WO2001083743A1 - A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001083743A1 WO2001083743A1 PCT/CN2001/000671 CN0100671W WO0183743A1 WO 2001083743 A1 WO2001083743 A1 WO 2001083743A1 CN 0100671 W CN0100671 W CN 0100671W WO 0183743 A1 WO0183743 A1 WO 0183743A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- red blood
- blood cell
- human red
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- a New Polypeptide Human Red Blood Cell Adhesin Alpha Alpha 11 Polynucleotide of this Polypeptide
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, ⁇ erythrocyte adduct protein a lpha subunit 11, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- the cytoplasmic membrane of eukaryotic cells contains a structural protein system called the spectrin membrane skeleton.
- the spectrin membrane skeleton plays a role in forming fixed membrane integrins and coupling these proteins to cytoplasmic proteins.
- ghost protein is the main component of the membrane skeleton, and it is a rod-shaped protein connected to F-actin at both ends.
- Actin, spectrin and auxiliary proteins together form the shortest orthodox dome structure in red blood cells.
- Short actin filaments are connected to five to seven spectrin molecules to form a polygonal network.
- Adductin is a membrane skeleton protein that promotes the connection of spectrin and actin. This response is regulated by calcium / calmodulin.
- the adduct protein consists of two subunits: an alpha subunit with a molecular weight of 103,000 and a beta subunit with a molecular weight of 97000.
- Adductin is also a substrate for protein kinase C. Immune-associated isoforms of red blood cell adduct are present in the meninges and liver, kidneys, lungs and testes. Adduct protein is located at the cell-to-cell contact site of epithelial tissue, and it has the function of assembling spectrin and actin networks.
- the a lpha subunit of the adduct is highly homologous to the beta subunit (Joshi et al (1991) J. Cel l Biol. 115: 665-675).
- the alpha subunit of the adduct protein is composed of three different regions.
- the N-terminal domain is proteolytic resistant, contains hydrophobic and hydrophilic residues, and has a spherical structure.
- the middle region connects the N- and C-terminal domains. It is a tail that is extremely sensitive to proteolytic enzymes.
- the C-terminal domain is rich in hydrophilic residues, contains phosphorylation sites, binds to calmodulin sites, and is necessary for linking spectrin and actin. .
- the gene encoding the alpha subunit is located on chromosome 4 (Joshi R, Gi ligan DM, Ot to E, McLaughl in T, Bennet t V, J Cel l Biol 1991 Nov; 115 (3): 665-75).
- the human red blood cell adductin a lpha subunit 11 protein plays an important role in regulating important functions of the body, such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. Therefore, there has been a need to identify more proteins in the field. Many human red blood cell adducts a lpha subunit 11 protein involved in these processes, especially the amino acid sequence identification of this protein. Isolation of the new human red blood cell adduct protein a lpha subunit 11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs, so isolating its coding DNA is important. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human red blood cell adduct protein a lpha subunit 11.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human red blood cell adductin a lpha subunit 11.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human red blood cell adductin apha subunit 11.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in human red blood cell adduct a lpha subunit 11. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 287-595 in SEQ ID NO: 1; and (b) a sequence having 1-1149 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human red blood cell adductin alpha subunit 11 protein activity, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human red blood cell adductin a lpha subunit 11 protein in vitro. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of red blood cell diseases, epithelial tumors, certain developmental disorders, inflammation, immune diseases, HIV infection or other human red blood cell adduct protein al pha Use of a medicament for a disease caused by abnormal expression of subunit 11.
- FIG. 1 is a comparison diagram of gene chip expression profiles of the human erythrocyte adductin al pha subunit 11 and the human erythrocyte adductin al pha subunit 11 according to the present invention.
- the upper graph is a graph of the expression profile of human erythrocyte adductin a lpha subunit 11 and the lower graph is the graph of the expression profile of human erythrocyte adhesin al pha subunit 11.
- 1 indicates fetal kidney
- 2 indicates fetal large intestine
- 3 indicates fetal small intestine
- 4 indicates fetal muscle
- 5 indicates fetal brain
- 6 indicates fetal bladder
- 7 indicates non-starved L02
- 8 indicates L02 +, lhr, As 3+
- 9 indicates ECV304 PMA-
- 10 means ECV304 PMA +
- 11 means fetal liver
- 12 means normal liver
- 13 means thyroid
- 14 means skin
- 15 means fetal lung
- 16 means lung
- 17 means lung cancer
- 18 means fetal spleen
- 19 means spleen
- 20 Indicates the prostate
- 21 indicates the fetal heart
- 22 is the heart
- 23 is the muscle
- 24 is the testis
- 25 is the fetal thymus
- 26 is the thymus.
- Figure 2 is a polyacrylamide gel electrophoresis image (SDS-PAGE) of the isolated human red blood cell adductin alpha subunit 11.
- lKDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when bound to the alpha subunit 11 of human red blood cell adductin, causes the protein to change, thereby regulating the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to human red blood cell adductin alpha subunit 11.
- Antagonist refers to a type that can block or regulate the biological or immunological activity of human erythrocyte adductin alpha subunit 11 when combined with human erythrocyte adductin alpha subunit 11.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human red blood cell adductin alpha subunit 11.
- Regulation refers to changes in the function of human red blood cell adductin alpha subunit 11, including an increase or decrease in protein activity, changes in binding characteristics, and any other biological properties of human red blood cell adductin a lpha subunit 11, Changes in functional or immune properties.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human red blood cell adductin alpha subunit 11 using standard protein purification techniques.
- the substantially pure human erythrocyte adductin alpha subunit 11 produces a single main band on a non-reducing polyacrylamide gel.
- the purity of human erythrocyte adductin alpha subunit 11 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method checks each pair by checking the distance between all pairs. Groups of sequences are arranged into clusters. Each cluster is then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:
- the number of residues in the sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues in the sequence can also be determined by the Clus ter method or using this Methods known in the art, such as Jotun Hein, determine the percent identity between nucleic acid sequences (Hein J., (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the amino acid at the corresponding position in the alignment of amino acid sequences. Residues Or the extent of conservative substitution.
- Amino acids used for conservative substitution may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (1) ') 2 and? ⁇ It can specifically bind to the antigenic determinant of human red blood cell adductin alpha subunit 11.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human red blood cell protein alpha subunit 11 refers to human red blood cell protein a lpha subunit 11 that is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated.
- Those skilled in the art can purify human red blood cell adductin alpha subunit 11 using standard protein purification techniques.
- Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.
- the purity of human erythrocyte adductin alpha subunit 11 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human red blood cell adductin alpha subunit 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or a recombinant technology from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, Insect and mammalian cells).
- a prokaryotic or eukaryotic host for example, bacteria, yeast, higher plants, Insect and mammalian cells.
- the polypeptide of the invention may be glycosylated, or it may be non-glycosylated.
- Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human red blood cell adductin alpha subunit 11.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human red blood cell adductin alpha subunit 11 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted
- the amino acid may or may not be encoded by the genetic code; or ( ⁇ ) such a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (III) such a Species, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethanol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide (such as a leader sequence) Or secreted sequences or sequences used to purify this polypeptide or protease sequences).
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1149 bases in length and its open reading frame 287-595 encodes 102 amino acids.
- this polypeptide has a similar expression profile with the human red blood cell adductin a lpha subunit, and it can be inferred that the human red blood cell adductin a lpha subunit 11 has the human red blood cell adductin a lpha subunit. Similar functions.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDM, genomic DM, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide means including a polynucleotide encoding the polypeptide and including additional Coding and / or non-coding polynucleotides.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2 .
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human red blood cell adduct protein alpha subunit 11.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence of the present invention encoding human red blood cell adductin alpha subunit 11 can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice.
- the more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating cDNA of interest is to isolate niRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mMA plasmid or phage cDNA library.
- kits are also commercially available. Obtained through industry (Qiagene).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DM-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript level of human red blood cell adduct protein alpha subunit 11 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the alpha subunit 11 gene of human red blood cell adduct protein.
- ELISA enzyme-linked immunosorbent assay
- a method using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human red blood cell adductin alpha subunit 11 coding sequence, and the recombinant technology to produce the Polypeptide method.
- a polynucleotide sequence encoding human red blood cell adductin a lpha subunit 11 may be inserted Into the vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- the expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells.
- Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human red blood cell adductin alpha subunit 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
- cell refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative example The children are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote, such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl 2 method. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human red blood cell adductin alpha subunit 11 (Science, 1984; 224: 1431). Generally speaking, there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- the cytoplasmic membrane of eukaryotic cells contains a structural protein system called the spectrin membrane skeleton.
- the spectrin membrane skeleton plays a role in forming specific membrane integrins and coupling these proteins to cytoplasmic proteins.
- ghost protein is the main component of the membrane skeleton. It is a rod-shaped protein connected to F-actin at both ends. Muscle Kinesin and spectrin and helper proteins together form the cytoskeleton in red blood cells.
- adductin promotes the connection of spectrin and actin, and is regulated by calcium / calmodulin.
- the adduct protein consists of an alpha subunit and a beta subunit, and the adduct protein is also a substrate of protein kinase C. Studies have shown that there are immune-associated isoforms of red blood cell adductin in the meninges as well as in the liver, kidneys, lungs and testes. Adduct protein is located at the cell-to-cell contact site of epithelial tissue, and it has the function of assembling spectrin and actin networks.
- the expression profile of the polypeptide of the invention is consistent with the expression profile of the human red blood cell adduct a lpha subunit, both of which have similar biological functions.
- the polypeptide of the present invention is mainly used as a cytoskeleton protein in the body, and shows its importance especially on the erythrocyte membrane, and also acts between the cells of the epithelial tissue. Its abnormal expression usually involves diseases related to abnormal cytoskeleton, especially some red blood cell diseases and diseases related to epithelial tissue.
- red blood cell diseases especially red blood cell diseases, epithelial tumors, certain development disorders, inflammation, and immune diseases.
- diseases include, but are not Limited to:
- Red blood cell disease erythrocytosis, hereditary oval red blood cells, malignant anemia, aplastic anemia, bone marrow anemia
- Epithelial tumors lung cancer, esophageal cancer, breast cancer, thyroid tumor, endometrial cancer, colon cancer, melanoma, bladder cancer, nasopharyngeal cancer, laryngeal cancer, tracheal tumor
- Inflammation chronic active hepatitis, sarcoidosis, chronic rhinitis, chronic gastritis, multiple sclerosis of the cerebral spinal cord, glomerulonephritis, atherosclerosis, gastric ulcer, cervicitis, certain infectious inflammations
- Immune diseases systemic lupus erythematosus, urticaria, atopic dermatitis, bronchial asthma, scleroderma, common variable immunodeficiency disease, primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
- the abnormal expression of the human red blood cell adduct protein a lpha subunit 11 of the present invention will also produce certain hereditary and hematological diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially red blood cell diseases, epithelial tumors, certain development disorders, inflammation, and immune diseases. , Some hereditary, hematological diseases, etc.
- the invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human red blood cell adductin a lpha subunit 11.
- Agonist increases human red blood cell adductin alpha Subunit 11 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- a mammalian cell or a membrane preparation expressing human red blood cell adductin alpha subunit 11 can be cultured together with a labeled human red blood cell adductin alpha subunit 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human erythrocyte adrenoceptor alpha subunit 11 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human erythrocyte adductin alpha subunit 11 can bind to human erythrocyte adductin a lpha subunit 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the Peptides cannot perform biological functions.
- human red blood cell adductin a lpha subunit 11 can be added to a bioanalytical assay. Influence to determine if a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human erythrocyte integrin alpha subunit 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the 11 molecules of human erythrocyte adductin subunit 11 are usually labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against human red blood cell adductin alpha subunit 11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human erythrocyte adenoprotein a lpha subunit 11 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human erythrocyte adductin a lpha subunit 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cells Hybridoma technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies U.S. Pat No. 4946778, can also be used to produce single chain antibodies against human red blood cell adduct a lpha subunit 11.
- Antibodies against human red blood cell adductin alpha subunit 11 can be used in immunohistochemical techniques to detect human red blood cell adductin a lpha subunit 11 in biopsy specimens.
- Monoclonal antibodies that bind to alpha subunit 11 of human erythrocytes can also be labeled with radioisotopes and injected into the body to track their location and distribution.
- This radiolabeled antibody can be used as a non- Traumatic diagnostic methods are used to locate tumor cells and determine if there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human erythrocyte adrenal protein alpha subunit 11 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human red blood cell adduct protein a lpha subunit. 11 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human red blood cell adductin alpha subunit 11.
- Administration of appropriate doses of antibodies can stimulate or block the production or activity of human red blood cell adductin apha subunit 11.
- the present invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human red blood cell adductin apha subunit 11.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human red blood cell adduct alpha subunit 11 detected in the test can be used to explain the importance of human red blood cell adduct alpha lpha subunit 11 in various diseases and to diagnose human red blood cell adduct alpha apha Radicals at work.
- the polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzyme, and can be analyzed by one-dimensional or two-dimensional or three-dimensional gel electrophoresis, and more preferably by mass spectrometry coding.
- Human red blood cell adduct alpha subunit 11 polynucleotides can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat cell proliferation, development, or metabolic abnormalities caused by the non-expression or abnormal / inactive expression of human red blood cell adductin apha subunit 11.
- Recombinant gene therapy vectors can be designed to express mutated human RBC adduct alpha subunit 11 to inhibit endogenous human RBC adduct alpha subunit 11 activity.
- a variant human erythrocyte adductin a lpha subunit 11 may be a shortened human erythrocyte adductin alpha subunit 11 lacking a signaling domain, and although it can bind to downstream substrates, it lacks a signal Conductive activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human red blood cell adduct protein apha subunit 11.
- Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human red blood cell adductin alpha subunit 11 into cells.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human erythrocyte adductin alpha subunit 11 can be found in existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding human red blood cell adductin alpha subunit 11 can be packaged into liposomes and transferred into cells.
- Methods for introducing polynucleotides into tissues or cells include: Injecting polynucleotides directly into tissues in vivo Or in vitro through a vector (such as a virus, phage, or plasmid) to introduce the polynucleotide into the cell, and then transplant the cell into the body.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human red blood cell adductin a 1 pha subunit 11 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RM molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
- Antisense MA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human red blood cell adductin a lpha subunit 11 can be used for diagnosis of diseases related to human red blood cell adductin a lpha subunit 11.
- the polynucleotide encoding human erythrocyte adductin alpha subunit 11 can be used to detect the expression of human erythrocyte adductin alpha subunit 11 or the abnormal expression of human erythrocyte adhesin a lpha subunit 11 in a disease state.
- the DNA sequence encoding the human erythrocyte adduct protein alpha subunit 11 can be used to hybridize biopsy specimens to determine the expression of human erythrocyte adduct protein a lpha subunit 11.
- Hybridization techniques include Southern blotting, Nor thern imprinting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available.
- Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DM chip (also known as a "gene chip") for differential expression analysis and gene diagnosis of genes in tissues.
- Human erythrocyte adduct alpha subunit 11 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human erythrocyte adduct alpha subunit 11 transcription products.
- RT-PCR RNA-polymerase chain reaction
- Detection of mutations in the human red blood cell adductin a lpha subunit 11 gene can also be used to diagnose human red blood cell adductin a lpha subunit 11-related diseases.
- Human red blood cell adduct, alpha subunit 11 mutant forms include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human red cell adduct protein alpha subunit 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Only few chromosome markers based on actual sequence data (repeat polymorphisms) are available For marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. 'Only those hybrid cells containing human genes corresponding to the primers will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technology, the cMA that is accurately mapped to a disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human red blood cell adductin a lpha subunit 11 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human red blood cell adductin a lpha subunit 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech ⁇ cDNA fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library.
- Dye terminate cycle react ion sequencing ki t Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequences were compared with the existing public D sequence database (Genebank) By comparison, it was found that the CDM sequence of one of the clones 0212f07 was the new D.
- a series of primers were synthesized to determine the inserted CDM fragments in both directions.
- Pr iraer2 5'- AGGGCGCTGGCAAGTGTAGCGGTC -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l reaction volume containing 50 mmol / L KCl, 10 mmol / L Tris-HCl pH 8.5, 1.5 mmol / L MgCl 2 , 200 mol / L dNTP, 1 Opmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72 ° C 2rain.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as 1-1149bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of the expression of human erythrocyte adduct alpha subunit 11 gene Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159].
- This method involves acid guanidinium thiocyanate-chloroform extraction
- the tissue was homogenized with 4M guanidine isothiocyanate-25m sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol ( 49: 1), mixed and centrifuged. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RM precipitate. Wash the obtained RM precipitate with 70% ethanol, dry and dissolve in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was transferred with a nitrocellulose membrane to which RNA was transferred. Hybridize overnight at 42 ° C in a solution containing 50% formamide-25mM KH 2 P0 4 (PH7. 4)-5 x SSC-5 x Denhardt, s solution and 200 g / ml salmon sperm DNA. After hybridization The membrane was washed in 1 x SSC-0. 1% SDS at 55 ° C. for 30 min. Then, it was analyzed and quantified by Phosphor Imager.
- Example 4 In vitro expression and isolation of recombinant human red blood cell adductin alpha subunit 11 And purification According to the sequence of the coding region shown in SEQ ID NO: 1 and Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:
- Pr imer3 5,-CCCCATATGATGGGGGAACAGAAAGAGGAACCA -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCTTATCCCCTGAAAGTGGTTTTGGA -3, (Seq ID No: 6)
- the two ends of these two primers contain Mel and BamHI digestion sites, respectively.
- the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET- Selective endonuclease site on 28b (+) (Novagen, Cat. No. 69865. 3).
- the PCR reaction was performed using the pBS-0212f07 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: 10 pg of pBS-0212f07 plasmid was contained in a total volume of 50 ⁇ 1, and Primer-3 and Primer-4 were 1 Opmol and Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- Ligation products were transformed by the calcium chloride method Escherichia bacteria DH5 a, the (final concentration of 30 ⁇ ⁇ / ⁇ 1) LB plates incubated overnight positive clones by colony PCR method containing kanamycin, and sequenced. A positive clone (PET-0212f07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0212f 07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to the final concentration lnmiol / L, Continue incubation for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain 6 histidines (6His-Tag). The purified human erythrocyte adductin alpha subunit 11 was purified.
- Polypeptide synthesizer (product of PE company) was used to synthesize the following specific peptides of human erythrocyte adductin alpha subunit 11:
- oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes. Uses: if the probe can be used to hybridize to the genomic or cDNA library of normal tissue or pathological tissue from different sources to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, it can further be used The probe detects whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof is abnormally expressed in cells of normal tissue or pathological tissue.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements For homology comparison of the regions, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used generally;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous to the gene fragment of SEQ ID NO: 1 Or complementary (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution 1 OxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data Analysis in order to achieve the purpose of fast, efficient and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature, for example, see the literature DeRis i, JL, Lyer, V. & Brown, P. 0.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from the human mixed tissue and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech), a fluorescent reagent, was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino -propargyl- 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe.
- Cy3dUTP (5-Amino-propargyl-2'-deoxyur idine 5--tr iphate coupled
- the probes from the above two types of tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was then performed with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU67288/01A AU6728801A (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00115545.8 | 2000-04-29 | ||
CN 00115545 CN1321673A (zh) | 2000-04-29 | 2000-04-29 | 一种新的多肽——人红细胞内收蛋白alpha亚基11和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001083743A1 true WO2001083743A1 (en) | 2001-11-08 |
Family
ID=4584991
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000671 WO2001083743A1 (en) | 2000-04-29 | 2001-04-28 | A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1321673A (zh) |
AU (1) | AU6728801A (zh) |
WO (1) | WO2001083743A1 (zh) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006030936A1 (ja) | 2004-09-13 | 2006-03-23 | Takeda Pharmaceutical Company Limited | 酸化化合物の製造方法及び製造装置 |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112679596B (zh) * | 2021-01-15 | 2022-03-15 | 武汉大学 | 一种内收蛋白的抗原肽及其抗体与应用 |
-
2000
- 2000-04-29 CN CN 00115545 patent/CN1321673A/zh active Pending
-
2001
- 2001-04-28 AU AU67288/01A patent/AU6728801A/en not_active Abandoned
- 2001-04-28 WO PCT/CN2001/000671 patent/WO2001083743A1/zh active Application Filing
Non-Patent Citations (4)
Title |
---|
DATABASE GENBANK [online] 26 September 1995 (1995-09-26), Database accession no. U35135 * |
DATABASE GENBANK [online] 26 September 1995 (1995-09-26), Database accession no. U35136 * |
DATABASE GENBANK [online] 27 October 1999 (1999-10-27), Database accession no. U46017 * |
DATABASE GENBANK [online] 27 October 1999 (1999-10-27), Database accession no. U46018 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006030936A1 (ja) | 2004-09-13 | 2006-03-23 | Takeda Pharmaceutical Company Limited | 酸化化合物の製造方法及び製造装置 |
EP2264025A1 (en) | 2004-09-13 | 2010-12-22 | Takeda Pharmaceutical Company Limited | Method to produce a crystalline form of compounds (II') |
Also Published As
Publication number | Publication date |
---|---|
CN1321673A (zh) | 2001-11-14 |
AU6728801A (en) | 2001-11-12 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001083743A1 (en) | A novel polypeptide, a human red blood cell adducin alpha subunit 11 and the polynucleotide encoding the polypeptide | |
WO2001055189A1 (fr) | NOUVEAU POLYPEPTIDE, SECp43, 32 S'ASSOCIANT AVEC L'ARNt DE LA SELENOCYSTEINE HUMAINE, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001096560A1 (fr) | Nouveau polypeptide, proteine humaine stat2, et polynucleotide codant ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001090348A1 (fr) | Nouveau polypeptide, chaine lourde de myoglobuline humaine 11, et polynucleotide codant ce polypeptide | |
WO2001072801A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide | |
WO2001083540A1 (fr) | Nouveau polypeptide, kiaa0883-44, et polynucleotide codant pour ce polypeptide | |
WO2001094401A1 (fr) | Nouveau polypeptide, proteine npat humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001094371A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide | |
WO2001090177A1 (fr) | Nouveau polypeptide, activateur humain de la mort naturelle des cellules b13.64, et polynucleotide codant ce polypeptide | |
WO2001049727A1 (fr) | Nouveau polypeptide, transducteur de signal 9 a effet chemotactique de bacteries, et polynucleotide codant pour ce polypeptide | |
WO2001092515A1 (fr) | Nouveau polypeptide, facteur humain de transcription 29.26, et polynucleotide codant ce polypeptide | |
WO2001083676A2 (en) | A novel polypeptide human strip-riched phosphatase 10 and the polynucleotide encoding said polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001090171A1 (fr) | Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide | |
WO2001090131A1 (fr) | Nouveau polypeptide, proteine humaine 10.56 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001090377A1 (fr) | Nouveau polypeptide, facteur humain 14 d'inhibition de la croissance tumorale von hippel-lindau, et polynucleotide codant ce polypeptide | |
WO2001073069A1 (fr) | Nouveau polypeptide, proteine humaine 12 associee aux tumeurs, et polynucleotide codant pour ce polypeptide | |
WO2001068872A1 (en) | Novel polypeptide---a human vacuolar h+ acyladenosine triphosphatase c subunit 22 and polynucleotide encoding it | |
WO2001092328A1 (fr) | Nouveau polypeptide, proteine humaine 10.78 du gene cancerigene tre, et polynucleotide codant ce polypeptide | |
WO2001094534A2 (fr) | Nouveau polypeptide, facteur humain de transcription 9.57, et polynucleotide codant ce polypeptide | |
WO2001072792A1 (fr) | Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide | |
WO2001083741A1 (fr) | Nouveau polypeptide, proteine myb humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001096525A2 (fr) | Nouveau polypeptide, unite de transposition pogo 18, et polynucleotide codant ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |