cDNA for the HIV- 1 gag/pol/tat/rev is derived from the previously described HLV-l based lentiviral vector EUV-1 ⁇ EN (Gruber, et al (2000) "Dendritic cells transduced by multiply deleted HIV-1 vectors exhibit normal phenotypes and functions and elicit an HTV-specific cytotoxic T- lymphocyte response in vitro" Blood, vol. 96, pp. 1327 -). Tat is replaced by the 4.6 kb nonfunctional tat cDNA fragment and cloned into a cassette with the CMV promoter upstream and the bovine poly A signal downstream of the cDNA.
  • the approximately 6 kb tat expression cassette is then tested for functionality in a eukaryotic expression vector before being cloned into the Minimal Ad vector pGT4163.
  • the bovine growth hormone poly A signal polyadenylation sequences are derived from plasmid pCDNA3 (Invitrogen Corp., San Diego, CA) using standard PCR techniques.
  • the RSV promoter is isolated from plasmid pOP13CAT (Stratagene, La Jolla, CA) and cloned upstream of the murine GM-CSF cDNA, which is isolated from a murine cDNA library (Stratagene, La Jolla, CA) using PCR methods.
  • the SV40 polyA site is isolated from the pOP13CAT plasmid and cloned downstream of the GM-CSF cDNA immediately before the 3' DNA stuffer region ("stuffer" contemplates endogenous or exogenous nucleic acid sequences to maintain the length of the minimal adenovirus for packaging).
  • the resulting 2 Kb expression cassette is then cloned downstream of the HLV-l expression cassette.
  • a minimum of at least 28 Kb is required to efficiently package a functional minimal Ad vector.
  • Genomic sequences from AFP, albumin and ⁇ -actin are utilized as "DNA stuffer" sequences between the packaging signal and the HTV- 1 cassette, between the HIN-1 and the GM-CSF cassette and the GM-CSF cassette and the 3' ITR (see Figure 2). It is generally known that humans generate immune responses to the gag, pol and nef antigens and minimal adenoviral vectors (e.g., MAXIMUM-Ad TM ) comprising such antigens are desirable.
  • minimal adenoviral vectors e.g., MAXIMUM-Ad TM
  • the adenoviral vector constructs are analyzed for expression of the HTV-1 immunogen as well as the cytokine.
  • the constructs are transiently transfected into 293 cells using standard CaPO 4 transfection methods.
  • the cell supernatant is analyzed for the presence of the HIV capsid protein p24 by ELISA (Abbott Laboratories, Chicago, LL).
  • ELISA Abbott Laboratories, Chicago, LL
  • correct processing of the HIV multiprotein is verified using an anti-p24 Western blot.
  • the minimal Ad/TUV viral particles are concentrated from the supernatant by pelleting at 25,000g for 90 minutes at 4°C. The presence of the murine GM-CSF will be detected in the supernatant by ELISA (R&D Systems, Minneapolis, M ⁇ ).
  • HJV-1 proteins among transduced DC will be determined to ascertain whether expression alters the phenotype and function of the DC.
  • a murine fibroblast cell line ⁇ LH 3T3
  • other relevant cells such as spleen- and bone-marrow-derived DC.
  • viability of the cells is determined by trypan exclusion method and the kinetics of viability following expression of FLTV proteins (HLNgag/pol/tat nf /rev) observed.
  • the expression of the capsid protein p24 in cell culture supernatants is determined by standard ELISA (R&D Systems).
  • DC dendritic cells
  • GM-CSF and EL-4 dendritic cell enrichment columns
  • EL-4 dendritic cell enrichment columns
  • These in vitro derived DC may be contaminated with macrophages. In that case, the cells are sorted to isolate the CDllc+ population, thus enriching for DC.
  • In vitro derived DC are then infected with minimal Ad/HTV. Following infection on days 1 through 7, viability (by trypan blue exclusion) of transduced DC is compared to that of untransduced DC. The kinetics of expression of p24 (by ELISA) secreted by Minimal Ad/HTV transduced DC is monitored.
  • cytokines IL-l ⁇ and ⁇ , T ⁇ F ⁇ , LL-6, IL-12 (p35 and p40) by activated DC using ELISA and/or R ⁇ Ase protection assays.
  • Minimal Ad/HLV-transduced DC to function as APC (i.e., to present antigen and activate both CD8 and CD4 T cells) is then ascertained.
  • One to ten x 10 5 DC transduced with minimal Ad/HTV are injected i.v., into syngeneic (C57BLJ6) mice.
  • CD8 T cells are prepared (purified using Stem Cell Columns) from DC primed mice and restimulated with Minimal Ad HLV-transduced DC for 5 days to expand H V-specific CTL.
  • HTV-specific cytotoxicity is determined by chromium release assay, using fibroblasts transduced/infected with minimal Ad/TUN, FLV or H V vectors as targets.
  • CD4 T cells prepared (using stem cell columns for enrichment of CD4 T cells from minimal Ad/HIN transduced DC- primed mice are incubated with minimal Ad/HIN-transduced DC for 48h. Following incubation, proliferation of CD4 T cells is determined by the uptake of 3 H- thymidine. LL-2 and LF ⁇ secretion of CD4 T cells is assayed by bioassay and/or ELISA.
  • mice are then directly immunized intranasally, intramuscularly, intraparitoneally, or subcutaneously with the minimal Ad/HIV vector, and the induction of cellular and humoral immune responses evaluated in both mucosal and systemic immune compartments. The impact of boosting as well as the maintenance of immunological memory is also determined. In addition, we will assess and compare the levels of protection afforded by the minimal Ad/TUN vaccines using a challenge model incorporating a vaccinia vector encoding HLV genes.
  • CTL Primary and memory CTL responses are evaluated in the spleen, draining lymph nodes and genital tissues of immunized mice. CTL are functionally evaluated in a chromium release assay by expanding splenocytes in vitro for 5-7 days using minimal Ad/TUN transfected cells. Splenocytes may then be incubated with 51 Cr labeled -, gag peptide pulsed targets and targets infected with Nacc-gag in a chromium release assay.
  • antigen specific CTL will be quantitatively enumerated in an IF ⁇ - ⁇ ELISPOT assay.
  • Splenocytes are serially diluted and cultured in the presence or absence of the HLV CTL gag epitope on nitrocellulose plates coated with anti- LF ⁇ - ⁇ .
  • Spot forming cells (SFC) secreting LF ⁇ - ⁇ in response to peptide stimulation and representing HTV-specific CTL are then visually enumerated.
  • ELISPOT analysis will also be used for quantification of IL-4 and IL-2 expressing lymphocytes. Comparisons of the total numbers of antigen specific LF ⁇ - ⁇ , LL-4 and LL-2 producing cells allows quantitative comparisons between groups. In addition, relative numbers of cytokine producing CTL indicate the phenotype of the immune response.
  • HLV-specific CTL are further quantitated and characterized by flow cytometry (FACS staining).
  • HLV-specific CTL may be quantitated by stimulating with HJV gag peptides and staining for intracellular IF ⁇ - ⁇ production.
  • HJV gag peptides In conjunction with LF ⁇ - ⁇ , other characteristics of the CTL may be evaluated such as FasL, perform expression, or the presence of costimulation molecules or adhesion molecules as well as other cytokines.
  • initial CTL responses may be visualized in the mediastinal/cervical lymph nodes that drain the respiratory tract following intranasal immunization.
  • Responses observed in the draining lymph nodes indicate the state of development of mucosal CTL, an important component of a mucosal vaccine.
  • lymphocytes are isolated from the draining lymph nodes and cultured for 3 days in vitro. HTV-specific lymphocytes are evaluated in a chromium release assay, or for LFN- ⁇ production by ELISPOT or FACS analysis.
  • the CTL memory response may be evaluated in the local draining lymph nodes.
  • the presence of recall or memory CTL responses locally in the genital tract or other mucosal tissues has been shown to be essential for long term protection from mucosal challenge.
  • the CTL from the local draining lymph nodes can be examined 2-3 days following intravaginal challenge. At this early time post infection, the immune response is still undetectable in na ⁇ ve animals, however, in vaccinated mice that have the capacity to mount mucosal CTL responses there is a substantial CTL responses that develops.
  • Vacc-gag vaccinia virus vector expressing gag
  • CTL mucosal CTL
  • the presence of mucosal CTL is also be visualized directly in the genital tissues following intravaginal Vacc-gag challenge.
  • the cells are isolated by digestion of the genital tissues 2 to 3 days following challenge.
  • CTL specific for gag will be evaluated ex vivo by IFN- ⁇ production in an ELISPOT assay and by FACS staining as described above.
  • helper responses are evaluated and compared in the spleen or draining lymph nodes following Minimal Ad/HTV immunization.
  • Splenocytes are cultured with tat and gag protein (pl7, p24) and proliferation measured by incorporation of thymidine.
  • IL-2 production are evaluated as a measure of the magnitude of the response.
  • Other cytokines such as LFN- ⁇ and LL-4 produced during this proliferative response are also be assessed as an indication of the phenotype of the response.
  • the lymphocytes isolated during the primary or memory response from the lymph nodes draining the respiratory and genital tract are evaluated in a similar manner.
  • mice will be challenged intravaginally with an HTV-gag expressing vaccinia virus vector.
  • This vector is replication competent and encodes for gag proteins but does not incorporate these proteins in its membrane.
  • protection or resistance to a Vacc-gag challenge will be mediated by a cellular immune response.
  • vaccinia viral titres will be determined daily in the ovaries where the virus preferentially replicates.
  • the MiniAd-Human Papilloma Virus (HPV) vectors are designed to deliver HPV immunogens with or without immune enhancing genes.
  • the immunogens of HPV are the early region genes 6 and 7 (E6 and E7) and the later genes 1 and 2 (LI and L2). It was known that E6 and E7 are critical transactivators for HPV to establish productive infection in host cells.
  • the modified E6 and E7 gene (E6 d and E7 d ) products delivered by the vector may play an immunogenic function and induce anti-HPV responses, both humoral and cellular.
  • the LI and L2 are structural proteins and known antigens of HPV. Therefore, the LI and L2 genes are included in the MiniAd-HPV vector.
  • the MiniAd vector has the capacity to incorporate other genes or elements to enhance vector delivery, gene expression, vector genomic stability, and augmentation of host immune responses to the viral immunogens.
  • the various orientations of suitable enhancer and stuffer elements are shown in Figure 3.
  • Each vector contains the HPV genes LI, L2, mutated E6 and E7.
  • the vector additionally contains the cytokine gene GM-CSF.
  • the wild type LI and L2 genes in their natural sequence are incorporated into a single expression cassette in which the TK promoter and the poly-A signal of the bovine growth hormone (BGH) gene flanking LI and L2.
  • BGH bovine growth hormone
  • E6 and E7 genes may be mutated using PCR.
  • E6 and E7 are clustered using the internal ribosomal entry site (IRES) and constructed into an expression cassette contains SV40 promoter/enhancer and poly-A signal sequence.
  • the GM-CSF cDNA under the transcriptional control of the Rous Sarcoma Virus (RSV) promoter is included.
  • DNA fragments from human genes such as albumin, alpha-fetoprotein, beta-actin, or other tissue-specific enhancer sequences may also be incorporated into the vectors to enhance the packaging efficiency and stability of the vector as well as expression of the genes encoded thereon. Exemplary embodiments of such vectors are illustrated in Figure 3.
  • the MiniAd-HPV vector may be initially examined in vitro to determine whether infected cells produce E6, E7, LI, L2 and cytokine (when incorporated) gene products. Next, the induction of cellular immune responses to E6 and E7 and humoral and cellular immune responses to LI and L2 may be examined in vivo. Finally, protection from infection by HPV may be evaluated in an animal model. The development of antibodies to LI and L2 following immunization with MiniAd/HPV vaccine will depend on the expression of these antigens in vivo and also their formation into virus-like particles (VLPs).
  • VLPs virus-like particles
  • Humoral immunity may be evaluated in mucosal compartments as well as in serum following intranasal (LN), intramuscular (LM), intraparitoneal (LP), or subcutaneous (SC) immunization. Serum samples may be taken weekly following immunization and evaluated for IgG and IgA against the LI protein in a capture ELISA. In addition, the subclasses of IgG specific for LI may be evaluated (to assess the phenotype of humoral the response). Vaginal as well as lung/nasal washes may be taken at 2 weeks following immunization and evaluated for IgA and IgG content as may be done for serum above (IgG subclasses can also be determined).
  • LN intranasal
  • LM intramuscular
  • LP intraparitoneal
  • SC subcutaneous
  • the stage of the estrous cycle may be determined by analysis of the cells present in the smear. Antibody levels may then be evaluated with respect to the stage of the estrous cycle (IgA is relatively high at estrus, and conversely, IgG is higher at diestrus). The long-term presence of VLP or Ll/2-specific antibodies in the genital tract may also be determined.
  • the neutralizing capacity of antibodies from the serum and mucosal washes may be determined using an infectious pseudotype neutralization assay (Balmelli, et al. (1998) "Nasal immunization of mice with human papillomavirus type 16 virus-like particles elicits neutralizing antibodies in mucosal secretions" / Virol, vol. 72, pp. 8220-; Roden, et al. (1996) "In vitro generation and type-specific neutralization of a human papillomavirus type 16 virion pseudotype” J Virol, vol. 70, pp. 5875-).
  • infectious pseudotyped virions consisting of the HPV16 capsid, comprising LI and L2, and containing the bovine papilloma virus (BPV) genome, are generated.
  • the neutralizing capacity of mucosal and serum samples may be evaluated by quantitating the reduction in the induction of transformed foci in monolayers of mouse C127 cells.
  • Mucosal tissues may be isolated and digested 2 weeks following immunization and examined for HPV-specific B cells by ELISPOT analysis.
  • specific B cell memory responses may be evaluated in the genital tract following intravaginal challenge with the pseudotyped virus or a vaccinia virus expressing LI antigens. This will demonstrate the local (or mucosal-specific) component of the antibody response observed in the genital tract.
  • CTL responses may be evaluated in the spleen, draining lymph nodes and genital tissues of immunized mice. CTL from the spleen in at least 3 ways.
  • CTL may be functionally evaluated in a chromium release assay by expanding CTL in vitro using peptide (i.e., amino acids 49-57 from E7 for H-2 b mice) pulsed cells or cell lines expressing HPV genes (i.e., E6/7, Ll/2). Splenocytes may then be purified and cultured for 5-7 days with peptide before being incubated with 51 Cr labeled E7-expressing cell lines (TC-1) or peptide pulsed targets (B16F1).
  • peptide i.e., amino acids 49-57 from E7 for H-2 b mice
  • HPV genes i.e., E6/7, Ll/2
  • Splenocytes may then be purified and cultured for 5-7 days with peptide before being incubated with 51 Cr labeled E7-expressing cell lines (TC-1) or peptide pulsed targets (B16F1).
  • CTL may also be enumerated in an ELISPOT assay to determine IFN- ⁇ production levels.
  • Splenocytes are first serially diluted and cultured in the presence or absence of peptide on nitrocellulose plates coated with anti-EFN- ⁇ .
  • Spot-forming cells (SFC) secreting LFN- ⁇ in response to peptide stimulation are determined, and the E7-specific CTL enumerated.
  • CTL may also be characterized by flow cytometry (FACS staining). E7-specific CTL are quantitated by stimulating the cells with peptide (i.e., amino acids 49-57 from E7 for H-2 b mice) and staining for intracellular LFN- ⁇ production. In addition, other characteristics of the CTL may be evaluated such as the expression of FasL, perforin, or cytokines, or the presence of costimulatory or adhesion molecules.
  • FACS staining flow cytometry
  • CTL from the iliac lymph nodes that drain the genital tract or mediastinal/cervical lymph nodes that drain the respiratory tract may also be evaluated using the methods described above, for example.
  • the in vitro stimulation procedure is not necessary and the primary assay can be carried out 5 days following initial immunization.
  • the memory response can be evaluated by examining the CTL from the lymph nodes two days following in vivo challenge using the pseudotyped virus or a vaccinia virus vector expressing E6/7 or Ll/2.
  • CTL from the genital tract may be evaluated without the in vitro stimulation required for splenocytes.
  • cells are isolated by digestion of the genital tissues.
  • CTL from the genital tract are visualized by LFN- ⁇ production in an ELISPOT assay or by FACS staining.
  • Helper responses may be evaluated in the spleen or draining lymph nodes.
  • Splenocytes are cultured with the recombinant E6/7 or Ll/2 recombinant protein or MHC U restricted peptide of E7 (amino acids 44-62) and proliferation measured by incorporation of thymidine.
  • LL-2 production may also be evaluated as an indicator of proliferation.
  • Other cytokines produced during this proliferative response (LFN- ⁇ ) is also assessed as an indication of the phenotype of the response.
  • the lymph node cells draining the respiratory tract are isolated 5-7 days post-immunization and stimulated as described above.
  • mice are challenged with tumors derived from E7 E6 transformed cell lines. Growth of tumors is monitored as a read out of protection (i.e., the RMA cell line on the B6 background; Shi, W. et al. (1999) "Human papillomavirus type 16 E7 DNA vaccine: mutation in the open reading frame of E7 enhances specific cytotoxic T-lymphocyte induction and antitumor activity" J Virol, vol. 73, no. 9, pp. 7877-7881). Human papillomavirus type 16 E7 DNA vaccine: mutation in the open reading frame of E7 enhances specific cytotoxic T-lymphocyte induction and antitumor activity. (Shi, W.
  • RMA cells are injected SC and tumor volume measured over time.
  • mice harboring tumors are immunized with the vector and monitored for clearance of established tumors.
  • Lrrmunized mice are also challenged LV with metastatic E6 E7 expressing tumor cells (TC-1) that localize exclusively in the lungs.
  • TC-1 metastatic E6 E7 expressing tumor cells
  • This model is attractive since there is a mucosal component to the localization of the tumor.
  • Mice can also be given TC-1 cells prior to immunization with the Minimal Ad/HPN vector.
  • This model has been used following immunization with a vaccinia vector expressing E7 and LAMP- 1 and shown protection (Ji, et al. 1998. Antigen-specific immunotherapy for murine lung metastatic tumors expressing human papillomavirus type 16 E7 oncoprotein. Int J Cancer 78:41.).
  • Mice may also be challenged intravaginally with a recombinant vaccinia virus expressing LI and L2. Vaccinia viral titres are then determined from the ovaries as a readout of protection (Marais, et al. 1999.
  • a recombinant human papillomavirus (HPV) type 16 Ll- vaccinia virus murine challenge model demonstrates cell-mediated immunity against HPV virus-like particles. J Gen Virol 80:2471.).
  • This model may also be extended to challenge with recombinant vaccinia or herpes vectors expressing LI and L2 or E6 and E7 antigens (He, et al. 2000. Viral recombinant vaccines to the E6 and E7 antigens of HPV-16. Virology 270:146).
  • a rabbit challenge model offers the ability to assess papilloma warts that are similar to those observed in humans.
  • Immunized rabbits may be challenged in the skin with cottontail rabbit papilloma virus (CRPV) and monitored for papilloma formation (Sundaram, P. et al. (1998) "Intracutaneous vaccination of rabbits with the E6 gene of cottontail rabbit papillomavirus provides partial protection against virus challenge" Vaccine, vol 16, no. 6, pp. 613-623). Complete or partial protection may be observed in all animals.
  • CRPV rabbit oral papilloma virus
  • ROPV offers a mucosal model in the rabbit. This virus shares homology in LI with CRPV (68% a.a. identity for LI).
  • Transcriptional targeting includes the use of a transcriptional regulatory unit that drives gene expression in only a certain type of cell or tissue.
  • a transcriptional regulatory unit is referred to as being tissue-specific.
  • a minimal Ad vector is designed to incorporate a tissue-specific transcriptional regulatory unit driving expression of a reporter or effector gene. In this manner, expression of the reporter or effector gene under control of the tissue-specific transcriptional regulatory unit will be detected at a higher level in those specific tissues in which the transcriptional regulatory unit is active. It may be preferable to restrict gene expression to a certain cell type or tissue.
  • Therapeutic genes are often toxic if expressed in high amounts. Regulation of gene expression to specific tissues, then, may serve to protect the host from the adverse effects of high level gene expression of certain therapeutic genes.
  • a further method to direct tissue-specific gene expression would be to utilize a helper virus that encodes a cell surface protein reactive to a ligand on a cell type of interest.
  • a helper virus may be engineered to express a ligand for a cell surface receptor.
  • an recombinant adenoviral particle that binds to a receptor on the surface of a cell is produced.
  • a further example would include a recombinant adenovirus that expresses an antibody or a fragment of an antibody on the surface of its viral coat.
  • Such a recombinant virus may be produced by engineering a packaging-deficient helper virus to express an antibody or antibody fragment as a fusion or a separate protein on its viral coat.
  • a packaging-deficient helper virus to express an antibody or antibody fragment as a fusion or a separate protein on its viral coat.
  • recombinant adenoviral particles having an antibody or antibody fragment reactive to a cell surface molecule on a target cell are produced.
  • recombinant adenoviral particles will specifically bind to those cells in the host that express cell surface molecules reactive to said antibodies or antibody fragments.
  • Certain autoimmune disorders result from the inappropriate immune reactions.
  • One method that may be utilized to prevent, halt or slow the autoimmune reaction is to direct expression of immunomodulatory proteins at the site of such reactions. This may be accomplished by application of adenoviral particles constructed from a minimal Ad genome as demonstrated within this application. Genes encoding certain cytokines or chemokines may be expressed and such expression may result in an attenuation of the immune reponse. This attenuation in the immune response would then lead to an alleviation of the symptoms of the autoimmune reaction.
  • a further example may include the attenuation of an allergic reaction.
  • An antigen known to cause an allergic reaction may be encoded by a minimal Ad vector.
  • the minimal Ad vector that hybridize with other elements It will also be possible to utilize the minimal Ad vectors disclosed in this application to prevent or eliminate viral infection and replication within a host.
  • Minimal Ad vectors can be designed such that viral certain genetic processes may be interfered with or eliminated.
  • the minimal Ad vectors may be designed to express antisense nucleic acids that interfere with viral replication at the transcriptional or translational stage of infection. Interference may be promoted by the expression of antisense RNA or DNA including that which binds to messenger RNA or binds to DNA after integration of a viral genome to prevent transcription. Also, ribozymes may be designed that target certain viral transcripts for destruction. "Decoy" molecules may also be encoded by a minimal Ad vector. Such decoys may function by binding to transcription factors required for viral trasncription such that the trasncription factors are no longer available for binding to and driving trasncription of genes required for viral gene expression and replication.
  • the AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell 61: 447-457.
  • a maltose-binding protein/adeno-associated virus rep68 fusion protein has DNA-RNA helicase and ATPase activities. J. Virol. 69: 3542-3548.
  • Adeno-associated virus (AAV) rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91: 5808-5812.
  • helper-dependent adenovirus helper system removal of helper virus by cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93: 13565-13570.
  • Adenovirus type 5 packaging domain is composed of a repeated element that is functionally redundant. J. Virol. 64: 2047-2056.
  • yeast UAS G is a transcriptional enhancer in human Hela cells in the presence of the Gal4 trans-activator. Cell 52: 169-178,
  • pl5INK4B is a potential effector of TGF- ⁇ -induced cell cycle arrest. Nature 371: 257-261.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Medicinal Chemistry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention se rapporte à des vecteurs adénoviraux (Ad) et à leurs applications dans le domaine de la médecine génétique et notamment, mais pas exclusivement, en vaccination génique, en transfert génique, en thérapie génique et analogue. L'invention se rapporte plus spécifiquement à des vecteurs adénoviraux qui portent l'élément cis minimal du génome de l'adénovirus (vecteur Ad minimal) et qui sont capables de délivrer de 36 kb environ à 38 kb environ d'ADN hétérologue. La génération et la propagation des vecteurs Ad minimaux nécessitent une complémentation trans d'un adénovirus assistant (assistant), atténué par encapsidation et défectif s'agissant de sa réplication, dans une lignée de cellules T auxiliaires d'adénovirus. L'invention se rapporte également à des vecteurs adénoviraux minimaux pouvant être utilisés pour le traitement ou la prévention de maladies ou d'états pathologiques, à des méthodes de génération de tels vecteurs et à des systèmes d'essai sur des animaux permettant une évaluation in vivo de ces vecteurs adénoviraux. Plus spécifiquement, l'invention se rapporte à des vecteurs adénoviraux du VIH et/ou du papillomavirus (HPV) qui contiennent des éléments cis minimaux du génome de l'adénovirus et comprennent une séquence d'acide nucléique du VIH et/ou HPV comportant approximativement jusqu'à 36 à 38 kb d'éléments d'acide nucléique de support et/ou de complémentation. L'adénovirus minimal du VIH et/ou HPV peut être généré et de préférence amplifié grâce à l'aide de l'adénovirus assistant atténué par encapsidation et d'une lignée de cellules T auxiliaire. Cette invention se rapporte également à des procédés de conception de tels vecteurs adénoviraux minimaux et à des procédés permettant de tester ces vecteurs in vivo.
PCT/US2001/031842 2000-10-10 2001-10-10 Vaccins de recombinaison a mediation par adenovirus minimal WO2002031168A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002211654A AU2002211654A1 (en) 2000-10-10 2001-10-10 Minimal adenoviral vector and recombinant vaccines based thereon

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US23922400P 2000-10-10 2000-10-10
US60/239,224 2000-10-10
US24162500P 2000-10-19 2000-10-19
US60/241,625 2000-10-19

Publications (2)

Publication Number Publication Date
WO2002031168A2 true WO2002031168A2 (fr) 2002-04-18
WO2002031168A3 WO2002031168A3 (fr) 2003-04-17

Family

ID=26932381

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/031842 WO2002031168A2 (fr) 2000-10-10 2001-10-10 Vaccins de recombinaison a mediation par adenovirus minimal

Country Status (2)

Country Link
AU (1) AU2002211654A1 (fr)
WO (1) WO2002031168A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009094647A2 (fr) 2008-01-25 2009-07-30 Introgen Therapeutics, Inc. Biomarqueurs p53
WO2012137071A2 (fr) 2011-04-06 2012-10-11 Biovaxim Limited Compositions pharmaceutiques pour prévenir et/ou traiter une maladie provoquée par le vih chez des êtres humains

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997002355A1 (fr) * 1995-07-04 1997-01-23 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Virus mva recombinants et leur utilisation
WO1998054345A1 (fr) * 1997-05-30 1998-12-03 Baxter International Inc. Vecteur mini-adenoviral
WO1999008706A1 (fr) * 1997-08-14 1999-02-25 Commonwealth Scientific And Industrial Research Organisation Vecteur d'adenovirus de recombinaison porcin
WO2002008436A2 (fr) * 2000-07-20 2002-01-31 Genstar Therapeutics Corporation Système de vecteur mini-adénoviral pour vaccination

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997002355A1 (fr) * 1995-07-04 1997-01-23 GSF-Forschungszentrum für Umwelt und Gesundheit GmbH Virus mva recombinants et leur utilisation
WO1998054345A1 (fr) * 1997-05-30 1998-12-03 Baxter International Inc. Vecteur mini-adenoviral
WO1999008706A1 (fr) * 1997-08-14 1999-02-25 Commonwealth Scientific And Industrial Research Organisation Vecteur d'adenovirus de recombinaison porcin
WO2002008436A2 (fr) * 2000-07-20 2002-01-31 Genstar Therapeutics Corporation Système de vecteur mini-adénoviral pour vaccination

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BALAGUE C. ET AL.: "Sustained high-level expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector." BLOOD, vol. 95, no. 3, 1 February 2000 (2000-02-01), pages 820-828, XP002216559 ISSN: 0006-4971 *
HINKULA J. ET AL.: "Nucleic acid vaccination with HIV regulatory genes: a combination of HIV-1 genes in separate plasmids induces strong immune responses" VACCINE, vol. 15, no. 8, 1 June 1997 (1997-06-01), pages 874-878, XP004075674 ISSN: 0264-410X *
NATUK R. J. ET AL.: "ADENOVIRUS VECTORED VACCINES" DEVELOPMENTS IN BIOLOGICAL STANDARDIZATION, KARGER, BASEL, CH, vol. 82, 1994, pages 71-77, XP000973545 ISSN: 0301-5149 *
SVANHOLM C. ET AL.: "ENHANCEMENT OF ANTIBODY RESPONSES BY DNA IMMUNIZATION SUING EXPRESSION VECTORS MEDIATING EFFICIENT ANTIGEN SECRETION" JOURNAL OF IMMUNOLOGICAL METHODS, vol. 228, no. 1/2, 1999, pages 121-130, XP000881871 ISSN: 0022-1759 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009094647A2 (fr) 2008-01-25 2009-07-30 Introgen Therapeutics, Inc. Biomarqueurs p53
WO2012137071A2 (fr) 2011-04-06 2012-10-11 Biovaxim Limited Compositions pharmaceutiques pour prévenir et/ou traiter une maladie provoquée par le vih chez des êtres humains
EP3000476A1 (fr) 2011-04-06 2016-03-30 Biovaxim Limited Compositions pharmaceutiques pour prévenir et/ou traiter une maladie vih chez l'homme

Also Published As

Publication number Publication date
AU2002211654A1 (en) 2002-04-22
WO2002031168A3 (fr) 2003-04-17

Similar Documents

Publication Publication Date Title
EP0954591A2 (fr) Vecteur mini-adenoviral
US6156497A (en) Recombinase-mediated generation of adenoviral vectors
DE69534166T2 (de) Rekombinanter adenovirus und methoden zu dessen verwendung
SK78598A3 (en) Complementary adenoviral vector systems and cell lines
WO1997025446A9 (fr) Generation de vecteurs adenoviraux a mediation de recombinase
JPH11262397A (ja) 複製欠陥組換えレトロウィルス
AU8576298A (en) Lentiviral vectors
JP4787440B2 (ja) 変異型ｆｒｔ配列を含有してなるｄｎａ
US20030192066A1 (en) Minimal adenoviral vector
JPH10512243A (ja) 遺伝子送達ビヒクルの非外傷性投与
US20070166286A1 (en) Self-rearranging DNA vectors
Jaalouk et al. Glucocorticoid-inducible retrovector for regulated transgene expression in genetically engineered bone marrow stromal cells
US20020088014A1 (en) Minimal adenovirus mediated recombinant vaccine
JPH10510995A (ja) 胚細胞発現のためのレトロウイルスベクター
US20040208846A1 (en) Mini-Ad vector for immunization
JPH10512242A (ja) 組み合わせ遺伝子送達ビヒクル
WO2002042482A2 (fr) Vecteur lentiviral fonctionnel a partir d'un squelette base sur mlv
WO2002031168A2 (fr) Vaccins de recombinaison a mediation par adenovirus minimal
WO2002008436A2 (fr) Système de vecteur mini-adénoviral pour vaccination
WO2002085287A2 (fr) Vecteurs adenoviraux minimaux pour immunisation
Ruiz et al. Robust hepatic gene silencing for functional studies using helper-dependent adenoviral vectors
He et al. Construction of adenoviral and retroviral vectors coexpressing the genes encoding the hepatitis B surface antigen and B7-1 protein
CZ402398A3 (cs) Molekuly DNA aplikující se in vivo, jejich příprava a farmaceutická kompozice, která je obsahuje
US20030031650A1 (en) Drug inducible system and use thereof
WO2002088319A2 (fr) Vecteur mini-adenoviral et ses methodes d'utilisation

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PH PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP