Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
  • A61K31/726—Glycosaminoglycans, i.e. mucopolysaccharides
  • A61K31/727—Heparin; Heparan
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis

Definitions

• This invention relates to a method for inhibiting apoptosis in ischemic- reperfused myocardium. More specifically this invention relates to a method for using heparin or noncoagulant heparin in the prevention of apoptosis.
• necrosis occurs through external injury producing cellular membrane destruction, swelling and lysis
• apoptosis is endogenously mediated cellular suicide effected by activation of a series of aspartate-specific proteases called caspases and endonucleases, resulting in proteolytic destruction of cellular proteins and chromosomal elements.
• Apoptotic events include DNA fragmentation, chromatin condensation, membrane blebbing, cell shrinkage, and disassembly into membrane-enclosed vesicles (apoptotic bodies).
• Apoptosis is controlled at two distinct levels.
• cells have unique sensors, termed death receptors, on their membrane surface.
• One of the more important receptors is the member of the tumor necrosis receptor family TNFR1 (also called p55).
• TNF plays an important role in hemorhagic shock.
• D.R. Meldrum, et al. "Hemorrhage activates myocardial NF/cB and increases TNF- ⁇ in the heart," J. Mol. Cell. Cardiol, 29:2849-2854, 1997.
• Apoptosis from TNF produced endogenously by overloaded myocardium also plays a significant role in mediating cardiac apoptosis leading to initiation and progression of congestive heart failure. See, for example, J.
• cytochrome c Upon entering the cytoplasm, cytochrome c binds to a cytosolic protein called apoptotic protease activating factor- 1 (Apaf-1).
• cytochrome c when it is transported to the cytoplasm appears to play an important and pivotal role in activating pro-apoptotic cascades, whether the initial induction of apoptosis is effected through membrane death receptor or mitochrondrial pathways.
• the present invention provides a method for inhibiting apoptosis in ischemic-reperfused myocardium by administering to a mammal an effective amount of heparin to reduce myocardial cell death in myocardial infarction. It has been found that at doses greatly exceeding those needed for anticoagulation heparin substantially reduces reperfusion injury both in the isolated perfused heart and intact whole animal models of myocardial infarction. This protective effect is independent of heparin's activity as an anticoagulant.
• heparin or nonanticoagulant heparin can be used to block apoptosis in situations of acute trauma, such as generalized trauma, global ischemia-reperfusion injury occurring as a consequence of hemorrhagic shock, or spinal cord injury, thereby preventing cell death in organs such as the spinal cord.
• acute trauma such as generalized trauma, global ischemia-reperfusion injury occurring as a consequence of hemorrhagic shock, or spinal cord injury, thereby preventing cell death in organs such as the spinal cord.
• Figure IB is another graph showing that heparin and O-desulfated nonanticoagulant heparin reduce infarct size (AN/ AAR) (or ratio of area of necrosis to area at risk);
• Figure 2 demonstrates that heparin and O-desulfated nonanticoagulant heparin reduce plasma creatine kinase activity after infarction;
• Figure 5 shows that O-desulfated nonanticoagulant heparin did not produce anticoagulation in vivo measured by ACT (activated clotting time);
• Figure 6 demonstrates that heparin and partially O-desulfated nonanticoagulant heparin block PMN adherence to normal coronary artery endothehum in vitro;
• Figure 7 illustrates that heparin and O-desulfated nonanticoagulant heparin reduce PMN adherence to post-experimental coronary artery endothehum;
• Figure 8 shows that heparin and O-desulfated nonanticoagulant heparin preserve the vasodilator function of ischemic-reperfused coronary arteries;
• Figure 9A demonstrates that NF-6B (brown stained) is normally present in the cytoplasm of unstimulated human umbilical vein endothelial cells (HUVECs) and that heparin and O-desulfated nonanticoagulant heparin prevent translocation of NF-6B from cytoplasm to the nucleus;
• HUVECs unstimulated human umbilical vein endothelial cells
• Figure 1 IB illustrates competition experiments performed by incubation of nuclear proteins with unlabeled NF -6B or cyclic- AMP responsive element oligonucleotides.
• heparin in larger than usual anticoagulant doses of heparin and a variety of nonanticoagulant heparins can attenuate ischemia-reperfusion injury in the heart and reduce myocardial infarct size as measured by the area of cellular necrosis and thus attenuate development of myocardial apoptosis.
• nonanticoagulant heparins N-desulfated; 2-O, 3-0 or 6-0 desulfated; N-desulfated and reacetylated; and O-decarboxylated heparin
• Examples of the preparation of O-desulfated nonanticoagulant heparin may be found in, for example, U.S. Patent No. 5,668,118 and U.S. Patent No.
• O-desulfated heparin can include O-desulfated heparin having modifications, such as reduced molecular weight or acetylation, deacetylation, oxidation, and decarboxylation.
• the heparin or nonant: coagulant heparin may be given in amounts of 3 mg/kg to 100 mg/kg, but preferably in amounts from about 3.5 mg/kg to about 10 mg/kg.
• ODS-HEP O- desulfated nonanticoagulant heparin
• ECAMs endothelial cell adhesion molecules
• ICM-1 intercellular adhesion molecule- 1
• E-selectin E-selectin and P-selectin
• NF- ⁇ B nuclear localization sequence a highly cationic domain of eight amino acids (VQRDRQKLM, single-letter amino acid code) that targets nuclear translocation.
• NLF nuclear localization sequence
• VQRDRQKLM single-letter amino acid code
• NF- ⁇ B is activated in the heart and cultured myocytes by ischemia or ischemia and reperfusion
• C. Li et al., "Early activation of transcription factor NF- ⁇ B during ischemia in perfused rat hearts," Am. J. Physiol, 276 (Heart Circ. Physiol. 45):H543-H552, 1999; and R. Kacimi, et al., "Expression and regulation of adhesion molecules in cardiac cells by cytokines, response to acute hypoxia," Circ. Res. 82:576-586, 1998, with subsequent upregulation of adhesion molecules on the myocyte surface. See, R.
• TNF levels in nonanticoagulant heparin treated ischemic-reperfused hearts were only 30% of those in untreated, ischemic reperfused hearts, reducing the potential stimulus for TNFRl mediated apoptosis (5.74 V 1.65 for ischemic-reperfused hearts vs 1.78 V 0.61 pg/g dry weight for nonanticoagulant heparin treated ischemic-reperfused hearts, p ⁇ 0.05).
• Reduction of exogenous TNF production by reduction of inflammatory cell influx into ischemic-reperfused myocardium were only 30% of those in untreated, ischemic reperfused hearts, reducing the potential stimulus for TNFRl mediated apoptosis (5.74 V 1.65 for ischemic-reperfused hearts vs 1.78 V 0.61 pg/g dry weight for nonanticoagulant heparin treated ischemic-reperfused hearts, p ⁇ 0.05).
• Mitochrondrial cytochrome c is a basic protein with a positive charge of +9.5 at neutral pH . See, L. C. Petersen, et al., "The effect of complex formation with polyanions on the redox properties of cytochrome c," Biochem. J., 192:687- 693, 1980; Bagelova, et al., "Studies on cytochrome c-heparin interactions by differential scanning calorimetry,” Biochem. J., 297:99-101. 1994. Within the cell, cytochrome c forms complexes with its natural electron chain redox partners such as cytochrome bcl complex and cytochrome c oxidase.
• cytochrome c Because of its positive charge, cytochrome c naturally binds to other polyanions such as heparin and dextran sulfate. See, L.C. Petersen, et al., supra. Binding of cytochrome c to heparin greatly decreases its reactivity in redox reactions.
• An example is the 200 fold reduction in reaction with ascorbate effected by addition of 40 ⁇ g/ml heparin to 10 ⁇ M cytochrome c and 0.4 M sodium ascorbate in 10 mM Tris buffer, pH 7.4 (see Table 2, Peterson, et al., cited above).
• cytochrome c The complex of heparin and cytochrome c occurs whether cytochrome c is in the reduced or oxidized state. See, M. Antalik, M., et al., "Spectrophotometric detection of the interaction between cytochrome c and heparin," Biochem.
• heparin and nonanticoagulant heparin inhibits activation of nuclear factor- ⁇ B in cultured human umbilical vein endothelial cells and in whole ischemic-reperfused rat hearts.
• nuclear factor- ⁇ B is a cytosolic protein. Therefore, at doses higher than used for anticoagulation, heparin or nonanticoagulant heparin both concentrates in myocardial endothelium and myocardium itself in levels sufficient to affect cytosolic events.
• Positively charged cytochrome c binds to Apaf-1 on a negatively charged region of the Apaf-1 molecule characterized by 12 WD (tryptophan-aspartic acid) amino acid repeats. See, H.
• ischemic preconditioning While possibly related to anti-apoptotic genes induced by NF- ⁇ B, ischemic preconditioning bears similarity to the tolerance against lethal endotoxemia confe ⁇ ed by prior exposure to sublethal doses of lipopolysaccharide. Tolerance to endotoxin induces several events which negatively regulate subsequent NF- ⁇ B activation. First, endotoxin related NF- ⁇ B activation induces transcriptional upregulation of I/cB- and pi 05, trapping NF- ⁇ B in the cytoplasmic compartment. See, C.
• nonanticoagulant heparin When given at the time of coronary reperfusion, nonanticoagulant heparin decreases myocardial infarct size, reduces neutrophilic influx into necrotic myocardium and preserves endothelial vasodilator function within the ischemic- reperfused coronary artery at risk without producing anticoagulation. Inhibition of NF-/cB activation and myocardial reperfusion injury is unlikely from the previously reported anti-complement activity of heparin, since the nonanticoagulant heparin we used has low inhibitory activity against complement.
• the resulting heparin derivative was a partially 2-0 and 3-0 desulfated heparin of approximately 10,500 daltons with an anticoagulant activity of 7.7 ⁇ 0.9 U/mg in the USP assay and 4.9 ⁇ 0.8 U/ml anti-Xa activity in the amidolytic assay, compared to 170 USP/mg anticoagulant activity and 150 U/mg anti-Xa activity for the unmodified porcine intestinal heparin from which it was manufactured. See, A. Fryer, supra.
• ODS-HEP reduced erythrocyte lysis only by 4 ⁇ 2% at 1.0 mg/ml.
• ODS-HEP was resuspended K-H buffer and administered as an intravenous bolus (3 mg/kg to dogs; 6 mg/kg to rats, with 100 ⁇ g/ml added to K-H perfusate for isolated hearts).
• the superior and inferior vena cava were looped with umbilical tapes and the heart suspended using a pericardial cradle.
• Millar catheter-tipped pressure transducers (Millar Instruments, Houston, Texas) were placed in the proximal aorta and in the left ventricular cavity to measure aortic and left ventricular pressure, respectively.
• a polyethylene catheter was inserted into the left atrium for colored microsphere injection.
• a one centimeter portion of the left anterior descending (LAD) coronary artery distal to the first diagonal branch was dissected and loosely encircled with a 2-0 silk suture.
• LAD left anterior descending
• a pair of opposing ultrasonic crystals were placed intramyocardially within the proposed ischemic area at risk within the left anterior descending coronary artery distribution, and were used to assess regional function within the area at risk. See, J.E. Jordan, et al., "Adenosine A receptor activation attenuates reperfusion injury by inhibiting neutrophil accumulation, superoxide generation and coronary adherence," J. Pharm. Exp. Therap., 280:301-309, 1997.
• the experiment was terminated with a bolus of intravenous sodium pentobarbital (100 mg/kg).
• the heart was immediately excised for further analysis and placed into ice-cold Krebs-Henseleit (K-H) buffer of the following composition: 118 mM NaCl, 4.7mM KC1, 1.2 mM KH 2 PO 4 , 1.2 mM MgSO 4 7H 2 0, 2.5 mM CaCl 2 2 H 2 O, 12.5 mM NaHCO 3 , and 1 1 mM glucose at pH 7.4.
• K-H Krebs-Henseleit
• PMN adherence to post-experimental coronary arteries was used as a bioassay of basal endothehal function.
• Canine PMNs were isolated from arterial blood and fluorescent labeled as previously described in Z.-Q. Zhao, et al., "Adenosine A 2 - receptor activation inhibits neutrophil-mediated injury to coronary endothehum," Am. J. Physiol., 27 H1456, 1996.
• ischemic-reperfused LAD and non-ischemic LCx segments were isolated, cut into 3 -mm segments, opened to expose the endothehum while being submerged in ice-cold K-H buffer, and then placed in dishes containing K-H buffer at 37°C.
• Agonist-stimulated macrovascular relaxation Agonist-stimulated vasoreactivity in epicardial macrovessels from ischemic (LAD) and nonischemic (Lex) was studied using the organ chamber technique. See, Z.-Q. Zhao, et al, supra. Indomethacin (10 ⁇ mol/L) was used to inhibit prostaglandin release. Coronary rings were precontracted with the thromboxane A mimetic U-46619 (5 nmol/L).
• Endothehal function was assessed by comparing the vasorelaxation responses to incremental concentrations of acetylcholine (1-686 ⁇ mol/L) and A23187 (1-191 ⁇ mol/L), whereas smooth muscle function was assessed with sodium nitroprusside (1-381 ⁇ mol/L).
• HUVEC human umiblical vein endothelial cells
• HUVECs were washed twice with PBS and incubated in Neuman/Tytell medium alone for 24 hours, followed by incubation with lipopolysaccharide (1 ⁇ g/ml) plus 10-20 ng/ml TNF ⁇ for 2 h, or in heparin or ODS-HEP (200 ⁇ g/ml) for 4 h with the addition of lipopolysaccharide and TNF ⁇ after 2 hours.
• Electrophoretic mobility shift assays were also used to study the translocation of NF- K B from the cytoplasm to the nucleus.
• Nuclear proteins were obtained from HUVEC as described by Digman, et al., "Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei," Nucleic Acid Res., 11 :1475-1481, 1983, with the addition of the following proteinase inhibitors: 1 mM phenylmethylsulfonyl fluoride, 1 ⁇ g/ml pepstatin A, 0.5 ⁇ g/ml chymostain, 1 ⁇ g/ml antipain, 1 ⁇ g/ml leupeptin and 4 ⁇ g/ml aprotinin.
• the double stranded oligonucleotide DNA probe of the NF- /cB consensus sequence AGTTGAGGGGACTTTCCCAGGC was 5OH end-labeled with [ ⁇ 32 P]ATP using polynucleotide kinase (Santa Cruz). Free radionucleotide was removed using a Sephadex G-25 column.
• Reactions were electrophoresed at 14 V/cm for 1.5-2.0 hours on a 6% nondenaturing polyacrylamide gel in 0.5 x TBE (45 mM Tris borate, 25 mM boric acid, 1 mM EDTA) at 4°C, and autoradiographed at -80° C.
• Nuclear proteins were immediately isolated from frozen myocardial powders of by the method of Li, et al., "Early activation of transcription factor NF- KB during ischemia in perfused rat heart," Am. J. Physiol., 276 (Heart Care Circ. Physiol. 45);H543-H552, 1999. EMS As were performed using 15 ⁇ g of nuclear protein in each binding reaction. Competition experiments were performed by incubation of nuclear proteins with lOx unlabeled NF- ⁇ B or cyclic-AMP responsive element oligonucleotides (CRE, AGAGATTGCCTGACGTCAGAGAGCTAG) for 5 minutes prior to addition of 32 P-labeled NF- B probe.
• CRE cyclic-AMP responsive element oligonucleotides
• heparin and O-desulfated anticoagulant heparin were found to significantly reduce myocardial infarct size.
• the area at risk (AAR) is expressed as a percentage of the left ventricle (LV).
• the infarct size (area of necrosis, AN) is expressed as a percentage of the area at risk (AAR).
• Columns represent group means ⁇ SEM. *p ⁇ 0.05 versus Control.
• HEP or ODS-HEP treatment decreased infarct size (area of necrosis, AN), expressed as a percentage of the area at risk (AN/ AAR), by 35% and 38%, respectively, compared to Controls.
• There was no statistical difference in size of infarcts between the HEP and ODS-HEP groups and the area at risk from LAD occlusion, expressed as a percentage of the left ventricular mass (AAR/LV), was comparable among groups.
• CK activity was used to confirm histologic measurement of infarct size during the time course of the experiment. Values are means ⁇ SEM. *p ⁇ 0.05 HEP and ODS-HEP versus Control and * p ⁇ 0.05 versus the previous time point in the same group. There were no significant differences in plasma CK activity at baseline among groups and no increases in CK activity after regional ischemia. Hearts in the Control group showed a steep rise in CK activity within the initial hour of reperfusion, which was significantly reduced by HEP or ODS-HEP treatment, consistent with the smaller infarct sizes in these groups.
• Baseline prior to left anterior descending (LAD) coronary artery occlusion;
• Ischemia at the end of 90 minutes of LAD ischemia;
• rl5min, rlhr, r2hr, r3hr, and r4hr minutes or hours of reperfusion following ischemia. Values are mean ⁇ standard error of the mean. * p ⁇ 0.05 versus previous time point within the same treatment group.
• heparin and O-desulfated heparin were found to reduce PMN accumulation in reperfused myocardium.
• PMN influx is a major mechanism underlying lethal reperfusion injury.
• Treatment with HEP or ODS-HEP significantly reduced MPO activity in necrotic myocardium by 50% compared to the Control group as shown in Figure 4.
• myeloperoxidase activity an index of PMN accumulation, is shown in normal, ischemic, and necrotic myocardial tissue samples from each group. *p ⁇ 0.05 HEP and ODS- HEP versus Control.
• HEP and ODS-HEP both decreased MPO activity in the nonnecrotic area at risk, but these changes did not achieve significance (p > 0.10).
• Example 6 Despite reducing infarct size, ODS-HEP did not produce anticoagulation.
• activated clotting time was increased greater than ten- fold after HEP treatment compared with Control (1425 ⁇ 38 seconds versus 123 ⁇ 10 seconds, respectively).
• ACT activated clotting time
• ODS-HEP was able to effect the same benefits as HEP without anticoagulation.
• Example 7 This example shows that heparin and O-desulfated heparin reduce neutrophil adherence and endothelial dysfunction in coronary arteries.
• ODS-HEP did not significantly reduce PAF-stimulated PMN degranulation (data not shown), suggesting that ODS-HEP has little direct effect on PMN activity.
• PAF- stimulated PMN attachment to coronary endothehum was significantly reduced by both HEP and ODS-HEP in a dose-dependent manner ( Figure 6).
• Neutrophil adherence to normal coronary endothehum was stimulated by 100 nM platelet activating factor (PAF) added to medium and was inhibited in a dose-dependent manner by heparin or ODS-HEP.
• PAF platelet activating factor
• HEP and ODS-HEP also reduced PMN adherence to ischemic-reperfused coronary endothehum in vivo.
• the bar graph in Figure 7 shows that PMN adherence to the ischemic-reperfused LAD coronary artery was increased by 300%> in the untreated Control group compared to the non-ischemic-reperfused LCx artery.
• Neutrophil (PMN) adherence to coronary endothehum was quantitated as the number of adherent PMNs/mm of coronary endothehum.
• LCx the non- ischemic-reperfused left circumflex coronary artery
• LAD the ischemic- reperfused left anterior descending coronary artery. *p ⁇ 0.05 HEP and ODS-HEP versus LAD control.
• HEP or ODS-HEP reduced PMN adherence to the ischemic- reperfused LAD by 51 and 42%, respectively, compared to untreated Controls ( Figure 7).
• HEP and ODS-HEP also preserved receptor-mediated vasodilator responses of coronary endothehum following ischemia and reperfusion.
• acetylcholine endothelial-dependent; receptor-dependent
• A23187 endothelial-dependent; receptor-independent
• sodium nitroprusside direct smooth muscle
• HUVECs were stimulated with 10 ng/ml TNF ⁇ for one hour and nuclear protein was harvested for electrophoretic mobility shift assays to detect binding of NF-6B, using the oligonucleotide consensus AGTTGAGGGGACTTTCCCAGGC, end-labeled with [ ⁇ 32 P]ATP.
• Treatment of monolayers with TNF stimulates DNA binding of NF - 6B (lane 2) compared to untreated controls (lane 1).
• Pretreatment of cells with 200 ⁇ g/ml ODS-HEP virtually eliminates NF-6B binding activity in nuclear protein extracts (lane 3), confirming that heparin prevents translocation of NF-6B from the cytoplasm to the nucleus.
• O-desulfated nonanticoagulant heparin also reduced DNA binding of NF- KB in ischemic-reperfused myocardium. Exposure of rat hearts to 15 minutes warm global ischemia and 15 minutes reperfusion increased DNA binding of myocardial nuclear protein to oligonucleotide sequences for NF- ⁇ B ( Figure 11 A, lane 2).
• HEP or ODS-HEP also interrupt NF- ⁇ B activation and possibly adhesion molecule expression.
• Langendorf perfused rat hearts were subjected to 15 minutes warm global ischemia followed by 15 minutes reperfusion. Nuclear protein was then harvested for EMS As to measure DNA binding of NF-6B.
• ischemia and reperfusion typically increased DNA binding of myocardial nuclear protein to oligonucleotide sequences for NF-6B (lanes 2 and 4). Three distinct complexes were identified.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Public Health (AREA)
• Engineering & Computer Science (AREA)
• Pharmacology & Pharmacy (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Organic Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Cardiology (AREA)
• Heart & Thoracic Surgery (AREA)
• Dermatology (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Urology & Nephrology (AREA)
• Hospice & Palliative Care (AREA)
• Vascular Medicine (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Polysaccharides And Polysaccharide Derivatives (AREA)
• Investigating Or Analysing Biological Materials (AREA)

Priority Applications (5)

Applications Claiming Priority (2)

Publications (3)

Family

ID=24242898

Family Applications (1)

Country Status (6)

Cited By (6)

Families Citing this family (18)

Family Cites Families (7)

• 2000
  • 2000-05-02 US US09/561,663 patent/US6489311B1/en not_active Expired - Lifetime
• 2001
  • 2001-04-30 EP EP01933380A patent/EP1289508A2/en not_active Ceased
  • 2001-04-30 AU AU2001259811A patent/AU2001259811B2/en not_active Ceased
  • 2001-04-30 AU AU5981101A patent/AU5981101A/xx active Pending
  • 2001-04-30 JP JP2001579793A patent/JP2003531854A/ja active Pending
  • 2001-04-30 CA CA2407806A patent/CA2407806C/en not_active Expired - Fee Related
  • 2001-04-30 WO PCT/US2001/040639 patent/WO2001082918A2/en not_active Ceased

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events