WO2001073085A1 - Expressionsvektoren zur anreicherung eines rekombinant hergestellten proteins in unterschiedlichen zellkompartimenten - Google Patents

Expressionsvektoren zur anreicherung eines rekombinant hergestellten proteins in unterschiedlichen zellkompartimenten Download PDF

Info

Publication number
WO2001073085A1
WO2001073085A1 PCT/DE2001/000133 DE0100133W WO0173085A1 WO 2001073085 A1 WO2001073085 A1 WO 2001073085A1 DE 0100133 W DE0100133 W DE 0100133W WO 0173085 A1 WO0173085 A1 WO 0173085A1
Authority
WO
WIPO (PCT)
Prior art keywords
host
desired protein
expression
composition
gene
Prior art date
Application number
PCT/DE2001/000133
Other languages
English (en)
French (fr)
Inventor
Klaus Düring
Original Assignee
Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology filed Critical Mpb Cologne Gmbh Molecular Plant & Protein Biotechnology
Priority to AU2001237217A priority Critical patent/AU2001237217A1/en
Publication of WO2001073085A1 publication Critical patent/WO2001073085A1/de

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
    • C12N15/8258—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon for the production of oral vaccines (antigens) or immunoglobulins

Definitions

  • the present invention relates to an expression vector (A) which is characterized in that it contains at least two copies of a gene coding for a desired protein each functionally linked to a promoter, or a composition (B) which comprises at least two expression vectors, each contain at least one copy of a gene coding for a desired protein functionally linked to a promoter, the individual gene copies being characterized in that (a) they code for the desired protein (I) as a fusion protein with a desired localization signal (II); where (b) in the individual gene copies, the portion coding for (I) is essentially identical, but the portion coding for (II) is different, the desired protein being introduced into a host after the expression vector (A) or the composition (B) has been introduced into a host is transported into different compartments of the host.
  • A which is characterized in that it contains at least two copies of a gene coding for a desired protein each functionally linked to a promoter
  • a composition (B) which comprises at least two expression vectors, each contain
  • the present invention also relates to a composition (C) which comprises at least one expression vector located in plastids and one in mitochondria, each of which contains at least one copy of a gene coding for a desired protein functionally linked to a promoter, the individual expression vectors being characterized in that are that the individual gene copies are essentially identical and the desired protein is expressed in plastids and mitochondria of the host.
  • the present invention also relates to the combination of the above embodiments.
  • the expression vectors / compositions according to the invention are used in a method which allows the production rate for recombinant proteins to be increased.
  • the transport apparatus or the storage capacity of the plant cell may be overloaded. This has the consequence that their maximum possible foreign protein biosynthesis capacity due to the limited performance of the transcription and translation apparatus is not fully exploited.
  • the kemgenome and its transcription and translation apparatus there are two further genomes in plant cells with (at least partially) independent transcription and translation apparatuses, namely those of the plastids and mitochondria.
  • the foreign gene is only integrated into one of these genomes, only part of the maximum possible foreign protein biosynthesis capacity of the cellular metabolism is used.
  • only the storage potential of a subcellular compartment is used by an expression construct with only one defined targeting signal.
  • the invention is therefore essentially based on the technical problem of providing means for increasing the yield of foreign proteins produced recombinantly in eukaryotes.
  • the present invention relates to a method which minimizes the limitations in the prior art in the efficiency of foreign protein biosynthesis in eukaryotes, in particular in plant cells.
  • the present invention offers the possibility of achieving substantial increases in the expression rates of foreign proteins.
  • the protein to be produced is not directed into a single subcellular compartment and only the storage potential of this one compartment is used; in one embodiment, two or more homologous genes for the expression of a defined protein are introduced into the host cell, whereby the proteins coded thereby differ in that they target signals (localization signals) for contain different subcellular compartments.
  • a diagnostic scFv antibody can be localized by fusion with a signal peptide in the apoplasts, but at the same time also by fusion with another signal peptide and with the KDEL targeting signal in the ER.
  • the storage potentials of the ER and the apoplast are used simultaneously.
  • genes can be introduced which code for scFv antibodies located in vacuolar or in the Golgi apparatus.
  • the storage potentials of four subcellular compartments can be combined with one another.
  • the foreign proteins are not produced by nuclear expression and transport in organelles, ie plastids or mitochondria, but the corresponding genes are introduced into these organelles by direct transformation of plastids or mitochondria by means of suitable vectors and the gene coding for the protein in question expressed directly in these compartments.
  • the storage potential of certain compartments for example plastids or mitochondria, is used more efficiently by carrying out both an organelle and a nuclear transformation with the corresponding genes, i.e. the direct one Protein synthesis in organelles is combined with the nuclear protein synthesis and subsequent transport of the protein into the organelles, ie plastids and mitochondria, by means of suitable signal sequences.
  • the individual storage capacities of typical storage compartments such as the plastids, the endoplasmic reticulum or storage vacuoles, can thus be combined and used synergistically.
  • one embodiment of the present invention relates to an expression vector (A) which is characterized in that it contains at least two copies of a gene coding for a desired protein each functionally linked to a promoter, or to a composition (B) which comprises at least two expression vectors which each contain at least one copy of a gene coding for a desired protein functionally linked to a promoter, the individual gene copies being characterized in that that they (a) code for the desired protein (I) as a fusion protein with a desired localization signal (II), where (b) in the individual gene copies the portion coding for (I) is essentially identical, but the (II) coding portion is different is, after the expression vector (A) or the composition (B) has been introduced into a host, the desired protein is transported into different compartments of the host.
  • A which is characterized in that it contains at least two copies of a gene coding for a desired protein each functionally linked to a promoter
  • a composition (B) which comprises at least two expression vectors which each contain at
  • An alternative embodiment of the present invention relates to a composition (C) which comprises at least one expression vector located in plastids and one in mitochondria, each of which contains at least one copy of a gene coding for a desired protein functionally linked to a promoter, the individual expression vectors are further characterized in that the individual gene copies are essentially identical and the desired protein is expressed in the mitochondria and plastids of the host.
  • the two above embodiments are combined, i.e. both an organelle and a nuclear transformation are carried out with the genes coding for the desired protein, i.e. the direct protein synthesis in organelles, i.e. in plastids and mitochondria, combined with the nuclear protein synthesis and subsequent transport of the protein into the organelles through the use of expression vectors in which the desired protein is linked to suitable signal sequences.
  • Vectors or vector sequences which express the expression of the desired protein in organelles, i.e. in plastids or mitochondria are known to the person skilled in the art. For example, Svab et al., Proc. Natl. Acad. Be. USA 87: 8526-8530 (1990); Khan and Maliga, Nature Biotechnology 1 (1999), 910-915; Sidorov et al., Plant Journal 19 (1999), 209-216.
  • the expression "essentially identical" used here with respect to the individual gene copies means that the proteins encoded by them have at least the same biological activity.
  • the individual gene copies can contain, for example, modifications necessary for the expression of the gene, for example depending on the Expression in certain organelles are beneficial; see. also the section below on “gene silencing".
  • the expression vectors according to the invention can be based on a plasmid, cosmid, virus, bacteriophage or another vector customary in genetic engineering. These vectors can have further functional units which bring about a stabilization of the vector in the host organism.
  • a termination sequence can be present which serves to correctly terminate the transcription and to add a poly-A sequence to the transcript.
  • Such elements are described in the literature (cf. Gielen et al., EMBO J. 8 (1989), 23-29) and can be exchanged as desired.
  • the signal sequence to be fused with the desired protein depends on the cell compartment into which the protein is to be transported. Suitable signal sequences (signal peptides) and DNA sequences coding for them and methods for linking to the desired protein, for example an scFv antibody, in such a way that the protein is still active and the transport into the desired cell compartment takes place known to the expert.
  • the signal peptide of the barley ⁇ -amylase with regard to the apoplast (Düring et al., Plant Journal 3 (1993), 587-598), the combination of mouse signal peptide and KDEL-ER retention signal with respect to the ER (Artsaenko et al., supra), on the targeting of a mammalian ⁇ -2,6-sialyltransferase with respect to the Golgi apparatus (Wee et al., Plant Cell IV (1998), 1759-1768) on the vacuole localization signal of a vacuolar chitinase cucumber for vacuoles (Neuhaus et al., Proc. Natl. Acad. Sci.
  • Promoters known for the expression of the gene coding for the desired protein are known to the person skilled in the art and these include, for example when using a plant as the host organism, the Cauliflower Mosaic Virus 35S promoter (Odell et al., Nature 313 (1995), 810-812) Agrobacterium tumefaciens nopaline synthase promoter and the mannopine synthase promoter (Harpster et al., Molecular and General Genetics 212 (1988), 182-190).
  • the gene encoding the desired protein can also be linked to an inducible promoter, e.g. controlling the synthesis of the desired protein e.g.
  • Suitable promoters are known to the person skilled in the art and include, for example, the anaerobically inducible gap C4 promoter from maize (Bülow et al., Molecular Plant-Microbe Interactions 12 (1999), 182-188), PR promoters such as L-phenylalanine ammonium lyase. , Chalcon synthase and "hydroxyproline rieh glycoprotein” promoters inducible by ethylene (Ecker and Davies, Proc. Natl. Acad. Sci.
  • a large number of cloning vectors which contain a replication signal for E. coli and a marker gene for the selection of transformed bacterial cells are available for producing the expression vectors for introduction into host organisms, for example plants.
  • examples of such vectors are pBR322, pUC series, M13mp series, pACYC184, etc.
  • the desired sequence can be introduced into the vector at a suitable restriction site.
  • the vector obtained is used for the transformation of E. coli cells.
  • Transformed E. coli cells are grown in a suitable medium, then harvested and lysed. The vector is then recovered.
  • the vector DNA obtained is generally used for restriction analyzes, gel electrophoresis and other biochemical-molecular biological methods. After each manipulation, the vector DNA can be cleaved and DNA fragments obtained can be linked to other DNA sequences.
  • Each vector DNA sequence can be cloned in the same or different vectors.
  • a variety of techniques are available for introducing the above expression vectors into a plant cell. These techniques include the transformation of plant lines with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as a transformation agent, the fusion of protoplasts, the injection, the electroporation of DNA, the introduction of DNA using the biolistic method and other possibilities.
  • Simple plasmids e.g. pUC derivatives can be used.
  • a selectable marker e.g. Suitable selectable markers are known to the person skilled in the art and include, for example, the neomycin phosphotransferase II gene from E. coli (Beck et al., Gene 19 (1982), 327-336), the sulfonamide resistance gene (EP-369637) and the hygromycin gene. Resistance gene (EP-186425).
  • additional DNA sequences may be required. E.g. If the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right boundary, but often the right and left boundary of the Ti and Ri plasmid T-DNA must be connected as a flank region with the genes to be introduced.
  • the DNA to be introduced must be cloned into special vectors, either in an intermediate vector or in a binary vector (cf. also Examples 1 to 3 below).
  • the intermediate vectors can be integrated into the Ti or Ri plasmid of the agrobacteria by means of sequences which are homologous to sequences in the T-DNA by homologous recombination. This also contains the for Transfer of the T-DNA necessary vir region. Intermediate vectors cannot replicate in agrobacteria.
  • the intermediate vector can be transferred to Agrobacterium tumefaciens using a helper plasmid.
  • Binary vectors can replicate in both E. coli and agrobacteria.
  • the agrobacterium serving as the host cell should contain a plasmid which carries a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present.
  • the agrobacterium transformed in this way is used to transform plant cells.
  • plant exhibits can advantageously be cocultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes.
  • Whole plants can then be regenerated from the infected plant material (e.g. leaf pieces, stem segments, roots, but also protoplasts or suspension-cultivated plant cells) in a suitable medium, which may contain antibiotics or biocides for the selection of transformed cells.
  • the plants thus obtained can then be examined for the presence of the introduced DNA.
  • the expression vectors according to the invention or the compositions (combinations) comprising them contain localization signals for localization in the endoplasmic reticulum (ER), in the apoplast, in the Golgi apparatus, in plastids, in peroxisomes, in mitochondria and / or in vacuoles.
  • ER endoplasmic reticulum
  • Golgi apparatus in plastids, in peroxisomes, in mitochondria and / or in vacuoles.
  • signal sequences signal sequences (signal peptides).
  • Particularly preferred as localization signals are the KDEL-ER targeting peptide, the Golgi localization signal of the ⁇ -1,2-acetylglucosamine transferase (GnTI), the small subunit of the ribulose-biphosphate carboxylase and / or the vacuolar targeting signal SKNPIN ,
  • the eukaryotes useful in the method according to the invention are preferably plants. In principle, these can be plants of any plant species, ie both monocot and dicot plants.
  • plant used here also includes fungi, mosses and algae. Preference is given to useful plants, for example plants such as wheat, barley, rice, corn, sugar beet, sugar cane, brassicaceae, legumes, tobacco or potatoes. Brassicaceae are particularly preferred as transgenic plants, Legumes and potato.
  • the parts of the plants desired for the expression of the desired protein basically concern any part of the plant, in any case propagation material and harvest products of these plants, for example fruits, seeds, tubers, rhizomes, seedlings, cuttings etc.
  • the present invention also relates to plant seeds, a plant cell or a plant which contains an expression vector according to the invention or a composition according to the invention.
  • the present invention relates to a method for increasing the production rate of a desired protein in a host, preferably a plant, which is characterized in that for the simultaneous expression of the gene coding for the desired protein in different compartments of the host and / or for the simultaneous transport of the desired protein is transformed into different compartments of the host of the host with the expression vector according to the invention and / or the composition according to the invention and the desired protein is obtained from the host.
  • a host preferably a plant
  • Suitable methods for obtaining the protein and the most suitable plant parts depending on the location of the protein are known to the person skilled in the art and e.g. also described in Examples 1 to 3 below.
  • the present invention is characterized in that a high expression rate of a desired protein can be achieved in a host, in particular a plant, without causing physiological disturbances in the cell household and thus in the growth and viability of the host.
  • a high expression rate of a desired protein can be achieved in a host, in particular a plant, without causing physiological disturbances in the cell household and thus in the growth and viability of the host.
  • This is achieved by using the above expression vectors or compositions (combinations), but above all also by combining the present invention with regard to the multiple subcellular localization of the desired protein, for example with the post-Emte production technology (cf. example 3 below ), in which the gene coding for the desired protein is only expressed after the plant or certain parts of the plant have been harvested.
  • the induction of expression for example the induction of the promoter to be activated, takes place via chemical stimuli (e.g.
  • transgenic host organism eg by inserting transcription-inhibiting sequences between the promoter and the gene to be expressed, which can be removed or deactivated in an externally controllable manner.
  • This approach is of particular interest with regard to transgenic plants, which represent an excellently suitable bioreactor system, especially since the large-scale cultivation of crop plants and the large-scale processing of large amounts of plants, for example for oil and starch extraction, have been established.
  • a preferred embodiment of the method according to the invention is characterized in that the gene coding for the desired protein is not expressed until after the host has been harvested, the gene coding for the desired protein being inserted on the expression vectors in such a way that its expression only in the presence an inducing connection (inductor) and the contacting with the inductor takes place after the harvest of the host.
  • inducing connection inducer
  • the inductor can take place, for example, by changing the gas phase surrounding the host organism, atomizing a solution of an inductor or actively overflowing with a volatile inductor.
  • the change in the gas phase can be, for example, an oxygen withdrawal, in which case a promoter active under anaerobic conditions is used for the expression, for example the GapC4 promoter from maize (Bülow et al., Supra).
  • Induction of expression for the desired protein coding gene can also be done by removing the functional inhibition of transcription and / or translation, for example by inserting a nucleic acid in the expression vectors according to the invention between the promoter and the gene, which is characterized in that it is the transcription and / or translation of the Gene can be prevented and excised after induction, which leads to expression of the gene.
  • This nucleic acid can be, for example, a nucleic acid excisable by an inducible recombinase.
  • the excisable nucleic acid and the recombinase can be components of the recombinase LBD system (WO 95/00555).
  • Example 1 Production of scFv (ox) antibodies in the ER, in the apoplast, in the Golgi apparatus and in plastids from transgenic potato tubers
  • the scFv-coding DNA fragment is inserted into this expression vector.
  • the plasmid pRT 100 / scFv (ox) ER is obtained.
  • the 35S-scfv (ox) ER expression cassette is isolated.
  • the cDNA for the scFv (ox) antibody without the coding sequence for the KDEL-ER targeting signal (Artsaenko et al., (Supra) using a linker ligation (at the 5 'end with CATGCCATGGCATG [5'-phosphorylated oligonucleotide]; modified at the 3'-end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) such that it has an Ncol restriction site at the 5'-end and an Xbal restriction site at the 3'-end having.
  • a linker ligation at the 5 'end with CATGCCATGGCATG [5'-phosphorylated oligonucleotide]; modified at the 3'-end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]
  • the scFv-coding DNA fragment is inserted into this expression vector.
  • the plasmid pRT 100 / scFv (ox) AP is obtained.
  • the 35S-scFv (ox) AP expression cassette is isolated.
  • the signal peptide in plasmid pRT 100 / scFv (ox) AP is determined by the Golgi localization signal of the ⁇ -1,2-N-acetylglucosaminyltransferase (GnTI) from rabbits (Burke et el., J.Biol. Chem. 267 (1992), 24433-24440).
  • GnTI ⁇ -1,2-N-acetylglucosaminyltransferase
  • the DNA sequence coding therefor is modified by means of a PCR reaction such that it has an Ncol interface at the 5 'end and the GTCGAC sequence at the 3' end, for which a SalI interface codes.
  • the following primer pair is used for the PCR reaction:
  • 5'-GnTI primer CCATGGATGCTGAAGAAGCAGTCTGCTGG 3'-GnTI primer: GTCGACACGTGTCCAGAAGAAGAGGAGGAG
  • the cDNA for the mature scFv (ox) antibody is modified in this way by means of a linker ligation (at the 5 'end with CCGTCGACAT [5'-phosphorylated oligonucleotide] and at the 3' end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) that it has a Sall site at the 5 'end and an Xbal restriction site at the 3' end. Both cDNA fragments are digested with Ncol + Sall or Sall + Xbal, so that overhanging ends arise. The cDNA fragments obtained are inserted simultaneously into the pRT 100 vector opened with Ncol and Xbal. The plasmid pRT 100 / scFv (ox) GO is obtained. After cleavage with HindIII, the expression cassette 35S-scFv (ox) GO is isolated.
  • a cDNA fragment coding for a transit peptide scFv (ox) is generated for the transport of the cytopiasmatic synthesized scFv (ox) antibody in chloroplasts.
  • the cDNA for the transit peptide from the gene coding for the small subunit of ribulose bisphosphate carboxylase (Anderson et al., Biochemical Journal 240 (1986), 709-715) is modified by means of a PCR reaction in such a way that on 5 ' -End an Ncol interface and at the 3 'end the GTCGAC sequence, which codes for a Sall interface, are inserted.
  • 5'-rbcT primer CCATGGCTTCTATGATATCCTCTTCAG 3'-rbcT primer: GTCGACGCACTTTACTCTTCCACCATTGC
  • the cDNA for the mature scFv (ox) antibody is modified in this way by means of a linker ligation at the 5'-end with CCGTCGACAT [5'-phosphorylated oligonucleotide] and at the 3'-end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]), that it has a Sall interface at the 5 'end and an Xbal restriction interface at the 3' end. Both cDNA fragments are digested with Ncol + Sall or Sall + Xbal, so that overhanging ends arise. The cDNA fragments obtained are inserted simultaneously into the pRT 100 vector opened with Ncol and Xbal. The plasmid pRT 100 / scFv (ox) CH is obtained. After cleavage with HindIII, the 35S-scFv (ox) CH expression cassette is isolated.
  • the binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-589; Porsch et al., Plant Molecular Biology 37 (1998), 581-585) is opened with HindIII. All four expression cassettes described above (35S-scFv (ox) ER, 35S-scFv (ox) AP, 35S-scFv (ox) GO "and 35S-scFv (ox) CH) are ligated simultaneously into the HindIII site of the binary vector Positive clones containing all four fragments are clearly identified by DNA sequencing and the binary vector pSR 8-30 / scFv (ox) EAGC is obtained.
  • the expression vector pSR 8-30 / scFv (ox) EAGC is used to transform E.coli SM10. Transformants are mixed with Agrobacterium GV 3101 and incubated overnight at 28 ° C (Koncz and Scheli, Molecular and General Genetics 204 (1986), 383-396; Koncz et al., Proc.Natl.Acad.Sci.USA 84 (1987 ), 131-135). Selection is carried out for carbenicillin, the bla gene required for this being present in the above expression vectors. Selection clones of Agrobacterium tumefaciens are cut on leaves of the potato plant cv that have been cut off and scratched several times on the midrib. Desiree applied and the leaves are incubated for 2 days at 20 ° C in the dark. Then the agrobacteria are washed off and plant growth substances are added to the potato leaves, so that preferably shoots lo
  • the detection of the expressed scFv antibody in transgenic leaf and tuber material is carried out by antibodies that bind to scFv or protein L in a Western blot or ELISA.
  • the total protein of the potato material is isolated and used in the corresponding detection methods.
  • chloroplast DNA (cp-DNA) is isolated from 8-week-old tobacco plants, grown in a greenhouse, according to the method of Koladner and Tewarl (Biochim. Biophys. Acta 404 (1975), 372-390).
  • the isolated chloroplast DNA is digested with BglII and the resulting BglII fragments are "shot gun" cloned into the vector pBluescriptKS (Stratagene) opened with BarnHI.
  • a clone is identified via colony hybridization which contains the BglII fragment with the ndhF, rpl32 and trnL genes (Shinozaki et al., EMBO J. 5 (1986), 2043-2049; 4,656 bp fragment, Nucieotide No. .111515-116171).
  • the plasmid pBKSnrt is obtained.
  • the gene for the scFv (ox) antibody from Artsaenka et al. Is inserted into the HinclI site of the 4,656 bp BglII fragment in the plasmid pBKSnrt. (supra) under the control of the psbA promoter and the psbA termination signal (Shinozaki et al., supra) cloned from tobacco.
  • the cDNA for the mature scFv (ox) antibody is modified in this way by means of a linker ligation at the 5'-end with CGCGAATTC [5'-phosphorylated oligonucleotide] and at the 3'-end with GACTAAGCTT [5'-phosphorylated oligonucleotide], that it has an EcoRI site at the 5 'end and a HindIII restriction cut at the 3' end. After digestion with EcoRI and HindIII, this cDNA fragment is cloned into the plasmid pBluescriptSK (Stratagene). The plasmid pBSK / scFv (ox) is obtained.
  • the 5 'region of the psbA gene (plastid-specific promoter) is amplified from chloroplast DNA from tobacco by a PCR reaction. The following phosphorylated primer pair is used for this:
  • psbA2 primer GGTAAAATCTTGGTTTATTTAATCATC
  • the PCR product is cloned "blunt end" into the Smal section of the vector pBSK / scFv (ox).
  • the plasmid pBSK / psbA-scFv (ox) is obtained.
  • the 3 'region of the psbA gene (termination signal) is also amplified via a PCR reaction. The following phosphorylated primer pair is used for this:
  • psbA4 primer CCTGGCCTAGTCTATAGGAG
  • the PCR product is inserted "blunt end" into the cut and filled Sall interface of the vector pBSK / psbA-scFv (ox).
  • the plasmid pBSK / psbA-scFv (ox) -PgbA is obtained.
  • the expression cassette is cut out of this plasmid by digestion with BamHI and Kpnl, filled in and cloned "blunt end 'into the Hincll site of the vector pBSKnrt.
  • the plasmid pBSKnnVscFv (ox) is obtained.
  • Plasmid pBSKnnVscFv (ox) is also cloned as a selection marker for the nptII gene under the control of the psbA promoter and the psbA termination signal from tobacco.
  • the nptll gene is isolated from the vector pCR2.1 (Invitrogen) using PCR amplification. The following pair of primers is used:
  • Kan1 primer CCGAATTCCAAGAGACAGGATGAGGATC
  • Kan2 primer CGCGAAGCTTCAATTCAGAAGAACTCAAG
  • the PCR product is cloned into the plasmid pBlueschptSK (Stratagene) via EcoRI and HindIII digestion.
  • the plasmid pBSK / NPT is obtained.
  • the 5 'region of the psbA gene is blunt end cloned into the Smal site of the vector pBSK / NPT.
  • the plasmid pF3SK / psbA-NPT is obtained.
  • the 3' region of the pshA Gene (termination signal) is also inserted (as described above) "blunt end" into the cut and filled Sall interface of the vector pBSK / psbA-NBT, the plasmid pBSK / psbA-NPT-psb being obtained.
  • the expression cassette is cut out of this plasmid with BamHI and Kpnl, filled in and blunt end cloned into the SnaBI site of the vector pBKSnrt / scFv (ox), whereby the plasmid pBKSnrt / scFv (ox) -NPT is obtained.
  • the transgenic potato line described above which contains the gene for the plastid expression of the scFv (ox) antibody in the plastids, is furthermore with the two expression cassettes 35S-scFv (ox) ER from Example 1 and a further one Expression cassette 35S-scFv (ox) VA transformed for the vacuolar localization of the produced scFv (ox) antibody.
  • the plasmid pSR9-12 For the cloning of the expression cassette 35S-scFv (ox) VA, the plasmid pSR9-12, a derivative of the plasmid pRT 100, which contains the coding sequence for a mouse IgG signal peptide downstream of the CaMV 35S promoter, is opened with Sall and Xbal.
  • the cDNA for the mature scFv (ox) antibody is modified in this way by means of a linker ligation (at the 5 'end with CCGTCGACTCTAAGAACCCAATTAAC [5'-phosphorylated oligonucleotide) and at the 3' end with GCTCTAGAGC [5'-phosphorylated oligonucleotide]) that it has a Sall site at the 5 'end and an Xbal restriction site at the 3' end.
  • the DNA sequence coding for the vacuolar targeting signal SKNPIN from the 20 kDa protein from the potato tuber (PT20; Kolde, Plant Cell Physiol. 40 (1999), 1152-1159) is integrated.
  • This cDNA fragment is digested with Sall and Xbal so that overhanging ends arise and inserted into the opened vector.
  • the plasmid pSR9-12 / scFv (ox) VA is obtained.
  • the expression cassette 35S-scFv (ox) VA is isolated.
  • the two expression cassettes 35S-scFv (ox) ER and 35S-scFv (ox) VA are simultaneously used as Hindlll fragments in the binary vector pSR 8 -30 hyg opened with Hindlll, a derivative of the vector rs p SR 8 -30 , which instead of the neomycin phosphotransferare Il gene contains the hygromycin phosphotransferare gene. Positive clones that contain both fragments are uniquely identified by DNA sequencing.
  • the binary vector pSR 8-30hyg / scFv (ox) EV is obtained.
  • the potato transformation is carried out as described in Example 1 above, the selection being carried out with 5 mg / l hygromycin.
  • Example 3 Post-harvest production of scFv (ox) antibodies by anaerobic expression in the ER and in the Golgi apparatus
  • the anaerobically inducible GapC4 promoter from maize (DE 195 47 272) is modified by means of a PCR reaction in such a way that it receives a HinclI restriction site at the 5 'end and an Ncol restriction site at the 3' end.
  • the following primer pair is used for the PCR reaction:
  • Hincll-pGapC4 Primer CATGTCAACACATAAGGAAGAAGAGGTAGAAAG pGapC4-Ncol Primer:
  • the artsaenko et al. (supra) described cDNA, which codes for the scFv (ox) antibody located in the endoplasmic reticulum (ER), is by means of a linker ligation at the 5'-end with CATGCCATGGCATG [5'-phosphorylated oligonucleotide] and at the 3'-end modified with GCTCTAGAGC [5'-phosphorylated oligonucleotide] such that it has an Ncol restriction site at the 5 'end and an Xbal restriction site at the 3' end.
  • the CaMV 35S promoter is removed from the plasmid pRT 100 by restriction digestion with HinclI and Xbal.
  • the two nucleic acid fragments described above which code for the GapC4 promoter and the scFv (ox) antibody, are inserted.
  • the plasmid pRT 100GAP / scFv (ox) ER is obtained. After partial cleavage with HindIII, the expression cassette GAP-scFv (ox) ER is isolated.
  • the plasmid pRT 100 / scFv (ox) GO from Example 1 is digested with Hincll and Ncol. This will remove the CaMV-35S promoter. Instead, the PCR-modified pGapC4 promoter fragment described above is inserted. The plasmid pRT 100GAP / scFv (ox) GO is obtained. After cleavage with HindIII, the expression cassette GAP-scFv (ox) GO is isolated.
  • the binary vector pSR 8-30 is opened with Hindlll. Both expression cassettes described above (GAP-scFv (ox) ER and GAP-scFv (ox) GO) are simultaneously ligated into the Hindlll interface of the binary vector. Positive clones that contain both fragments are uniquely identified by DNA sequencing.
  • the binary vector PSR 8-30GAP / scFv (ox) EG is obtained.
  • the expression vector pSR 8-30GAP / scFv (ox) EG is used for the transformation of potatoes as described in Example 1 above.
  • cut leaf material or intact (or cut) tuber material is used using the "Anaeroculf system (from Merck, Darmstadt, Germany) as in Bülow et al. Molecular Plant-Microbe Interactions 12 (1999), 192-198
  • the leaf material is removed and mortar taken after 40 hours
  • the detection of the expressed scFv antibody is again provided by antibodies which bind to the scFv antibody or protein L in a Western blot or ELISA of the potato material isolated and used in the corresponding detection methods.
  • Transgenic potato plants that are determined to be expression-positive are grown in the greenhouse (in a pot or in a straw bed) or in the open under normal horticultural or agricultural conditions.
  • the tubers are harvested and stored after normal handling.
  • the tubers are placed in a reaction vessel made of steel (or plastic), which has a gas supply valve at the bottom and a gas discharge valve at the top.
  • the room air in the container is quickly displaced by adding technical nitrogen (or carbon dioxide), for example.
  • a constant composition of the gas phase in the reaction vessel is set with a slow air flow (1 m 3 gas supply per hour per m 2 base area).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Beschrieben wird ein Expressionsvektor (A), der dadurch gekennzeichnet ist, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder eine Zusammensetzung (B), die mindestens zwei Expressionsvektoren umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie (a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalinerungssignal (II) kodieren; wobei (b) bei den einzelnen Genkopien der für (I) kodierende Anteil im wesentlichen identisch, der für (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirst transportiert wird. Die vorliegende Erfindung betrifft auch eine Zusammensetzung (C), die mindestens einen in Plastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in den Plastiden und Mitochondrien des Wirts exprimiert wird. Die erfindungsgemäßen Expressionsvektoren/Zusammensetzungen finden Verwendung in einem Verfahren, das die Steigerung der Produktionsrate für rekombinante Proteine erlaubt.

Description

Expressionsvektoren zur Anreicherung eines rekombinant hergestellten Proteins in unterschiedlichen Zellkompartimenten
Die vorliegende Erfindung betrifft einen Expressionsvektor (A), der dadurch gekennzeichnet ist, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktioneil verknüpft enthält, oder eine Zusammensetzung (B), die mindestens zwei Expressionsvektoren umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie (a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren; wobei (b) bei den einzelnen Genkopien der für (I) kodierende Anteil im wesentlichen identisch, der für (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird. Die vorliegende Erfindung betrifft auch eine Zusammensetzung (C), die mindestens einen in Piastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in Piastiden und Mitochondrien des Wirts exprimiert wird. Die vorliegende Erfindung betrifft auch die Kombination der vorstehenden Ausführungsformen. Die erfindungsgemäßen Expressionsvektoren/ Zusammensetzungen finden Verwendung in einem Verfahren, das die Steigerung der Produktionsrate für rekombinante Proteine erlaubt.
Inzwischen werden die meisten Proteine von kommerziellem Interesse in pro- oder eukaryotischen Wirtsorganismen rekombinant hergestellt. Während die Expressionsraten in prokaryotischen Organismen, insbesondere in Bakterien, oft sehr hoch sind (bis zu 50% des Gesamtproteins), werden in eukaryotischen Zellen oft nur geringe Expressionsraten erzielt (deutlich unter 1% bis höchstens zu wenigen Prozenten im Vergleich zu dem löslichen Gesamtprotein). Somit ist die Expression eines gewünschten Proteins in Bakterien in vielen Fällen bevorzugt. Allerdings tritt hier oft das Problem der Bildung von "inclusion bodies" (Einschlußkörpern) auf, in denen das überproduzierte Protein in denaturierter Form vorliegt. Die natürlichen Biosynthese-Apparate von Pflanzenzellen sind in der Lage, auch solche, z.T. komplexe, Proteine zu synthetisieren, die der Expression in prokaryotischen Zellen nicht zugänglich sind. Allerdings sind die Expressionsraten in Pflanzenzellen oft sehr gering und in verschiedenen Kompartimenten dieser Zellen auch unterschiedlich. Dies wird z.B. bei rekombinanten scFv-Antikörpem in transgenen Pflanzen hinsichtlich der Kompartimente Cytoplasma, Apoplast und endoplasmatisches Retikulum (ER) untersucht (Conrad und Fiedler, Plant Molecular Biology 38 (1998), 101-109). Es zeigte sich, daß eine cytoplasmatische Expression von scFv-Antikörpem kaum realisierbar war, nur in Einzelfällen konnten überhaupt Expressionsraten nachgewiesen werden, wobei diese allerdings extrem gering waren. Die subzelluläre Lokalisation im endoplasmatischen Retikulum (ER) führte dagegen sowohl in Samen von Tabak oder Arabidopsis (Conrad und Fiedler, supra) als auch in Kartoffelknollen (Artsaenko et al., Molecular Breeding 4 (1998), 313-319) zu einer effizienteren Produktion des Fremdproteins. Apoplastische Expression konnte ebenfalls nachgewiesen werden, wenn auch nur mit etwa einem Zehntel der Menge im Vergleich zur Lokalisation im ER.
Andererseits ist bekannt, daß in der Natur bestimmte Proteine in mehrere subzelluläre Kompartimente einer Zelle gleichzeitig sortiert werden. So wird z.B. in Erbsen die Glutathion-Reduktase aufgrund des Vorhandenseins einer einzigen Prosequenz sowohl in Chloroplasten als auch in Mitochondrien transportiert (Creissen et al., Plant Journal 8 (1995), 167-175). Bezüglich der rekombinanten Produktion von Proteinen, beispielsweise in Pflanzenzellen, ist allerdings zu betonen, daß ein bestimmtes Kompartiment einer Pflanzenzelle aus biologischen und physikalischen Gründen nur eine begrenzte Speicherfähigkeit für ein zu produzierendes Protein aufweist, da der notwendige physikalische Speicherplatz mit anderen Proteinen geteilt werden muß. Außerdem sind teilweise bei Proteinfaltung und -transport Chaperone und Rezeptoren beteiligt. Bei hohen Expressionsraten kann demzufolge eine Überlastung des Transportapparates oder der Speicherkapazität der Pflanzenzelie eintreten. Dies hat zur Folge, daß deren maximal mögliche Fremdproteinbiosynthese-Kapazität aufgrund der eingeschränkten Leistungsfähigkeit des Transkriptions- und Translationsapparates nicht vollständig ausgenutzt wird. Schließlich gibt es in Pflanzenzellen neben dem Kemgenom und dessen Transkriptions- und Translationsapparat zwei weitere Genome mit (zumindest teilweise) eigenständigen Transkriptions- und Translationsapparaten, nämlich die der Piastiden und Mitochondrien. Erfolgt eine Integration des Fremdgens allerdings ausschließlich in eines dieser Genome, so wird nur ein Teil der maximal möglichen Fremdproteinbiosynthese-Kapazität des zellulären Stoffwechsels genutzt. Außerdem wird durch ein Expressionskonstrukt mit nur einem definierten Targetting-Signal nur das Speicherpotential eines subzellulären Kompartimentes genutzt. Die vorstehend beschriebenen Probleme hinsichtlich der Effizienz der rekombinanten Herstellung von Proteinen in Eukaryoten, insbesondere Pflanzen, wirdn bisher nicht bzw. nur wenig zufriedenstellend gelöst. Auch beschränkte sich die Fachliteratur bisher nur auf die Schilderung von Experimenten hinsichtlich der vergleichenden Bestimmung der Expressionsraten in einzelnen subzellulären Kompartimenten.
Somit liegt der Erfindung im wesentlichen das technische Problem zugrunde, Mittel zur Steigerung der Ausbeute von in Eukaryoten rekombinant hergestellten Fremdproteinen zur Verfügung zu stellen.
Die Lösung dieses technischen Problems wird durch die Bereitstellung der in den Patentansprüchen gekennzeichneten Ausführungsformen erreicht.
Die vorliegende Erfindung betrifft ein Verfahren, das die bisher im Stand der Technik vorhandenen Beschränkungen in der Effizienz der Fremdproteinbiosynthese in Eukaryoten, insbesondere in Pflanzenzellen, minimiert. So bietet sich für das "Molecular Farming" in transgenen Pflanzen durch die vorliegende Erfindung die Möglichkeit, wesentliche Erhöhungen der Expressionsraten fremder Proteine zu erreichen. Im Gegensatz zu den bisherigen Vorgehensweisen wird dabei das zu produzierende Protein nicht in ein einziges subzelluläres Kompartiment geleitet und nur das Speicherpotential dieses einen Kompartimentes genutzt, vielmehr werden in einer Ausführungsform zwei oder mehrere homologe Gene für die Expression eines definierten Proteins in die Wirtszelle eingebracht, wobei sich die dadurch kodierten Proteine darin unterscheiden, daß sie Targetting-Signale (Lokalisierungssignale) für unterschiedliche subzelluläre Kompartimente enthalten. Beispielsweise kann ein diagnostischer scFv-Antikörper durch Fusion mit einem Signalpeptid in den Apoplasten, gleichzeitig aber auch durch Fusion mit einem anderen Signalpeptid und mit dem KDEL-Targetting-Signal im ER lokalisiert werden. Somit werden beispielsweise die Speicherpotentiale des ER und des Apoplasten gleichzeitig genutzt. Weiterhin können zusätzlich Gene eingebracht werden, die für vakuolär oder im Golgi- Apparat lokalisierte scFv-Antikörper kodieren. Somit können in diesem Ausführungsbeispiel der vorliegenden Erfindung die Speicherpotentiale von vier subzellulären Kompartimenten miteinander kombiniert werden. In einer alternativen Ausführungsform werden die Fremdproteine nicht durch nukleare Expression und Transport in Organelien, d.h. Piastiden oder Mitochondrien, produziert, sondern die entsprechenden Gene werden durch direkte Transformation von Piastiden oder Mitochondrien mittels geeigneter Vektoren in diese Organellen eingeschleust und das für das betreffende Protein kodierende Gen direkt in diesen Kompartimenten exprimiert. Beide Vorgehensweisen können kombiniert werden, d.h. in einer weiteren Ausführungsform der vorliegenden Erfindung wird das Speicherpotential von bestimmten Kompartimenten, z.B. von Piastiden oder Mitochondrien, dadurch effizienter ausgenutzt, daß sowohl eine Organellen- als auch eine Kerntransformation mit den entsprechenden Genen durchgeführt wird, also die direkte Proteinsynthese in Organellen mit der nuklearen Proteinsynthese und nachfolgendem Transport des Proteins in die Organellen, d.h. Piastiden und Mitochondrien, mittels geeigneter Signalsequenzen kombiniert wird. Mit der vorliegenden Erfindung können somit die einzelnen Speicherkapazitäten typischer Speicherkompartimente, wie z.B. der Piastiden, des endoplasmatischen Retikulums oder von Speichervakuolen, kombiniert und synergistisch ausgenutzt werden.
Somit betrifft eine Ausführungsform der vorliegenden Erfindung einen Expressionsvektor (A), der dadurch gekennzeichnet ist, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder eine Zusammensetzung (B), die mindestens zwei Expressionsvektoren umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie (a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren, wobei (b) bei den einzelnen Genkopien der für (I) kodierende Anteil im wesentlichen identisch, der (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird.
Eine alternative Ausführungsform der vorliegenden Erfindung betrifft eine Zusammensetzung (C), die mindestens einen in Piastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor umfaßt, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren weiter dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in den Mitochondrien und Piastiden des Wirts exprimiert wird.
In einer bevorzugten Ausführungsform der vorliegenden Erfindung sind die beiden vorstehenden Ausführungsformen kombiniert, d.h., es wird sowohl eine Organellen- als auch eine Kerntransformation mit den für das gewünschte Protein kodierenden Genen durchgeführt, also die direkte Proteinsynthese in Organellen, d.h. in Piastiden und Mitochondrien, mit der nuklearen Proteinsynthese und nachfolgendem Transport des Proteins in die Organellen durch die Verwendung von Expressionsvektoren, bei denen das gewünschte Protein mit geeigneten Signalsequenzen verknüpft ist, kombiniert. Vektoren bzw. Vektorsequenzen, die die Expression des gewünschten Proteins in Organellen, d.h. in Piastiden oder Mitochondrien, erlauben, sind dem Fachmann bekannt. Beispielsweise wird auf Svab et al., Proc. Natl. Acad. Sei. USA 87 (1990) 8526 - 8530; Khan and Maliga, Nature Biotechnology 1 (1999), 910 - 915; Sidorov et al., Plant Journal 19 ( 1999), 209 - 216 verwiesen.
Der hier gebrauchte Ausdruck "im wesentlich identisch" bezüglich der einzelnen Genkopien bedeutet, daß die davon kodierten Proteine zumindest über die gleiche biologische Aktivität verfügen. Die einzelnen Genkopien können z.B. Modifikationen enthalten, die für die Expression des Gens, beispielsweise in Abhängigkeit von der Expression in bestimmten Organellen, von Vorteil sind; vgl. dazu auch den nachstehenden Abschnitt zu "gene silencing".
Verfahren zur Konstruktion der Expressionsvektoren, die für das gewünschte Gen in exprimierbarer Form enthalten, sind dem Fachmann bekannt und beispielsweise auch in gängigen Standardwerken beschrieben (vgl. z.B. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Die erfindungsgemäßen Expressionsvektoren können auf einem Plasmid, Cosmid, Virus, Bacteriophagen oder einem anderen in der Gentechnik üblichen Vektor basieren. Diese Vektoren können weitere Funktionseinheiten besitzen, die eine Stabilisierung des Vektors im Wirtsorganismus bewirken. Ferner können bei Verwendung einer Pflanze als Wirtsorganismus "left border"- und "right border"- Sequenzen agrobakterieller T-DNA enthalten sein, wodurch eine stabile Integration in das Erbgut von Pflanzen ermöglicht wird. Ferner kann eine Terminationssequenz vorhanden sein, die der korrekten Beendigung der Transkription sowie der Addition einer Poly-A-Sequenz an das Transkript dient. Derartige Elemente sind in der Literatur beschrieben (vgl. Gielen et al., EMBO J. 8 (1989), 23-29) und beliebig austauschbar.
Die mit dem gewünschten Protein zu fusionierende Signalsequenz richtet sich nach dem Zellkompartiment, in das der Transport des Proteins erfolgen soll. Geeignete Signalsequenzen (Signalpeptide) und für diese kodierenden DNA-Sequenzen sowie Verfahren zur Verknüpfung mit dem gewünschten Protein, z.B. einem scFv-Antikörper, auf eine solche Weise, daß sowohl das Protein noch aktiv ist als auch der Transport in das gewünschte Zellkompartiment erfolgt, sind dem Fachmann bekannt. Beispielsweise wird auf das Signalpeptid der α-Amylase aus Gerste hinsichtlich des Apoplasten (Düring et al., Plant Journal 3 (1993), 587 - 598), auf die Kombination aus Maus-Signalpeptid und KDEL-ER-Retentionssignal hinsichtlich des ER (Artsaenko et al., supra), auf das Targetting einer Säuger-α-2,6-Sialyltransferase hinsichtlich des Golgi-Apparats (Wee et al., Plant Cell IV (1998), 1759 - 1768, auf das Vakuolen- Lokalisierungssignal einer vakuolären Chitinase aus Gurke hinsichtlich der Vakuolen (Neuhaus et al., Proc. Natl. Acad. Sei. USA 88 (1991), 10362 - 10366), auf das Ferredoxin-Transitpeptid hinsichtlich der Chloroplasten und Piastiden, und auf das Transitpeptid von Tryptophanyl-t RNA-Snthetase aus Hefe hinsichtlich der O 01/73085 7
Mitochondrien (Schmitz and Lonsdale, Plant Cell 1 (1989), 783-791) verwiesen.
Für die Expression des für das gewünschte Protein kodierenden Gens geeignete Promotoren sind dem Fachmann bekannt und dazu zählen beispielsweise bei der Verwendung einer Pflanze als Wirtsorganismus der Cauliflower Mosaic Virus 35S Promotor (Odell et al., Nature 313 (1995), 810 - 812) der Agrobacterium tumefaciens Nopalin Synthase Promotor und der Mannopin Synthase Promotor (Harpster et al., Molecular and General Genetics 212 (1988), 182 - 190). Das für das gewünschte Protein kodierende Gen kann auch mit einem induzierbaren Promotor verknüpft sein, was z.B. die Steuerung der Synthese des gewünschten Proteins z.B. in einer transgenen Pflanze, zu einem gewünschten Zeitpunkt erlaubt, wie bei der nachstehend beschriebenen Nach-Ernte-Produktionstechnologie. Geeignete Promotoren sind dem Fachmann bekannt und dazu zählen beispielsweise der anaerob induzierbare Gap C4 Promotor aus Mais (Bülow et al., Molecular Plant- Microbe Interactions 12 (1999), 182 - 188), PR-Promotoren, wie L-Phenylalanin Ammonium Lyase-, Chalcon Synthase- und "Hydroxyproline rieh glycoprotein"- Promotoren induzierbar durch Ethylen (Ecker and Davies, Proc. Natl. Acad. Sei. USA 84 (1987), 5202 - 5210) und durch Dexamethason induzierbares chimäres Transkriptions-Induktionssystem (Kunkel et al., Nature Biotechnology 17 (1990), 916 - 918), IncW-Promotor aus Mais, induzierbar durch Sucrose oder D-Glucose (Chen et al., Proc. Natl. Acad. Sei. USA 96 (1999), 10512 - 10517. Ergänzend wird auf Datla et al., Biotechnology Annual Review 3 (1997), 269 - 290 und Gatz and Denk, Trends in Plant Science 3 (1998), 352 - 358 verwiesen.
Zur Herstellung der Expressionsvektoren zur Einführung in Wirtsorganismen, z.B. Pflanzen, stehen eine große Anzahl von Klonierungsvektoren zur Verfügung, die ein Replikationssignal für E.coli und ein Markergen zur Selektion transformierter Bakterienzellen enthalten. Beispiele für derartige Vektoren sind pBR322, pUC-Serien, M13mp-Serien, pACYC184, etc.. Die gewünschte Sequenz kann an einer passenden Restriktionsschnittstelle in den Vektor eingeführt werden. Der erhaltene Vektor wird für die Transformation von E.coli-Zellen verwendet. Transformierte E.coli-Zellen werden in einem geeigneten Medium gezüchtet, anschließend geerntet und lysiert. Der Vektor wird dann wiedergewonnen. Als Analysemethode zur Charakterisierung der gewonnenen Vektor-DNA werden im allgemeinen Restriktionsanalysen, Gelelektrophoresen und weitere biochemisch-molekularbiologische Methoden eingesetzt. Nach jeder Manipulation kann die Vektor-DNA gespalten und gewonnene DNA- Fragmente können mit anderen DNA-Sequenzen verknüpft werden. Jede Vektor-DNA- Sequenz kann in den gleichen oder anderen Vektoren kloniert werden.
Für die Einführung der vorstehenden Expressionsvektoren in eine Pflanzzelle stehen eine Vielzahl von Techniken zur Verfügung. Diese Techniken umfassen die Transformation von Pflanzenzeilen mit T-DNA unter Verwendung von Agrobacterium tumefaciens oder Agrobacterium rhizogenes als Transformationsmittel, die Fusion von Protoplasten, die Injektion, die Elektroporation von DNA, die Einbringung von DNA mittels der biolistischen Methode sowie weitere Möglichkeiten.
Bei der Injektion und Elektroporation von DNA in Pflanzenzellen werden an sich keine speziellen Anforderungen an die verwendeten Vektoren gestellt. Es können einfache Plasmide, wie z.B. pUC-Derivate, verwendet werden. Sollen aber aus derartig transformierten Zellen ganze Pflanzen regeneriert werden, sollte ein selektierbarer Marker vorhanden sein. Geeignete selektierbare Marker sind dem Fachmann bekannt und dazu zählen beispielsweise das Neomycinphosphotransferase Il-Gen aus E. coli (Beck et al., Gene 19 (1982), 327 - 336), das Sulfonamid-Resistenzgen (EP-369637) und das Hygromycin-Resistenzgen (EP-186425). Je nach Einführungsmethode für die gewünschten Gene in die Pflanzenzelle können weitere DNA-Sequenzen erforderlich sein. Wird z.B. für die Transformation der Pflanzenzelle das Ti- oder Ri-Plasmid verwendet, so muß mindestens die rechte Begrenzung, häufig jedoch müssen die rechte und linke Begrenzung der Ti- und Ri-Plasmid T-DNA als Flankenbereich mit den einzuführenden Genen verbunden werden.
Werden für die Transformation Agrobakterien verwendet, muß die einzuführende DNA in spezielle Vektoren kloniert werden, und zwar entweder in einen intermediären Vektor oder in einen binären Vektor (vgl. dazu auch die nachstehenden Beispiele 1 bis 3). Die intermediären Vektoren können aufgrund von Sequenzen, die homolog zu Sequenzen in der T-DNA sind, durch homologe Rekombination in das Ti- oder Ri- Plasmid der Agrobakterien integriert werden. Dieses enthält außerdem die für den Transfer der T-DNA notwendige vir-Region. Intermediäre Vektoren können nicht in Agrobakterien replizieren. Mittels eines Helferplasmids kann der intermediäre Vektor auf Agrobacterium tumefaciens übertragen werden. Binäre Vektoren können sowohl in E.coli als auch in Agrobakterien replizieren. Sie enthalten ein Selektionsmarker-Gen und einen Linker oder Polylinker, welche von der rechten und linken T-DNA Grenzregion eingerahmt werden. Sie können direkt in die Agrobakterien transformiert werden. Das als Wirtszelle dienende Agrobakterium sollte ein Plasmid, das eine vir- Region trägt, enthalten. Die vir-Region ist für den Transfer der T-DNA in die Pflanzenzelle notwendig. Zusätzliche T-DNA kann vorhanden sein. Das derartig transformierte Agrobakterium wird zur Transformation von Pflanzenzellen verwendet.
Für den Transfer der DNA in die Pflanzenzelle können Pflanzen-Expiantate zweckmäßigerweise mit Agrobacterium tumefaciens oder Agrobacterium rhizogenes cokultiviert werden. Aus dem infizierten Pflanzenmaterial (z.B. Blattstücke, Stengelsegmente, Wurzeln, aber auch Protoplasten oder Suspensions-kultivierte Pflanzenzellen) können dann in einem geeigneten Medium, welches Antibiotika oder Biozide zur Selektion transformierter Zellen enthalten kann, wieder ganze Pflanzen regeneriert werden. Die so erhaltenen Pflanzen können dann auf Anwesenheit der eingeführten DNA untersucht werden. Alternative Systeme zur Transformation von monokotylen Pflanzen sind die Transformation mittels des biolistischen Ansatzes, die elektrisch oder chemisch induzierte DNA-Aufnahme in Protoplasten, die Elektroporation von partiell permeabilisierten Zellen, die Makroinjektion von DNA in Blütenstände, die Mikroinjektion von DNA in Mikrosporen und Pro-Embryonen, die DNA-Aufnahme durch keimende Pollen und die DNA-Aufnahme in Embryonen durch Quellung (zur Übersicht: Potrykus, Physiol. Plant (1990), 269 - 273). Während die Transformation dikotyler Pflanzen über Ti-Plasmid-Vektorsysteme mit Hilfe von Agrobacterium tumefaciens wohl etabliert ist, weisen neuere Arbeiten darauf hin, daß auch monokotyle Pflanzen der Transformation mittels auf Agrobacterium basierender Vektoren sehr wohl zugänglich sind.
B e i d e r A n w e n d u n g d e r e r f i n d u n g s g e m ä ß e n Expressionsvektoren/Zusammensetzungen (Kombinationen) ist zu beachten, daß bei der Produktion therapeutischer Proteine die Homogenität des produzierten Proteins nicht beeinträchtigt wird und nur solche subzellulären Kompartimente miteinander gekoppelt werden, die keine Beeinträchtigung der Qualität des produzierten Proteins herbeiführen. Andererseits ist bei diagnostischen Proteinen oder Proteinwerkstoffen hierhin a priori keine Beeinträchtigung gegeben, so daß sich das erfindungsgemäße Verfahren bzw. die erfindungsgemäßen Expressionsvektoren insbesondere für derartige Proteine mit niedrigeren wirtschaftlichen Gewinnspannen eignen, weil hierbei die Expressionsraten einen wesentlich höheren Einfluß auf die wirtschaftliche Realisierbarkeit haben als bei therapeutischen Proteinen. Dem Problem eines potentiellen "gene silencing" bei Vorhandensein mehrerer gleicher Gene, z.B. in einer transgenen Pflanzenzelle/einer transgenen Pflanze, kann der Fachmann dadurch entgegengewirken, daß z.B. bei mehreren Kern-kodierten Fremdgenen für dasselbe Protein der Einsatz der möglichen unterschiedlichen Codons für eine Aminosäure unter Berücksichtigung der in einem bestimmten Organismus bevorzugten Codons eine unterschiedliche Nucleinsäuresequenz für die verschiedenen Gene z.B. in Form synthetisch hergestellter Gene benutzt wird.
In einer bevorzugten Ausführungsform enthalten die erfindungsgemäßen Expressionsvektoren bzw. die diese umfassenden Zusammensetzungen (Kombinationen) Lokalisierungssignale für die Lokalisierung im endoplasmatischen Retikulum (ER), im Apoplasten, im Golgi-Apparat, in Piastiden, in Peroxisomen, in Mitochondrien und/oder in Vakuolen. Es wird auf vorstehende Ausführungen hinsichtlich Signaisequenzen (Signalpeptide) verwiesen. Besonders bevorzugt sind als Lokalisierungssignale das KDEL-ER-Targeting-Peptid, das Golgi-Lokalisierungssignal der ß-1 ,2-N-Acetylglucosamintransferase (GnTI), die kleine Untereinheit der Ribulose- Biphosphat-Carboxylase und/oder das vakuoläre Targeting-Signal SKNPIN.
Bei den in dem erfindungsgemäßen Verfahren nützlichen Eukaryoten handelt es sich vorzugsweise um Pflanzen. Dabei kann es sich prinzipiell um Pflanzen jeder beliebigen Pflanzenspezies handeln, d.h. sowohl monokotyle als auch dikotyle Pflanzen. Der hier verwendete Begriff "Pflanze" umfaßt auch Pilze, Moose und Algen. Bevorzugt handelt es sich um Nutzpflanzen, z.B. um Pflanzen wie Weizen, Gerste, Reis, Mais, Zuckerrübe, Zuckerrohr, Brassicaceen, Leguminosen, Tabak oder Kartoffel. Besonders bevorzugt als transgene Pflanzen sind Brassicaceen, Leguminosen und Kartoffel. Die für die Expression des gewünschten Proteins gewünschten Pflanzenteile betreffen im Prinzip jedes beliebige Pflanzenteil, jedenfalls Vermehrungsmaterial und Ernteprodukte dieser Pflanzen, beispielsweise Früchte, Samen, Knollen, Wurzelstöcke, Sämlinge, Stecklinge etc.
Ferner betrifft die vorliegende Erfindung auch Pflanzensamen, eine Pflanzenzelle oder eine Pflanze, die einen erfindungsgemäßen Expressionsvektor oder eine erfindungsgemäße Zusammensetzung enthält.
Schließlich betrifft die vorliegende Erfindung ein Verfahren zur Steigerung der Produktionsrate eines gewünschten Proteins in einem Wirt, vorzugsweise einer Pflanze, das dadurch gekennzeichnet ist, daß zur simultanen Expression des für das gewünschte Protein kodierenden Gens in verschiedenen Kompartimenten des Wirts und/oder zum simultanen Transport des gewünschten Proteins in verschiedene Kompartimente des Wirts der Wirt mit dem erfindungsgemäßen Expressionsvektor und/oder der erfindungsgemäßen Zusammensetzung transformiert und das gewünschte Protein aus dem Wirt gewonnen wird. Geeignete Verfahren zur Gewinnung des Proteins und der am besten geeigneten Pflanzenteile in Abhängigkeit von der Lokalisierung des Proteins sind dem Fachmann bekannt und z.B. auch in den nachstehenden Beispielen 1 bis 3 beschrieben.
Die vorliegende Erfindung zeichnet sich dadurch aus, daß in einem Wirt, insbesondere einer Pflanze, eine hohe Expressionsrate eines gewünschten Proteins erreicht werden kann, ohne daß es zu physiologischen Störungen im Zellhaushalt und damit im Wachstum und der Lebensfähigkeit des Wirts kommt. Dies wird durch die Verwendung der vorstehenden Expressionsvektoren bzw. Zusammensetzungen (Kombinationen) erreicht, vor allem aber auch durch die Kombination der vorliegenden Erfindung hinsichtlich der multiplen subzellulären Lokalisation des gewünschten Proteins beispielsweise mit der Nach-Emte-Produktionstechnologie (vgl. dazu das nachstehende Beispiel 3), bei der die Expression des für das gewünschte Protein kodierenden Gens erst nach Ernte der Pflanze bzw. bestimmter Pflanzenteile erfolgt. Bei dieser durch den Anmelder entwickelten Technologie erfolgt die Induktion der Expression, beispielsweise die Induktion des zu aktivierenden Promotors, über chemische Stimuli (z.B. Veränderung der Zusammensetzung der umgebenden Gasphase, vorzugsweise anaerobe Induktion, Vernebelung von Lösungen fester induzierender (Bio-)chemikaiien oder Verwendung flüchtiger Substanzen und deren gleichmäßige Verteilung im Reaktionsraum) oder Aufhebung der funktionellen Inhibition der Transkription des betreffenden Fremdgens im transgenen Wirtsorganismus (z.B. durch Insertion von transkriptionsinhibierenden Sequenzen zwischen Promotor und zu exprimierendem Gen, welche extern steuerbar entfernt oder inaktiviert werden können). Diese Vorgehensweise ist vor allem im Hinblick auf transgene Pflanzen von Interesse, die hierfür ein hervorragend geeignetes Bioreaktor-System darstellen, vor allem da der großflächige Anbau von Kulturpflanzen und die großtechnische Verarbeitung großer Pflanzenmengen, z.B. für die Öl - und Stärkegewinnung, etabliert sind. Solches, unter Einbezug der Nach-Emte-Produktions- Technologie beispielsweise für die Produktion hochwertiger Proteine oder anderer (bio-)chemischer Substanzen in großem Maßstab eröffnet neue (bio)medizinische und technologische Anwendungsgebiete. Außerdem kann bei dieser Vorgehensweise das Pflanzengewebe, beispielsweise beim Einsatz eines gasförmigen Induktionsstimulus, intakt und unzerstört bleiben, da es nicht zerkleinert werden muß. Ferner kommt es zu einer sehr gleichmäßigen und schnellen Verteilung des Induktionsstimulus um das Gewebe herum, wie auch zwischen den Zellen im Zellverband.
Somit ist eine bevorzugte Ausführungsform des erfindungsgemäßen Verfahrens dadurch gekennzeichnet, daß die Expression des für das gewünschte Protein kodierenden Gens erst nach der Ernte des Wirts erfolgt, wobei das für das gewünschte Protein kodierende Gen so auf den Expressionsvektoren inseriert ist, daß dessen Expression erst in Anwesenheit einer induzierenden Verbindung (Induktor) erfolgt und das Inkontaktbringen mit dem Induktor nach der Ernte des Wirts erfolgt. Geeignete Vorgehensweisen sind dem Fachmann bekannt. Der Induktor kann z.B. über die Veränderung der den Wirtsorganismus umgebenden Gasphase, eine Vernebelung einer Lösung eines Induktors oder ein aktives Überströmen mit einem flüchtigen Induktor erfolgen. Bei der Veränderung der Gasphase kann es sich z.B. um einen Sauerstoffentzug handeln, wobei dann für die Expression ein unter anaeroben Bedingungen aktiver Promotor verwendet wird, z.B. der GapC4-Promotor aus Mais (Bülow et al., supra). Die Induktion der Expression des für das gewünschte Protein kodierenden Gens kann auch durch Aufhebung der funktionellen Hemmung der Transkription und/oder Translation erfolgen, beispielsweise dadurch, daß bei den erfindungsgemäßen Expressionsvektoren zwischen dem Promotor und dem Gen eine Nucleinsäure inseriert ist, die dadurch gekennzeichnet ist, daß sie die Transkription und/oder Translation des Gens verhindert und nach Induktion exzisiert werden kann, was zur Expression des Gens führt. Diese Nucleinsäure kann z.B. eine durch eine induzierbare Rekombinase exzisierbare Nucleinsäure sein. Die exzisierbare Nucleinsäure und die Rekombinase können Bestandteile des Rekombinase-LBD- Systems (WO 95/00555) sein.
Die folgenden Beispiele erläutern die Erfindung.
Beispiel 1: Produktion von scFv(ox)-Antikörpern im ER, im Apoplasten, im Golgi-Apparat und in Piastiden von transgenen Kartoffelknollen
Die in Artsaenko et al. (supra) beschriebene cDNA, die für einen im endoplasmatischen Retikulum (ER) lokalisierten scFv(ox)-Antikörper mit KDEL-ER-Targetting-Sequenz kodiert, wird mittels einer Linker-Ligation (am 5'-Ende mit CATGCCATGGCATG [5'-phosphoryliertes Oligonucleotid]), am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid] derart modifiziert, daß sie am 5'- Ende eine Ncol-Restriktionsschnittstelle und am 3'-Ende eine Xbal-Restriktionsschnittstelle aufweist. Nach Verdau des Plasmids pRT 100 (Töpfer et el. (1987) Nucleic Acids Research 15, 5890) mit Ncol und Xbal wird das scFv-kodierende DNA-Fragment in diesen Expressionsvektor inseriert. Es wird das Plasmid pRT 100/scFv(ox)ER erhalten. Nach Spaltung mit Hindill wird die Expressionskassette 35S-scfv(ox)ER Isoliert.
In einer weiteren Klonierung wird die cDNA für den scFv(ox)-Antikörper ohne die kodierende Sequenz für das KDEL-ER-Targetting-Signal (Artsaenko et al., (supra)) mittels einer Linker-Ligation (am 5'-Ende mit CATGCCATGGCATG [5'- phosphoryliertes Oligonucleotid]; am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine Ncol-Restriktionsschnittstelle und am 3'-Ende eine Xbal-Restriktionsschnittstelle aufweist. Nach Verdau des Plasmids pRT 100 mit Ncol und Xbal wird das scFv-kodierende DNA-Fragment in diesen Expressionsvektor inseriert. Es wird das Plasmid pRT 100/scFv(ox)AP erhalten. Nach Spaltung mit Hindlll wird die Expressionskassette 35S-scFv(ox)AP isoliert.
Für die Lokalisierung des scFv(ox)-Antikörpers im Golgi-Apparat wird das Signalpeptid in Plasmid pRT 100/scFv(ox)AP durch das Golgi-Lokalisierunggssignal der ß-1 ,2-N- Acetylglucosaminyltransferase (GnTI) aus Kaninchen (Burke et el., J.Biol.Chem. 267 (1992), 24433-24440) ersetzt. Dazu wird mittels einer PCR-Reaktion die dafür kodierende DNA-Sequenz so modifiziert, daß sie am 5'-Ende eine Ncol-Schnittstelle und am 3'-Ende die GTCGAC-Sequenz aufweist, für die eine Sall-Schnittstelle codiert. Für die PCR-Reaktion wird das folgende Primerpaar verwendet:
5'-GnTI-Primer: CCATGGATGCTGAAGAAGCAGTCTGCTGG 3'-GnTI-Primer: GTCGACACGTGTCCAGAAGAAGAGGAGGAG
Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation (am 5'-Ende mit CCGTCGACAT [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine Sall-Schnittstelle und am 3'-Ende eine Xbal-Restriktionsschnittstellle aufweist. Beide cDNA-Fragmente werden mit Ncol + Sall bzw. Sall + Xbal verdaut, so daß überhängende Enden entstehen. Die erhaltenen cDNA-Fragmente werden gleichzeitig in den mit Ncol und Xbal geöffneten Vektor pRT 100 inseriert. Es wird das Plasmid pRT 100/scFv(ox)GO erhalten. Nach Spaltung mit Hindlll wird die Expressionskassette 35S-scFv(ox)GO isoliert.
Für den Transport des cytopiasmatisch synthetisierten scFv(ox)-Antikörpers in Chloroplasten wird eine für ein Transitpeptid-scFv(ox) kodierendes cDNA-Fragment erzeugt. Dazu wird die cDNA für das Transitpeptid aus dem für die kleine Untereinheit der Ribulose-Bisphosphat-Carboxylase kodierenden Gens (Anderson et al., Biochemical Journal 240 (1986), 709-715) mittels einer PCR-Peaktion so modifiziert, daß am 5'-Ende eine Ncol-Schnittstelle und am 3'-Ende die GTCGAC-Sequenz, die für eine Sall-Schnittstelle kodiert, eingefügt werden. Dafür wird das folgende Primerpaar verwendet:
5'-rbcT Primer: CCATGGCTTCTATGATATCCTCTTCAG 3'-rbcT Primer: GTCGACGCACTTTACTCTTCCACCATTGC
Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation am 5'-Ende mit CCGTCGACAT [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5' Ende eine Sall-Schnittstelle und am 3'-Ende eine Xbal-Restriktionsschnittstelle aufweist. Beide cDNA-Fragmente werden mit Ncol + Sall bzw. Sall + Xbal verdaut, so daß überhängende Enden entstehen. Die erhaltenen cDNA-Fragmente werden gleichzeitig in den mit Ncol und Xbal geöffneten Vektor pRT 100 inseriert. Es wird das Plasmid pRT 100/scFv(ox)CH erhalten. Nach Spaltung mit Hindlll wird die Expressionskasette 35S-scFv(ox)CH isoliert.
Der binäre Vektor pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-589; Porsch et al., Plant Molecular Biology 37 (1998), 581-585) wird mit Hindlll geöffnet. Alle vier vorstehend beschriebenen Expressionskassetten (35S-scFv(ox)ER, 35S-scFv(ox)AP, 35S-scFv(ox)GO" und 35S-scFv(ox)CH) werden gleichzeitig In die Hindlll-Schnittstelle des binären Vektors ligiert Die eindeutige Identifizierung positiver Klone, die alle vier Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor pSR 8-30/scFv(ox)EAGC erhalten.
Der Expressionsvektor pSR 8-30/scFv(ox)EAGC wird zur Transformation von E.coli SM10 verwendet. Transformanten werden mit Agrobacterium GV 3101 gemischt und über Nacht bei 28°C inkubiert (Koncz und Scheli, Molecular and General Genetics 204 (1986), 383-396; Koncz et al., Proc.Natl.Acad.Sci.USA 84 (1987), 131 - 135). Es wird auf Carbenicillin selektioniert, wobei das hierfür notwendige bla-Gen in den vorstehenden Expresssionsvektoren vorliegt. Selektionsklone von Agrobacterium tumefaciens werden auf abgeschnittenen und mehrfach an der Mittelrippe eingeritzten Blättern der Kartoffelpflanze cv. Desiree aufgebracht und die Blätter werden 2 Tage bei 20°C im Dunkeln inkubiert. Danach werden die Agrobakterien abgewaschen und den Kartoffelblättern Pflanzenwuchsstoffe zugesetzt, so daß bevorzugt Sprosse lo
regenerieren. Ferner werden durch die Zugabe von Kanamycin 100 mg/l in das Pflanzenmedium nicht-transformierte Zellen in den Kartoffelblättern abgetötet. Heranwachsende Sprosse werden abgeschnitten und auf das Medium ohne Pflanzenwachstumsstoffe, aber mit Kanamycin, bewurzelt. Die weitere Kultivierung der Kartoffelpflanzen erfolgt in üblicher Weise.
Der Nachweis des exprimierten scFv-Antikörpers in transgenem Blatt- und Knollenmaterial wird durch Antikörper, die an scFv oder Protein L binden, im Western Blot bzw. ELISA erbracht. Hierzu wird das Gesamtprotein des Kartoffelmaterials isoliert und in die entsprechenden Nachweisverfahren eingesetzt. Im Vergleich zu den in Artsaenko et al. (supra) publizierten Ergebnissen zur Knollen-Expression von scFv(ox) ausschließlich im ER (Expressionsraten von bis zu 2% des löslichen Gesamtproteins) werden durch die simultane Expression in insgesamt vier Kompartimenten bis zu 5% scFv(ox)-Antikörper-Protein vom löslichen Gesamtprotein erreicht.
Beispiel 2: Produktion von scFv(ox)-Antikörpern durch nukleare
Transformation für die Expression im ER und in Vakuolen und plastidäre
Transformation für die Expression in Piastiden
Für die Herstellung eines Plastiden-Transformationsvektors wird Chloroplasten-DNA (cp-DNA) aus 8 Wochen alten Tabakpflanzen, angezogen im Gewächshaus, nach dem Verfahren von Koladner und Tewarl (Biochim. Biophys. Acta 404 (1975), 372-390) isoliert. Die isolierte Chloroplasten-DNA wird mit Bglll verdaut und die entstandenen Bglll- Fragmente werden "shot gun" in den mit BarnHI geöffneten Vektor pBluescriptKS (Stratagene) kloniert. Über Kolonie-Hybridisierung wird ein Klon identifiziert, der das Bglll-Fragment mit den ndhF-, rpl32 und trnL-Genen enthält (Shinozaki et al., EMBO J. 5 (1986), 2043-2049; 4.656bp-Fragment, Nucieotide Nr. 111515-116171). Es wird das Plasmid pBKSnrt erhalten.
In die Hincll-Schnittstelle des 4.656bp-Bglll-Fragments im Plasmid pBKSnrt wird das Gen für den scFv(ox)-Antikörper aus Artsaenka et al. (supra) unter die Kontrolle des psbA-Promotors und des psbA-Terminationssignals (Shinozaki et al., supra) aus Tabak kloniert. Dafür wird die cDNA für den reifen scFv(ox)-Antikörper mittels einer Linker-Ligation am 5'-Ende mit CGCGAATTC [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GACTAAGCTT [5'-phosphoryliertes Oligonucleotid] derart modifiziert, daß sie am 5'-Ende eine EcoRI-Schnittstelle und am 3'-Ende eine Hindill- Restriktionsschnittsteile aufweist. Dieses cDNA-Fragment wird nach Verdau mit EcoRI und Hindlll in das Plasmid pBluescriptSK (Stratagene) kloniert. Es wird das Plasmid pBSK/scFv(ox) erhalten. Der 5'-Bereich des psbA-Gens (Plastiden-spezifischer Promotor) wird aus Chloroplasten-DNA von Tabak durch eine PCR-Reaktion amplifiziert. Dafür wird folgendes phosphoryliertes Primerpaar verwendet:
psbA1 Primer: GTCATGTTATACTGTTG
(Nucleotide 1700-1684, Shinozaki et al., supra) psbA2 Primer: GGTAAAATCTTGGTTTATTTAATCATC
(Nucleotide 1596-1622, Shinozaki et al., supra)
Das PCR-Produkt wird "blunt end" in die Smal-Schnittstetle des Vektors pBSK/scFv(ox) kloniert. Es wird das Plasmid pBSK/psbA-scFv(ox) erhalten. Der 3'-Bereich des psbA-Gens (Terminationssignal) wird ebenfalls über eine PCR-Reaktion amplifiziert. Dazu wird folgendes phosphoryliertes Primerpaar verwendet:
psbA3 Primer: AGTCTATGTAAGTAAAATAC
(Nucleotide 401-420, Shinozaki et al., supra) psbA4 Primer: CCTGGCCTAGTCTATAGGAG
(Nucleotide 530-511 , Shinozaki et al., supra)
Das PCR-Produkt wird "blunt end" in die aufgeschnittene und aufgefüllte Sall-Schnittstelle des Vektors pBSK/psbA-scFv(ox) inseriert. Es wird das Plasmid pBSK/psbA-scFv(ox)-PgbA erhalten. Die Expressionskassette wird aus diesem Plasmid durch Verdau mit BamHI und Kpnl herausgeschnitten, aufgefüllt und "blunt end' in die Hincll-Schnittstelle des Vektors pBSKnrt kloniert. Es wird das Plasmid pBSKnnVscFv(ox) erhalten. In die SnaBI-Schnittstelle des 4.656bp-Bglll-Fragments des 1 o
Plasmids pBSKnnVscFv(ox) wird weiterhin als Selektionsmarker das nptll-Gen unter die Kontrolle des psbA-Promotors und des psbA-Terminationssignals aus Tabak kloniert. Dafür wird das nptll-Gen mit einer PCR-Amplifizierung aus dem Vektor pCR2.1 (Invitrogen) isoliert. Dazu wird folgendes Primerpaar verwendet:
Kan1 -Primer: CCGAATTCCAAGAGACAGGATGAGGATC
Kan2-Primer: CGCGAAGCTTCAATTCAGAAGAACTCAAG
Das PCR-Produkt wird über EcoRI- und Hindlll-Verdau in das Plasmid pBlueschptSK (Stratagene) kloniert. Es wird das Plasmid pBSK/NPT erhalten. Der 5'-Bereich des psbA-Gens (wie vorstehend beschrieben isoliert) wird "blunt end' in die Smal-Schnittstelle des Vektors pBSK/NPT kloniert. Es wird das Plasmid pF3SK/psbA-NPT erhalten. Der 3'-Bereich des pshA-Gens (Terminationssignal) wird (wie vorstehend beschrieben) ebenfalls "blunt end' in die aufgeschnittene und aufgefüllte Sall-Schnittstelle des Vektors pBSK/psbA-NBT inseriert, wobei das Plasmid pBSK/psbA-NPT-psb erhalten wird. Die Expressionskassette wird aus diesem Plasmid mit BamHI und Kpnl herausgeschnitten, aufgefüllt und "blunt end" in die SnaBI- Schnittstelle des Vektors pBKSnrt/scFv(ox) kloniert, wodurch das Plasmid pBKSnrt/scFv(ox)-NPT erhalten wird.
Die Transformation von Kartoffelplastiden und die Selektion von transgenen Kartoffelpflanzen, die das vorstehend beschriebene Konstrukt in das Piastidengenom eingebaut haben, erfolgt nach den von Svab et al., supra, Carrer et al. (Mol.Gen.Genet. 241 (1993), 49-56) und Sidorov et al. (Plant J. (1999), supra beschriebenen Protokollen (biolistischer DNA-Transfer) mit dem Helium-betriebenen "Particle-Gun" Gerät PDS-1000/He (Du Pont Willmington, USA). Der Nachweis der Piastidentransformation erfolgt durch Isolierung plastidärer DNA und Hybridisierung mit dem scFv(ox)-Gen. Der Nachweis des produzierten scFv(ox)-Antikörpers erfolgt analog zu vorstehendem Beispiel 1.
Die vorstehend beschriebene transgene Kartoffellinie, die das Gen für die plastidäre Expression des scFv(ox)-Antikörpers in den Piastiden enthält, wird weiterhin mit den beiden Expressionskassetten 35S-scFv(ox)ER aus Beispiel 1 und einer weiteren Expressionskassette 35S-scFv(ox)VA für die vakuoläre Lokaiisation des produzierten scFv(ox)-Antikörpers transformiert.
Für die Klonierung der Expressionskassette 35S-scFv(ox)VA wird das Plasmid pSR9-12 ein Derivat des Plasmids pRT 100, welches stromabwärts vom CaMV 35S- Promotor die kodierende Sequenz für ein Maus IgG-Signalpeptid enthält, mit Sall und Xbal geöffnet. Die cDNA für den reifen scFv(ox)-Antikörper wird mittels einer Linker-Ligation (am 5'-Ende mit CCGTCGACTCTAAGAACCCAATTAAC [5'- phosphoryliertes Oligonucleotid) und am 3'-Ende mit GCTCTAGAGC [5'- phosphoryliertes Oligonucleotid]) derart modifiziert, daß sie am 5'-Ende eine Sall-Schnittstelle und am 3'-Ende Ende eine Xbal-Restriktionsschnittstelle aufweist. Gleichzeitig wird damit die für das vakuoläre Targetting-Signal SKNPIN aus dem 20 kDa-Protein aus der Kartoffelknolle kodierende DNA-Sequenz (PT20; Kolde, Plant Cell Physiol. 40 (1999), 1152-1159) integriert. Dieses cDNA-Fragment wird mit Sall und Xbal verdaut, so daß überhängende Enden entstehen, und in den geöffneten Vektor inseriert. Es wird das Plasmid pSR9-12/scFv(ox)VA erhalten. Nach Spaltung mit Hindlll wird die Expressionskassette 35S-scFv(ox)VA isoliert.
Die beiden Expressionskassetten 35S-scFv(ox)ER und 35S-scFv(ox)VA werden gleichzeitig als Hindlll-Fragmente in den mit Hindlll geöffneten binären Vektor pSR 8 -30 hyg , e i n D e rivat d es Vekto rs p S R 8 -30 , d e r an stel le d es Neomycinphosphotransferare Il-Gens das Hygromycinphosphotransferare-Gen enthält, ligiert. Die eindeutige Identifizierung positiver Klone, die beide Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor pSR 8-30hyg/scFv(ox)EV erhalten. Die Kartoffeltransformation erfolgt wie im vorstehenden Beispiel 1 beschrieben, wobei die Selektion mit 5mg/l Hygromycin erfolgt. Der Nachweis des produzierten scFv(ox)Antikörpers erfolgt wie im vorstehenden Beispiel 1 beschrieben. Die Integration des vorstehend beschriebenen Konstrukts in das Kerngenom wird durch Isolierung kemgenomischer DNA und Hybridisierung mit dem scFv(ox)-Gen gemäß Standardverfahren nachgewiesen. Gegenüber Beispiel 1 kann die Menge des exprimierten scFv(ox) nochmals gesteigert werden, nämlich auf 8% scFv(ox)- Antikörper-Protein vom löslichen Gesamtprotein. Beispiel 3: Nach-Ernte-Produktion von scFv(ox)-Antiköpern durch anaerobe Expression im ER und im Golgi-Apparat
Der anaerob induzierbare GapC4-Promotor aus Mais (DE 195 47 272) wird mittels einer PCR-Reaktion derart modifiziert, daß er am 5'-Ende eine Hincll- Restriktionsschnittstelle und am 3'-Ende eine Ncol-Restriktionschnittstelle erhält. Für die PCR-Reaktion wird folgendes Primerpaar verwendet:
Hincll-pGapC4 Primer: CATGTCAACACATAAGGAAGAAGAGGTAGAAAG pGapC4-Ncol Primer:
CATGCCATGGATCGATGACGGGGTTGGCGAGTGTG
Die in Artsaenko et al. (supra) beschriebene cDNA, die für den im endoplasmatischen Retikulum (ER) lokalisierten scFv(ox)-Antikörper kodiert, wird mittels einer Linker- Ligation am 5'-Ende mit CATGCCATGGCATG [5'-phosphoryliertes Oligonucleotid] und am 3'-Ende mit GCTCTAGAGC [5'-phosphoryliertes Oligonucleotid] derart modifiziert, daß sie am 5'-Ende eine Ncol-Restriktionsschnittstelle und am 3'-Ende eine Xbal-Restriktionsschnittstelle aufweist. Aus dem Plasmid pRT 100 wird der CaMV 35S-Promotor mittels Restriktionsverdau mit Hincll und Xbal entfernt. Stattdessen werden die beiden oben beschriebenen Nucleinsäurefragmente, die für den GapC4- Promotor und den scFv(ox)-Antikörper kodieren, inseriert. Es wird das Plasmid pRT 100GAP/scFv(ox)ER erhalten. Nach partieller Spaltung mit Hindlll wird die Expressionskassette GAP-scFv(ox)ER isoliert.
Für die anaerobe Expression des im Golgi-Apparat lokalisierten scFv(ox)-Antikörpers wird das Plasmid pRT 100/scFv(ox)GO aus Beispiel 1 mit Hincll und Ncol verdaut. Dadurch wird der CaMV-35S Promotor entfernt. Statt dessen wird das vorstehend beschriebene PCR-modifizierte pGapC4-Promotorfragment inseriert. Es wird das Plasmid pRT 100GAP/scFv(ox)GO erhalten. Nach Spaltung mit Hindlll wird die Expressionskassette GAP-scFv(ox)GO isoliert.
Der binäre Vektor pSR 8-30 wird mit Hindlll geöffnet. Beide vorstehend beschriebenen Expressionskassetten (GAP-scFv(ox)ER und GAP-scFv(ox)GO) werden gleichzeitig in die Hindlll-Schnittstelle des binären Vektors ligiert. Die eindeutige Identifizierung positiver Klone, die beide Fragmente enthalten, erfolgt durch DNA-Sequenzierung. Es wird der binäre Vektor PSR 8-30GAP/scFv(ox)EG erhalten.
Der Expressionsvektor pSR 8-30GAP/scFv(ox)EG wird wie im vorstehenden Beispiel 1 beschrieben zur Transformation von Kartoffeln verwendet. Zum Nachweis der Expression des scFv-Antikörpers wird abgeschnittenes Blattmaterial bzw. intaktes (oder geschnittenes) Knollenmaterial mittels des "Anaeroculf-Systems (Fa. Merck, Darmstadt, Deutschland) wie bei Bülow et al. Molecular Plant-Microbe Interactions 12 (1999), 192-198 beschrieben induziert. Nach 40 Stunden wird das Blattmaterial entnommen und gemörsert. Der Nachweis des exprimierten scFv-Antikörpers wird wieder durch Antikörper, die an den scFv-Antikörper oder Protein L binden im Western Blot bzw. ELISA erbracht. Hierzu wird das Gesamtprotein des Kartoffelmaterials isoliert und in die entsprechenden Nachweisverfahren eingesetzt.
Als expressions-positiv ermittelte transgene Kartoffelpflanzen werden im Gewächshaus (im Topf oder im Erdbeet) oder im Freiland unter üblichen gartenbaulichen bzw. landwirtschaftlichen Bedingungen angebaut. Die Knollen werden nach üblicher Handhabung geerntet und gelagert. Für die Nach-Ernte-Produktion des scFv-Antikörpers werden die Knollen in einen Reaktionsbehälter aus Stahl (oder Kunststoff) verbracht, der unten ein Gaszufuhrventil und oben ein Gasabführventil aufwies. Die Raumluft im Behälter wird schnell durch Zufuhr von beispielsweise technischem Stickstoff (oder Kohlendioxid) verdrängt. Unter langsamem Luftstrom (1 m3 Gaszufuhr pro Stunde pro m2 Grundfläche) wird eine konstante Zusammensetzung der Gasphase im Reaktionsbehälter eingestellt. Nach 40 Stunden werden die Knollen aus dem Reaktionsbehälter entnommen, homogenisiert, der Festanteil wird abzentrifugiert und der wäßrige Überstand der chromatographischen Aufreinigung des scFv-Antikörpers zugeführt. Durch Vergleich von Proben vor und nach Sauerstoffentzug dieser transgenen Kartoffellinie mit den transgenen Kartoffellinien, die den scFv(ox)-Antikörper nur im ER exprimieren, zeigt sich, daß durch die kombinierte Expression in zwei Zellkompartimenten (hier: ER und Golgi-Apparat) deutlich höhere Expressionsraten erzielt werden.

Claims

Patentansprüche
1. Expressionsvektor (A), dadurch gekennzeichnet, daß er mindestens zwei Kopien eines für ein gewünschtes Protein kodierenden Gens jeweils mit einem Promotor funktionell verknüpft enthält, oder Zusammensetzung (B), umfassend mindestens zwei Expressionsvektoren umfassend, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Genkopien dadurch gekennzeichnet sind, daß sie
(a) für das gewünschte Protein (I) als Fusionsprotein mit einem gewünschten Lokalisierungssignal (II) kodieren; wobei
(b) bei den einzelnen Genkopien der (I) kodierende Anteil im wesentlichen identisch, der (II) kodierende Anteil jedoch unterschiedlich ist, wobei nach Einschleusen des Expressionsvektors (A) oder der Zusammensetzung (B) in einen Wirt das gewünschte Protein in unterschiedliche Kompartimente des Wirts transportiert wird.
2. Zusammensetzung (C), umfassend mindestens einen in Piastiden lokalisierten und einen in Mitochondrien lokalisierten Expressionsvektor, die jeweils mindestens eine Kopie eines für ein gewünschtes Protein kodierenden Gens mit einem Promotor funktionell verknüpft enthalten, wobei die einzelnen Expressionsvektoren dadurch gekennzeichnet sind, daß die einzelnen Genkopien im wesentlichen identisch sind und das gewünschte Protein in Piastiden und Mitochondrien des Wirts exprimiert wird.
3. Kombination, enthaltend den Expressionsvektor (A) nach Anspruch 1 , und/oder die Zusammensetzung (B) nach Anspruch 1 und die Zusammensetzung (C) nach Anspruch 2.
4. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach einem der Ansprüche 1 bis 3, wobei das Lokalisierungssignal ein solches für die Lokalisierung im endoplasmatischen Retikulum (ER), Apoplasten, Golgi-Apparat, in Piastiden, Mitochondrien, Peroxisosomen und/oder in Vakuolen ist.
5. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach Anspruch 4, wobei das Lokalisierungssignal das KDEL-ER-Targetting-Peptid ist, das Golgi-Lokalisierungssignal der ß-1 ,2-N-Acetylglucosamintransferase (GnTI), die kleine Untereinheit der Ribulose-Biphosphat-Carboxylase und/oder das vakuoläre Targetting- Signal SKNPIN ist.
6. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach einem der Ansprüche 1 bis 5, wobei der Wirt eine Pflanze ist.
7. Expressionsvektor (A), Zusammensetzung (B) oder (C) bzw. Kombination nach Anspruch 6, wobei die Pflanze eine Brassicacee, Leguminose oder Kartoffel ist.
8. Verfahren zur Steigerung der Produktionsrate eines gewünschten Proteins in einem Wirt, dadurch gekennzeichnet, daß zur simultanen Expression des das gewünschte Protein kodierenden Gens in verschiedenen Kompartimenten des Wirts und/oder zum simultanen Transport des gewünschten Proteins in verschiedene Kompartimente des Wirts der Wirt mit dem Expressionsvektor (A), der Zusammensetzung (B) oder (C) bzw. der Kombination nach einem der Ansprüche 1 bis 7 transformiert und das gewünschte Protein aus dem Wirt gewonnen wird.
9. Verfahren nach Anspruch 8, weiter dadurch gekennzeichnet, daß die Expression des das gewünschte Protein kodierenden Gens erst nach der Ernte des Wirts erfolgt, wobei das das gewünschte Protein kodierende Gen so vorliegt, daß dessen Expression erst in Anwesenheit einer induzierenden Verbindung erfolgt und das Inkontaktbringen mit der Verbindung nach der Ernte des Wirts erfolgt.
10. Verfahren nach Anspruch 8 oder 9, wobei der Wirt eine Pflanze ist.
11. Pflanzensamen, Pflanzenzelle oder Pflanze, die einen Expressionsvektor (A), eine Zusammensetzung (B) oder (C) bzw. eine Kombination nach einem der Ansprüche 1 bis 7 enthält.
PCT/DE2001/000133 2000-03-24 2001-01-10 Expressionsvektoren zur anreicherung eines rekombinant hergestellten proteins in unterschiedlichen zellkompartimenten WO2001073085A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001237217A AU2001237217A1 (en) 2000-03-24 2001-01-10 Expression vectors for concentrating a recombinantly produced protein in different cell compartments

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE2000114412 DE10014412A1 (de) 2000-03-24 2000-03-24 Expressionsvektoren zur Anreicherung eines rekombinant hergestellten Proteins in unterschiedlichen Zellkompartimenten
DE10014412.8 2000-03-24

Publications (1)

Publication Number Publication Date
WO2001073085A1 true WO2001073085A1 (de) 2001-10-04

Family

ID=7636035

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/DE2001/000133 WO2001073085A1 (de) 2000-03-24 2001-01-10 Expressionsvektoren zur anreicherung eines rekombinant hergestellten proteins in unterschiedlichen zellkompartimenten

Country Status (3)

Country Link
AU (1) AU2001237217A1 (de)
DE (1) DE10014412A1 (de)
WO (1) WO2001073085A1 (de)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0223247A2 (de) * 1985-11-22 1987-05-27 Ciba-Geigy Ag Direkter Gentransfer in Plastide und Mitochondrien
WO1988002402A1 (en) * 1986-09-26 1988-04-07 Calgene, Inc. Intracellular directed delivery of expression products
WO1990002804A1 (en) * 1988-09-02 1990-03-22 Plant Genetic Systems N.V. Stress-tolerant plants
WO1995003690A1 (en) * 1993-08-02 1995-02-09 Virginia Tech Intellectual Properties, Inc. Hmg2 promoter expression system and post-harvest production of gene products in plants and plant cell cultures

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0223247A2 (de) * 1985-11-22 1987-05-27 Ciba-Geigy Ag Direkter Gentransfer in Plastide und Mitochondrien
WO1988002402A1 (en) * 1986-09-26 1988-04-07 Calgene, Inc. Intracellular directed delivery of expression products
WO1990002804A1 (en) * 1988-09-02 1990-03-22 Plant Genetic Systems N.V. Stress-tolerant plants
WO1995003690A1 (en) * 1993-08-02 1995-02-09 Virginia Tech Intellectual Properties, Inc. Hmg2 promoter expression system and post-harvest production of gene products in plants and plant cell cultures

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ARTSAENKO OLGA ET AL: "Potato tubers as a biofactory for recombinant antibodies.", MOLECULAR BREEDING, vol. 4, no. 4, August 1998 (1998-08-01), pages 313 - 319, XP002174096, ISSN: 1380-3743 *
BURKE JO ET AL: "The transmembrane and flanking sequences of beta-1,2-N-acetylglucosam inyltransferase I specify medial-Golgi localization.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, no. 34, 1992, pages 24433 - 24440, XP002174097, ISSN: 0021-9258 *
CONRAD ET AL: "Compartment-specific accumulation of recombinant immunoglobulins in plant cells: an essential tool for antibody production and immunomodulation of physiological functions and pathogen activity", PLANT MOLECULAR BIOLOGY, NIJHOFF PUBLISHERS, DORDRECHT, NL, vol. 38, September 1998 (1998-09-01), pages 101 - 109, XP002135721, ISSN: 0167-4412 *
CREISSEN GARY ET AL: "Simultaneous targeting of pea glutathione reductase and of a bacterial fusion protein to chloroplasts and mitochondria in transgenic tobacco.", PLANT JOURNAL, vol. 8, no. 2, 1995, pages 167 - 175, XP002174094, ISSN: 0960-7412 *
DUERING K ET AL: "SYNTHESIS AND SELF-ASSEMBLY OF A FUNCTIONAL MONOCLONAL ANTIBODY IN TRANSGENIC NICOTIANA-TABACUM", PLANT MOLECULAR BIOLOGY, vol. 15, no. 2, 1990, pages 281 - 293, XP002922696, ISSN: 0167-4412 *
PORSCH PETRA ET AL: "A plant transformation vector with a minimal T-DNA II. Irregular integration patterns of the T-DNA in the plant genome.", PLANT MOLECULAR BIOLOGY, vol. 37, no. 3, June 1998 (1998-06-01), pages 581 - 585, XP002174098, ISSN: 0167-4412 *
SILVA FILHO MARCIO DE CASTRO ET AL: "Mitochondrial and chloroplast targeting sequences in tandem modify protein import specificity in plant organelles.", PLANT MOLECULAR BIOLOGY, vol. 30, no. 4, 1996, pages 769 - 780, XP002174093, ISSN: 0167-4412 *

Also Published As

Publication number Publication date
DE10014412A1 (de) 2001-10-04
AU2001237217A1 (en) 2001-10-08

Similar Documents

Publication Publication Date Title
EP0616035A2 (de) Transgener Pathogen-resistenter Organismus
WO1996023891A1 (de) Stresstolerante pflanzen und verfahren zu deren herstellung
DE69633568T2 (de) Expressionskontrollesequenz zur allgemeinen und effektiven genexpression in pflanzen
WO2002012474A2 (de) Verfahren zur selektion auf wirtszellen mit eliminierten dna-sequenzen
WO2001012827A9 (de) Verfahren zur herstellung transgener pflanzen mit erhöhtem tocopherol-gehalt
AU7284898A (en) Anti-bacterial protein extracts from seeds of marigold and paprika
EP1272645B1 (de) Produktion nicht-kariogener zucker in transgenen pflanzen
DE10047286B4 (de) Isomalt produzierende transgene Pflanze
WO2001059135A1 (de) Verfahren zur beeinflussung der pollenentwicklung durch veränderung des saccharosestoffwechsels
DE10049267B4 (de) Verfahren zur Erzeugung oder Erhöhung einer Resistenz in Organismen gegenüber biotischen Streßfaktoren
DE69938144T2 (de) Antikörper-vermittelte verminderungsregulation von pflanzenproteinen
WO2001073085A1 (de) Expressionsvektoren zur anreicherung eines rekombinant hergestellten proteins in unterschiedlichen zellkompartimenten
DE4439748A1 (de) Verfahren zur Veränderung des Blühverhaltens bei Pflanzen
EP1458230A1 (de) Produktion von rekombinanten antikörpern mittels fusion mit elastin-ähnlichen peptiden
EP1144610B1 (de) Verfahren zur gesteuerten nach-ernte-produktion von proteinen in pflanzen
WO2001073086A2 (de) Verfahren zur genetischen modifizierung einer pflanze
WO2001088164A1 (de) Induzierbare eliminierung von dna-sequenzen in pflanzen
WO2000060101A1 (de) Metabolische selektionsmarker für pflanzen
WO2003014364A1 (de) Verfahren zur beeinflussung der mineralstoffaufnahme in transgenen pflanzen
DE10318087B4 (de) Genetische Kontrolle von Blühzeitpunkt und Pathogenbefall in Pflanzen
EP2342345A1 (de) Ngf-produktion in pflanzen
WO2001059131A2 (de) Verwendung von palatinase- und trehalulase-sequenzen als nutritive marker in transformierten zellen
DE10040179A1 (de) Beeinflussung der Verteilung von Metallen in transgenen Pflanzen
DE10050233A1 (de) Verfahren zur genetischen Modifizierung einer Pflanze

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: FESTSTELLUNG EINES RECHTSVERLUSTS NACH REGEL 69(1) EPUE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP