WO2001075131A2 - Compositions et procedes permettant de reguler le metabolisme de vegetaux - Google Patents

Compositions et procedes permettant de reguler le metabolisme de vegetaux Download PDF

Info

Publication number
WO2001075131A2
WO2001075131A2 PCT/US2001/010236 US0110236W WO0175131A2 WO 2001075131 A2 WO2001075131 A2 WO 2001075131A2 US 0110236 W US0110236 W US 0110236W WO 0175131 A2 WO0175131 A2 WO 0175131A2
Authority
WO
WIPO (PCT)
Prior art keywords
ucp
plant
expression
cell wall
chloroplast
Prior art date
Application number
PCT/US2001/010236
Other languages
English (en)
Other versions
WO2001075131A3 (fr
WO2001075131A9 (fr
Inventor
Sandra Lee Berry-Lowe
Martha Karen Newell
Original Assignee
University Technology Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Technology Corporation filed Critical University Technology Corporation
Priority to AU2001251132A priority Critical patent/AU2001251132A1/en
Publication of WO2001075131A2 publication Critical patent/WO2001075131A2/fr
Publication of WO2001075131A3 publication Critical patent/WO2001075131A3/fr
Publication of WO2001075131A9 publication Critical patent/WO2001075131A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C12N1/125—Unicellular algae isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/89—Algae ; Processes using algae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to compositions and methods for regulating metabolism in plants by controlling photosynthetic fuel metabolism.
  • the present invention also relates to compositions and methods for protecting plants from free radical damage.
  • regulating plant fuel metabolism and protecting plants from free radical damage are achieved by compositions and methods for expressing and regulating plant cell wall uncoupling proteins.
  • the invention in some aspects relates to a plant expressing a cell wall UCP encoded by a heterologous UCP gene.
  • the heterologous UCP gene comprises a gene encoding UCP2.
  • the heterologous UCP gene is a gene encoding UCP1, UCP3, UCP4, UCP5, or UCP6.
  • the heterologous UCP gene comprises a gene encoding PUMP, StUCP, or AtPUMP.
  • a method for regulating fuel metabolism in a plant involves regulating UCP expression in an alternative membrane, such as a plant cell wall/ plasma membrane or chloroplast to regulate fuel metabolism of the plant.
  • the method involves increasing the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast.
  • the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast may be increased by introducing into the plant cell an expression vector including a gene encoding a heterologous UCP.
  • the expression of activity of UCP in the plant cell wall/ plasma membrane or chloroplast is increased by stably transforming the plant cell with an expression vector including a gene encoding a heterologous UCP.
  • the heterologous UCP gene is a gene encoding UCP1, UCP2, UCP3, UCP4, UCP5, UCP6 PUMP, StUCP, or AtPUMP.
  • UCP activator is a compound selected from the group consisting of sugars including but not limited to glucose, sucrose, maltose, and dextrose, structural analogs of sugars including but not limited to glucose, glucose, sucrose, maltose, and dextrose, inhibitors of nucleotides and nucleotide analogs, omega 3 fatty acids, omega 6 fatty acids, and norflurazon.
  • the expression of UCP in the cell wall/plasma membrane is increased by contacting the plant with a cell wall targeted UCP molecule, which optionally is a UCP molecule linked to a targeting molecule such as glucose transporters, sucrose transporters, maltose transporters, and fatty acid transporters.
  • a cell wall targeted UCP molecule which optionally is a UCP molecule linked to a targeting molecule such as glucose transporters, sucrose transporters, maltose transporters, and fatty acid transporters.
  • the expression of UCP in the chloroplast is increased by contacting the plant with a chloroplast targeted UCP molecule, which optionally is a UCP molecule linked to a targeting molecule selected from the group consisting of a chloroplast transit protein and a peptide of N terminus small subunit of ribulose 5- phosphate carboxylase.
  • the expression of UCP in the cell wall/plasma membrane is increased by contacting the plant with a plasma membrane targeted UCP molecule, which optionally is a UCP molecule linked to a targeting molecule which is plant specific membrane targeting sequence lacking a VSS or KDEL sequence.
  • the expression of UCP in the cell wall/plasma membrane is increased by contacting the plant with a plasma desmata targeted UCP molecule in some embodiments.
  • the plasma desmata targeted UCP molecule may be a UCP molecule linked to a plasma desmata targeting molecule selected from the group consisting of porin-like targeting sequences.
  • the expression of UCP in the cell wall/plasma membrane is increased by contacting the plant with a pore targeted UCP molecule, which may be a UCP molecule linked to a targeting molecule selected from the group consisting of a porin peptide, a VSS tail and a KDEL tail.
  • the method involves decreasing the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast.
  • UCP inhibitor which optionally is a compound including but not limited to UCP binding peptides such as anti-UCP antibodies, UCP anti-sense nucleic acids, UCP dominant-negative nucleic acids, nucleotides, nucleotide analogs, tocopherols, including but not limited to tocotrienols, and non-omega-3, -6 fatty acids.
  • the system includes a promoter sequence, a first structural gene encoding a heterologous UCP and a second structural gene encoding a plant cell wall targeting peptide or a chloroplast targeting peptide, the first and second structural genes arranged to form a fusion protein and operably linked to and under the control of the promoter sequence.
  • the promoter sequence is a plant specific promoter.
  • the UCP encoded by the first structural gene is a mammalian UCP or a plant UCP.
  • the invention also includes plants stably transformed with the expression system as well as seeds of the plant.
  • a progeny, clone, cell line or cell of the plant is included in the invention.
  • a transgenic plant transformed with a nucleic acid construct including a nucleic acid sequence encoding a UCP operably linked to a promoter sequence is also provided.
  • the nucleic acid contract also encodes a plant cell wall targeting peptide or a chloroplast targeting peptide.
  • the invention also includes seeds of the transgenic plant as well as a progeny, clone, cell line or cell of the transgenic plant.
  • the invention also includes a method for producing a nutritionally enhanced plant.
  • the method involves decreasing the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast to produce a nutritionally enhanced plant.
  • a method for preventing an infection in a plant by decreasing the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast in an amount to prevent an increase in oxygen free radicals and to prevent infection in the plant is also provided.
  • a plant produced by these methods is also provided.
  • the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast is decreased by contacting the plant with a UCP inhibitor.
  • the UCP inhibitor may be a chloroplast or cell wall UCP antisense sequence.
  • the invention relates to a method for improving the light and cold sensitivity of a plant.
  • the method involves increasing the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast to improve the light and cold sensitivity of the plant.
  • the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast is increased by introducing into the plant cell an expression vector including a gene encoding a heterologous UCP.
  • the expression of activity of UCP in the plant cell wall/ plasma membrane or chloroplast is increased by stably transforming the plant cell with an expression vector including a gene encoding a heterologous UCP.
  • the heterologous UCP gene may be a gene encoding UCP1, UCP2, UCP3, UCP4, PUMP, StUCP, or AtPUMP.
  • the expression or activity of UCP in the plant cell wall/ plasma membrane or chloroplast is increased by contacting the plant with a UCP activator. In yet other embodiments the expression of UCP in the plant cell wall/ plasma membrane or chloroplast is increased by contacting the plant with a UCP molecule.
  • FIG 1 Panel B, shows that cell wall-less (cwl5+) strains of Chlamydomonas reinhardtii do not express cell wall surface molecules recognized by antibodies to UCP2.
  • Figure 2 Panel A, shows that light sensitive cell-walled (Its) strains of Chlamydomonas reinhardtii express high levels of UCP.
  • FIG 2 Panel B, shows that dark sensitive (CC2654; dark-dier) strains of Chlamydomonas reinhardtii do not express cell-wall UCP over control samples.
  • Figure 3 shows that norflurazon upregulates cell wall expression of UCP in wild type strains of C. reinhardtii.
  • Figure 4 is a slot blot of total RNA from C. reinhardtii probed for UCP expression.
  • SEQ ID NO:l is the nucleotide sequence of the human uncoupling (UCP-1) cDNA with GenBank Ace. no.U28480.
  • SEQ ID NO:2 is the predicted amino acid sequence of the translation product of human uncoupling cDNA (UCP-1).
  • SEQ ID NO:3 is the nucleotide sequence of the human uncoupling (UCP-2) cDNA with GenBank Ace. n ⁇ .U82819.
  • SEQ ID NO:4 is the predicted amino acid sequence of the translation product of human uncoupling cDNA (UCP-2).
  • SEQ ID NO: 5 is the nucleotide sequence of the human uncoupling (UCP-3S) cDNA with GenBank Ace. no.U82818.
  • SEQ ID NO: 6 is the predicted amino acid sequence of the translation product of human uncoupling cDNA (UCP-3S).
  • SEQ ID NO: 7 is the nucleotide sequence of the solanum tubersum UCP cDNA with GenBank Ace. no. AJ002586.
  • SEQ ID NO: 8 is the nucleotide sequence of the arabidopsis thaliana UCP cDNA with GenBank Ace. no. AJ223983.
  • SEQ ID NO:9 is the nucleotide sequence of the arabidopsis thaliana UCP cDNA with GenBank Ace. no. AB021706.
  • SEQ ID NO: 10 is the nucleotide sequence of the human UCP4 cDNA with GenBank Ace. no. NM_004277.
  • SEQ ID NO: 11 is the nucleotide sequence of the wheat UCP cDNA with
  • GenBank Acc. no. AB042428 is the nucleotide sequence of the human UCP5 cDNA with GenBank Acc. no. NM_022810.
  • SEQ ID NO: 13 is a primer.
  • SEQ ID NO: 14 is a primer.
  • SEQ ID NO: 15 is a primer.
  • SEQ ID NO: 16 is a primer.
  • the invention relates in some aspects to the finding that UCP is present in plant cellular membranes other than the mitochondrial membrane. For instance, UCP is expressed on the cell wall, plasma membrane and chloroplasts of light and cold sensitive cells but not of light and cold resistant cells. This discovery has important implications for the regulation of plant metabolism.
  • the present invention relates in some aspects to compositions and methods for regulating fuel metabolism in plants by controlling photosynthesis through regulation of plant fuel metabolism.
  • the present invention also relates to compositions and methods for protecting plants from the free radical damage and thus in the control of infectious disease.
  • regulation of plant fuel metabolism and protecting plants from free radical damage is achieved by compositions and methods for expressing and regulation of plant cell wall uncoupling proteins. Free energy consumed by biological systems originates as solar energy.
  • Photosynthetic organisms have evolved the processes of photosynthesis to take advantage of the solar radiation reaching the earth. Essentially, photosynthesis is a light- induced redox process in which carbon dioxide is reduced to a metabolizable storage compound by an external reductant (i.e., light is used to create reducing potential). Photosynthetic organisms are primarily classified by the nature of the reductant used during photosynthetic processes. Oxygenic photosynthetic organisms, for instance, are distinguished from prokaryotic photosynthetic organisms primarily by their ability to use water as a reductant. Plants, algae, cyanobacteria, and prochlorophytes are all oxygenic photosynthetic organisms. Green plants photosynthesis takes place in chloroplasts.
  • the systems that convert solar energy in green plants to useful metabolic energy are integrated into the thylakoid membrane system of green plant chloroplasts.
  • the thylakoid membranes contain the energy-transducing machinery: the light- harvesting-proteins, reaction centers, electron transport chains, and ATP synthase.
  • Photosynthesis in green plants begins by the absorption of light by a chlorophyll porphyrin (i.e., with a coordinated magnesium ion).
  • the resulting electronic excitation passes along a series of chlorophyll molecules until the excitation is trapped in a reaction center.
  • the energy of light i.e., electron excitation
  • a separation of charge i.e., reducing potential
  • Green plants use two light reactions: photosystem I and photosystem II.
  • Photosystem I generates reducing potential in the form of NADPH.
  • Photosystem II transfers the electrons of water to a quinone and concomitantly evolves diatomic oxygen.
  • the flow of electrons in, and between, both photosystem generates a proton gradient across the thylakoid membrane that drives the synthesis of ATP.
  • the ATP and NADPH that results from photophosphorylation processes in green plants are used to reduce carbon dioxide and convert it into 3-phosphoglycerate.
  • the electron-motive force generated in green plant chloroplast photosystems drives electron transfer in a opposite direction from that in mitochondria.
  • electrons are taken from water to produce diatomic oxygen, and concomitantly used to reduce carbon dioxide to synthesize carbohydrates.
  • Chloroplasts therefore, generate diatomic oxygen and carbohydrate, while mitochondria consume oxygen and carbohydrate.
  • UCPs uncoupling proteins
  • These proteins are named for the ability to dissipate the above described proton gradient generated by the respective electron transport chains in mammalian mitochondria and green plan chloroplasts.
  • these proteins are said to uncouple the flow of protons across a membrane through ATP synthetase and prevent the concomitant production of ATP.
  • Dissipation of the proton gradient in this manner produces heat in a process called thermogenesis.
  • UCP-like proteins occur in each of the four eukaryotic kingdoms: animals, plants, fungi, and protists (See e.g., Jarmuszkiewicz et al., FEBS Lett., 467:145 [2000].) UCPs are encoded by small multi-gene families in both mammals and plants. In mammals, UCP1 is exclusively expressed in brown adipocyte tissue, while UCP2 is expressed in most tissues of humans and rodents (See e.g., Boss et al., Eur. J. of
  • UCP3 is expressed in both skeletal muscle and in human brown adipoctye tissue (See e.g., Vidal-Puig et al., Biochem. Biophys. Res. Com 235:79 [1997]); and UCP4 is expressed in brain tissues. In mammals, UCP causes a change from glucose to fatty acid oxidation in mitochondria, and consequent thermogenesis in brown adipocyte tissue.
  • Plant UCP was first identified in potato tuber and has been isolated in Arabidopsis. These potato UCP are located in the mitochondria and have been implicated in chill resistance in plants (See e.g., France et al., FEBS Lett., 457:103 [1999].
  • UCP is expressed on other cellular membranes including the plant cell wall, plasma membrane, and the chloroplasts. It was further discovered that the expression and activity of UCP in each of these distinct locations has an important impact on the regulation of cellular metabolism and free radical accumulation.
  • C. reinhardtii Chlamydomonas reinhardtii
  • C. reinhardtii Chlamydomonas reinhardtii
  • Photosynthesis when light is available, and acetate when light is not, are involved in energy production and consumption in C. reinhardtii.
  • the invention includes in some aspects methods for increasing or decreasing the membrane potential in a plant cell.
  • the ability to manipulate the membrane potential, e.g., of the plant cell wall provides the ability to control the fate of the cell.
  • the cell wall/plasma membrane potential is increased by increasing or decreasing expression of UCP in the cell wall/plasma membrane
  • the cell is able to alter it's ability to process energy and to grow more efficiently than it would otherwise, e.g. when UCP is not increased.
  • the cell is also able to differentiate more efficiently when UCP is increased in mitochondria. This is useful under conditions when light is scarce and the temperatures are cold. This shift allows the cell to use alternative non-photosynthetic fuel sources when light is scarce.
  • the invention involves the use of this discovery to alter a plant's metabolism.
  • UCP activity in these alternative membranes can be increased. It is desirable to increase UCP expression, for instance, when it is desirable to increase crop yields (even when solar energy is scarce or in cold temperatures) or to protect plants against cold-induced injury (in cold environments or during times of frost).
  • the invention encompasses mechanisms for controlling these complex interactions to regulate the processes of plant metabolism and resistance to infection.
  • the methods of the invention have broad utility in regulating plant cell metabolism. Because plant cells utilize the membrane potential and alternative membrane UCP in regulating their own metabolism, any type of plant cell can be manipulated according to the methods of the invention.
  • the invention is a method for regulating fuel metabolism in a plant.
  • the method is accomplished by regulating UCP expression in a plant cell wall/ plasma membrane or chloroplast to regulate fuel metabolism of the plant.
  • plant is used in its broadest sense.
  • the term plant includes, but is not limited to, any species of woody, ornamental or decorative, crop or cereal, fruit or vegetable plant, and algae (e.g., Chlamydomonas reinhardtii).
  • algae e.g., Chlamydomonas reinhardtii
  • cereal crop is used in its broadest sense.
  • the term includes, but is not limited to, any species of grass, or grain plant (e.g., barley, corn, oats, rice, wild rice, rye, wheat, millet, sorghum, triticale, etc.), non-grass plants (e.g., buckwheat flax, legumes [soybeans] etc.), or other common plant derived carbohydrate source, etc.
  • crop or "crop plant” is used in its broadest sense.
  • the term includes, but is not limited to, any species of plant or algae edible by humans or used as a feed for animals or used, or consumed by humans, or any plant or algae used in industry or commerce.
  • the term “dark-dier” refers to a class of mutant organisms strains that are obligate phototrophs, including but not limited to, mutant strains of Chamydomonas reinhardtii.
  • alternative membranes refers to membranes other than mitochondrial membranes including the membranes of other plant cell compartments and organelles and the cell wall/plasma membrane.
  • plant cell components or organelles
  • plant cell is used in its broadest sense. The term includes but is not limited to, the endoplasmic reticulum, Golgi apparatus, trans Golgi network, plastids, sarcoplasmic reticulum, gloxysomes, chloroplast, and nuclear membranes, and the like.
  • the alternative membrane in which the UCP is manipulated is a cell wall/ plasma membrane or a chloroplast.
  • a "cell wall/ plasma membrane” as used herein refers to the cell wall or plasma membrane of the plant cell or structures located therein such as the plasma desmata or pores.
  • the present invention while not intended to be limited by the selection of a particular uncoupling protein sequences, provides a variety of UCP gene or mRNA sequences, including, but not limited to, 1) plant UCPs: Genbank accession AJ002586 (Solanum tuberosum “potato,” SEQ ID NO:7), AJ223983 (Arabidopsis thaliana, SEQ ID NO:8), AB021706 (Arabidopsis thaliana, SEQ ID NO:9), AB024733 (Symplocarpus renifoliu “skunk cabbage”); 2) human UCPs: U28480 (UCP), AF096289 (UCP2), AF019409 (UCP2), U7637 (UCP2), AF011449 (UCP3), AF001787 (UCP3), U08
  • NM012682 (UCP), X03894 (UCP), X12925 (UCP), Ml 1814 (UCP), AF039033 (UCP2), AB010743 (UCP2), AB005143 (UCP2), AB006613 (UCP2), AF030163 (UCP3), AB008216 (UCP3), AF035943 (UCP3), AB006614 (UCP3), U92069 (UCP3); 5) pig UCPs: AF111998 (UCP2), 111999 (UCP2), AF036757 (UCP2), A128837 (UCP3), AF095744 (UCP3); 6) cow UCPs: AF092048 (UCP3); 7) dog UCPs: AB020887 (UCP2), AB022020 (UCP3); and 8) rabbit UCP X14696.
  • UCP activity may be modified with the use of UCP activators or UCP inhibitors.
  • UCP activity refers to an induction of expression of new or exogenous UCP, modulation of the activity of existing UCP, or the translocation of existing sources of UCP to different membranes.
  • UCP activators are any compounds which increase the activity of UCP in an alternative membrane.
  • UCP activators include but are not limited to UCP polypeptides and nucleic acids encoding the polypeptides which are delivered to the plant cell, glucose, sucrose, maltose, and dextrose, structural analogs of sugars including but not limited to glucose, glucose, sucrose, maltose, and dextrose, inhibitors of nucleotides and nucleotide analogs, omega 3 fatty acids, omega 6 fatty acids, and norflurazon. Each of these compounds is well known in the art. Omega-3 fatty acids include but are not limited to oleic acid, palmitic acid and myrisitate.
  • the UCP activators may be modified to include a cell wall/ plasma membrane targeting sequence or to become membrane impermeable. This is particularly desirable when the activators are being delivered to the plant cell wall.
  • Additional targeting sequences optionally may be added to the activators. These include for instance targeting sequences for targeting proteins to different membranes within the plant cell and include but are not limited to targeting sequences for chloroplast, plasma desmata, and pores. These types of targeting sequences are well known in the art and are described in textbooks and other references on plant physiology and biochemistry. See e.g., Buchanan, Biochemistry and Molecular Biology of Plants, American Society of Plant Physiologists, Rockville, Maryland, 2000.
  • Cell wall/ plasma membrane targeting sequences include hydrophobic moieties and membrane attachment domains. Hydrophobic moieties are well known in the art.
  • a "membrane attachment domain,” as used herein, refers to a domain that spans the width of a cell wall/ plasma membrane, or any part thereof, and that functions to attach a UCP activator or inhibitor to a cell membrane.
  • Membrane attachment domains useful in the invention are those domains that function to attach a UCP inhibitor or activator to a cell wall/ plasma membrane of an plant cell.
  • an appropriate membrane attachment domain is selected based on the type of cell in which the membrane-bound fusion protein is to be expressed.
  • UCP nucleic acids can be delivered to a cell such that the UCP peptide will be expressed in the cell wall/ plasma membrane of the cell.
  • the UCP expression vectors and other relevant expression vectors described herein can be prepared and inserted into cells using routine procedures known in the art. These procedures are set forth below in more detail.
  • UCP nucleic acid refers to a nucleic acid molecule which:
  • UCP nucleic acids have the nucleic acid sequence of SEQ ID NO:l, 3, 5, and 7-12 (the nucleic acids encoding several examplary UCP polypeptides).
  • the UCP nucleic acids may be intact UCP nucleic acids which include the nucleic acid sequence of Sequence ID No.: 1, 3, 5, and 7-12 as well as homologs and alleles of a nucleic acid having the sequence of SEQ ID NO: 1, 3, 5, and 7-12.
  • Intact UCP nucleic acids further embrace nucleic acid molecules which differ from the sequence of SEQ ID NO: 1, 3, 5, and 7-12 in codon sequence due to the degeneracy of the genetic code.
  • the UCP nucleic acids of the invention may also be functionally equivalent variants, analogs and fragments of the foregoing nucleic acids.
  • “Functionally equivalent”, in reference to a UCP nucleic acid variant, analog or fragment, refers to a nucleic acid that codes for a UCP polypeptide that is capable of functioning as an UCP.
  • the invention further embraces complements of the foregoing nucleic acids or of unique fragments of the foregoing nucleic acids. Such complements can be used, for example, as antisense nucleic acids for inhibiting the expression of UCP in a cell for accomplishing the effects of the inhibitors described below.
  • UCP nucleic acid molecules can be identified by conventional techniques, e.g., by identifying nucleic acid sequences which code for UCP polypeptides and which hybridize to a nucleic acid molecule having the sequence of SEQ ID NO: 1, 3, 5, and 7- 12 or other publicly available UCP nucleic acid sequences under stringent conditions.
  • stringent conditions refers to parameters with which the art is familiar. More specifically, stringent conditions, as used herein, refer to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinyl pyrolidone, 0.02% bovine serum albumin, 2.5mM NaH 2 PO 4 (pH 7), 0.5% SDS, 2mM EDTA).
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH 7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetraacetic acid.
  • SSC 0.15M sodium chloride/0.15M sodium citrate, pH 7; SDS is sodium dodecyl sulphate; and EDTA is ethylenediaminetetraacetic acid.
  • Southern blot refers to the analysis of DNA on agarose or acrylamide gels in which DNA is separated or fragmented according to size followed by transfer of the DNA from the gel to a solid support, such as nitrocellulose or a nylon membrane.
  • the immobilized DNA is then exposed to a labeled probe to detect DNA species complementary to the probe used.
  • the DNA may be cleaved with restriction enzymes prior to electrophoresis. Following electrophoresis, the DNA may be partially depurinated and denatured prior to or during transfer to the solid support.
  • Southern blots are a standard tool of molecular biologists (J. Sambrook et al. [1989] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, pp 9.31-9.58).
  • Northern Blot refers to the analysis of RNA by electrophoresis of RNA on agarose gels to fractionate the RNA according to size followed by transfer of the RNA from the gel to a solid support, such as nitrocellulose or a nylon membrane. The immobilized RNA is then probed with a labeled probe to detect RNA species complementary to the probe used.
  • Northern blots are a standard tool of molecular biologists (J. Sambrook, J. et al. [1989] supra, pp. 7.39-7.52].
  • homologs and alleles typically will share at least 40% nucleotide identity with SEQ ID NO: 1, 3, 5, and 7-12; in some instances, will share at least 50% nucleotide identity; and in still other instances, will share at least 60% nucleotide identity.
  • the preferred homologs have at least 70% sequence homology to SEQ ID NO: 1, 3, 5, and 7-12. More preferably the preferred homologs have at least 80% and, most preferably, at least 90% sequence homology to SEQ ID NO: 1, 3, 5, and 7-12.
  • the invention also includes degenerate nucleic acids which include alternative codons to those present in the naturally occurring nucleic acid that codes for the UCP polypeptide.
  • serine residues are encoded by the codons TCA, AGT, TCC, TCG, TCT and AGC.
  • Each of the six codons is equivalent for the purposes of encoding a serine residue.
  • any of the serine-encoding nucleotide codons may be employed to direct the protein synthesis apparatus, in vitro or in vivo, to incorporate a serine residue.
  • nucleotide sequence triplets which encode other amino acid residues include, but are not limited to, CCA, CCC, CCG and CCT (proline codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and ACT (threonine codons); AAC and NAT (asparagine codons); and ATA, ATC and ATT (isoleucine codons).
  • Other amino acid residues may be encoded similarly by multiple nucleotide sequences.
  • the invention embraces degenerate nucleic acids that differ from the naturally occurring nucleic acids in codon sequence due to the degeneracy of the genetic code.
  • the UCP nucleic acid in one embodiment, is operably linked to a gene expression sequence which directs the expression of the UCP nucleic acid within a plant cell.
  • the "gene expression sequence” is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the UCP nucleic acid to which it is operably linked.
  • the gene expression sequence may, for example, be a eukaryotic e.g. plant or viral promoter, such as a constitutive or inducible promoter. Promoters and enhancers consist of short arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (Maniatis, T. et al, Science 236:1237 [1987]).
  • Promoter and enhancer elements have been isolated from a variety of eukaryotic sources including genes in plant, yeast, insect and mammalian cells and viruses (analogous control elements, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on what cell type is to be used to express the protein of interest. A wide variety of promoters have been isolated from plants, which are functional not only in the cellular source of the promoter, but also in numerous other plant species. There are also other promoters (e.g., viral and Ti-plasmid) which can be used.
  • promoters e.g., viral and Ti-plasmid
  • these promoters include promoters from the Ti-plasmid, such as the octopine synthase promoter, the nopaline synthase promoter, the mannopine synthase promoter, promoters from other open reading frames in the T-DNA, such as ORF7, etc.
  • Promoters isolated from plant viruses include the 35S promoter from cauliflower mosaic virus (CaMV). Promoters that have been isolated and reported for use in plants include ribulose-1,3- biphosphate carboxylase small subunit promoter, phaseolin promoter, etc.
  • Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
  • Other constitutive promoters are known to those of ordinary skill in the art.
  • the promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent.
  • the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions.
  • Other inducible promoters are known to those of ordinary skill in the art.
  • the gene expression sequence shall include, as necessary, 5' non- transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like.
  • 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined UCP nucleic acid.
  • the gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
  • the UCP nucleic acid of the invention is linked to a gene expression sequence which permits expression of the UCP nucleic acid in an alternative membrane such as the cell wall/ plasma membrane or chloroplast of a cell.
  • a sequence which permits expression of the UCP nucleic acid in a plant cell is one which is selectively active in the particular plant cell and thereby causes the expression of the UCP nucleic acid in these cells.
  • the UCP nucleic acid sequence and the gene expression sequence are said to be "operably linked” when they are covalently linked in such a way as to place the transcription and/or translation of the UCP coding sequence under the influence or control of the gene expression sequence.
  • two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the UCP sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the UCP sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein.
  • a gene expression sequence would be operably linked to a UCP nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that UCP nucleic acid sequence such that the resulting transcript might be translated into the desired protein or polypeptide.
  • UCP is a naturally occurring cell wall/ plasma membrane protein having several transmembrane spanning regions including many hydrophobic residues. Proteins of this type can spontaneously insert into a biological membrane in an aqueous environment. See, e.g., US Patent No.
  • UCP can be inserted in to a biological membrane consistent with the methods described in US Patent No. 5,739,273 for inserting bacteriorhodopsin C into a membrane, including in lipid vesicles and by modification of various residues to increase the hydrophobicity of the molecule, without altering the function. Additionally UCP can be conjugated to a molecule which will insert in the membrane, causing the UCP to also insert in the membrane.
  • cell membranes are composed mainly of phospholipids and proteins, both containing hydrophobic and hydrophilic groups.
  • the lipids orient themselves into an orderly bilayer configuration within the membrane core with the hydrophobic chains facing toward the center of the membrane while the hydrophilic portions are oriented toward the outer and inner membrane surfaces.
  • the proteins are dispersed throughout the lipid layer, in some instances protruding through the surface of the membrane or extending from one side of the membrane to the other with some of the hydrophobic residues being buried in the interior of the lipid bilayer.
  • 5,739,273 teaches that a synthetic polypeptide maintaining the characteristics of a native polypeptide by including a hydrophobic alpha-helical transmembrane region containing one or more acidic or basic amino acids can be generated.
  • the amino acids are aspartic acid, glutamic acid, lysine, arginine or histidine. This is based on the teachings of Popot and Engelman, Biochem.
  • the UCP insertion into the membrane can be enhanced using lipid vesicles.
  • Lipid vesicles such as micelles can be formed by the addition of phospholipids to achieve a specific ratio of protein to phospholipid.
  • the orientation of the chimeric protein components of the micelles can be controlled also, so that the micelles have an outer surface which is predominantly composed of the phospholipid moieties or predominantly composed of the protein moieties.
  • the size of the micelles may also be controlled by varying the detergent employed, the nature of the added phospholipid, or the phospholipid/protein ratio.
  • UCP proteins include the intact native UCP in an isolated form as well as functionally active fragments and variants thereof.
  • a UCP activator induces the uncoupling function of a UCP molecule that is already expressed in the an alternative membrane such as the cell wall/ plasma membrane or chloroplast or causes a functional UCP to be expressed or inserted into the alternative membrane.
  • the present invention provides methods and compositions for the expression of UCP in plants.
  • the present invention contemplates that any method of transfection that is suitable for transfection of plants, plant tissues, and plant cells may be used with the present invention.
  • Such methods include, but are not limited to, Agrobacterium-mcdiated transformation (e.g. , Komari et al. , Curr. Opin. Plant Biol., 1 :161 [1998]), particle bombardment mediated transformation (e.g. , Finer et al. , Curr. Top. Microbiol. Immunol., 240:59 [1999]), protoplast electroporation (e.g., Bates, Methods Mol.
  • an expression vector harboring the UCP gene of interest is transformed into the desired plant sample to achieve temporary or prolonged expression of the UCP.
  • Any suitable expression system may be used, so long as it is capable of undergoing transformation and expressing of the gene of interest in the host.
  • a pET vector Novagen, Madison, Wisconsin
  • a pBI vector Clontech, Palo Alto, California
  • an expression vector further encoding a green fluorescent protein (GFP) is used to allow simple selection of transfected cells and to monitor expression levels. Examples of such vectors include Clontech's "Living Colors Vectors" pEYFP and pEYFP-Cl .
  • the EYFP gene is codon optimized for high expression in plant cells.
  • promoters and regulatory elements may be used in the expression vectors of the present invention.
  • an inducible promoter is used to allow control of UCP expression through the presentation of external stimuli (e.g., environmentally inducible promoters).
  • external stimuli e.g., environmentally inducible promoters
  • the timing and amount of UCP expression may be controlled.
  • expression systems, promoters, inducible promoters, environmentally inducible promoters, and enhancers are described in WO 00/12714, WO 00/11175, WO 00/12713, WO 00/03012, WO 00/03017, WO 00/01832, WO 99/50428, WO 99/46976 and U.S. Pat. Nos. 6,028,250, 5,959,176, 5,907,086, 5,898,096, 5,824,857, 5,744,334, 5,689,044, and 5,612,472 each of which is herein incorporated by reference in its entirety.
  • UCP expression may be controlled in a number of ways. For example, expression may be stimulated by expressing a UCP gene in the plant, plant tissue, or plant cell. Expression may be from a UCP gene from a different species or may be from the expression of an endogenous gene. Regulation of the endogenous gene may be achieved, for example, through the introduction of a heterologous promoter, by increasing the copy number of the gene, and through the stimulation of native gene expression by regulating the levels or presence of particular transcription factors.
  • UCP expression may be inhibited, for example, through the introduction of antisense molecules or other RNA targeting molecules (e.g., ribozymes), gene-knockout (i.e., disrupting the UCP gene), down-regulation of gene expression by manipulating transcription factor activity, introduction of protein inhibitors, and other established methods.
  • RNA targeting molecules e.g., ribozymes
  • gene-knockout i.e., disrupting the UCP gene
  • cDNA encoding mouse UCP2 (genbank accession #U69135, SEQ ID NO: 1) is cloned into a Bluescript (Stratagene, La Jolla, California) as a 1588 bp XhoI-EcoRI fragment.
  • the start codon begins at nucleotide position 360.
  • the stop codon begins at nucleotide position 1290.
  • This clone contains both 5' and 3' flanking sequences.
  • Two sets of PCR primers were synthesized and may be used to isolate the gene fragment.
  • the primer set corresponds to the sense sequence of the mouse UCP2 (that is, the entire sequence, from nucleotide 360 to nucleotide 1290). Each of these primers also contains a restriction enzyme site corresponding to the cloning site.
  • the sense 5' primer 5' GTACCGGGCCCCATGGTTGGTTTCAAG 3' (SEQ ID NO: 13)
  • the sense 3' primer 5' GGCCATCTCGAGGAAAGGTGCCTCCCG 3'
  • the antisense fragment is approximately 550 nucleotides long (between nucleotides 1005 and 305 when looking at the sequence in antisense) and encodes an open reading frame.
  • Each of the primers also contains a restriction enzyme site corresponding to the cloning site.
  • the sense 5' primer ' 5' GTACCGGGCCCCATGGGCTCTTTTGAGCTG 3'
  • the sense and antisense fragments are isolated from the UCP2 gene in the Bluescript vector using the polymerase chain reaction.
  • the isolated fragments are cloned into a GFP fusion protein vector optimized for Chlamydomonas.
  • a GFP fusion protein vector optimized for Chlamydomonas is pFCrGFP (Entelechon GmbH, Regensburg, Germany).
  • Chlamydomonas is transformed using the glass bead- vortex method (See e.g.,, Kindle, "Chap 4, Nuclear Transformation: Technology and Applications," The Molecular Biology of Chloroplasts and Mitochondria in Chlamydomonas, Klawer Academic Publishers [1998]; Kindle, Proc. Natl. Acad. Sci. USA 87:1228 [1990]).
  • a cell-wall-less strain, nit 1-305 is used and transformed with the plasmid pMN24 containing a gene that allows transformants to grow on nitrate-containing medium.
  • a first transformation is gain-of- function.
  • the sense-GFP construct is transformed into the cell wall-less strain nit 1-305. This strain has two advantages. It lacks a cell wall and so can be easily transformed and it lacks UCP2 when analyzed by flow cytometry, as is predicted from the flow cytometry results discussed above (/ ' . e. , that no cell wall-less strains will have UCP2 when grown under standard light conditions).
  • a second transformation involves loss-of-function.
  • the anti-sense-GFP construct is used.
  • the cell wall is removed by autolysin to facilitate transfection prior to vortexing with glass beads. The selection process is as described in Kindle, Chapter 4, Nuclear Transformation: Technology and Applications, Supra.
  • the selection process can be achieved via drug sensitivity as described in Kindle, Chapter 4, Nuclear Transformation: Technology and Applications, Supra.
  • Successful transformation and expression levels may be detected any number of ways.
  • Southern and Northern hybridization assays may be conducted to identify successful transformants and detected UCP expression levels.
  • the UCP fragments described above may be used as probes.
  • Northern blot analysis RNAs isolated from different strains of Chlamydomonas, and Chlamydomonas grown under different conditions are isolated and tested.
  • ribozymes may be used to bind to a target RNA through complementary base-pairing, and once bound to the correct site, act enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein.
  • ribozymes motifs with enzymatic activity include hammerheads and hairpins (See, e.g., U.S. Pat. Nos. 5,891,684; 5,877,022; 5,869,253; 5,811,300; 5,795,778; 5,728,818; and 5,714,383, all of which are incorporated herein by reference).
  • UCP inhibitors are any compounds which decrease the activity of UCP in an alternative membrane.
  • UCP inhibitors include but are not limited to UCP binding peptides such as anti-UCP antibodies, UCP anti-sense nucleic acids, UCP dominant negative nucleic acids, nucleotides, nucleotide analogs, tocopherols, such as tocotrienols, and non omega 3 or 6 fatty acids.
  • Other types of inhibitors include ribozymes which interfere with the transcription, processing, or translation of UCP mRNA.
  • the UCP inhibitor is tunicamycin. Tunicamycin promotes intracellular trafficking of the UCP between intracellular locations. Each of these inhibitors is well known in the art and has been described extensively in the literature. Nucleotides and nucleotide (purine and pyrimidine) analogs include but are not limited to guanosine diphosphate (GDP).
  • GDP guanosine diphosphate
  • Purine analogs include but are not limited to guanosine diphosphate, 8-oxo-Adenosine, 8-oxo-Guanosine, 8-fluoro-Adenosine, 8-fluoro-Guanosine, 8-methoxy-Adenosine, 8-methoxy-Guanosine, 8-aza-Adenosine and 8-aza-Guanosine, azacitidine, Fludarabine phosphate, 6-MP, 6-TG, azathiprine, allopurinol, acyclovir, gancylovir, deoxycoformycin, and arabinosyladienine (ara-A), guanosine diphosphate fucose, guanosine diphosphate-2-fluorofucose, guanosine diphosphate-.
  • guanosine diphosphate fucose
  • guanosine diphosphate-2-fluorofucose guanosine diphosphat
  • pyrimidine analogues are uracil, thymine, cytosine, 5-fluorouracil, 5-chlorouracil, 5-bromouracil, dihydrouracil, 5-methylcytosine, 5-propynylthymine, 5-propynyluracil and 5-propynylcytosine, 5-fluorocytosine, Floxuridine, uridine, thymine, 3'-azido-3'-deoxythymidine, 2-fluorodeoxycytidine, 3-fluoro-3'-deoxythymidine; 3'-dideoxycytidin-2'-ene; and
  • nucleotides and nucleotide analogs can be modified to produce cell wall/ plasma membrane targeted UCP inhibitors by attaching a cell wall/ plasma membrane targeting sequence to the nucleotide or nucleotide analog. This can be accomplished by linking the nucleotide analog to a cell surface targeting molecule. Several methods for linking molecules are described below and others are known in the art.
  • the nucleotide or nucleotide analogs may also be modified such that it is membrane impermeable to prevent uptake of the nucleotide analog by the cell.
  • UCP inhibitors also include UCP binding peptides or molecules.
  • the binding peptides or molecules can be delivered directly to the cell to act on the cell wall/ plasma membrane UCP.
  • the UCP binding peptide or molecule may also be attached to a targeting molecule which targets the peptide or molecule to the cell of interest, as discussed in more detail below.
  • the UCP binding peptides and molecules of the invention can be identified using routine assays, such as the binding and activation assays described in the Examples and elsewhere throughout this patent application.
  • the UCP binding molecule is an isolated molecule.
  • An isolated molecule is a molecule that is substantially pure and is free of other substances with which it is ordinarily found in nature or in vivo systems to an extent practical and appropriate for its intended use.
  • the molecular species are sufficiently pure and are sufficiently free from other biological constituents of host cells so as to be useful in, for example, producing pharmaceutical preparations or sequencing if the molecular species is a nucleic acid, peptide, or polysaccharide.
  • an isolated molecular species of the invention may be admixed with a pharmaceutically-acceptable carrier in a pharmaceutical preparation, the molecular species may comprise only a small percentage by weight of the preparation.
  • the molecular species is nonetheless substantially pure in that it has been substantially separated from the substances with which it may be associated in living systems.
  • the UCP binding molecules may be isolated from natural sources or synthesized or produced by recombinant means. Methods for preparing or identifying molecules which bind to a particular target are well-known in the art.
  • Molecular imprinting for instance, may be used for the de novo construction of macro molecular structures, such as peptides, which bind to a particular molecule. See for example, Kenneth J. Shea, Molecular Imprinting of Synthetic Network Polymers:The De novo Synthesis of
  • Binding peptides such as antibodies, may easily be prepared by generating antibodies to UCP (or obtained from commercial sources) or by screening libraries to identify peptides or other compounds which bind to the UCP. Many UCP antibodies are commercially available.
  • Mimics of known binding molecules may also be prepared by known methods, such as (i) polymerization of functional monomers around a known binding molecule or the binding region of an antibody which also binds to the target (the template) that exhibits the desired activity; (ii) removal of the template molecule; and then (iii) polymerization of a second class of monomers in the void left by the template, to provide a new molecule which exhibits one or more desired properties which are similar to that of the template.
  • the method is useful for preparing peptides, and other binding molecules which have the same function as binding peptides, such as polysaccharides, nucleotides, nucleoproteins, lipoproteins, carbohydrates, glycoproteins, steroids, lipids and other biologically-active material can also be prepared.
  • a template such as a UCP binding antibody can be used to identify UCP inhibitors. It is now routine to produce large numbers of inhibitors based on one or a few peptide sequences or sequence motifs. (See, e.g., Bromme, et al., Biochem. J. 315:85-89 (1996); Palmer, et al., J Med. Chem. 38:3193-3196 (1995)).
  • an inhibitor of UCP may be chosen or designed as a polypeptide or modified polypeptide having the same sequence as protein X, or structural similarity to the sequence of protein X, in the region adjacent to position Y.
  • the region adjacent to the cleavage site Y spanning residues removed by 10 residues or, more preferably 5 residues, N-terminal and C-terminal of position Y may be defined as a "preferred protein X site" for the choice or design of UCP inhibitors.
  • a plurality of UCP inhibitors chosen or designed to span the preferred protein X binding site around position Y may be produced, tested for inhibitory activity, and sequentially modified to optimize or alter activity, stability, and/or specificity.
  • the method is useful for designing a wide variety of biological mimics that are more stable than the natural counterpart, because they are typically prepared by the free radical polymerization of functional monomers, resulting in a compound with a non- biodegradable backbone.
  • the created molecules would have the same binding properties as the UCP antibody but be more stable in vivo, thus preventing UCP from interacting with components normally available in its native environment.
  • Other methods for designing such molecules include, for example, drug design based on structure activity relationships which require the synthesis and evaluation of a number of compounds and molecular modeling. Binding molecules may also be identified by conventional screening methods, such as phage display procedures (e.g. methods described in Hart et al., J Biol. Chem. 269:12468 (1994)).
  • phage display libraries using, e.g., Ml 3 or fd phage, are prepared using conventional procedures such as those described in the foregoing reference.
  • the libraries generally display inserts containing from 4 to 80 amino acid residues.
  • the inserts optionally represent a completely degenerate or biased array of peptides.
  • Ligands having the appropriate binding properties are obtained by selecting those phage which express on their surface a ligand that binds to the target molecule. These phage are then subjected to several cycles of reselection to identify the peptide ligand expressing phage that have the most useful binding characteristics.
  • phage that exhibit the best binding characteristics are further characterized by nucleic acid analysis to identify the particular amino acid sequences of the peptide expressed on the phage surface in the optimum length of the express peptide to achieve optimum binding.
  • UCP binding molecules can be identified from combinatorial libraries. Many types of combinatorial libraries have been described. For instance, U.S. Patent Nos. 5,712,171 (which describes methods for constructing arrays of synthetic molecular constructs by forming a plurality of molecular constructs having the scaffold backbone of the chemical molecule and modifying at least one location on the molecule in a logically-ordered array); 5, 962, 412 (which describes methods for making polymers having specific physiochemical properties); and 5, 962, 736 (which describes specific arrayed compounds) .
  • 5,712,171 which describes methods for constructing arrays of synthetic molecular constructs by forming a plurality of molecular constructs having the scaffold backbone of the chemical molecule and modifying at least one location on the molecule in a logically-ordered array
  • 5, 962, 412 which describes methods for making polymers having specific physiochemical properties
  • 5, 962, 736 which describes specific arrayed compounds
  • any known binding assay may be employed.
  • the molecule may be immobilized on a surface and then contacted with a labeled UCP (or vice versa).
  • the amount of UCP which interacts with the molecule or the amount which does not bind to the molecule may then be quantitated to determine whether the molecule binds to UCP.
  • a surface having a known molecule that binds to UCP such as a commercially available monoclonal antibody immobilized thereto may serve as a positive control. Several types of commercially available antibodies are described above.
  • Screening of molecules of the invention also can be carried out utilizing a competition assay. If the molecule being tested competes with the known monoclonal antibody, as shown by a decrease in binding of the known monoclonal antibody, then it is likely that the molecule and the known monoclonal antibody bind to the same, or a closely related, epitope. Still another way to determine whether a molecule has the specificity of the known monoclonal antibody is to pre-incubate the known monoclonal antibody with the target with which it is normally reactive, and then add the molecule being tested to determine if the molecule being tested is inhibited in its ability to bind the target.
  • the molecule being tested is inhibited then, in all likelihood, it has the same, or a functionally equivalent, epitope and specificity as the known monoclonal antibody.
  • anti-idiotypic antibodies which can be used to screen other antibodies to identify whether the antibody has the same binding specificity as the known monoclonal antibody.
  • anti-idiotypic antibodies can be produced using well-known hybridoma techniques (Kohler and Milstein, Nature, 256:495, 1975).
  • An anti-idiotypic antibody is an antibody which recognizes unique determinants present on the known monoclonal antibodies. These determinants are located in the hypervariable region of the antibody.
  • An anti-idiotypic antibody can be prepared by immunizing an animal with the known monoclonal antibodies. The immunized animal will recognize and respond to the idiotypic determinants of the immunizing known monoclonal antibodies and produce an antibody to these idiotypic determinants. By using the anti-idiotypic antibodies of the immunized animal, which are specific for the known monoclonal antibodies of the invention, it is possible to identify other clones with the same idiotype as the known monoclonal antibody used for immunization.
  • Idiotypic identity between monoclonal antibodies of two cell lines demonstrates that the two monoclonal antibodies are the same with respect to their recognition of the same epitopic determinant.
  • anti-idiotypic antibodies it is possible to identify other hybridomas expressing monoclonal antibodies having the same epitopic specificity.
  • an anti-idiotypic monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region which is the image of the epitope bound by the first monoclonal antibody.
  • the binding peptides useful according to the invention are antibodies or functionally active antibody fragments.
  • Antibodies are well known to those of ordinary skill in the science of immunology. Many of the binding peptides described herein are available from commercial sources as intact functional antibodies, as described above.
  • the term "antibody” means not only intact antibody molecules but also fragments of antibody molecules retaining specific binding ability. Such fragments are also well known in the art.
  • the term “antibody” means not only intact immunoglobulin molecules but also the well-known active fragments F(ab') 2 , and Fab. F(ab') 2 , and Fab fragments which lack the Fc fragment of intact antibody (Wahl et al, J. Nucl.
  • CDRs complementarity determining regions
  • the CDR's directly interact with the epitope of the antigen (see, in general, Clark, 1986; Roitt, 1991).
  • FR1 through FR4 framework regions separated respectively by three complementarity determining regions (CDR1 through CDR3).
  • the framework regions (FRs) maintain the tertiary structure of the paratope, which is the portion of the antibody which is involved in the interaction with the antigen.
  • the CDRs, and in particular the CDR3 regions, and more particularly the heavy chain CDR3 contribute to antibody specificity. Because these CDR regions and in particular the CDR3 region confer antigen specificity on the antibody these regions may be incorporated into other antibodies or peptides to confer the identical specificity onto that antibody or peptide.
  • the peptide of the invention is an intact soluble monoclonal antibody in an isolated form or in a pharmaceutical preparation.
  • An intact soluble monoclonal antibody as is well known in the art, is an assembly of polypeptide chains linked by disulfide bridges. Two principle polypeptide chains, referred to as the light chain and heavy chain, make up all major structural classes (isotypes) of antibody. Both heavy chains and light chains are further divided into subregions referred to as variable regions and constant regions.
  • the term "monoclonal antibody” refers to a homogenous population of immunoglobulins which specifically bind to an epitope (i.e. antigenic determinant) , e.g., of cell wall/ plasma membrane UCP, chloroplast UCP etc.
  • the binding peptides may also be functionally active antibody fragments.
  • the paratope is involved in the binding of the antibody to its epitope (see, in general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford).
  • the pFc' and Fc regions of the antibody are effectors of the complement cascade but are not involved in antigen binding.
  • an antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region designated an F(ab') 2 fragment, retains both of the antigen binding sites of an intact antibody.
  • An isolated F(ab') fragment is referred to as a bivalent monoclonal fragment because of its two antigen binding sites.
  • an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region designated an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule.
  • Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd (heavy chain variable region). The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains
  • the invention also encompasses the use of antisense oligonucleotides that selectively bind to a UCP nucleic acid molecule, and dominant negative UCP to reduce the expression of UCP.
  • Antisense oligonucleotides are useful, for example, for inhibiting UCP in a cell in which it is ordinarily expressed in alternative membranes such as the cell wall/ plasma membrane and chloroplasts.
  • antisense oligonucleotide or “antisense” describes an oligonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an RNA transcript of that gene and, thereby, inhibits the transcription of that gene and/or the translation of the mRNA.
  • the antisense molecules are designed so as to hybridize with the target gene or target gene product and thereby, interfere with transcription or translation of the target plant cell gene.
  • the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence.
  • the antisense must be a unique fragment.
  • a unique fragment is one that is a 'signature' for the larger nucleic acid. It, for example, is long enough to assure that its precise sequence is not found in molecules outside of the UCP gene. As will be recognized by those skilled in the art, the size of the unique fragment will depend upon its conservancy in the genetic code. Thus, some regions of SEQ ID NO:l, 3, 5, and 7-12, will require longer segments to be unique while others will require only short segments, typically between 12 and 32 base pairs (e.g. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32 bases long).
  • the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions.
  • the antisense oligonucleotides should comprise at least 7 and, more preferably, at least 15 consecutive bases which are complementary to the target.
  • the antisense oligonucleotides comprise a complementary sequence of 20-30 bases.
  • oligonucleotides may be chosen which are antisense to any region of the gene or RNA (e.g., mRNA) transcripts
  • the antisense oligonucleotides are complementary to 5' sites, such as translation initiation, transcription initiation or promoter sites, that are upstream of the gene that is targeted for inhibition by the antisense oligonucleotides.
  • 5' or 3' enhancers may be targeted. Targeting to mRNA splice sites has also been used in the art but may be less preferred if alternative mRNA splicing occurs.
  • the antisense is targeted, preferably, to sites in which mRNA secondary structure is not expected (see, e.g., Sainio et al., Cell Mol. Neurobiol, (1994) 14(5):439-457) and at which proteins are not expected to bind.
  • the selective binding of the antisense oligonucleotide to a plant cell nucleic acid effectively decreases or eliminates the transcription or translation of the plant target cell nucleic acid molecule, thus reducing UCP expression in the plant.
  • the invention also includes the use of a "dominant negative cell wall/ plasma membrane UCP" polypeptide.
  • a dominant negative polypeptide is an inactive variant of a protein, which, by interacting with the cellular machinery, displaces an active protein from its interaction with the cellular machinery or competes with the active protein, thereby reducing the effect of the active protein.
  • a dominant negative receptor which binds a ligand but does not transmit a signal in response to binding of the ligand can reduce the biological effect of expression of the ligand.
  • a dominant negative catalytically-inactive kinase which interacts normally with target proteins but does not phosphorylate the target proteins can reduce phosphorylation of the target proteins in response to a cellular signal.
  • a dominant negative transcription factor which binds to a promoter site in the control region of a gene but does not increase gene transcription can reduce the effect of a normal transcription factor by occupying promoter binding sites without increasing transcription.
  • the end result of the expression of a dominant negative polypeptide as used herein in a cell is a reduction in membrane expressed UCP.
  • One of ordinary skill in the art can assess the potential for a dominant negative variant of a protein, and using standard mutagenesis techniques to create one or more dominant negative variant polypeptides. For example, one of ordinary skill in the art can modify the sequence of the cell wall/ plasma membrane UCP by site-specific mutagenesis, scanning mutagenesis, partial gene deletion or truncation, and the like. See, e.g., U.S. Patent No. 5,580,723 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989.
  • a plant cell targeting sequence can be used to target the UCP inhibitor or activator to a specific type of plant cell. It is desirable in many instances to specifically target the activator or inhibitor to a specific plant cell type to increase the efficiency and specificity of administration of the UCP inhibitor or activator and to avoid delivering the compounds to another plant cell in close physical proximity, for which the treatment may not be beneficial.
  • One method of targeting involves antibody or receptor targeting.
  • Receptor or antibody targeting involves linking the UCP inhibitor or activator to a ligand or an antibody which has an affinity for a receptor or cell surface molecule expressed on the desired target cell surface.
  • the UCP inhibitor or activator is intended to adhere to the target cell following formation of a ligand-receptor or antibody- cell surface antigen complex on the cell surface.
  • the type of receptor or antibody used to target the cell will depend on the specific cell type being targeted.
  • a plant cell targeting sequence may be attached by a peptide or other type of bond such as a sulfhydryl or disulfide bond.
  • Targeting molecules are described, for instance in US Patent No. 5,849,718 as well as many other references.
  • the plant cell targeting sequence is coupled to the UCP inhibitor or activator.
  • the molecules may be directly coupled to one another, such as by conjugation or may be indirectly coupled to one another where, for example, plant cell targeting sequence is on the surface of a liposome and the UCP inhibitor or activator is contained within the liposome. If the molecules are linked to one another, then the plant cell targeting sequence is covalently or noncovalently bound to the UCP inhibitor or activator in a manner that preserves the targeting specificity of the plant cell targeting sequence.
  • linkage means two entities are bound to one another by any physiochemical means. It is important that the linkage be of such a nature that it does not impair substantially the effectiveness of the UCP inhibitor or activator or the binding specificity of the plant cell targeting sequence. Keeping these parameters in mind, any linkage known to those of ordinary skill in the art may be employed, covalent or noncovalent. Such means and methods of linkage are well known to those of ordinary skill in the art.
  • Linkage according to the invention need not be direct linkage.
  • the components of the compositions of the invention may be provided with functionalized groups to facilitate their linkage and/or linker groups may be interposed between the components of these compositions to facilitate their linkage.
  • the components of the present invention may be synthesized in a single process, whereby the components could be regarded as one in the same entity.
  • a plant cell targeting sequence specific for a plant cell could be synthesized together with the UCP inhibitor or activator.
  • covalent bonds include those wherein bifunctional cross- linker molecules are used.
  • the cross-linker molecules may be homobifunctional or heterobifunctional, depending upon the nature of the molecules to be conjugated.
  • Homobifunctional cross-linkers have two identical reactive groups. Heterobifunctional cross-linkers have two different reactive groups that allow sequential conjugation reaction. Various types of commercially available cross-linkers are reactive with one or more of the following groups: primary amines, secondary amines, sulfhydriles, carboxyls, carbonyls and carbohydrates.
  • Non-covalent methods of conjugation also may be used to join the targeting moiety and the UCP inhibitor or activator.
  • Non-covalent conjugation may be accomplished by direct or indirect means including hydrophobic interaction, ionic interaction, intercalation, binding to major or minor grooves of a nucleic acid and other affinity interactions.
  • Covalent linkages may be noncleavable in physiological environments or cleavable in physiological environments, such as linkers containing disulfide bonds. Such molecules may resist degradation and/or may be subject to different intracellular transport mechanisms.
  • One of ordinary skill in the art will be able to ascertain without undue experimentation the preferred bond for linking the targeting moiety and the UCP inhibitor or activator, based on the chemical properties of the molecules being linked and the preferred characteristics of the bond.
  • the plant cell targeting sequence may be part of a particle, such as a liposome, which targets the liposome to the plant cell or organelle.
  • the liposome may contain the UCP inhibitor or activator.
  • the manufacture of liposomes containing a protein or nucleic acid such as a UCP inhibitor or activator is fully described in the literature.
  • Many are based upon cholesteric molecules as starting ingredients and/or phospholipids. They may be synthetically derived or isolated from natural membrane components. Virtually any hydrophobic substance can be used, including cholesteric molecules, phospholipids and fatty acids preferably of medium chain length (12C-20C). Preferred are naturally occurring fatty acids of between 14 and 18 carbons in length.
  • These molecules can be attached to the UCP inhibitor or activator of the invention, with the lipophilic anchor inserting into the membrane of a liposome and the UCP inhibitor or activator tethered on the surface of the liposome for targeting the liposome to the cell.
  • the UCP activators and inhibitors are targeted to the intracellular organelles or to the cell wall or plasma membrane, including the plasma desmata or pores. These types of targeting molecules are described above and can be linked to the activators and inhibitors as described herein.
  • heterologous as used herein in reference to a membrane attachment domain operatively fused to a UCP inhibitor or activator, means a membrane attachment domain derived from a source other than the gene encoding the UCP inhibitor or activator.
  • a heterologous membrane attachment domain can be synthetic or can be encoded by a gene distinct from the gene encoding the UCP inhibitor or activator to which it is fused.
  • operatively fused means that the UCP inhibitor or activator and membrane attachment domain are fused in the correct reading frame such that, under appropriate conditions, a full-length fusion protein is expressed.
  • a fusion protein can comprise, for example, an amino-terminal UCP inhibitor or activator operatively fused to a carboxyl- terminal heterologous membrane attachment domain or can comprise an amino-terminal heterologous membrane attachment domain operatively fused to a carboxyl-terminal UCP inhibitor or activator
  • membrane-bound as used herein in reference to a fusion protein means stably attached to a cellular membrane.
  • fusion protein means a hybrid protein including a synthetic or heterologous amino acid sequence.
  • dissipation of cellular proton motor force refers to the relative amount of protons in the cell. It can be assessed by measuring cell wall/ plasma, chloroplast, or mitochondrial membrane potential depending on the UCP being studied.
  • cell wall/ plasma membrane potential is the pressure on the inside of the cell wall/ plasma membrane measured relative to the extracellular fluid which is created by the generation and dissipation of charge within the cell.
  • chloroplast membrane potential is the pressure on the inside of the chloroplast membrane measured relative to the cytoplasma which is created by the generation and dissipation of charge within the chloroplast.
  • the cell wall/ plasma or chloroplast membrane potential is maintained by the energy generating system of the cell wall/ plasma or chloroplast membrane respectively.
  • electron transport is coupled to oxidative phosphorylation resulting in the production of ATP from glucose.
  • UCPs can cause the reversible uncoupling of electron transport and oxidative phosphorylation, which leads to a decrease in the mitochondrial membrane potential, or as discovered herein the cell wall/ plasma or chloroplast membrane potential.
  • the absolute levels of the cell wall/ plasma membrane potential vary depending on the cell or tissue type. As used herein an "increase in cell wall/ plasma or chloroplast membrane potential" is an increase relative to the normal status of the cell being examined and results from the prevention of dissipation of proton motor force with respect to cell wall/ plasma or chloroplast respectively. "Prevention” as used herein refers to a decrease or reduction in the amount of dissipation that would ordinarily occur in the absence of the stimulus applied according to the methods of the invention to cause coupling.
  • the baseline potential will be relatively low and when the ATP generating systems are coupled an increase in cell wall/ plasma or chloroplast membrane potential from that baseline level is observed.
  • a "decrease in cell wall/ plasma or chloroplast membrane potential” is a decrease relative to the normal status of the cell being examined and results from the dissipation of proton motor force. If electron transport and oxidative phosphorylation are normally coupled within the cell then the baseline potential will be relatively high and when the ATP generating systems are uncoupled a decrease in cell wall/ plasma membrane potential from that baseline level is observed.
  • Cell wall/ plasma or chloroplast membrane ATP synthase is likely the source of ATP for the cell wall/ plasma or chloroplast membrane UCP.
  • Changes in cell wall/ plasma or chloroplast membrane potential can be assessed by any method known in the art for making such measurements.
  • the cell wall/ plasma or chloroplast membrane potential may be assessed using the well known comet assay, where whole cells are electrophoresed on an agarose gel and examined for the presence of a tail. Alternatively it may be measured using electrodes placed on opposite sides of the membrane.
  • Cell wall/ plasma or chloroplast membrane potential may also be measured cytometrically by incubating cells for approximately 20 minutes at room temperature with a cell wall/ plasma or chloroplast membrane specific fluorescent probe. The aggregation state and consequently the fluorescence emission of fluorescent probe changes as the cell wall/ plasma or chloroplast membrane potential is altered. Flow cytometry permits the examination of more than one, for instance eight, fluorescent markers concurrently.
  • the invention also relates to the discovery that modulation of UCP activity also influences reactive oxygen generation and accumulation. This finding has important implications for the regulation of many physiological processes including infectious disease.
  • the invention relates to the treatment and prevention of disease in plants.
  • Each of the compositions of the invention may optionally be associated with a delivery system or vector.
  • a "vector" is any vehicle capable of facilitating: (1) delivery of a composition to a target cell or (2) uptake of a composition by a target cell, if uptake is important.
  • the vectors useful in the invention are divided into two classes: colloidal dispersion systems and biological vectors.
  • a "colloidal dispersion system” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering to and releasing the active agent to the plant cell.
  • Colloidal dispersion systems include macromolecular complexes, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • a preferred colloidal system of the invention is a liposome. Liposomes are artificial membrane vessels.
  • LUV large unilamellar vessels
  • Lipid formulations for transfection are commercially available from QIAGEN, for example as EFFECTENETM (a non-liposomal lipid with a special DNA condensing enhancer) and SUPER-FECTTM (a novel acting dendrimeric technology) as well as Gibco BRL, for example, as LIPOFECTINTM and LIPOFECTACETM, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • DOTMA N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride
  • DDAB dimethyl dioctadecylammonium bromide
  • the UCP activator or UCP inhibitor may be delivered to the subject in a biological vector which is a nucleic acid molecule which encodes for the UCP activator or UCP inhibitor such that the UCP activator or UCP inhibitor is expressed.
  • the nucleic acid encoding the UCP activator or UCP inhibitor is operatively linked to a gene expression sequence, such as that described above.
  • the UCP activator or UCP inhibitor nucleic acid of the invention may be delivered to the cell alone or in association with a vector.
  • a "vector" is any vehicle capable of facilitating the transfer of the UCP activator or UCP inhibitor nucleic acid to the appropriate cells so that the UCP activator or UCP inhibitor can be expressed on the cell wall/ plasma membrane or within the cell respectively.
  • the vector transports the nucleic acid to the cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector.
  • the vector optionally includes the above-described gene expression sequence to enhance expression of the UCP activator or UCP inhibitor nucleic acid.
  • the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the UCP activator or UCP inhibitor nucleic acid sequences.
  • Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein- Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus.
  • retrovirus such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus
  • adenovirus adeno-associated virus
  • SV40-type viruses polyoma viruses
  • Epstein- Barr viruses papilloma viruses
  • herpes virus vaccinia virus
  • polio virus poli
  • Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
  • An example of virus for certain applications is the adeno-associated virus, a double-stranded DNA virus.
  • the adeno-associated virus can be engineered to be replication -deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions.
  • Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., "Molecular Cloning: A Laboratory Manual," Second Edition, Cold Spring Harbor Laboratory Press, 1989. These plasmids having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC 18, pUC 19, pRC/CMV, S V40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
  • compositions that can be used to facilitate uptake by a target cell of the compositions of the invention include calcium phosphate and other chemical mediators of intracellular transport, microinjection compositions, electroporation and homologous recombination compositions (e.g., for integrating a composition of the invention into a preselected location within the target cell chromosome).
  • transgenic when used in reference to a plant or fruit (i.e., a “transgenic plant” or “transgenic fruit”) refers to a plant or fruit that contains at least one heterologous gene in one or more of its cells.
  • sample is used in its broadest sense. In one sense it can refer to a plant cell or tissue. In another sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from plants or animals and encompass fluids, solids, tissues, and gases. Environmental samples include environmental material such as surface matter, soil, water, and industrial samples. These examples are not to be construed as limiting the sample types applicable to the present invention.
  • transformants or “transformed cells” include the primary transformed cell and cultures derived from that cell without regard to the number of transfers. All progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same functionality as screened for in the originally transformed cell are included in the definition of transformants.
  • selectable marker refers to the use of a gene that encodes an enzymatic or other detectable activity (e.g., luminescence, fluorescence, or radioactivity) that confers the ability to grow in medium lacking what would otherwise be an essential nutrient. A selectable marker may also confer resistance to an antibiotic or drug upon the cell in which the selectable marker is expressed.
  • Selectable markers may be "dominant”; a dominant selectable marker encodes an enzymatic or other activity (e.g., luminescence, fluorescence, or radioactivity) that can be detected in any cell line.
  • transfection refers to the introduction of foreign DNA into cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, glass beads, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, viral infection, biolistics (i.e., particle bombardment) and the like.
  • Wild type (CC124, mt-) and cell wall-less (CC, mt+) C. reinhardtii were tested for the presence of UCP by flow cytometry.
  • Non-permeabilized cells were stained with anti-UCP2 antibody (Santa Cruz Technologies).
  • Cells were prepared for staining with goat anti-UCP2 antibody (Santa Cruz Pharmaceuticals) followed by fluorescein conjugated anti-rabbit or goat outer step antibodies, respectively.
  • Data were acquired on a Coulter Elite Epics flow cytometer (Coulter, Hialeah, Florida) and analyzed with CellQuest software, (Becton Dickinson, San Jose, California).
  • DCF- DA 6-carboxy-2'-7'-dichlorodihydrofluorescein diacetate
  • DCF-DA 6-carboxy-2'-7'-dichlorodihydrofluorescein diacetate
  • CM-H2XROS Mitotracker Red
  • Coulter Excel flow cytometer was used with a single excitation wavelength (488 nm) and band filters for PE (575 nm), FITC (525 nm) and Red613 (613 nm) to analyze the stained cells. Each sample population was classified for cell size (forward scatter) and complexity (side scatter), gated on a population of interest and evaluated using 40,000 cells.
  • FIG 1 Panel A, illustrates that in wild type (cell-walled [CC124-]), but not in cell wall-less strains (cwl5+) of C. reinhardtii, as shown in Figure 1, Panel B, express cell surface molecules recognized by antibodies to UCP2. This result confirms that UCP can be localized to the cell wall, in addition to mitochondria and chloroplast. It was also hypothesized that if cell wall expression of UCP2 facilitates uptake of acetate as an alternative carbon source during non-photosynthetic periods, then mutant strains of C. reinhardtii that die in the dark should not express cell wall UCP2. Such mutants were tested for the presence of cell wall UCP.
  • Figure 2 Panel A, shows that light-sensitive, cell-walled strains of C.
  • reinhardtii express high levels of UCP.
  • Panel B dark sensitive strains (CC2654; dark-dier) of C. reinhardtii express no cell-wall UCP over control samples.
  • RNA from C. reinhardtii. was also examined. Total RNA was isolated from wild type, wild type treated with norflurazen, cell wall less CW15+, and light sensitive cells. Four concentrations of RNA were attached to the blot, 20ug, 10 ug, 5 ug, and 2,5 ug. A 32P labeled probe from mouse clone in Bluescript was utilized. The results are shown in Figure 4.
  • UCPs may also be utilized to protect plants, tissues, or cells against free radical damage.
  • C. reinhardtii cell walls protects against free radical damage.
  • C. reinhardtii was tested for changes in reactive oxygen levels flow cytometrically using DCF-DA (Molecular Probes, Eugene, Oregon). It was shown that levels of peroxide are different between strains of C. reinhardtii. It was reasoned that UCP functions to prevent increased levels of oxygen free radicals, thus, mitochondrial membrane potential was measured using Cm-CS ros (Molecular Probes, Eugene, Oregon). The accuracy of this method for free radical quantification has been validated. The results demonstrate that UCP in C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Nutrition Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des procédés et des produits permettant de manipuler le métabolisme de végétaux et leur résistance à l'infection.
PCT/US2001/010236 2000-03-31 2001-03-30 Compositions et procedes permettant de reguler le metabolisme de vegetaux WO2001075131A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001251132A AU2001251132A1 (en) 2000-03-31 2001-03-30 Expression of uncoupling protein (ucp) in plants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US19353300P 2000-03-31 2000-03-31
US60/193,533 2000-03-31

Publications (3)

Publication Number Publication Date
WO2001075131A2 true WO2001075131A2 (fr) 2001-10-11
WO2001075131A3 WO2001075131A3 (fr) 2002-03-14
WO2001075131A9 WO2001075131A9 (fr) 2002-12-27

Family

ID=22714007

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/010236 WO2001075131A2 (fr) 2000-03-31 2001-03-30 Compositions et procedes permettant de reguler le metabolisme de vegetaux

Country Status (2)

Country Link
AU (1) AU2001251132A1 (fr)
WO (1) WO2001075131A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2836688A1 (fr) * 2002-03-01 2003-09-05 Biogemma Fr Utilisation de proteines elip pour accroitre la resistance de vegetaux au stress photo-oxydant
WO2003080122A1 (fr) * 2002-03-22 2003-10-02 Orthogen Ag Procede et agent de fabrication de compositions sanguines therapeutiquement actives

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988002402A1 (fr) * 1986-09-26 1988-04-07 Calgene, Inc. Apport intracellulaire de produits d'expression
WO1990008831A1 (fr) * 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Inhibition de la respiration cellulaire des plantes
US5360726A (en) * 1989-09-12 1994-11-01 Board Of Trustees Operating Michigan State University Polypeptides enabling sorting of proteins to vacuoles in plants
FR2767058A1 (fr) * 1997-08-05 1999-02-12 Centre Nat Rech Scient Utilisation d'un compose de type retinoide, notamment l'acide retinoique pour la preparation d' un medicament destine au traitement de l'obesite.

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1988002402A1 (fr) * 1986-09-26 1988-04-07 Calgene, Inc. Apport intracellulaire de produits d'expression
WO1990008831A1 (fr) * 1989-01-26 1990-08-09 Imperial Chemical Industries Plc Inhibition de la respiration cellulaire des plantes
US5360726A (en) * 1989-09-12 1994-11-01 Board Of Trustees Operating Michigan State University Polypeptides enabling sorting of proteins to vacuoles in plants
FR2767058A1 (fr) * 1997-08-05 1999-02-12 Centre Nat Rech Scient Utilisation d'un compose de type retinoide, notamment l'acide retinoique pour la preparation d' un medicament destine au traitement de l'obesite.

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
LALOI M ET AL: "A plant cold-induced uncoupling protein." NATURE, vol. 389, no. 6647, 11 September 1997 (1997-09-11), page 135-136 XP002180563 *
MAIA IVAN G ET AL: "AtPUMP: An Arabidopsis gene encoding a plant uncoupling mitochondrial protein." FEBS LETTERS, vol. 429, no. 3, 16 June 1998 (1998-06-16), pages 403-406, XP002180564 ISSN: 0014-5793 *
RICQUIER DANIEL ET AL: "The uncoupling protein homologues: UCP1, UCP2, UCP3, StUCP and AtUCP." BIOCHEMICAL JOURNAL, vol. 345, no. 2, 15 January 2000 (2000-01-15), pages 161-179, XP002180562 ISSN: 0264-6021 *
SAVIANI ELZIRA E ET AL: "Fatty acid-mediated uncoupling of potato tuber mitochondria." BIOCHEMISTRY AND MOLECULAR BIOLOGY INTERNATIONAL, vol. 44, no. 4, April 1998 (1998-04), pages 833-839, XP001034371 ISSN: 1039-9712 *
WINKLER EDITH ET AL: "UCP3 expressed in yeast is primarily localized in extramitochondrial particles." BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 282, no. 1, 23 March 2001 (2001-03-23), pages 334-340, XP002180565 ISSN: 0006-291X *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2836688A1 (fr) * 2002-03-01 2003-09-05 Biogemma Fr Utilisation de proteines elip pour accroitre la resistance de vegetaux au stress photo-oxydant
WO2003074713A1 (fr) * 2002-03-01 2003-09-12 Biogemma Utilisation de proteines elip pour accroitre la resistance des vegetaux au stress photo-oxydant
WO2003080122A1 (fr) * 2002-03-22 2003-10-02 Orthogen Ag Procede et agent de fabrication de compositions sanguines therapeutiquement actives

Also Published As

Publication number Publication date
WO2001075131A3 (fr) 2002-03-14
AU2001251132A1 (en) 2001-10-15
WO2001075131A9 (fr) 2002-12-27

Similar Documents

Publication Publication Date Title
Gonzalez et al. A cluster of phosphorylation sites on the cyclic AMP-regulated nuclear factor CREB predicted by its sequence
DE69838613T2 (de) Gene, welche den phytat-metabolismus kontrollieren und daraus entstehende anwendungen
Murata et al. A specific transporter for iron (III)–phytosiderophore in barley roots
AU2009202280B2 (en) Carotene synthase gene and uses therefor
Bilang et al. Cloning and characterization of a glutathione S-transferase that can be photolabeled with 5-azido-indole-3-acetic acid
RU2268301C9 (ru) Инкапсулирование полипептидов в матрицу крахмала
CN108531505A (zh) 在昆虫害虫中下调基因表达
CN110452908A (zh) 在昆虫害虫中下调基因表达
JP2000023681A (ja) 腫瘍タンパク質のプロテインキナ―ゼ
SK148498A3 (en) Regulating metabolism by modifying the level of trehalose-6-phosphate
AU2018216169B2 (en) Expression of nitrogenase polypeptides in plant cells
JPH11510389A (ja) 細胞タンパク質の機能を不活性化するためのタンパク質−タンパク質相互作用表面の拡張
TWI377954B (en) Oil body carriers, uses in target therapy and/or detection of the same, and fusion proteins comprised therein
SK3922001A3 (en) Genes of the 1-desoxy-d-xylulose biosynthetic pathway
KR20150128770A (ko) 티오에스테라아제 및 맞춤형 오일 생산용 세포
US7105718B2 (en) Compositions and methods for regulating metabolism in plants
CN103562217A (zh) 在重组含油微生物中表达油体钙蛋白以提高其中的油含量
CN100374568C (zh) Tao蛋白激酶及其使用方法
AU753169B2 (en) Method for identifying chemical active agents and active agents for inhibiting the 1-desoxy-D-xylulose-5-phosphate biosynthetic pathway
Lee et al. Biochemical properties and localization of the β-expansin OsEXPB3 in rice (Oryza sativa L.)
WO2001075131A2 (fr) Compositions et procedes permettant de reguler le metabolisme de vegetaux
Cohen et al. Functional expression of rat GLUT 1 glucose transporter in Dictyostelium discoideum
CN110144327A (zh) 一种靶向性抗肿瘤t细胞及其制备方法和应用
CN110430899A (zh) 光感受灵敏度的抑制或减弱剂
KR20060129459A (ko) 스키조키트리움 지방산 합성효소 (ｆａｓ) 및 이와 관련된제품 및 방법

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGE 6, DESCRIPTION, REPLACED BY CORRECT PAGE 6; PAGES 1/4-4/4, DRAWINGS, REPLACED BY NEW PAGES 1/6-6/6

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 69(1) EPC. EPO FORM 1205A DATED 18.03.03

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP