WO2001075009A2 - Nouveau polypeptide, sérine arnt synthétase 27, et polynucléotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, sérine arnt synthétase 27, et polynucléotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001075009A2 WO2001075009A2 PCT/CN2001/000276 CN0100276W WO0175009A2 WO 2001075009 A2 WO2001075009 A2 WO 2001075009A2 CN 0100276 W CN0100276 W CN 0100276W WO 0175009 A2 WO0175009 A2 WO 0175009A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- trna synthetase
- human
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human serine-tRNA synthetase 27, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
- the protein information carried by DNA generates mRNA through transcription to complete only part of gene expression, and a more complicated part is the translation process, that is, the process of converting nucleic acid language into protein language.
- the main roles of this process are various aminoacyl-tRNA synthetases, various tRNAs and ribosomes. Due to their combined action, amino acids can be connected to each other into a polypeptide chain according to the information provided by mRNA.
- a group of isotropic tRNAs carry amino acids catalyzed by the same aminoacyl-tRNA synthetase. For most tRNAs, aminoacyl-tRNA synthetase does not recognize the anti-codon, but recognizes some other site, the codon of the tRNA.
- aminoacyl-tRNA synthetase family contains 20 members, distinguished by many structurally similar tRNAs and specific selectivity among amino acids. In higher eukaryotes, nine different types of aminoacyl-tRNA synthetases are removed, as well as serine-tRNA synthetases associated with a multienzyme complex.
- Aminoacyl-tRNA synthetases can be divided into two categories: the catalytic domain of Class I enzymes has a nucleotide binding Rossmann folding structure, while the catalytic domain of Class II enzymes consists of a seven-strand antiparallel ⁇ -sheet template, including valylyl -, Isoleucyl-, Leucyl-, and Methionyl-tRNA Synthetase, Class I enzymes catalyze the aminoacylation of their associated tRNAs at the 2'-0H position of the terminal adenosine. Class II enzymes have three characteristic sequences!
- eukaryotic aminoacyl-tRNA synthetases contain N-terminal extensions, but only eukaryotic isoleucine-tRNA synthetases and seryl-tRNA synthetases have additional C-terminal domains.
- Serine-tRNA synthetase templates 2 and 3 play an extremely important role in the formation of active sites.
- the N-terminal domain is involved in tRNA recognition, and the extended C-terminal domain is rich in leucine residues, affecting the enzyme and Substrate affinity and stability.
- the nucleotide sequence of human serine-tRNA synthetase is different from that of the prokaryotic serine-tRNA synthetase at the N-terminal secondary structure, and exon 4 is inserted to improve the specific recognition of tRNA.
- the two major recognition components of human seryl-tRNA synthetase are the identification base point G73 and the long outer arm.
- the novel seryl-tRNA synthetase of the present invention and human seryl-t RM synthetase have a protein level
- human seryl-tRNA synthetase 27 97% identity and 100% similarity, and also contains various characteristic sequence fragments common to other members of the human seryl-tRNA synthetase family, so it is named human seryl-t RNA synthetase 27, and It is inferred that this protein is similar to human serine-tRNA synthetase and has similar biological functions. This protein regulates the translation of mRNA into protein in the body, and abnormal expression of this protein will lead to abnormal protein synthesis.
- the human serine-tRNA synthetase 27 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art
- Isolation of the novel human seryl-t RNA synthetase 27 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human seryl-t RNA synthetase 27.
- Another object of the present invention is to provide a method for producing human seryl-tRNA synthetase 27.
- Another object of the present invention is to provide an antibody against the polypeptide-human seryl-tRNA synthetase 27 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against human serine-tRNA synthetase 27 of the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human seryl-t RM synthase 27.
- the present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID D. 2, or a conservative variant, biologically active fragment, or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID D0: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 90-824 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 91 4-bit sequence.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human seryl-tRM synthase 27 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of human seryl-t RM synthetase 27 protein, which comprises detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample. Or detecting the amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human seryl-tRNA synthetase 27.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, which The amino acid substituted in the amino acid has a structural or chemical property similar to that of the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
- An "agonist” refers to a molecule that, when combined with human seryl-tRNA synthetase 27, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human seryl-tRNA synthetase 27.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of human serine-tRNA synthetase 27 when combined with human serine-tRNA synthetase 27 .
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human seryl-tRNA synthetase 27.
- Regular refers to a change in the function of human serine-tRM synthetase 27, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human serine-tRNA synthetase 27 Or changes in immune properties.
- substantially pure is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human seryl-tRNA synthetase 27 using standard protein purification techniques. Basically pure human serine-tRNA synthetase 27 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human seryl-tRNA synthetase 27 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou thern blotting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). 0
- the Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups.
- sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
- the percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) 0 "similarity" refers to the amino acid sequence The degree of identity or conservativeness of amino acid residues at corresponding positions in the alignment between the two-for conservative amino acids.
- negatively charged amino acids may include aspartic acid and glutamic acid; Amino acids may include lysine and arginine; amino acids with similarly charged head groups that have no charge may include leucine, isoleucine, and valine; glycine and alanine; asparagus Amide and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? ⁇ It can specifically bind to human serine-tRNA synthetase 27 epitopes.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human seryl-t RNA synthetase 27 refers to human seryl-tRNA synthetase 27 that is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human seryl-tRNA synthetase 27 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human seryl-tRNA synthetase 27 polypeptide can be analyzed by amino acid sequence analysis.
- the present invention provides a new polypeptide, human serine-tRNA synthetase 27, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
- the invention also includes fragments, derivatives and analogs of human seryl-t RNA synthetase 27.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human seryl-t RNA synthetase 27 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
- the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ )
- Such a polypeptide sequence in which the mature polypeptide is fused with another compound such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol
- a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence)
- such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 1914 bases in length and its open reading frame 90-824 encodes 244 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 97% homology with human seryl-tRNA synthetase. It can be inferred that human seryl-tRNA synthetase 27 is similar to human seryl-tRNA synthetase Structure and function.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- stringent conditions means: (1) Hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /.
- the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.
- the invention also relates to nucleic acid fragments that hybridize to the sequences described above.
- nucleic acid fragment contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human seryl-tRNA synthetase 27.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human seryl-tRNA synthetase 27 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human serine-tRNA synthetase 27 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human seryl-tRNA synthetase 27 gene.
- a method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human serine-tRNA synthetase 27 coding sequence, and the recombinant technology to produce the Polypeptide method.
- a polynucleotide sequence encoding human seryl-tRNA synthetase 27 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human seryl-tRNA synthetase 27 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome junction for translation initiation Binding site and transcription terminator, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human seryl-tRNA synthetase 27 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (Method 12, using the procedure well known in the art.
- Alternative is MgC l 2.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human seryl-tRNA synthetase 27 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and The cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography
- Fig. 1 is a comparison diagram of amino acid sequence homology between human serine-tRNA synthetase 27 and human serine-tRNA synthetase of the present invention.
- the upper sequence is human serine-tRNA synthetase 27, and the lower sequence is human serine-tRNA synthetase.
- Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human serine-tRNA synthetase 27 isolated.
- 27KDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band. The best way to implement the invention
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). 0 The human fragment was inserted into the multicloning site of pBSK (+) vector (Clontech), and transformed into DH5cc to form a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elraer
- the cDNA sequence of 0225d04 is new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the sequence of the human seryl-tRNA synthetase 27 of the present invention and the protein sequence encoded by the same were analyzed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403- 10].
- the gene with the highest homology to the human serine-tRNA synthetase 27 of the present invention is a known human serine-tRNA synthetase, which encodes a protein with accession number X91257 in Genbank.
- the protein homology results are shown in Figure 1. The two are highly homologous, with an identity of 97% and a similarity of 100%.
- Example 3 Cloning of a gene encoding human seryl-tRNA synthetase 27 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGGGAAGTGCATGGTGGAGTGGCG -3 '(SEQ ID NO: 3)
- Primer2 5'- CCTCCCCAGAGATGCTTTATTACA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 mmol / L KC1, 10 mmol / L Tris-CI, (pH 8.5), 1.5 mmol / L MgCl 2 , 200 ⁇ mol / L dNTP, lOpmol primers in a reaction volume of 50 ⁇ 1 1U of Taq DNA polymerase (C 1 on t ech).
- the reaction was performed for 25 cycles on a PE 9600 DNA thermal cycler (Perkin-Elmer) under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- RT-PCR set ⁇ -act in as a positive control and template blank as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen).
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1919bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of human serine-tRNA synthetase 27 gene expression:
- This method involves acid guanidinium thiocyanate-chloroform extraction.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH7.4)-5 x SSC-5 x Denhardt's solution and 200 ⁇ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant human serine-tRNA synthetase 27
- Primer3 5'- CATGCTAGCATGCATAAGCCCCCAGTGCTCCAT -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCCTAGATTGAGAAGCTCAGATTTTC -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the PCR reaction was performed using the pBS-0225d04 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS- 0225d04 plasmid and primers! ⁇ ! ⁇ ! ⁇ And? ! ⁇ ! ⁇ ! ⁇ Points are ⁇ ! ⁇ , Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into E. coli DH5CC using the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration: 30 ⁇ 1), positive clones were selected by colony PCR and sequenced. A positive clone (pET-0225d04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the host bacteria BL21 (pET-0225d04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours.
- the bacteria were collected by centrifugation, and the supernatant was collected by centrifugation.
- the supernatant was collected by centrifugation.
- the purified human protein serine-tRNA synthetase 27 was purified.
- the following peptides specific to human seryl-tRNA synthetase 27 were synthesized using a peptide synthesizer (product of PE company): -Cys-Leu-Cys-Met-Arg-Arg-COOH (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once.
- a 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for ELI SA to determine antibody titers in rabbit serum.
- Protein A-Sepha rose was used to isolate total I gG from antibody-positive rabbit serum.
- the peptide was bound to a cyanogen bromide-activated Sepha ros e4B column, and anti-peptide antibodies were separated from total I gG by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody specifically bound to human seryl-tRNA synthetase 27.
- Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention can be used as hybridization probes in a variety of ways.
- the probes can be used with normal tissues or epilepsy tissues from different origins or cDNA libraries. Hybridize to identify whether it contains the polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence, further use the probe to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues Whether or not the expression in histological cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Sou thern blotting, Nor thern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. W / 75 TO 1 7 I. Selection of probe
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the requirements can be used as primary selection probes, and then further computer sequence analysis is performed, including the primary selection probes and their source sequence domains (ie, SEQ ID NO: 1) and other known genomic sequences and their interactions. For homology comparison of the regions, if the homology with the non-target molecular domain is greater than 85% or there are 15 consecutive bases that are identical, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is homologous or mutual (41Nt) with the gene fragment of SEQ ID NO: 1:
- Probe 2 which belongs to the second type of probe, is equivalent to the gene fragment of SEQ ID NO: 1
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are needed for each probe, so that they can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- X-ray autoradiography -70 ° C
- X-ray autoradiography compression time depends on the radioactivity of the hybrid spot
- Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of large numbers of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. , Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5- Amino- propargy 1-2 '-deoxyuri dine 5'— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 '-deoxyuri dine 5'-tr iphate coupled to Cy5 A fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification.
- Cy3dUTP 5- Amino- propargy 1-2 '-deoxyuri dine 5'— triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of
- Probes from the above two tissues and chips were hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChera) hybridization solution for 16 hours, washed with a washing solution (1 ⁇ SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000.
- the scanner purchased from General Scanning Company, USA
- the scanned image was processed by Imagene software (Biodi scovery Company, USA) for data analysis, and the Cy3 / Cy5 ratio of each point was calculated. It is considered to be a gene whose expression is different.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
- Aminoacyl-tRNA synthetase is an important enzyme system in protein translation.
- Serine-tRNA synthetase belongs to the second class of aminoacyl-tRNA synthetase, which has the function of serine-specific recognition and transport.
- This protein regulates the translation of mRNA into protein in the body, and abnormal expression of this protein will lead to abnormal protein synthesis.
- the polypeptide of the present invention and human serine-tRNA synthetase are homologous proteins and contain characteristic sequences of the human serine-tRNA synthetase family, both of which have similar biological functions. It is involved in serine in the body Heterosexual recognition and transport is of great significance for the correct translation of proteins. Abnormal expression will cause genetic information to be incorrect, produce functionally incorrect or inferior proteins, and cause related diseases.
- the abnormal expression of the human seryl-tRNA synthetase 27 of the present invention will produce various diseases, especially various tumors, embryonic development disorders, growth disorders, inflammation, and immune diseases. These diseases include But not limited to:
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma, embryonic developmental disorders Symptoms: Congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital hearing loss
- Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
- Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
- Immune diseases Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome
- Abnormal expression of the human seryl-tRNA synthetase 27 of the present invention will also produce certain hereditary, hematological diseases and the like.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human seryl-tRNA synthetase 27. Agonists enhance human serine-tRNA synthetase 27 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human serine-tRNA synthetase 27 can be cultured with labeled human serine-tRNA synthetase 27 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human seryl-tRNA synthetase 27 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human serine-tRNA synthetase 27 can bind to human serine-tRNA synthetase 27 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.
- human seryl-tRNA synthetase 27 can be added to the bioanalytical assay to determine the effect of the compound on the interaction between human seryl-tRNA. Synthase 27 and its receptor To determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human serine-tRNA synthetase 27 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human serine-tRNA synthetase 27 molecules should generally be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the human serine-tRNA synthetase 27 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human serine-tRNA synthetase 27 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- a variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on.
- Techniques for preparing monoclonal antibodies to human serine-tRNA synthetase 27 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single-chain antibodies against human seryl-tRNA synthetase 27.
- Antibodies against human seryl-tRNA synthetase 27 can be used in immunohistochemistry to detect human seryl-tRNA synthetase 27 in biopsy specimens.
- Monoclonal antibodies that bind to human seryl-tRNA synthetase 27 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human serine-tRNA synthetase 27 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human silk.
- Aminoacyl-tRNA synthetase 27 positive cells are examples of the amino group of an antibody.
- the antibodies of the present invention can be used to treat or prevent diseases related to human seryl-tRNA synthetase 27.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of human seryl-tRNA synthetase 27.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human seryl-tRNA synthetase 27 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human serine-tRNA synthetase 27 detected in the test can be used to explain the importance of human serine-tRNA synthetase 27 in various diseases and to diagnose human serine-tRNA synthase 27 A working disease.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- the polynucleotide encoding human seryl-tRNA synthetase 27 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human seryl-tRNA synthetase 27.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human seryl-tRNA synthetase 27 to inhibit endogenous human seryl-tRNA synthetase 27 activity.
- a mutated human seryl-tRNA synthetase 27 may be a shortened human seryl-tRNA synthetase 27 that lacks a signaling domain.
- the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human seryl-tRNA synthetase 27.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human seryl-tRNA synthetase 27 into a cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human seryl-tRNA synthetase 27 can be found in the existing literature (Sambrook, et al.).
- the recombinant polynucleotide encoding human seryl-tRNA synthetase 27 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human seryl-tRNA synthetase 27 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated into the vector's RNA Downstream of the polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human serine-tRNA synthetase 27 can be used for diagnosis of diseases related to human serine-tRNA synthetase 27.
- the polynucleotide encoding human seryl-tRNA synthetase 27 can be used to detect the expression of human seryl-tRNA synthetase 27 or the abnormal expression of human seryl-tRNA synthetase 27 in a disease state.
- a DNA sequence encoding human serine-t RNA synthetase 27 can be used to hybridize biopsy specimens to determine the expression of human serine-tRNA synthetase 27.
- Hybridization techniques include Souter hern imprinting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis.
- Human serine-tRNA synthetase 27 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human serine-tRNA synthetase 27 transcripts.
- Detection of mutations in the human serine-t RNA synthetase 27 gene can also be used to diagnose human serine-t RNA synthetase 27-related diseases.
- Human serine-t RNA synthetase 27 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human serine-tRNA synthetase 27 DNA sequence. Mutations can be detected using existing techniques such as Sou thern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- the sequences of the invention are also valuable for chromosome identification.
- the sequence specifically targets a specific position on a human chromosome and can hybridize to it.
- specific sites for each gene on the chromosome need to be identified.
- only a few chromosome markers based on actual sequence data are available for marking chromosome positions.
- an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybrids to construct chromosome-specific W
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human seryl-tRNA synthetase 27 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human seryl-tRNA synthetase 27 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001246312A AU2001246312A1 (en) | 2000-03-02 | 2001-02-26 | A novel polypeptide, arnt synthetase serine 27 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00111834 CN1311301A (zh) | 2000-03-02 | 2000-03-02 | 一种新的多肽——人丝氨酰-tRNA合成酶27和编码这种多肽的多核苷酸 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075009A2 true WO2001075009A2 (fr) | 2001-10-11 |
WO2001075009A3 WO2001075009A3 (fr) | 2002-06-06 |
Family
ID=4581730
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000276 WO2001075009A2 (fr) | 2000-03-02 | 2001-02-26 | Nouveau polypeptide, sérine arnt synthétase 27, et polynucléotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1311301A (zh) |
AU (1) | AU2001246312A1 (zh) |
WO (1) | WO2001075009A2 (zh) |
-
2000
- 2000-03-02 CN CN 00111834 patent/CN1311301A/zh active Pending
-
2001
- 2001-02-26 AU AU2001246312A patent/AU2001246312A1/en not_active Abandoned
- 2001-02-26 WO PCT/CN2001/000276 patent/WO2001075009A2/zh active Application Filing
Non-Patent Citations (4)
Title |
---|
EUR. J. BIOCHEM. vol. 250, no. 1, 1997, pages 77 - 84 * |
J. BACTERIOL. vol. 176, no. 1, 1994, pages 232 - 239 * |
J. BIOL. CHEM. vol. 272, no. 22, 1997, pages 14420 - 14425 * |
MOL. GEN. GENET. vol. 231, no. 1, 1991, pages 106 - 112 * |
Also Published As
Publication number | Publication date |
---|---|
CN1311301A (zh) | 2001-09-05 |
WO2001075009A3 (fr) | 2002-06-06 |
AU2001246312A1 (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001064892A1 (fr) | Nouveau polypeptide, threonyl-arnt synthetase humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001075009A2 (fr) | Nouveau polypeptide, sérine arnt synthétase 27, et polynucléotide codant pour ce polypeptide | |
WO2001048223A1 (fr) | Nouveau polypeptide, ubiquitine-protease 18, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001068688A1 (fr) | Nouveau polypeptide, proteine kinase humaine tak1-27, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001055414A1 (fr) | Nouveau polypeptide, proteine rgs 17, et polynucleotide codant pour ce polypeptide | |
WO2001040487A1 (fr) | NOUVEAU POLYPEPTIDE, SYNTHASE HUMAINE 9 DE TYPE II A BASE AMINEE D'ARNt, ET POLYNUCLEOTIDE CODANT POUR CE POLYPEPTIDE | |
WO2001079423A2 (en) | A novel polypeptide, human bcr protein 10 and the polynucleotide encoding said polypeptide | |
WO2001070965A1 (fr) | Nouveau polypeptide, facteur humain de regulation de la transcription 15, et polynucleotide codant pour ce polypeptide | |
WO2001068878A1 (fr) | Nouveau polypeptide, proteine de transport c 28 a orientation de membrane fixe, et polynucleotide codant pour ce polypeptide | |
WO2001055419A1 (fr) | Nouveau polypeptide, site de liaison 27 d'arn s1, et polynucleotide codant pour ce polypeptide | |
WO2001081392A1 (fr) | Nouveau polypeptide, phosphoproteine nucleolaire humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001081537A2 (fr) | Nouveau polypeptide, sous-unite 49 humaine du facteur c(a1) 37kd de replication de l'adn, et polynucleotide codant pour ce polypeptide | |
WO2001073061A1 (fr) | Nouveau polypeptide, proteine humaine 22 du retinoblastome, et polynucleotide codant pour ce polypeptide | |
WO2001081592A1 (fr) | Nouveau polypeptide, proteine humaine 11 contenant un fragment de sequence particulier d'une signal peptidase i, et polynucleotide codant pour ce polypeptide | |
WO2001066577A1 (en) | A novel polypeptide - homo signal transduction protein kinase 17 and polynucleotide encoding said polypeptide | |
WO2001066581A1 (fr) | Nouveau polypeptide, proteine ribosomale humaine s4-19, et polynucleotide codant pour ce polypeptide | |
WO2001075017A2 (en) | Novel polypeptide, a human carbamylaspartic dehydrase 17 and the polynucleotide encoding it | |
WO2001064868A1 (fr) | Nouveau polypeptide, recepteur humain de cytokine 12, et polynucleotide codant pour ce polypeptide | |
WO2001074892A1 (fr) | Nouveau polypeptide, proteine antigene prostatique specifique membranaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001075079A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 13, et polynucleotide codant pour ce polypeptide | |
WO2001064917A1 (fr) | Nouveau polypeptide, proteine kinase humaine de transduction de signal 11, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
AK | Designated states |
Kind code of ref document: A3 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A3 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |