WO2002026828A1 - Nouveau polypeptide, complexe proteique humain majeur d'histocompatibilite de type iii 61, et polynucleotide codant ce polypeptide - Google Patents
Nouveau polypeptide, complexe proteique humain majeur d'histocompatibilite de type iii 61, et polynucleotide codant ce polypeptide Download PDFInfo
- Publication number
- WO2002026828A1 WO2002026828A1 PCT/CN2001/001116 CN0101116W WO0226828A1 WO 2002026828 A1 WO2002026828 A1 WO 2002026828A1 CN 0101116 W CN0101116 W CN 0101116W WO 0226828 A1 WO0226828 A1 WO 0226828A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- major histocompatibility
- protein complex
- human
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human type II major histocompatibility protein complex 61, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. , Background technique
- the main histocompatibility protein complex (MHC) in the organism is a series of genes encoded by protein molecules. These protein products are involved in regulating many important physiological processes such as cell-to-cell recognition and interaction in the body.
- MHC histocompatibility protein complex
- the rejection response is a response to the human major histocompatibility antigen (HLA) in the transplant.
- HLA human major histocompatibility antigen
- the degree of difference between the HLA of the donor and the recipient determines the severity of the rejection. It can be known from the above that selecting donors and recipients with similar histocompatibility is the key to the success of allogeneic tissue and organ transplantation.
- the major histocompatibility antigen complex is a protein product encoded by the MHC gene, which plays an extremely important role in this immune regulation.
- the main physiological role of HLA molecules is to present antigens to T cells to induce the cells to produce corresponding immune responses, in which type II antigens regulate the magnitude of the immune response, and type II antigens are highly expressed in complement C2, C4 and factor B .
- T cell-mediated delayed hypersensitivity and cytotoxicity play an important role in graft rejection.
- Donor lymphocytes and dendritic cells in the transplant have abundant HLA antigens and are the main allergens. Once they are recognized by the recipient lymphocytes, they can cause a series of allergic and rejection reactions. Therefore, when the major histocompatibility between the donor and recipient is similar, the probability of rejection will be significantly reduced, that is, the success rate of transplantation is high.
- the major histocompatibility protein complex plays an important regulatory role in the recognition and action of heterologous tissues in organisms, and is an important determinant of the success of organ transplantation in vivo.
- major histocompatibility protein complexes There are three different types of major histocompatibility protein complexes in mammals. They cooperate in vivo, and copper controls the occurrence of various immune and rejection reactions in vivo. Mutation or abnormal expression of any of these types of protein complexes will lead to failure of organ transplantation.
- Such proteins are usually closely related to the occurrence of pathological phenomena such as organ transplant rejection, overreaction to disease, or underreaction in vivo.
- the human gene of the present invention has 96% identity and 96% similarity at the protein level with the known human in type main histocompatibility protein complex, and has similar structural characteristics to it. Based on the above points, the novel gene of the present invention is considered to be a new member of the human I I type I major histocompatibility protein complex family, and is named human type II major histocompatibility protein complex 61. Based on this, it is inferred that it is a member of the human I I I major histocompatibility protein complex family, and has similar biological functions.
- the protein is expressed in cells such as factor B, complements C2, C4, etc. Mutations or abnormal expression of this protein will usually lead to failure of organ transplantation in vivo, and its rejection with organ transplantation in vivo, overreaction to disease, or underreaction. The occurrence of other pathological phenomena is closely related.
- the human type III major histocompatibility protein complex 61 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art Identification of more human type III major histocompatibility protein complex 61 proteins involved in these processes, especially the amino acid sequence of this protein. Isolation of the new human I I type I major histocompatibility protein complex 61 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human type III major histocompatibility protein complex 61.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human type III major histocompatibility protein complex 61.
- Another object of the present invention is to provide a method for producing a human III major histocompatibility protein complex 61.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention-human I I type I major histocompatibility protein complex 61.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide-to-human type III major histocompatibility protein complex 61 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the human type III major histocompatibility protein complex 61.
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 29-1705 in SEQ ID NO: 1; and (b) a sequence having 1-1952 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human I I I major histocompatibility protein complex 61 protein activity, which comprises utilizing the polypeptide of the present invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or disease susceptibility associated with abnormal expression of a human III type major histocompatibility protein complex 61 protein, comprising detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of polypeptides and / or polynucleotides of the present invention for use in the treatment of cancer, developmental or immune diseases or other diseases caused by abnormal expression of human type I major histocompatibility protein complex 61. Use of medicine.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with a human type II major histocompatibility protein complex 61, can cause the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to the human type III major histocompatibility protein complex 61.
- Antagonist refers to a type of major histocompatibility protein complex 61 that blocks or modifies the biology of the human III major histocompatibility protein complex 61 when combined with the human type III major histocompatibility protein complex 61.
- Active Or immunologically active molecules may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to the human type III major histocompatibility protein complex 61.
- Regular refers to a change in the function of human type I major histocompatibility protein complex 61, including an increase or decrease in protein activity, a change in binding characteristics, and the function of human type III major histocompatibility protein complex 61. Any other biological, functional or immune change.
- Substantially pure ' 1 means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human type III major histocompatibility proteins using standard protein purification techniques.
- Complex 61 A substantially pure human type III major histocompatibility protein complex 61 produces a single main band on a non-reducing polyacrylamide gel. Human ⁇ type I major histocompatibility protein complex 61 The purity of the polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence "C-T-G-A” can be combined with the complementary sequence "G-A-C-T”.
- the complementarity between two single-stranded molecules may be partial or complete. 'The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acids or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higg ins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Clus ter method groups each group by checking the distance between all pairs. The sequences are arranged in clusters. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence B
- nucleic acid sequences X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B
- percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (He in J., (1990) Methods in emzumol ogy 183: 625-645)
- 0 "similarity" is Refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences.
- Amino acids used for conservative substitutions may include-aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; have uncharged head groups
- Amino acids with similar hydrophilicity may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine .
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to the epitope of human type III major histocompatibility protein complex 61.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.
- isolated human III type I major histocompatibility protein complex 61 means that the human type III major histocompatibility protein complex 61 is substantially free of other proteins, lipids, Sugars or other substances.
- the present invention provides a novel polypeptide-human type III major histocompatibility protein complex 61, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the present invention also includes fragments, derivatives and analogs of the human type II major histocompatibility protein complex 61.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human type I I type major histocompatibility protein complex 61 of the present invention.
- a fragment, derivative, or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1952 bases, and its open reading frame 29-1705 encodes 558 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 96% homology with the human type III major histocompatibility protein complex. It can be concluded that the human type III major histocompatibility protein complex 61 has human III Structure and Function of Type I Major Histocompatibility Protein Complex.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- the DNA form includes C DNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fico ll, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human I I type I major histocompatibility protein complex 61.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human I I type I major histocompatibility protein complex 61 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al.,
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcription of human type III major histocompatibility protein complex 61 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- the protein product of human type III major histocompatibility protein complex 61 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). .
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).
- the RACE method RACE-rapid amplification of cDNA ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein.
- the amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human type III major histocompatibility protein complex 61 coding sequence, and the recombinant technology to produce the present A method of inventing the polypeptide.
- a polynucleotide sequence encoding a human type III major histocompatibility protein complex 61 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human type II major histocompatibility protein complex 61 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Labora tory Manua 1, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV 40 enhancers on the late side of the replication start point, polyoma enhancers and adenovirus enhancers on the late side of the replication start point.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding a human type III major histocompatibility protein complex 61 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a gene containing the polynucleotide or the recombinant vector. Engineered host cells.
- host cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
- a prokaryotic cell such as a bacterial cell
- a lower eukaryotic cell such as a yeast cell
- a higher eukaryotic cell such as a mammalian cell.
- Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CHO, COS or Bowes melanoma cells.
- Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human I I type I major histocompatibility protein complex 61 (Sc ience, 1984; 224: 1431). Generally there are the following steps:
- polynucleotide or variant
- encoding the human-human type III major histocompatibility protein complex 61 of the present invention or a suitable host transformed or transduced with a recombinant expression vector containing the polynucleotide Cell
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromat
- FIG. 1 is a comparison diagram of amino acid sequence homology of the inventor's type III major histocompatibility protein complex 61 and human type III major histocompatibility protein complex.
- the upper sequence is human type III major histocompatibility protein complex 61
- the lower sequence is human type III major histocompatibility protein complex.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+”.
- Figure 2 is a polyacrylamide gel electrophoresis chart (SDS-PAGE) of an isolated human type II major histocompatibility protein complex 61.
- 61kDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Example 1 Cloning of human type III major histocompatibility protein complex 61
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multicloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ . The bacteria formed a cDNA library.
- Dye terminate cycle reaction sequencing kit Perkin-Elraer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0197e05 was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the human type III major histocompatibility protein complex 61 of the present invention and the protein sequence encoded by the same were subjected to the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], homology search in databases such as Genbank, Swissport.
- the gene with the highest homology to the human type III major histocompatibility protein complex 61 of the present invention is an unknown human type III major histocompatibility protein complex, and the protein encoded by it is in the accession number of Genbank for
- RNA sample was used as a template, and oligo-dT was used as a primer to perform reverse transcription reaction to synthesize cDM.
- PCR was performed with the following primers:
- Primerl 5'- GGGAAGAGCAGCGGCCCGAGCCGG -3 '(SEQ ID NO: 3)
- Primer2 5'- AAAAATACCTTTTTATTAATTATT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l of reaction volume in 50 ⁇ l of C1, 10 mmol / L Tris-Cl, ( ⁇ 8.5 ⁇ ), 1.5 ⁇ l / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30 sec; 55 ° C 30 sec; 72 ° C 2miii.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit.
- DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1 to 1952bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human type III major histocompatibility protein complex 61 gene expression: total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0 This method includes acidic thiocyanate Guanidinephenol-chloroform extraction.
- the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge.
- the aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate.
- the obtained RM precipitate was washed with 70% ethanol, dried and dissolved in water.
- electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.
- Example 5 In vitro expression, isolation and purification of recombinant human type III major histocompatibility protein complex 61 A pair of specific amplification primers were designed based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, The sequence is as follows:
- Primer 3 5'-CCCCATATGATGGCGAAGCTGCTGAGCTGCGTC-3 '(Seq ID No: 5)
- Primer4 5'-CATGGATCCCTAGAGGTGCCAGGGCATCTGGAA-3 '(Seq ID No: 6)
- the 5' ends of these two primers contain Nhel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively.
- Nhel and BamHI restriction sites correspond to selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3).
- PCR was performed using the pBS-0197e05 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of plasmid pBS-0197e05, primers? 1 1116: 1: -3 Hekou? 6]: -4 points and 1) is 1011101, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into the colibacillus DH5 ⁇ by the calcium chloride method.
- the cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was subjected to centrifugation, and chromatography was performed using an His. Bind Quick Cartridge (product of Novagen) which can bind to 6 histidines (6His-Tag)
- the purified human protein III major histocompatibility protein complex 61 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 61 kDa ( Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.
- Example 6 Production of anti-human type III major histocompatibility protein complex 61 antibody
- NH2-Met-Ala-Lys-Leu-Leu-Ser-Cys-Val-Leu-Gly-Pro-Arg-Leu-Tyr-Lys-C00H (SEQ ID NO: 7).
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the a-cyanin polymorphic complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- the suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method Acid sequence or a homologous polynucleotide sequence thereof.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;
- the primary probe is compared with its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions. If the homology with the non-target molecular region is greater than 85% or more than 15 consecutive bases are identical, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared after the collection solutions of the first peak are combined.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (l OxDenhardt's; 6xSSC, 0. lrag / ml) was added.
- prehybridization solution l OxDenhardt's; 6xSSC, 0. lrag / ml
- CT DNA (calf thymus DNA).
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Example 8 DM Microarray
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software, so as to achieve the purpose of analyzing biological information quickly, efficiently and with high throughput.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature for various references.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by (as described in Example_) the PCR, and the amplified product was purified to a concentration of about 500ng / ul, and a Cartesian 7500 spotting instrument (purchased from Cartesian Corporation, USA) was used. The point is on the glass medium, and the distance between the points is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips.
- the specific method steps have been variously reported in the literature, and the specific method steps have been variously reported in the literature.
- the sample post-processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 ' -deoxyuri dine 5'-triphate coupled to Cy3 f luorescent dye (purchased from Araersham Pamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamacia Biotech) was used to label the raRNA of liver cancer tissue, and the probe was prepared after purification.
- the probes from the above two tissues and the chips were respectively hybridized in a UniHyb TM Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and a washing solution (1> ⁇ SSC, 0.2% SDS) was used at room temperature. After washing, it was scanned with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned image was analyzed by Imagene software (Biodi scovery, USA), and the Cy3 / Cy5 ratio of each point was calculated. Points greater than 5 are considered genes with differential expression.
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Human 111 type major histocompatibility protein complex plays an important regulatory role in the recognition and action of human foreign tissues, and is an important determinant of the success of human organ transplantation. Moreover, it plays an important role in antigen processing, restricting the interaction between immune cells, inducing lymphocyte responses, and participating in ⁇ cell differentiation. Abnormal expression can cause disorders in the body's immune system, which in turn can lead to the occurrence of related diseases.
- the expression profile of the polypeptide of the present invention is consistent with the expression profile of human type II major histocompatibility proteins, and both have similar biological functions.
- the polypeptide of the present invention plays an important regulatory role in the recognition and action of heterologous tissues in the body, and is an important determinant of the success of human organ transplantation. Moreover, it plays an important role in antigen processing, restricting the interaction between immune cells, inducing lymphocyte responses, and participating in T cell differentiation. Abnormal expression can cause disorders of the body's immune system, which in turn can lead to the occurrence of related diseases, including but not limited to:
- Defects in cellular immune function can cause various intracellular parasitic infections and various viral infections. These diseases include but are not limited to: 1) Intracellular parasitic infections: typhoid, paratyphoid (typhoid), tuberculosis (tuberculosis), leprosy (leprosy), wave thermal conductivity (brutella), etc .;
- measles virus measles, measles bronchitis, pneumonia, otitis media, subacute sclerosis panencephalitis
- herpes virus herpes zoster, chicken pox
- Humoral immune deficiency can lead to various extracellular parasites and various viral infections. These diseases include but are not limited to:
- polio virus poliomyelitis
- hepatitis virus A, B, C, D, E, H, G
- viruses infections polio virus (poliomyelitis), hepatitis virus (A, B, C, D, E, H, G), etc .;
- Immunodeficiency patients are prone to malignant tumors, mainly leukemia and lymphatic tumors (malignant lymphomas [neck, mediastinum, mesenteric and retroperitoneal lymph nodes]).
- Immunodeficiency patients are prone to autoimmune diseases, and SLE, rheumatoid arthritis and malignant anemia are more common;
- Malignant lymphoma [Neck, mediastinum, mesenteric and retroperitoneal lymph nodes], various leukemias [lymphoid hematopoietic tissue], multiple myeloma [push / thoracic / rib / skull and long bone], etc .;
- polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as immune system dysfunction diseases, organ transplantation, and the like.
- the invention also provides methods for screening compounds to identify agents that enhance (agonist) or repress (antagonist) human Type II major histocompatibility protein complex 61.
- Agonists enhance human type II major tissue-compatibility protein complexes 61 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing a human type II major histocompatibility protein complex 61 and a labeled human type I I major histocompatibility protein complex 61 can be cultured in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human type I I major histocompatibility protein complex 61 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human type III major histocompatibility protein complex 61 can bind to human type III major histocompatibility protein complex 61 and eliminate its function, or inhibit the production of the polypeptide, or interact with the polypeptide The active site binding prevents the polypeptide from performing its biological function.
- human type III major histocompatibility protein complex 61 When screening compounds as antagonists, human type III major histocompatibility protein complex 61 can be added to the bioanalytical assay, and the compound can be used to compound human type III major histocompatibility proteins. The effect of the interaction between compound 61 and its receptor to determine whether the compound is an antagonist. In the same manner as described above for screening compounds, antagonist deletions and analogs can be screened.
- Polypeptide molecules capable of binding to human type III major histocompatibility protein complex 61 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 61 molecules of human type III major histocompatibility protein complex should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human type III major histocompatibility protein complex 61 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human III type major histocompatibility protein complex 61 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including It is not limited to Freund's adjuvant and the like.
- Techniques for preparing monoclonal antibodies to human type III major histocompatibility protein complex 61 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851) c and existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against human type III major histocompatibility protein complex 61.
- Antibodies against human type III major histocompatibility protein complex 61 can be used in immunohistochemical techniques to detect human type III major histocompatibility protein complex 61 in biopsy specimens.
- Monoclonal antibodies that bind to human type III major histocompatibility protein complex 61 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human type III major histocompatibility protein complex 61 For example, human type III major histocompatibility protein complex 61.
- High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human type III major histocompatibility proteins Complex 61 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to the human type III major histocompatibility protein complex 61.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human type III major histocompatibility protein complex 61. .
- the invention also relates to the quantitative and localized detection of human III type major histocompatibility protein complex 61 levels Diagnostic test method. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human type III major histocompatibility protein complex 61 detected in the test can be used to explain the importance of human type III major histocompatibility protein complex 61 in various diseases and to diagnose human III A disease in which the major histocompatibility protein complex 61 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding human Type I I major histocompatibility protein complex 61 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human type II major histocompatibility protein complex 61. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human I I type I major histocompatibility protein complexes 61 to inhibit endogenous human I I type I major histocompatibility protein complexes 61 activity.
- a variant human III type major histocompatibility protein complex 61 may be a shortened human III type major histocompatibility protein complex 61 that lacks a signaling domain, although it may be related to downstream Substrate binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human type II major tissue-compatible protein complex 61.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human type III major histocompatibility protein complex 61 into cells .
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human type I I type I major histocompatibility protein complex 61 can be found in existing literature (Sambroolc, et al.).
- a polynucleotide encoding human type I I type I major histocompatibility protein complex 61 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DM
- ribozymes that inhibit human type III major histocompatibility protein complex 61 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester bonds or Peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human type I I major histocompatibility protein complex 61 can be used for diagnosis of diseases related to human type II major histocompatibility protein complex 61.
- the polynucleotide encoding human type III major histocompatibility protein complex 61 can be used to detect the expression of human type III major histocompatibility protein complex 61 or human type III major histocompatibility protein in a disease state Abnormal expression of complex 61.
- the DNA sequence encoding the human type II major histocompatibility protein complex 61 can be used to hybridize biopsy specimens to determine the expression status of the human type II major histocompatibility protein complex 61.
- Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be fixed as a probe on a microarray or a DM chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes. diagnosis.
- RNA-polymerase chain reaction (RT-PCR) in vitro amplification using human type II major histocompatibility protein complex 61-specific primers can also detect the transcription products of human type I major histocompatibility protein complex 61.
- Human type III major histocompatibility protein complex 61 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild type human type III major histocompatibility protein complex 61 DNA sequence Wait. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific cDNA library.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mendei ian
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human I type II major histocompatibility protein complex 61 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of doses of human type II major histocompatibility protein complex 61 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2002213742A AU2002213742A1 (en) | 2000-07-07 | 2001-07-02 | A novel peptide-human class iii mhc 61 and the polynucleotide coding this novel peptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00117015 CN1333239A (zh) | 2000-07-07 | 2000-07-07 | 一种新的多肽——人ⅲ型主要组织相容性蛋白复合物61和编码这种多肽的多核苷酸 |
CN00117015.5 | 2000-07-07 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2002026828A1 true WO2002026828A1 (fr) | 2002-04-04 |
Family
ID=4586413
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/001116 WO2002026828A1 (fr) | 2000-07-07 | 2001-07-02 | Nouveau polypeptide, complexe proteique humain majeur d'histocompatibilite de type iii 61, et polynucleotide codant ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1333239A (zh) |
AU (1) | AU2002213742A1 (zh) |
WO (1) | WO2002026828A1 (zh) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2280186A (en) * | 1993-07-23 | 1995-01-25 | Zeneca Ltd | Human MHC Class II transgenes |
FR2717498A1 (fr) * | 1994-03-18 | 1995-09-22 | Commissariat Energie Atomique | Transcrits du gène de CMH de classe I HLA-G et leurs applications. |
-
2000
- 2000-07-07 CN CN 00117015 patent/CN1333239A/zh active Pending
-
2001
- 2001-07-02 AU AU2002213742A patent/AU2002213742A1/en not_active Abandoned
- 2001-07-02 WO PCT/CN2001/001116 patent/WO2002026828A1/zh active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2280186A (en) * | 1993-07-23 | 1995-01-25 | Zeneca Ltd | Human MHC Class II transgenes |
FR2717498A1 (fr) * | 1994-03-18 | 1995-09-22 | Commissariat Energie Atomique | Transcrits du gène de CMH de classe I HLA-G et leurs applications. |
Non-Patent Citations (2)
Title |
---|
DATABASE GENBANK [online] 22 February 2000 (2000-02-22), ISOGAI T. ET AL., retrieved from GI:7022315 accession no. NCBI Database accession no. (AK001207.1) * |
DATABASE PROTEIN [online] 28 October 1999 (1999-10-28), ROWEN L. ET AL., retrieved from GI:4337103 accession no. NCBI Database accession no. (AAD18079.1) * |
Also Published As
Publication number | Publication date |
---|---|
AU2002213742A1 (en) | 2002-04-08 |
CN1333239A (zh) | 2002-01-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001083688A2 (fr) | Nouveau polypeptide, sous-unite humaine 13 phosphatidylinositol-4-phosphate-5-kinase ii beta, et polynucleotide codant pour ce polypeptide | |
WO2002026828A1 (fr) | Nouveau polypeptide, complexe proteique humain majeur d'histocompatibilite de type iii 61, et polynucleotide codant ce polypeptide | |
WO2001083743A1 (en) | A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide | |
WO2001075054A2 (fr) | Nouveau polypeptide, facteur humain de regulation 30 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001055195A1 (fr) | Nouveau polypeptide, proteine de type an1 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001072792A1 (fr) | Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide | |
WO2001075048A2 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 23, et polynucleotide codant pour ce polypeptide | |
WO2001075016A2 (fr) | Nouveau polypeptide, tyrosinase humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001072799A1 (fr) | Nouveau polypeptide, proteine humaine a doigt de zinc 9, et polynucleotide codant pour ce polypeptide | |
WO2001081382A1 (fr) | Nouveau polypeptide, proteine hs1 humaine 16, et polynucleotide codant pour ce polypeptide | |
WO2001070956A1 (fr) | Nouveau polypeptide, proteine humaine de reparation 8 du mesappariement de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001083678A2 (en) | A novel polypeptide, homo uridylic acid kinase 13 and polynucleotide encoding said polypeptide | |
WO2001072800A1 (fr) | Nouveau polypeptide, proteine humaine d'echange nucleotidique 13 contenant un domaine de liaison atp/gtp, et polynucleotide codant pour ce polypeptide | |
WO2001088154A1 (fr) | Nouveau polypeptide, facteur humain de regulation 17 de la transcription de la microglobuline, et polynucleotide codant pour ce polypeptide | |
WO2001083726A1 (fr) | Nouveau polypeptide, uridylate kinase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001077286A2 (fr) | Nouveau polypeptide, globine humaine 58 de l'uterus, et un polynucleotide codant pour ce polypeptide | |
WO2001047969A1 (fr) | Nouveau polypeptide, proteine de translocation nucleaire i10, et polynucleotide codant pour ce polypeptide | |
WO2001078755A2 (en) | A novel polypeptide - human ataxia-telangiectasia mutant protein 9 and a polynucleotide encoding the same | |
WO2001087968A1 (fr) | Proteine s4-36 ribosomale, polypeptide humain, et polynucleotide la codant | |
WO2001090351A1 (fr) | Nouveau polypeptide, facteur humain 13.31 de liaison d'interleukine, et polynucleotide codant ce polypeptide | |
WO2001081572A1 (fr) | Nouveau polypeptide, antigene humain rage4 25 du cancer du rein, et polynucleotide codant pour ce polypeptide | |
WO2001070994A1 (fr) | Nouveau polypeptide, dihydropyridine dicarboxylate deshydrogenase humaine 18, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |