WO2001072768A2 - Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same - Google Patents

Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same Download PDF

Info

Publication number
WO2001072768A2
WO2001072768A2 PCT/IL2001/000260 IL0100260W WO0172768A2 WO 2001072768 A2 WO2001072768 A2 WO 2001072768A2 IL 0100260 W IL0100260 W IL 0100260W WO 0172768 A2 WO0172768 A2 WO 0172768A2
Authority
WO
WIPO (PCT)
Prior art keywords
cell
nucleic acid
mhc class
peptide
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IL2001/000260
Other languages
English (en)
French (fr)
Other versions
WO2001072768A8 (en
WO2001072768A3 (en
Inventor
Yoram Reiter
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Technion Research and Development Foundation Ltd
Original Assignee
Technion Research and Development Foundation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DE60142475T priority Critical patent/DE60142475D1/de
Priority to AT01914159T priority patent/ATE472601T1/de
Priority to EP01914159A priority patent/EP1294748B1/en
Priority to IL15186001A priority patent/IL151860A0/xx
Priority to JP2001571699A priority patent/JP2004503213A/ja
Priority to CA002404489A priority patent/CA2404489A1/en
Application filed by Technion Research and Development Foundation Ltd filed Critical Technion Research and Development Foundation Ltd
Priority to AU39534/01A priority patent/AU785493B2/en
Publication of WO2001072768A2 publication Critical patent/WO2001072768A2/en
Anticipated expiration legal-status Critical
Publication of WO2001072768A3 publication Critical patent/WO2001072768A3/en
Publication of WO2001072768A8 publication Critical patent/WO2001072768A8/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70539MHC-molecules, e.g. HLA-molecules

Definitions

  • the present invention relates to methods of generating a functional mammalian single chain MHC class I complex in prokaryotic expression systems and a functional human single chain MHC class I complex in eukaryotic or prokaryotic expression systems, which complexes are capable of presenting specific antigenic peptides restricted to class I MHC and recognizable by specific CTL clones or CD+8 T- cells.
  • the present invention further relates to a method of generating a functional mammalian single chain MHC class I-peptide complex in eukaryotic, or preferably prokaryotic expression systems, to nucleic acid constructs encoding said single chain MHC class I complexes and to a novel human single chain MHC class I polypeptide.
  • MHC The major histocompatibility complex
  • H-2 The major histocompatibility complex
  • class I and class II each comprise a set of cell surface glycoproteins which play a role in determining tissue type and transplant compatibility.
  • CTLs cytotoxic T-cells
  • helper T-cells respond mainly against foreign class II glycoproteins.
  • Major histocompatibility complex (MHC) class I molecules are expressed on the surface of nearly all cells.
  • the class I MHC molecule is a heterodimer composed of a 46-kDa heavy chain which is non-covalently associated with the 12-kDa light chain ⁇ -2 microglobulin.
  • Class I MHC-restricted peptides which are typically 8-10-amino acid-long, bind to the heavy chain ⁇ l- ⁇ 2 groove via two or three anchor residues that interact with corresponding binding pockets in the MHC molecule.
  • the ⁇ -2 microglobulin chain plays an important role in MHC class I intracellular transport, peptide binding, and conformational stability [5].
  • the formation of a heterodimer consisting of the MHC class I heavy chain, peptide (self or antigenic) and ⁇ -2 microglobulin is required for biosynthetic maturation and cell-surface expression [5].
  • CTLs have an important role in the control of many diseases, including chronic viral diseases, such as AIDS, and cancer have lead to an increased need to produce sufficient amounts of stable class I MHC complexes for functional and structural studies.
  • Soluble MHC molecules bound to various peptides are a valuable tool for the study of disease-related immune responses, for characterizing MHC-T-cell receptor (TCR) interactions [6], for structural studies [4]. and more recently for direct visualization of antigen-specific T cells [8]. These molecules can be also used to activate specific CTLs in vitro as well as to study their phenotypic characteristics.
  • Soluble MHC multimers posses a higher avidity for T-cells since they provide multi-point binding of TCRs with their MHC-peptide ligands.
  • multimeric forms (tetramers) of MHC-peptide complexes have been the center of much interest recently, because they can be used for direct phenotypic characterization of T cell responses in normal as well as pathological conditions, thus, providing insight into the pathopysiology and mechanisms of various diseases.
  • the expressed polypeptides form a functional MHC complex they bind peptides endogenously derived from the cells utilized for expression and as such the purified MHC complex must be subjected to a peptide exchange step following purification [13].
  • the production yields of these single-chain MHC-peptide complexes was limited, typically reaching levels of several hundred micrograms per liter of culture supernatant.
  • the present invention provides a novel approach for the production of unprecedented large amounts of soluble, stable and functional MHC-peptide complex by utilizing high level bacterial expression of a single-chain MHC class I polypeptide or co-expression of the single chain MHC class I polypeptide and an MHC class I restricted antigenic peptide followed by in-vitro reconstitution of the scMHC class I-peptide complex via redox-shuffling and refolding in the presence of the antigenic peptide.
  • the present invention further provides a novel human single chain MHC class I polypeptide which is functional and which can therefore be utilized in either the monomeric or preferably the multimeric form to present MHC class I restricted antigenic peptides to CTL clones or to CD8+ T-cells from various sources.
  • nucleic acid construct comprising a first nucleic acid sequence including a first polynucleotide encoding a functional human ⁇ - microglobulin, being translationally fused upstream of a second polynucleotide encoding a functional human MHC class I heavy chain.
  • the nucleic acid construct further comprising a second nucleic acid sequence encoding an antigenic peptide, the antigenic peptide being capable of binding a human MHC class I complex.
  • the second polynucleotide encodes ⁇ 1-3 domains of the human MHC class I heavy chain.
  • a nucleic acid construct comprising (a) a first nucleic acid sequence including (i) a first polynucleotide encoding a functional mammalian ⁇ -2 microglobulin; and (ii) a second polynucleotide encoding a functional mammalian MHC class I heavy chain, the second polynucleotide being translationally fused downstream of the first polynucleotide; and (b) a cis acting regulatory sequence being selected capable for directing expression of the first nucleic acid sequence in bacteria.
  • the cis acting regulatory sequence is selected from the group consisting of a bacterial derived cis acting regulatory sequence and a phage derived cis acting regulatory sequence.
  • a transformed cell comprising any of the nucleic acid constructs described herein.
  • the cell can be a eukaryotic cell, such as, for example, a mammalian cell, an insect cell, a plant cell, a yeast cell and a protozoa cell, or alternatively, the cell can be a bacterial cell.
  • a host cell being co-transformed with (a) a first expression construct including a first polynucleotide encoding a functional mammalian ⁇ -2 microglobulin, being translationally fused upstream of a second polynucleotide encoding a functional MHC class I heavy chain; and (b) a second expression construct including a third polynucleotide encoding an antigenic peptide, wherein when the first, second and third polynucleotides are co-expressed in the host cell, an MHC class I- antigenic peptide complex is formed.
  • the first nucleic acid sequence further includes an in-frame linker polynucleotide encoding a linker peptide interposed between the first and the second polynucleotides.
  • the first nucleic acid sequence further includes an in-frame tag sequence encoding a peptide capable of being enzymatically modified to include a binding entity.
  • linker peptide is as set forth in SEQ ID NO: 10.
  • nucleic acid construct further comprising a first cis acting regulatory sequence for regulating expression of the first nucleic acid sequence.
  • nucleic acid construct further comprising a second cis acting regulatory sequence for regulating expression of the second nucleic acid sequence.
  • the cis acting regulator)' sequence is functional in a bacterial host.
  • a recombinant polypeptide comprising an amino acid sequence including a functional human ⁇ -2 microglobulin directly or indirectly covalently linked to a functional human MHC class I heavy chain.
  • the recombinant polypeptide further comprising a linker peptide being interposed between the functional human ⁇ -2 microglobulin and the functional human MHC class I heavy chain.
  • the recombinant polypeptide comprising an amino acid sequence as set forth in SEQ ID NO:5
  • a preparation of bacterial derived inclusion bodies comprising over 30 percent by weight of a recombinant polypeptide including an amino acid sequence including a functional mammalian ⁇ -2 microglobulin directly or indirectly covalently linked to a functional mammalian MHC class I heavy chain.
  • a method of producing a functional MHC class I molecule comprising the steps of (a) expressing, in bacteria, a single chain MHC class I polypeptide including a functional mammalian ⁇ -2 microglobulin amino acid sequence directly or indirectly covalently linked to a functional mammalian MHC class I heavy chain amino acid sequence; and (b) isolating the single chain MHC class I polypeptide.
  • the method further comprising the step of (c) refolding the single chain MHC class I polypeptide in presence of an antigenic peptide capable of binding the single chain MHC class I polypeptide, to thereby generate an MHC class I-antigenic peptide complex.
  • the method further comprising the step of (d) isolating the MHC class I-antigenic peptide complex via size exclusion chromatography.
  • the antigenic peptide is co-expressed along with the single chain MHC class I polypeptide in the bacteria.
  • step (a) is effected such that the single chain MHC class I polypeptide forms inclusion bodies in the bacteria.
  • the antigenic peptide and the single chain MHC class I polypeptide form inclusion bodies in the bacteria.
  • the step of isolating the polypeptide further includes the steps of (i) denaturing the inclusion bodies so as to release protein molecules therefrom; and (ii) renaturing the protein molecules.
  • the antigenic peptide is co-expressed along with the single chain MHC class I polypeptide in the bacteria.
  • the mammalian ⁇ -2 microglobulin amino acid sequence is a human ⁇ -2 microglobulin amino acid sequence and further wherein the mammalian MHC class I heavy chain amino acid sequence is a human
  • MHC class I heavy chain amino acid sequence According to still another aspect of the present invention, there is provided a multimeric MHC class I complex comprising a plurality of recombinant polypeptide monomers each including a functional human ⁇
  • microglobulin directly or indirectly covalently linked to a functional human MHC class I heavy chain.
  • the plurality of recombinant polypeptide monomers are linked to a common substrate.
  • the present invention successfully addresses the shortcomings of the presently known configurations by providing a method of generating large quantities of pure single chain MHC class I polypeptides which can be utilized in monomeric or multimeric form to present antigenic peptides to CTL clones.
  • the present invention further addresses the shortcomings of the presently known configurations by providing, for the first time, a human single chain MHC class I polypeptide functional in both monomeric and multimeric form in presenting antigenic peptides to CTL clones.
  • FIG. 1 illustrates the various expression cassettes of the present invention which were cloned into a bacterial expression vector.
  • FIGs. 2a-b are SDS page gels depicting the analysis of the expression products of the various constructs of Figure 1.
  • the ⁇ -2 microglobulin, HLA-A2, and the scMHC polypeptides were expressed in E. Coli BL21 cells and the polypeptides accumulated as insoluble inclusion bodies. Inclusion bodies were purified and analyzed by reduced SDS-PAGE electrophoresis on 10% gels, ⁇ -2 - human ⁇ -2 microglobulin, HLA-A2 - human MHC class I heavy, S.C. ⁇ 2-A2 - human scMHC class I and S.C. ⁇ 2-A2-BirA human scMHC-BirA. Arrows indicate molecular size markers. In all cases, the recombinant polypeptide expressed comprised >90% of total inclusion body protein.
  • FIGs. 3a-c are SDS-PAGE gels depicting the analysis of refolded purified single-chain MHC-peptide complexes. scMHC-peptide complexes were generated by refolding of purified solubilized inclusion bodies in the presence of antigenic peptides as described in the Examples section.
  • FIG. 4 is a CD spectra analysis of a refolded single-chain MHC- peptide complex collected and analyzed as described in the Examples section below.
  • FIGs. 5a-b are graphs depicting antibody analysis of single-chain
  • FIGs. 6a-c depict mass spectroscopy analysis of single-chain MHC-peptide complexes.
  • the scMHC-209 complex was resolved by HPLC on a C-8 hydrophobic column, and eluted with a linear gradient of acetonitrile in TFA, The sample was microsprayed directly from the HPLC column into an electrospray ion trap (ESI) mass spectrometer (LCQ) and analyzed in the positive ion mode.
  • ESI electrospray ion trap
  • LCQ mass spectrometer
  • FIGs. 7a-c are graphs depicting the biological activity of single- chain MHC-peptide complexes as determined by measuring the release of IFNg from specific CTL clones.
  • Figure 7a depicts the ability of various scMHC-peptide complexes coated onto microtiter plates to activate the G9-209-2M specific CTL clone R6C 12. Spontaneous release (Spont) was determined by incubation of CTLs in wells that were not coated with the various complexes.
  • Figure 7b depicts the role of peptide specificity in CTL activation. scMHC tetramers complexed with the G9-209-2M peptide were generated as described in the Examples section.
  • the soluble tetramers were incubated with the 209-specific CTL clone R6C12 or with the Mart- 1 -specific clone JB2F4 as indicated. Spontaneous IFNg release was determined by incubating the CTL clones with the unbiotinylated scMHC-peptide complex (which does not support tetramer formation).
  • Figure 7c depicts the dependency of CTLs activation on tetramer formation.
  • the 209-specific CTL clone R6C 12 was incubated with various biotinylated or unbiotinylated scMHC-BirA- peptide complexes and streptavidin.
  • FIGs. 8a-e are microscopic images of microtiter plate wells containing the G9-209-2M - specific CTL clone R6C 12 incubated with biotinylated and thus tetramer forming scMHC-BirA-209 complexes or unbiotinylated scMHC-BirA-209 complexes which are incapable of forming tetramers and which served as controls.
  • FIGs. 9a-b are FACS analysis images of CTL clones specific for the MART-1 peptide 27-35 incubated with either scMHC-BirA/MART-1 PE-labeled tetramers ( Figure 9a) or with scMHC-Bir A/TAX PE-labeled tetramers ( Figure 9b) and co-stained with FITC-labeled anti CD8 antibody. Specific staining of high avidity CTLs was observed only when using the specific and functional MART-1 peptide-containing scMHC tetramer.
  • FIGs. lOa-b are FACS analysis images of a heterogeneous population of T-cells from an HLA-A2 transgenic mice immunized with the TAX peptide.
  • Figure 10a is the FACS image of T- cells from non- immunized mice stained with scMHC-BirA/TAX tetramer and
  • Figure 10b is the FACS image of T-cells from TAX-immunized mice stained with the tetramers. Both preparations were also double stained with anti- CD8.
  • the present invention is of methods of generating a functional mammalian single chain MHC class I complex in prokaryotic expression systems and a functional human single chain MHC class I complex in eukaryotic or prokaryotic expression systems, which complexes are capable of presenting specific antigenic peptides restricted to specific
  • the present invention is further of a method of generating a functional mammalian single chain MHC class I-peptide complex in eukaryotic, or preferably prokaryotic expression systems.
  • the present invention is also of nucleic acid constructs encoding said single chain
  • MHC class I complexes and of a novel human single chain MHC class I polypeptide are novel human single chain MHC class I polypeptide.
  • MHC- peptide complexes One of the limitations in generating and using recombinant MHC- peptide complexes is a relatively low production efficiency. Most of the present studies utilize production methods that are based on transfection of cells with MHC constructs which express and secrete either scMHC or complexed MHC to the cell culture medium [12-23]. These complexes contain peptides from endogenously-expressed proteins which have to be subsequently exchanged with the desired peptide to be displayed in the complex [13].
  • Coli constitute an efficient new way for the generation of unprecedented large amounts (e.g., grams) of highly purified and functional MFIC-peptide complexes, as well as MHC-peptide tetramers.
  • human scMHC-peptide complexes generated from E. Coli inclusion bodies by in vitro refolding in the presence of antigenic peptides are highly pure and functional.
  • nucleic acid construct which includes a first nucleic acid sequence including a first polynucleotide encoding a functional human ⁇ - 2 microglobulin translationally fused upstream of a second polynucleotide encoding a functional human MHC class I heavy chain.
  • the term "functional" when used in reference to the ⁇ -2 microglobulin and heavy chain polypeptides regions of a single chain MHC class I complex refers to any portion of each which is capable of contributing to the assembly of a functional single chain MHC class I complex (i.e., capable of binding and presenting to CTLs specific antigenic peptides when complexed).
  • the first polynucleotide encodes the entire ⁇ -2 microglobulin polypeptide w hile
  • the second polynucleotide encodes the ⁇ 1-3 domains of the heavy chain.
  • the phrases "translationally fused” and "in frame” are interchangeably used herein to refer to polynucleotides w hich are covalently linked to form a single continuous open reading frame spanning the length of the coding sequences of the linked polynucleotides.
  • Such polynucleotides can be covalently linked directly or preferably indirectly through a spacer or linker region.
  • the nucleic acid sequence further includes an in-frame linker polynucleotide. This linker polynucleotide encodes a linker peptide and is interposed between the first and said second polynucleotides.
  • the linker peptide is selected of an amino acid sequence w hich is inherently flexible, such that the polypeptides encoded by the first and said second polynucleotides independently and natively fold following expression thereof, thus facilitating the formation of a functional single chain (sc) human MHC class I complex.
  • the linker peptide is as set forth in SEQ ID NO: 10.
  • the first nucleic acid sequence of this aspect of the present invention encodes a functional human single chain MHC class I polypeptide.
  • the first nucleic acid sequence is as set forth in SEQ ID NO: 4.
  • the first nucleic acid sequence further includes an in-frame tag sequence (such as that set forth in SEQ ID NO:20) which encodes a peptide capable of being enzymatically modified to include a binding entity.
  • the binding entity which can be.
  • biotin can be utilized by the present invention to assemble a plurality of scMHC class I polypeptides into multimers, by providing a ligand, such as avidin or streptavidin which serves as a common attachment entity for the scMFIC class I polypeptides.
  • a ligand such as avidin or streptavidin which serves as a common attachment entity for the scMFIC class I polypeptides.
  • MHC class I multimers are particularly advantageous for peptide mediated CTL activation as is further described in the Examples section which follows.
  • the nucleic acid construct further includes a first cis acting regulatory sequence.
  • the cis acting regulatory sequence can include a promoter sequence and additional transcriptional or a translational enhancer sequences all of which serve for facilitating the expression of the nucleic acid sequence when introduced into a host cell. Specific examples of promoters are described hereinbelow in context of various eukaryotic and prokaryotic expression systems and in the Examples section which follows.
  • the nucleic acid construct of this aspect of the present invention is capable of expressing in a host cell, a recombinant human single chain MHC class I polypeptide which includes the functional human ⁇ -2 microglobulin and the functional human MHC class I heavy chain and a linker peptide interposed therebetween.
  • a recombinant human single chain MHC class I polypeptide which includes the functional human ⁇ -2 microglobulin and the functional human MHC class I heavy chain and a linker peptide interposed therebetween.
  • the expressible recombinant polypeptide is as set forth in SEQ ID NO: 5
  • the nucleic acid construct also includes a second nucleic acid sequence encoding an antigenic peptide.
  • the antigenic peptide is selected such that it is capable of binding a human MHC class I complex.
  • various CTL specific antigenic peptides can be encoded by the second nucleic acid sequence, including but not limited to cancer cell derived antigenic peptides, virally derived antigenic peptides and the like.
  • the nucleic acid construct includes a second cis acting regulatory sequence which serves for expressing the second nucleic acid sequence when introduced into a host cell.
  • a single cis acting regulatory sequence can be utilized by the nucleic acid construct to direct transcription of a single transcript which includes the first and second nucleic acid sequence.
  • an internal ribosome entry site IVS
  • IVS internal ribosome entry site
  • the two nucleic acid sequences can alternatively be included in two separate nucleic acid construct which can be utilized to co-transform a single cell.
  • nucleic acid construct or constructs must be configured such that the levels of expression of both the scMHC class I polypeptide and the binding peptide thereof are stoichiometrically correct (a 1 : 1 peptide to scMHC class I polypeptide ratio is preferred) so as to allow efficient assembly of the scMHC class I- peptide complex.
  • the promoter utilized by the nucleic acid construct(s) of the present invention is a strong constitutive promoter such that high levels of expression are attained for the first and second nucleic acid sequences following host cell transformation.
  • high levels of expression can also be effected by transforming the host cell with a high copy number of the nucleic acid construct, or by utilizing cis acting sequences which stabilize the resultant transcript and as such decrease the degradation or "turn-over" of such a transcript.
  • a transformed host cell including the nucleic acid construct or constructs described above.
  • the phrase "transformed cell” describes a cell into which an exogenous nucleic acid sequence is introduced to thereby stabily or transiently genetically alter the host cell. It may occur under natural or artificial conditions using various methods well known in the art some of which are described in detail hereinbelow in context with specific examples of host cells.
  • the transformed host cell can be a eukaryotic cell, such as, for example, a mammalian cell, an insect cell, a plant cell, a yeast cell and a protozoa cell, or alternatively, the cell can be a bacterial cell.
  • the nucleic acid construct(s) according to the present invention can be a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for expression in eukaryotic host cells.
  • the nucleic acid construct(s) according to the present invention can be, for example, a plasmid, a bacmid, a phagemid, a cosmid, a phage, a virus or an artificial chromosome.
  • the host cell is a mammalian cell of, for example, a mammalian cell culture.
  • suitable mammalian expression systems include, but are not limited to, pcDNA3, pcDNA3.1 (+/-), pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, which are available from Invitrogen, pCI which is available from Promega, pBK-RSV and pBK-CMV which are available from Stratagene, pTRES which is available from Clontech, and their derivatives.
  • Insect cell cultures can also be utilized to express the nucleic acid sequences of the present invention.
  • suitable insect expression systems include, but are not limited to the baculovirus expression system and its derivatives which are commercially available from numerous suppliers such as Invitrogen (maxBacTM), Clontech (BacPakTM), or Gibco (Bac-to-
  • plant cell can refer to plant protoplasts, cells of a plant tissue culture, cells of plant derived tissues or cells of whole plants.
  • nucleic acid constructs there are various methods of introducing nucleic acid constructs into plant cells. Such methods rely on either stable integration of the nucleic acid construct or a portion thereof into the genome of the plant cell, or on transient expression of the nucleic acid construct in which case these sequences are not stabily integrated into the genome of the plant cell. There are two principle methods of effecting stable genomic integration of exogenous nucleic acid sequences such as those included within the nucleic acid construct of the present invention into plant cell genomes:
  • the Agrobacterium system includes the use of plasmid vectors that contain defined DNA segments that integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf disc procedure, see for example, Horsch et al. in Plant Molecular Biology Manual A5, Kluwer Academic Publishers, Dordrecht (1988) p. 1-9. A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially viable in the creation of stabily transformed dicotyledenous plants.
  • suitable plant promoters which can be utilized for plant cell expression of the first and second nucleic acid sequences, include, but are not limited to CaMV 35S promoter, ubiquitin promoter, and other strong promoters which can express the nucleic acid sequences in a constitutive or tissue specific manner.
  • Plant viruses can also be used as transformation vectors. Viruses that have been shown to be useful for the transformation of plant cell hosts include CaV, TMV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855.237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al, Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172- 189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
  • the constructions can be made to the virus itself.
  • the virus can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the nucleic acid sequences described above. The virus can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA.
  • the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions.
  • RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
  • Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of the present invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.
  • Yeast cells can also be utilized as host cells by the present invention. Numerous examples of yeast expression vectors suitable for expression of the nucleic acid sequences of the present invention in yeast are known in the art. Such vectors are usually introduced in a yeast host cell via chemical or electroporation transformation methods well known in the art. Commercially available systems include, for example, the pYESTM (Invitrogen) or the YEXTM (Clontech) expression systems.
  • the nucleic acid construct when expressed in eukaryotic expression systems such as those described above, preferably includes a signal peptide encoding sequence such that the polypeptides produced from the first and second nucleic acid sequences are directed via the attached signal peptide into secretion pathways.
  • the expressed polypeptides in mammalian, insect and yeast host cells, can be secreted to the growth medium, while in plant expression systems the polypeptides can be secreted into the apoplast, or directed into a subcellular organelle.
  • the host cell is a bacterial cell, such as for example, E. coli.
  • a bacterial host can be transformed with the nucleic acid sequence via transformation methods well known in the art, including for example, chemical transformation (e.g., CaCl 2 ) or electroporation.
  • transformation methods well known in the art, including for example, chemical transformation (e.g., CaCl 2 ) or electroporation.
  • Numerous examples of bacterial expression systems which can be utilized to express the nucleic acid sequences of the present invention are known in the art.
  • Commercially available bacterial expression systems include, but are not limited to, the pETTM expression system (Novagen), pSETM expression system (Invitrogen) or the pGEXTM expression system (Amersham).
  • bacterial expression is particularly advantageous since the expressed polypeptides form substantially pure inclusion bodies readily amenable to recovery and purification of the expressed polypeptide.
  • a preparation of bacterial derived inclusion bodies which are composed of over 30 percent, preferably over 50 %, more preferably over 75 %, most preferably over 90 % by weight of the recombinant human scMHC class I polypeptide of the present invention.
  • the isolation of such inclusion bodies and the purification of the scMHC class I polypeptide therefrom are described in detail in the Examples section which follows.
  • bacterial expression of an scMHC class I polypeptide can provide high quantities of pure and functional scMHC class I polypeptides.
  • the method of the present invention can also be applied to bacterially express mammalian scMHC class I polypeptides which to date have been expressed, with limited success, only in eukaryotic expression system.
  • a nucleic acid construct which includes a nucleic acid sequence including a first polynucleotide encoding a functional mammalian ⁇ -2 microglobulin.
  • the nucleic acid construct further includes a second polynucleotide encoding a functional mammalian MHC class I heavy chain which is translationally fused downstream of the first polynucleotide.
  • the nucleic acid construct according to this aspect of the present invention further includes a cis acting regulatory sequence which is capable of directing expression of the nucleic acid sequence in bacteria. Suitable promoters and bacterial expression systems which can be utilized to express the nucleic acid sequence of this aspect of the present invention are described hereinabove.
  • the nucleic acid sequence according to this aspect of the present invention can be derived from, or synthesized according to, the MHC class I encoding sequences of a mammal such as. but not limited to, a mouse, a rat, a pig. and a rabbit.
  • the present invention provides various expression constructs which can be utilized to express scMHC class I polypeptides preferably along with binding peptides thereof in eukaryotic or preferably bacterial expression systems.
  • a method of producing a functional MHC class I molecule the method according to this aspect of the present invention utilizes any of the nucleic acid constructs described for expressing, in bacteria, a single chain MHC class I polypeptide including a functional mammalian ⁇ -2 microglobulin amino acid sequence directly or indirectly covalently linked to a functional mammalian MHC class I heavy chain amino acid sequence.
  • the single chain MHC class I polypeptide is isolated and purified as described below.
  • the expressed polypeptide forms substantially pure inclusion bodies which are readily isolated via fractionation techniques well known in the art and purified via for example denaturing-renaturing steps.
  • the single chain MHC class I polypeptide is renatured and refolded in the presence of an antigenic peptide capable of binding the single chain MHC class I polypeptide.
  • an antigenic peptide capable of binding the single chain MHC class I polypeptide.
  • this enables to generate a substantially pure MHC class I-antigenic peptide complex which can further be purified via size exclusion chromatography.
  • antigenic peptide used for refolding can be co-expressed along with the single chain MHC class I polypeptide in the bacteria.
  • expressed polypeptide and peptide co- form inclusion bodies which can be isolated and utilized for MHC class I-antigenic peptide complex formation.
  • G9-280-9V YLEPGPVTV SEQ ID NO:2
  • G9-280-9V YLEPGPVTV SEQ ID NO:2
  • TAX 1 1-19 HTLV- 1 peptide (LLFGYPVYV, SEQ ID NO:3) was used as a control [53].
  • a cDNA construct (SEQ ID NO:4) encoding a single-chain (sc) MHC polypeptide (SEQ ID NO:5) which includes the first three extracellular domains of HLA-A2 (HL A- A* 0201, amino acids 1-275 SEQ ID NO:6) and the human ⁇ 2-microglobulin polypeptide (SEQ ID NO:7) was assembled from ⁇ l-3 and ⁇ -2 microglobulin cDNAs derived from the human T-B cell hybrid T2 cell line [27].
  • the human ⁇ -2 microglobulin was PCR amplified using b2M-5, 5'- AGGAGATATACATATGATCCAGCGTACTCCAAAGAT-3' (SEQ ID NO:8) and b2M-3, 5 * -CGGGCTTTGTTAGCAGCC GAATTCATTACA TGTCTCGATCCCACTTAAC-3' (SEQ ID NO:9) and linked via a 15 residue flexible linker (Gly-Ser4) 3 (SEQ ID NO: 10) to the N-terminus of the HLA-A2 heavy chain which was PCR amplified using A2-5, 5'-GGAGATATACATATGGGCTCTCACTC
  • CATGAGGTA-3' (SEQ ID NO: l l) and A2-3, 5'- CGGGCTTTGTTAGCAGCCGAATTCATTAGGT GAGGGGCTTG GGCAA-3' (SEQ ID NO: 12) primers.
  • the cDNAs of both chains were used in a two-step PCR overlap extension reaction in which the 3 ⁇ -end of the ⁇ -2 microglobulin was connected to the 5 '-end of the HLA-A2 gene.
  • the ⁇ -2 microglobulin and HLA-A2 PCR products were combined in a 1 : 1 ratio and the reaction was PCR amplified using the b2M-L5 and A2-L3 primers, the PCR product was purified and subcloned into the pET-based expression vector.
  • the HLA-A2 and ⁇ -2 microglobulin coding sequences described above were also separately cloned in pET21 for independent expression.
  • the scMHC-BirA coding sequence included a peptide sequence for site specific biotinylation (LGGIFEAMKMELRD, SEQ ID NO: 17), the lysine residue biotinylated underlined) linked to HLA-A2 N-terminus via a short linker (QSTRGGASGGG, SEQ ID NO: 18).
  • the scMHC-BirA coding sequence was PCR amplified using B2M-BirA-3, 5'- CAGTAAAAGCTTTTTATCAGCCTCCGAACTGTG GATGCCTCCACGCCGAACCTCCACCAGAACCACCTCCGGACCC GCCACCTCCCTCCCATCTCAGGGT -3' (SEQ ID NO: 19) and the b2M-L5 primer described above.
  • the resultant PCR product which included the BirA recognition sequence (SEQ ID NO:20) was purified digested and subcloned into a bacterial expression vector as shown in Figure 1.
  • HLA-A2, ⁇ -2 microglobulin, and the scMHC constructs subcloned into pET21 were expressed under IPTG induction, forming intracellular inclusion bodies in BL-21 DE3 cells. Inclusion bodies were isolated and purified from the induced BL21 cells and solubilized in 6M Guanidine HCl pH 7.4.
  • inclusion bodies were refolded in a redox-shuffling buffer system (0.1M Tris, 0.5M Arginine, 0.09 mM oxidized glutathione, pH 8.0) in the presence of a 5 to 10 molar excess of the antigenic peptides derived from gplOO or the HTLV-1 viral peptide described above [26,52].
  • a redox-shuffling buffer system 0.1M Tris, 0.5M Arginine, 0.09 mM oxidized glutathione, pH 8.0
  • the protein was dialyzed and concentrated by a Minisette system (Filtron, Northborough, MA) using a 10K cutoff cassette. Soluble scMHC-peptide complexes were purified by size- exclusion chromatography on TSK3000 column (TOSOHAAS, Montgomeryville, PA) using PBS as an elution buffer.
  • the s.c-b2-A2-BirA (scMHC-BirA) construct also expressed as described above was refolded in the presence of peptides 209 or 280 and purified by size exclusion chromatography on TSK3000 column (elution buffer lOmM Tris-HCl pH 8).
  • the scMHC-peptide-BirA complexes were concentrated to 20-30 mM (1-1.5 mg/ml) by Centricon 30 (Amicon) and were then subjected to enzymatic biotinylation for 16 hr at 25 C using a biotin protein ligase- Bir A enzyme (AVIDITY).
  • biotinylated or unbiotinylated scMHC-BirA-peptide complexes were incubated for 30 minutes at room temperature with washed MagnaBind streptavidin beads (PIERCE). An external magnetic field was used to separate biotinylated complexes bound to the beads from unbound material. The supernatant was pooled away from bound sample and the beads were blocked with 2% MPBS (PBS + 2% semi-skimmed milk powder) for 30 minutes at room temperature. The biotinylated complexes were subsequently assayed with the conformational dependent antibody W6/32 and detected using anti- mouse IgG-peroxidase.
  • the circular dichroism spectra of the scMHC-peptide complexes was measured at room temperature via a spectropolarimeter (JASCO 500) adjusted to a sensitivity of 0.5 mdeg/cm and a scan speed of 10 nm/minute. Scans were performed between 195 and 275 nm at a protein concentration of 0.27 mg/ml. Secondary structure calculations were measured using published programs [29].
  • the mass estimation of the proteins was done using the deconvolution algorithm, which transforms an ESI mass spectral plot of relative abundance versus mass-to-charge ratios into a plot of relative abundance versus mass.
  • Each sequence of multiply charged ion peaks in the acquired mass spectrum corresponding to one sample component, is converted into a single peak positioned at the molecular mass M in the deconvoluted spectrum.
  • CTL clones specific for melanoma peptides were provided by Drs. Steven Rosenberg and Mark Dudley (Surgery Branch, National Cancer Institute, NIH). These CTL clones were generated by cloning from bulk cultures of PBMCs acquired from patients receiving peptide immunizations [24]. The CTLs were subsequently expanded using irradiated PBMCs and the OKT3 antibody (30 ng/ml) in the presence of 50 CU/ml IL-2.
  • the CTL clones (1x10 /well) were washed in tissue culture medium and incubated in duplicates or triplicates with various concentrations of scMHC-peptide tetramers in tissue culture medium for 24 hrs at 37 °C.
  • scMHC-peptide complexes were immobilized onto Maxisorb immunoplates over night at 4 °C and CTL clones in culture medium were subsequently added to the wells and incubated for 24 hrs at 37 °C.
  • supernatants were collected via centrifugation and IL-2 and IFNg present in the culture supernatants were assayed using a double sandwich antibody-capture 5 enzyme immunoassay (Flexia, BIOSOURCE, Camarillo. CA). Concentrations of IL-2 and INF ⁇ in the culture supernatants was determined against a calibration curve of recombinant human IL-2 and INF ⁇ .
  • Purified inclusion bodies contained 80-90% recombinant scMHC. Inclusion bodies were purified, solubilized in 6M guanidine HCl, and refolded by in vitro redox-shuffling buffer system in the presence of the antigenic peptide. Three different peptides were used
  • Two peptides are tumor associated antigens derived from the melanoma common antigen gplOO [26] and one is a viral peptide derived from HTLV-1 (TAX) [53]. These peptides were previously shown to be HLA-A2 restricted [26, 53]. Refolded complexes were dialyzed and concentrated following by purification using size-exclusion chromatography on TSK3000 column.
  • the refolded scMLIC-peptide complexes were also assayed using conformation-specific antibodies, which recognize MHC-peptide complexes only when correctly folded.
  • the anti- HLA-A2 specific mAb fragment BB7.2 and the mAb fragment W6/32 specific for a fully assembled, peptide-containing HLA-A2 detected soluble scMHC-peptide complex.
  • the W6/32 antibody specifically recognized, in a concentration dependent manner, the refolded and purified scMHC complexes containing any of the two gplOO-derived peptides indicating that the complexes are correctly folded, include the peptide, and are structurally functional.
  • Mass spectrometry analysis was performed in order to clearly demonstrate that the scMHC complex is folded correctly and includes the peptide.
  • the refolded and purified complex was concentrated to 6 mg/ml and a sample was subjected to analysis by electron spray mass spectrometry.
  • the complex sample was first resolved by HPLC on a C-8 column and was subsequently eluted with a linear gradient of Acetonitrile in TFA, leading to separate sequential elution of the peptide and the scMHC protein from the column.
  • the eluted samples were microsprayed directly from the HPLC column into an electrospray ion trap (ESI) mass spectrometer and analyzed in the positive ion mode.
  • ESI electrospray ion trap
  • the eluted peptide has an expected mass of 1035 dalton which corresponds to the mass of the G9-209-2M peptide used for refolding the scMHC-peptide complex. This was the only peptide detected indicating that the refolded complex is a homogenous population of molecules containing a single specific peptide. A minor peak with a mass of 1057 daltons was also observed, which peak corresponds to the G9-209-2M peptide including a sodium ion which probably originated from the PBS buffer in which the complex was purified and concentrated prior to analysis.
  • the mass estimation of the scMHC complex was done using a deconvolution algorithm, which transforms an ESI mass spectral plot of relative abundance versus mass-to-charge ratios into a plot of relative abundance versus mass ( Figures 6b-c).
  • Each sequence of multiply charged ion peaks in the acquired mass spectrum ( Figure 6b) which corresponds to one sample component, is converted into a single peak positioned at the molecular mass (M) in the deconvoluted spectrum ( Figure 6c).
  • the deconvoluted spectrum revealed a single peak with a mass of 44.6 kDa corresponding to the expected molecular weight of the scMHC protein.
  • a CTL stimulation assay using cloned CTLs specific for the G9- 209-2M peptide was utilized to test the biological activity of the scMHC- peptide complex.
  • the recombinant purified scMHC complexes that were produced with the 3 different peptides (G9-209-2M, G9-280-9V, and TAX) were immobilized on a microtiter plate and tested for the ability to induce CTL activation.
  • Figure 7a the single-chain MHC molecule bound to the g9-209-2M peptide induced specific activation of the g209- specific CTL clone R6C12 as determined by interferon-g levels.
  • the complexes bound to the g280 and TAX peptides did not induce specific activation.
  • scMHC-peptide complexes The ability of soluble scMHC-peptide complexes to induce T cell activation in solution was also tested by generating scMHC-peptide tetramers composed of the scMHC-peptide molecule containing the sequence tag for site-specific biotinylation. Refolded and purified peptide containing scMHC-BirA complexes were biotinylated using the BirA enzyme. Following purification of the scMHC-BirA complexes tetramers were formed by incubation with streptavidin. The biological activity of the scMHC-BirA-peptide tetramers was tested by their ability to activate the corresponding CTL clone.
  • the scMHC tetramers also specifically stained CTL clones which recognize the MART-1 specific peptide 27-35. As shown in Figure 9a, the scMHC/Mart tetramers specifically recognized a specific CTL clone which was not recognized by the scMHC/TAX tetramers ( Figure 9b).
  • ScMHC tetramers were also used to stain a heterogeneous population of T cells from the spleen of transgenic mice (expressing
  • the scMHC tetramers generated according to the teachings of the present invention can be utilized to detect and isolate antigen-specific subpopulations of T cells.
  • the results presented herein suggest that the recombinant scMHC- peptide complexes generated according to the teachings of the present invention are functional, in both the monomeric and the complexed tetrameric forms.
  • Recombinant MHC-peptide tetramers are a very important tool for the molecular characterization of immune responses.
  • Fluorogenic tetramers have been widely used for the characterization of CTL responses and have afforded many advantages over previous techniques, particularly the ability to directly quantify and phenotype Ag-specific CTLs ex-vivo [32-35,38-53]. It has also been suggested that the enhanced avidity afforded by multimerization of peptide-MHC may allow binding to TCRs with affinities too low to ever generate ligand-induced physiological responses.
  • MHC-peptide tetramers can be utilized in the field of viral infections for direct visualization of antigen-specific CD8+ cells in HIV and EBV infection [33,40,41 ,45,52], animal models of viral infection [41-43] and direct analysis of viral-specific CD8+ cells in patients with human T cell lymphotropic virus-associated myelopathy [53].
  • MHC-peptide tetramers might also revolutionize the field of anti cancer immunity and immunotherapy since they can be used to identify low frequency anti-tumor CD8+ immune responses. This has already been demonstrated for melanoma where there is now considerable evidence that human tumors often express antigens that make them susceptible to lysis by CTLs [32,36,37,48,50]. Recently the use of tetrameric soluble class I MHC-peptide complexes for characterizing melanoma-specific CTL ex vivo has been reported [36]. An important advance in the field of immunotherapy will be the ability to use this technology for adoptive immunotherapy.
  • MHC-peptide tetramers will allow the isolation of CTLs specific for one melanoma epitope from a mixed CTL population using tetramer-driven cell sorting [36].
  • Polyclonal CTL lines can be utilized to efficiently lyse autologous tumor cells by generating monoclonal CTL lines against different melanoma epitopes using direct tetramer-driven CTL cloning [24,36].
  • the ability to efficiently generate recombinant MHC-peptide complexes, with a large variety of antigenic peptides, all related to one disease (for example, melanoma) may lead to improved modes of immunotherapy.
  • it will enable the simultaneous isolation and cloning of tumor-specific CTL clones specific for the various peptides ex-vivo, accompanied with specific PCR typing of tumor associated peptides expressed by individual patients.
  • the specific clones an then be expanded for adoptive transfer according to the tumor associated antigen (peptide) expression profile of the patient.
  • MHC-peptide complexes The availability of recombinant MHC-peptide complexes is of interest not only for the generation of MHC tetramers but also for rapid, sensitive, and reliable MHC-peptide binding assay to identify high affinity MHC binding T cell epitopes. These complexes can be used also in in-vitro primary CTL induction studies to define, among the various MHC binders, those peptides that are immunogenic.
  • CTL in vitro induction may be used for CTL in vitro induction as well as for the generation of MHC-peptide tetramers and analysis of specific immune responses or direct selection of CTLs from heterogeneous lymphocyte populations by tetramer-driven cell sorting and analysis.
  • Recombinant scMHC-peptide complexes can also be used to generate specific antibodies by phage display technology [54].
  • Such antibodies with TCR-like specificity can be a valuable tool for studying antigen presentation by tumor cells as well as to develop novel targeting agents for immunotherapy.
  • the expression method of the present invention provides an invaluable tool for advancing studies with MHC complexes by providing an easy and rapid method for producing large amounts of highly pure and functional monomeric or multimeric scMHC-peptide complexes without the need for arduous and time consuming purification steps such as peptide exchange employed by prior art methods.
  • the present invention provides a novel human single chain MHC class I polypeptide which is functional in activating CTL clones when utilized as either a monomer or a multimer.
  • scMHC constructs described above and any mammalian scMHC class polypeptides can also be co- expressed in E. coli or any other prokaryotic or eukaryotic expression systems along with the respective binding peptides thereof, thus negating the need for separately providing the binding peptide.
  • a single construct can be configured so as to express both the scMHC class I polypeptide and respective binding peptide coding sequences in the same cell by utilizing for example two separate promoters or an internal ribosome entry site.
  • the cells of the prokaryotic or eukaryotic expression system be co-transformed with two expression constructs each expressing a single coding sequence and each having a specific selection marker.
  • Suitable eukaryotic expression systems include, but are not limited to mammalian or insect cell cultures, plant protoplasts, plant cell cultures, whole plants, yeast cells or protozoan cells. It will be appreciated that when expressed in eukaryotic expression systems the produced scMHC class I polypeptide preferably includes a transit peptide (signal sequence) such that the expressed polypeptide is secreted outside the cell (into the apoplast in plant cell cultures or whole plants) so as to avoid interaction with endogenous peptides.
  • construct or constructs must be configured such that the levels of expression of both the scMHC class I polypeptide and the binding peptide thereof are stoichiometrically correct.
  • a cell which expresses both coding sequences can produce a fully functional scMHC-peptide complex which can be purified via suitable isolation protocols well known in the art.
  • a bacterial expression system is especially advantageous in this case since the scMHC-peptide complex expressed thereby can form substantially pure inclusion bodies when suitable expression conditions are employed.
  • suitable renaturation conditions can be used so as to reform a functional scMHC-peptide complex.
  • HLA-A2- peptide complexes refolding and crystallization of molecules expressed in Escherichia coli and complexed with single antigenic peptides. Proc. Natl. Acad. Sci. USA 89:3429.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Compression, Expansion, Code Conversion, And Decoders (AREA)
  • Steroid Compounds (AREA)
  • Compression Of Band Width Or Redundancy In Fax (AREA)
  • Processing Of Solid Wastes (AREA)
PCT/IL2001/000260 2000-03-27 2001-03-19 Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same Ceased WO2001072768A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AT01914159T ATE472601T1 (de) 2000-03-27 2001-03-19 Einkettige haupthistokompatibilitätskomplexe der klasse i (mhc-i), kodierende konstrukte und methoden ihrer erzeugung
EP01914159A EP1294748B1 (en) 2000-03-27 2001-03-19 Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same
IL15186001A IL151860A0 (en) 2000-03-27 2001-03-19 Single chain class i major histocompatibility complexes, constructs encoding same and methods of generating same
JP2001571699A JP2004503213A (ja) 2000-03-27 2001-03-19 1本鎖クラスi主要組織適合性複合体、それをコードする構築物およびそれを生成する方法
CA002404489A CA2404489A1 (en) 2000-03-27 2001-03-19 Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same
DE60142475T DE60142475D1 (de) 2000-03-27 2001-03-19 Einkettige haupthistokompatibilitätskomplexe der klasse i (mhc-i), kodierende konstrukte und methoden ihrer erzeugung
AU39534/01A AU785493B2 (en) 2000-03-27 2001-03-19 Single chain class I major histo-compatibility complexes, constructs encoding same and methods of generating same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US53496600A 2000-03-27 2000-03-27
US09/534,966 2000-03-27

Publications (3)

Publication Number Publication Date
WO2001072768A2 true WO2001072768A2 (en) 2001-10-04
WO2001072768A3 WO2001072768A3 (en) 2003-01-23
WO2001072768A8 WO2001072768A8 (en) 2005-11-17

Family

ID=24132253

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2001/000260 Ceased WO2001072768A2 (en) 2000-03-27 2001-03-19 Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same

Country Status (10)

Country Link
US (4) US7399838B2 (https=)
EP (2) EP2316950A1 (https=)
JP (1) JP2004503213A (https=)
AT (1) ATE472601T1 (https=)
AU (1) AU785493B2 (https=)
CA (1) CA2404489A1 (https=)
DE (1) DE60142475D1 (https=)
IL (1) IL151860A0 (https=)
WO (1) WO2001072768A2 (https=)
ZA (1) ZA200207515B (https=)

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002102840A3 (en) * 2001-06-20 2003-10-16 Avidex Ltd Multiners of class i major histocompatibility complexes cantaining modified beta2-microglobulin proteins
JP2005521389A (ja) * 2002-02-13 2005-07-21 テクニオン リサーチ アンド ディベロップメント ファウンデーション リミテッド T細胞受容体様特異性を有し、さらに高親和性の抗体ならびに癌、ウイルス感染、および自己免疫疾患の検出および治療でのその使用
JP2005533486A (ja) * 2002-02-20 2005-11-10 ダイアックス、コープ Mhc−ペプチド複合体結合リガンド
US7632923B2 (en) 2003-03-26 2009-12-15 Technion Research & Development Foundation Ltd. Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
EP2184297A1 (en) * 2008-11-07 2010-05-12 Hla-G Technologies HLA-G polypeptides and pharmaceutical uses thereof
EP1572929B1 (en) * 2002-06-12 2011-05-11 Gavish-Galilee Bio Applications Ltd Membrane-anchored beta2 microglobulin covalently linked to mhc class i peptide epitopes
US7977457B2 (en) 2006-05-19 2011-07-12 Teva Pharmaceutical Industries Ltd. Fusion proteins, uses thereof and processes for producing same
US8022190B2 (en) 2001-06-19 2011-09-20 Technion Research & Development Foundation Ltd. Immuno-molecules containing viral proteins, compositions thereof and methods of using
EP2514766A2 (en) 2007-03-29 2012-10-24 Technion Research & Development Foundation Ltd. Antibodies, methods and kits for diagnosing and treating melanoma
US8518697B2 (en) 2006-04-04 2013-08-27 Washington University Single chain trimers and uses therefor
US8747855B2 (en) 2008-04-09 2014-06-10 Technion Research & Development Foundation Limited Anti human immunodeficiency antibodies and uses thereof
US8895020B2 (en) * 2002-04-19 2014-11-25 Washington University Single chain trimers and uses therefor
EP2899206A1 (en) 2008-05-14 2015-07-29 immatics biotechnologies GmbH Novel and powerful MHC-class II peptides derived from survivin
EP3069728A1 (en) 2008-10-01 2016-09-21 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors including neuronal and brain tumors
WO2016156230A1 (en) 2015-03-31 2016-10-06 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides and scaffolds for use in immunotherapy against renal cell carcinoma (rcc) and other cancers
WO2018037085A1 (en) 2016-08-26 2018-03-01 Immatics Biotechnologies Gmbh Novel peptides and scaffolds for use in immunotherapy against head and neck squamous cell carcinoma and other cancers
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
WO2018138257A1 (en) 2017-01-27 2018-08-02 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
WO2018189152A2 (en) 2017-04-10 2018-10-18 Immatics Biotechnologies Gmbh Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers
WO2018189148A1 (en) 2017-04-10 2018-10-18 Immatics Biotechnologies Gmbh Peptides and combination thereof for use in the immunotherapy against cancers
WO2019007974A1 (en) 2017-07-07 2019-01-10 Immatics Biotechnologies Gmbh NOVEL PEPTIDES AND COMBINATION OF PEPTIDES FOR USE IN IMMUNOTHERAPY OF LUNG CANCER, INCLUDING NSCLC, CPPC AND OTHER CANCERS
WO2019028266A1 (en) 2017-08-02 2019-02-07 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services HEPATITIS B NANOPARTICLE VACCINE FOR INFLUENZA VIRUS
DE102018107224A1 (de) 2018-02-21 2019-08-22 Immatics Biotechnologies Gmbh Peptide und Kombinationen von Peptiden nicht-kanonischen Ursprungs zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
EP3545965A2 (en) 2014-12-23 2019-10-02 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
WO2019219312A1 (en) 2018-05-16 2019-11-21 Immatics Biotechnologies Gmbh Peptides for use in immunotherapy against cancers
US10501559B2 (en) 2015-06-09 2019-12-10 Memorial Sloan Kettering Cancer Center T cell receptor-like antibody agents specific for EBV latent membrane protein 2A peptide presented by human HLA
EP3578196A1 (en) 2013-08-05 2019-12-11 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer, including nsclc
WO2020002063A1 (en) 2018-06-29 2020-01-02 Immatics Biotechnologies Gmbh A*03 restricted peptides for use in immunotherapy against cancers and related methods
EP3604327A1 (en) 2014-05-09 2020-02-05 immatics Biotechnologies GmbH Novel immunotherapy against several tumors of the blood, such as acute myeloid leukemia (aml)
WO2020025576A1 (en) 2018-07-31 2020-02-06 Immatics Biotechnologies Gmbh Immunotherapy with b*07 restricted peptides and combination of peptides against cancers and related methods
WO2020058360A1 (en) 2018-09-18 2020-03-26 Immatics Biotechnologies Gmbh Immunotherapy with a*01 restricted peptides and combination of peptides against cancers and related methods
WO2020058285A1 (en) 2018-09-17 2020-03-26 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
WO2020127546A2 (en) 2018-12-18 2020-06-25 Immatics Biotechnologies Gmbh Immunotherapy with b*08 restricted peptides and combination of peptides against cancers and related methods
EP3708185A2 (en) 2014-06-20 2020-09-16 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors of the blood, in particular chronic lymphoid leukemia (cll)
EP3712165A2 (en) 2015-07-01 2020-09-23 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
EP3725327A2 (en) 2017-04-10 2020-10-21 Immatics Biotechnologies GmbH Peptides and combination thereof for use in the immunotherapy against cancers
EP3736283A1 (en) 2015-07-06 2020-11-11 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against esophageal cancer and other cancers
EP3750558A1 (en) 2015-04-24 2020-12-16 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc and other cancers
WO2021038062A1 (en) 2019-08-29 2021-03-04 Eberhard Karls Universität Tübingen, Medizinische Fakultät T cell epitopes of hcmv and uses of thereof
EP3815712A1 (en) 2015-05-06 2021-05-05 immatics biotechnologies GmbH Novel peptides and combination of peptides and scaffolds thereof for use in immunotherapy against colorectal carcinoma (crc) and other cancers
EP3875467A2 (en) 2015-12-22 2021-09-08 Immatics Biotechnologies GmbH Peptides and combination of peptides for use in immunotherapy against breast cancer and other cancers
EP3885356A1 (en) 2016-02-19 2021-09-29 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against nhl and other cancers
EP3919507A2 (en) 2015-07-01 2021-12-08 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
DE102020125457A1 (de) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidierte Peptide und ihre deamidierten Gegenstücke, die durch HLA-A*02-Moleküle präsentiert werden, zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
DE102020125465A1 (de) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidierte Peptide und ihre deamidierten Gegenstücke, die durch nicht-HLA-A*02-Moleküle präsentiert werden, zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
WO2022069579A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers
WO2022152880A1 (en) 2021-01-15 2022-07-21 Immatics Biotechnologies Gmbh Peptides displayed by hla for use in immunotherapy against different types of cancers
US11673917B2 (en) 2016-03-01 2023-06-13 Immatics Biotechnologies Gmbh Peptides, combination of peptides, and cell based medicaments for use in immunotherapy against urinary bladder cancer and other cancers
EP4219524A2 (en) 2016-04-06 2023-08-02 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against aml and other cancers
EP4253401A2 (en) 2013-11-04 2023-10-04 immatics biotechnologies GmbH Personalized immunotherapy against several neuronal and brain tumors
US11813318B2 (en) 2011-04-20 2023-11-14 University Of Washington Beta-2 microglobulin-deficient cells
EP4316597A2 (en) 2017-07-07 2024-02-07 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc, sclc and other cancers
EP4324472A2 (en) 2015-08-05 2024-02-21 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against prostate cancer and other cancers
EP4397676A2 (en) 2015-03-27 2024-07-10 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against various tumors
EP4461371A2 (en) 2014-12-23 2024-11-13 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP4491191A2 (en) 2016-03-08 2025-01-15 immatics biotechnologies GmbH Uterine cancer treatments
WO2025040598A2 (en) 2023-08-18 2025-02-27 Immatics Biotechnologies Gmbh Peptides displayed by mhc for use in immunotherapy against different types of cancer

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60142475D1 (de) * 2000-03-27 2010-08-12 Technion Res And Dev Of Founda Einkettige haupthistokompatibilitätskomplexe der klasse i (mhc-i), kodierende konstrukte und methoden ihrer erzeugung
US20030017134A1 (en) * 2001-06-19 2003-01-23 Technion Research And Development Foundation Ltd. Methods and pharmaceutical compositions for immune deception, particularly useful in the treatment of cancer
US20030199024A1 (en) * 2002-04-19 2003-10-23 Hansen Ted H. Single chain trimers of class I MHC molecules
US20090233318A1 (en) * 2004-12-28 2009-09-17 Weidanz Jon A Methods of assaying vaccine potency
US20090075304A1 (en) * 2004-05-27 2009-03-19 Weidanz Jon A Methods of assaying vaccine potency
WO2005118791A1 (ja) * 2004-06-03 2005-12-15 National Institute Of Radiological Sciences 微量試料を用いる網羅的遺伝子発現プロフィール解析法
JP2008501781A (ja) * 2004-06-09 2008-01-24 テクニオン リサーチ アンド ディベロップメント ファウンデーション リミテッド 細胞の選択的アポトーシスのための抗体
US8394590B2 (en) * 2006-08-02 2013-03-12 California Institute Of Technology Capture agents and related methods and systems for detecting and/or sorting targets
EA201400046A1 (ru) * 2011-06-22 2014-07-30 Ф. Хоффманн-Ля Рош Аг Удаление клеток-мишеней с помощью циркулирующих вирусспецифических цитотоксических т-клеток с использованием содержащих гкгс класса i комплексов
WO2018148671A1 (en) 2017-02-12 2018-08-16 Neon Therapeutics, Inc. Hla-based methods and compositions and uses thereof
CN111727262A (zh) 2017-07-25 2020-09-29 加州理工学院 胞啃介导的表位发现
EP3707247A4 (en) * 2017-11-10 2021-11-03 Jura Bio, Inc. MAJOR HISTOCOMPATIBILITY COMPLEX CHEMERICAL RECEPTORS AND ASSOCIATED USES FOR THE TREATMENT OF AUTOIMMUNE DISEASES
GB201802338D0 (en) 2018-02-13 2018-03-28 Univ Oslo Antigen binding proteins
KR20200137548A (ko) 2019-05-30 2020-12-09 에스케이하이닉스 주식회사 메모리 장치 및 이의 테스트 동작 방법
AU2019404547B2 (en) 2018-12-21 2025-01-30 Biontech Us Inc. Method and systems for prediction of HLA class II-specific epitopes and characterization of CD4+ T cells
EP4630562A1 (en) * 2022-12-09 2025-10-15 Advanced RNA Vaccine (ARV) Technologies, Inc. Nucleic acid based cancer vaccine and methods thereof

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154600B (nl) 1971-02-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen.
NL154598B (nl) 1970-11-10 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking.
NL154599B (nl) 1970-12-28 1977-09-15 Organon Nv Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen, alsmede testverpakking.
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
NL171930C (nl) 1972-05-11 1983-06-01 Akzo Nv Werkwijze voor het aantonen en bepalen van haptenen, alsmede testverpakkingen.
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
CA1192510A (en) 1981-05-27 1985-08-27 Lawrence E. Pelcher Rna plant virus vector or portion thereof, a method of construction thereof, and a method of producing a gene derived product therefrom
JPS6054684A (ja) 1983-09-05 1985-03-29 Teijin Ltd 新規dνa及びハイブリツドdνa
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
CA1288073C (en) 1985-03-07 1991-08-27 Paul G. Ahlquist Rna transformation vector
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
GB8608850D0 (en) 1986-04-11 1986-05-14 Diatech Ltd Packaging system
JPS6314693A (ja) 1986-07-04 1988-01-21 Sumitomo Chem Co Ltd 植物ウイルスrnaベクタ−
ATE108828T1 (de) 1987-02-09 1994-08-15 Lubrizol Genetics Inc Hybrides rns-virus.
US5316931A (en) 1988-02-26 1994-05-31 Biosource Genetics Corp. Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes
US5260422A (en) * 1988-06-23 1993-11-09 Anergen, Inc. MHC conjugates useful in ameliorating autoimmunity
US5194425A (en) * 1988-06-23 1993-03-16 Anergen, Inc. Mhc-mediated toxic conjugates useful in ameliorating autoimmunity
US5468481A (en) * 1988-06-23 1995-11-21 Amergen, Inc. MHC class II-peptide conjugates useful in ameliorating autoimmunity
DE3825615A1 (de) * 1988-07-28 1990-02-01 Behringwerke Ag Antigenkonstrukte von "major histocompatibility complex" klasse i antigenen mit spezifischen traegermolekuelen, ihre herstellung und verwendung
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5976551A (en) * 1991-11-15 1999-11-02 Institut Pasteur And Institut Nationale De La Sante Et De La Recherche Medicale Altered major histocompatibility complex (MHC) determinant and method of using the determinant
US6153408A (en) * 1991-11-15 2000-11-28 Institut Pasteur And Institut National De La Sante Et De La Recherche Medicale Altered major histocompatibility complex (MHC) determinant and methods of using the determinant
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US5837477A (en) * 1993-01-15 1998-11-17 The United States Of America As Represented By The Department Of Health And Human Services T cell receptor ligands and methods of using same
DE69434520T3 (de) * 1993-07-30 2009-10-15 Affymax, Inc., Palo Alto Biotinylierung von proteinen
US5820866A (en) * 1994-03-04 1998-10-13 National Jewish Center For Immunology And Respiratory Medicine Product and process for T cell regulation
US5635363A (en) * 1995-02-28 1997-06-03 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for the detection, quantitation and purification of antigen-specific T cells
US5869270A (en) * 1996-01-31 1999-02-09 Sunol Molecular Corporation Single chain MHC complexes and uses thereof
CA2250166A1 (en) * 1996-03-28 1997-10-02 The Johns Hopkins University Soluble divalent and multivalent heterodimeric analogs of proteins
US6140113A (en) * 1996-03-28 2000-10-31 The Johns Hopkins University Polynucleotides encoding molecular complexes which modify immune responses
US6211342B1 (en) * 1996-07-18 2001-04-03 Children's Hospital Medical Center Multivalent MHC complex peptide fusion protein complex for stimulating specific T cell function
US6248564B1 (en) * 1997-08-29 2001-06-19 Harvard University Mutant MHC class I molecules
US6232445B1 (en) * 1997-10-29 2001-05-15 Sunol Molecular Corporation Soluble MHC complexes and methods of use thereof
DE60142475D1 (de) * 2000-03-27 2010-08-12 Technion Res And Dev Of Founda Einkettige haupthistokompatibilitätskomplexe der klasse i (mhc-i), kodierende konstrukte und methoden ihrer erzeugung
US8022190B2 (en) * 2001-06-19 2011-09-20 Technion Research & Development Foundation Ltd. Immuno-molecules containing viral proteins, compositions thereof and methods of using
US20030017134A1 (en) * 2001-06-19 2003-01-23 Technion Research And Development Foundation Ltd. Methods and pharmaceutical compositions for immune deception, particularly useful in the treatment of cancer
US7362707B2 (en) * 2001-07-23 2008-04-22 Acme Packet, Inc. System and method for determining flow quality statistics for real-time transport protocol data flows
US6843882B2 (en) * 2002-07-15 2005-01-18 Applied Materials, Inc. Gas flow control in a wafer processing system having multiple chambers for performing same process
US7977457B2 (en) * 2006-05-19 2011-07-12 Teva Pharmaceutical Industries Ltd. Fusion proteins, uses thereof and processes for producing same

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
KOURILSKY ET AL.: 'Immunological issues in vaccine trials: T-cell responses' PRECLINICAL AND CLINICAL DEVELOPMENT OF NEW VACCINES, (DEV. BIOL. STAND. PLOTKIN S.B., BROWN F. AND HORAUD F., EDS. BASEL, KARGER) vol. 95, 1998, pages 117 - 124, XP002955936 *
LEE ET AL.: 'Functional cell surface expression by a recombinant single-chain class I major histocompatibility complex molecule with a cis-active B2-microglobulin domain' EUR. J. IMMUNOL. vol. 24, 1994, pages 2633 - 2639, XP002955934 *
LONE ET AL.: 'In vitro induction of specific cytotoxic T lymphocytes using recombinant single-chain MHC class I/peptide complexes' JOURNAL OF IMMUNOTHERAPY vol. 21, no. 4, 1998, pages 283 - 294, XP002955935 *
OJCIUS ET AL.: 'Dissociation of the peptide-MHC class I complex limits the binding rate of exogenous peptide' THE JOURNAL OF IMMUNOLOGY vol. 151, no. 11, 01 December 1993, pages 6020 - 6026, XP000872960 *
PARKER ET AL.: 'Sequence motifs important for peptide binding to the human MHC class I molecule, HLA-A2' THE JOURNAL OF IMMUNOLOGY vol. 149, no. 11, 01 December 1992, pages 3580 - 3587, XP000371892 *
See also references of EP1294748A2 *

Cited By (103)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9095533B2 (en) 2000-03-27 2015-08-04 Technion Research & Development Foundation Limited Antigen-presenting complex-binding compositions and uses thereof
US8022190B2 (en) 2001-06-19 2011-09-20 Technion Research & Development Foundation Ltd. Immuno-molecules containing viral proteins, compositions thereof and methods of using
US8449889B2 (en) 2001-06-19 2013-05-28 Technion Research & Development Foundation Limited Immuno-molecules containing viral proteins, compositions thereof and methods of using
WO2002102840A3 (en) * 2001-06-20 2003-10-16 Avidex Ltd Multiners of class i major histocompatibility complexes cantaining modified beta2-microglobulin proteins
JP2005521389A (ja) * 2002-02-13 2005-07-21 テクニオン リサーチ アンド ディベロップメント ファウンデーション リミテッド T細胞受容体様特異性を有し、さらに高親和性の抗体ならびに癌、ウイルス感染、および自己免疫疾患の検出および治療でのその使用
EP2072045A2 (en) 2002-02-13 2009-06-24 Technion Research and Development Foundation, Ltd. Antibody having a t-cell receptor-like specificity, yet higher affinity, and the use of same in the detection and treatment of cancer, viral infection and autoimmune disease
EP2329814A1 (en) 2002-02-13 2011-06-08 Technion Research and Development Foundation, Ltd. Antibody having a T-cell receptor-like specificity, yet higher affinity, and the use of same in the detection and treatment of cancer
JP2005533486A (ja) * 2002-02-20 2005-11-10 ダイアックス、コープ Mhc−ペプチド複合体結合リガンド
EP1485075A4 (en) * 2002-02-20 2006-04-26 Dyax Corp MHC-PEPTIDE COMPLEX BINDING LIGANDS
US7718777B2 (en) 2002-02-20 2010-05-18 Technion Research & Development Foundation Ltd. MHC-peptide complex binding ligands
US8895020B2 (en) * 2002-04-19 2014-11-25 Washington University Single chain trimers and uses therefor
EP1572929B1 (en) * 2002-06-12 2011-05-11 Gavish-Galilee Bio Applications Ltd Membrane-anchored beta2 microglobulin covalently linked to mhc class i peptide epitopes
US9023348B2 (en) 2003-03-26 2015-05-05 Technion Research & Development Foundation Limited Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
US7632923B2 (en) 2003-03-26 2009-12-15 Technion Research & Development Foundation Ltd. Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
US9616112B2 (en) 2003-03-26 2017-04-11 Technion Research & Development Foundation Limited Compositions capable of specifically binding particular human antigen presenting molecule/pathogen-derived antigen complexes and uses thereof
US8518697B2 (en) 2006-04-04 2013-08-27 Washington University Single chain trimers and uses therefor
US7977457B2 (en) 2006-05-19 2011-07-12 Teva Pharmaceutical Industries Ltd. Fusion proteins, uses thereof and processes for producing same
EP2514766A2 (en) 2007-03-29 2012-10-24 Technion Research & Development Foundation Ltd. Antibodies, methods and kits for diagnosing and treating melanoma
US8747855B2 (en) 2008-04-09 2014-06-10 Technion Research & Development Foundation Limited Anti human immunodeficiency antibodies and uses thereof
EP2899206A1 (en) 2008-05-14 2015-07-29 immatics biotechnologies GmbH Novel and powerful MHC-class II peptides derived from survivin
EP3069728A1 (en) 2008-10-01 2016-09-21 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors including neuronal and brain tumors
WO2010052229A1 (en) * 2008-11-07 2010-05-14 Hla-G Technologies Hla-g polypeptides and pharmaceutical uses thereof
EP2184297A1 (en) * 2008-11-07 2010-05-12 Hla-G Technologies HLA-G polypeptides and pharmaceutical uses thereof
US11813318B2 (en) 2011-04-20 2023-11-14 University Of Washington Beta-2 microglobulin-deficient cells
EP3616708A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3578196A1 (en) 2013-08-05 2019-12-11 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer, including nsclc
EP3616711A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3616707A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3616709A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3616710A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3616712A1 (en) 2013-08-05 2020-03-04 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP3613427A1 (en) 2013-08-05 2020-02-26 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors, such as lung cancer including nsclc
EP4253401A2 (en) 2013-11-04 2023-10-04 immatics biotechnologies GmbH Personalized immunotherapy against several neuronal and brain tumors
EP3604327A1 (en) 2014-05-09 2020-02-05 immatics Biotechnologies GmbH Novel immunotherapy against several tumors of the blood, such as acute myeloid leukemia (aml)
EP3708185A2 (en) 2014-06-20 2020-09-16 Immatics Biotechnologies GmbH Novel immunotherapy against several tumors of the blood, in particular chronic lymphoid leukemia (cll)
EP3626730A1 (en) 2014-12-23 2020-03-25 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP4461371A2 (en) 2014-12-23 2024-11-13 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3620168A1 (en) 2014-12-23 2020-03-11 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3715357A1 (en) 2014-12-23 2020-09-30 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3616706A1 (en) 2014-12-23 2020-03-04 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3626731A1 (en) 2014-12-23 2020-03-25 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3545965A2 (en) 2014-12-23 2019-10-02 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP3626729A1 (en) 2014-12-23 2020-03-25 immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers
EP4397676A2 (en) 2015-03-27 2024-07-10 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against various tumors
EP3517128A1 (en) 2015-03-31 2019-07-31 immatics Biotechnologies GmbH Novel peptides and combination of peptides and scaffolds for use in immunotherapy against renal cell carcinoma (rcc) and other cancers
EP3517126A1 (en) 2015-03-31 2019-07-31 immatics Biotechnologies GmbH Novel peptides and combination of peptides and scaffolds for use in immunotherapy against renal cell carcinoma (rcc) and other cancers
EP3517127A1 (en) 2015-03-31 2019-07-31 immatics Biotechnologies GmbH Novel peptides and combination of peptides and scaffolds for use in immunotherapy against renal cell carcinoma (rcc) and other cancers
WO2016156230A1 (en) 2015-03-31 2016-10-06 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides and scaffolds for use in immunotherapy against renal cell carcinoma (rcc) and other cancers
US10011658B2 (en) 2015-04-03 2018-07-03 Eureka Therapeutics, Inc. Constructs targeting AFP peptide/MHC complexes and uses thereof
EP3760225A2 (en) 2015-04-24 2021-01-06 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc and other cancers
EP3750557A1 (en) 2015-04-24 2020-12-16 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc and other cancers
EP3750558A1 (en) 2015-04-24 2020-12-16 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc and other cancers
EP3815712A1 (en) 2015-05-06 2021-05-05 immatics biotechnologies GmbH Novel peptides and combination of peptides and scaffolds thereof for use in immunotherapy against colorectal carcinoma (crc) and other cancers
US11168150B2 (en) 2015-06-09 2021-11-09 Memorial Sloan Kettering Cancer Center T cell receptor-like antibody agents specific for EBV latent membrane protein 2A peptide presented by human HLA
US10501559B2 (en) 2015-06-09 2019-12-10 Memorial Sloan Kettering Cancer Center T cell receptor-like antibody agents specific for EBV latent membrane protein 2A peptide presented by human HLA
EP3919507A2 (en) 2015-07-01 2021-12-08 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
EP3712165A2 (en) 2015-07-01 2020-09-23 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
EP4321172A2 (en) 2015-07-06 2024-02-14 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against esophageal cancer and other cancers
EP3736283A1 (en) 2015-07-06 2020-11-11 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against esophageal cancer and other cancers
EP4324472A2 (en) 2015-08-05 2024-02-21 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against prostate cancer and other cancers
EP3875467A2 (en) 2015-12-22 2021-09-08 Immatics Biotechnologies GmbH Peptides and combination of peptides for use in immunotherapy against breast cancer and other cancers
EP3885356A1 (en) 2016-02-19 2021-09-29 Immatics Biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against nhl and other cancers
US11673917B2 (en) 2016-03-01 2023-06-13 Immatics Biotechnologies Gmbh Peptides, combination of peptides, and cell based medicaments for use in immunotherapy against urinary bladder cancer and other cancers
EP4491191A2 (en) 2016-03-08 2025-01-15 immatics biotechnologies GmbH Uterine cancer treatments
EP4219524A2 (en) 2016-04-06 2023-08-02 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against aml and other cancers
WO2018037085A1 (en) 2016-08-26 2018-03-01 Immatics Biotechnologies Gmbh Novel peptides and scaffolds for use in immunotherapy against head and neck squamous cell carcinoma and other cancers
US11274157B2 (en) 2017-01-12 2022-03-15 Eureka Therapeutics, Inc. Constructs targeting histone H3 peptide/MHC complexes and uses thereof
WO2018138257A1 (en) 2017-01-27 2018-08-02 Immatics Biotechnologies Gmbh Novel peptides and combination of peptides for use in immunotherapy against ovarian cancer and other cancers
EP3725327A2 (en) 2017-04-10 2020-10-21 Immatics Biotechnologies GmbH Peptides and combination thereof for use in the immunotherapy against cancers
WO2018189152A2 (en) 2017-04-10 2018-10-18 Immatics Biotechnologies Gmbh Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers
WO2018189148A1 (en) 2017-04-10 2018-10-18 Immatics Biotechnologies Gmbh Peptides and combination thereof for use in the immunotherapy against cancers
WO2019007974A1 (en) 2017-07-07 2019-01-10 Immatics Biotechnologies Gmbh NOVEL PEPTIDES AND COMBINATION OF PEPTIDES FOR USE IN IMMUNOTHERAPY OF LUNG CANCER, INCLUDING NSCLC, CPPC AND OTHER CANCERS
EP4316597A2 (en) 2017-07-07 2024-02-07 immatics biotechnologies GmbH Novel peptides and combination of peptides for use in immunotherapy against lung cancer, including nsclc, sclc and other cancers
WO2019028266A1 (en) 2017-08-02 2019-02-07 The Usa, As Represented By The Secretary, Dept. Of Health And Human Services HEPATITIS B NANOPARTICLE VACCINE FOR INFLUENZA VIRUS
EP4321529A2 (en) 2018-02-21 2024-02-14 immatics biotechnologies GmbH Peptides and combination of peptides of non-canonical origin for use in immunotherapy against different types of cancers
WO2019162110A1 (en) 2018-02-21 2019-08-29 Immatics Biotechnologies Gmbh Peptides and combination of peptides of non-canonical origin for use in immunotherapy against different types of cancers
DE102018107224A1 (de) 2018-02-21 2019-08-22 Immatics Biotechnologies Gmbh Peptide und Kombinationen von Peptiden nicht-kanonischen Ursprungs zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
WO2019219312A1 (en) 2018-05-16 2019-11-21 Immatics Biotechnologies Gmbh Peptides for use in immunotherapy against cancers
WO2020002063A1 (en) 2018-06-29 2020-01-02 Immatics Biotechnologies Gmbh A*03 restricted peptides for use in immunotherapy against cancers and related methods
WO2020025576A1 (en) 2018-07-31 2020-02-06 Immatics Biotechnologies Gmbh Immunotherapy with b*07 restricted peptides and combination of peptides against cancers and related methods
US11014972B2 (en) 2018-09-17 2021-05-25 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11680089B2 (en) 2018-09-17 2023-06-20 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US12162917B2 (en) 2018-09-17 2024-12-10 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
WO2020058285A1 (en) 2018-09-17 2020-03-26 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US12065471B2 (en) 2018-09-17 2024-08-20 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11629177B2 (en) 2018-09-17 2023-04-18 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11667685B2 (en) 2018-09-17 2023-06-06 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11945850B2 (en) 2018-09-17 2024-04-02 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11208448B2 (en) 2018-09-17 2021-12-28 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11117941B2 (en) 2018-09-17 2021-09-14 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US10899811B2 (en) 2018-09-17 2021-01-26 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11111281B2 (en) 2018-09-17 2021-09-07 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US11155590B2 (en) 2018-09-17 2021-10-26 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
US10899810B2 (en) 2018-09-17 2021-01-26 Immatics Biotechnologies Gmbh B*44 restricted peptides for use in immunotherapy against cancers and related methods
WO2020058360A1 (en) 2018-09-18 2020-03-26 Immatics Biotechnologies Gmbh Immunotherapy with a*01 restricted peptides and combination of peptides against cancers and related methods
WO2020127546A2 (en) 2018-12-18 2020-06-25 Immatics Biotechnologies Gmbh Immunotherapy with b*08 restricted peptides and combination of peptides against cancers and related methods
WO2021038062A1 (en) 2019-08-29 2021-03-04 Eberhard Karls Universität Tübingen, Medizinische Fakultät T cell epitopes of hcmv and uses of thereof
DE102020125465A1 (de) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidierte Peptide und ihre deamidierten Gegenstücke, die durch nicht-HLA-A*02-Moleküle präsentiert werden, zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
DE102020125457A1 (de) 2020-09-29 2022-03-31 Immatics Biotechnologies Gmbh Amidierte Peptide und ihre deamidierten Gegenstücke, die durch HLA-A*02-Moleküle präsentiert werden, zur Verwendung in der Immuntherapie gegen verschiedene Krebsarten
WO2022069557A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by hla-a*02 for use in immunotherapy against different types of cancers
WO2022069579A2 (en) 2020-09-29 2022-04-07 Immatics Biotechnologies Gmbh Amidated peptides and their deamidated counterparts displayed by non-hla-a*02 for use in immunotherapy against different types of cancers
WO2022152880A1 (en) 2021-01-15 2022-07-21 Immatics Biotechnologies Gmbh Peptides displayed by hla for use in immunotherapy against different types of cancers
WO2025040598A2 (en) 2023-08-18 2025-02-27 Immatics Biotechnologies Gmbh Peptides displayed by mhc for use in immunotherapy against different types of cancer

Also Published As

Publication number Publication date
ZA200207515B (en) 2004-07-21
WO2001072768A8 (en) 2005-11-17
AU3953401A (en) 2001-10-08
US20090258393A1 (en) 2009-10-15
US7399838B2 (en) 2008-07-15
DE60142475D1 (de) 2010-08-12
AU785493B2 (en) 2008-01-03
JP2004503213A (ja) 2004-02-05
WO2001072768A3 (en) 2003-01-23
US20040086960A1 (en) 2004-05-06
IL151860A0 (en) 2003-04-10
EP1294748B1 (en) 2010-06-30
EP1294748A4 (en) 2004-10-06
ATE472601T1 (de) 2010-07-15
EP1294748A2 (en) 2003-03-26
US20090148925A1 (en) 2009-06-11
CA2404489A1 (en) 2001-10-04
US20030003535A1 (en) 2003-01-02
EP2316950A1 (en) 2011-05-04

Similar Documents

Publication Publication Date Title
EP1294748B1 (en) Single chain class i major histo-compatibility complexes, constructs encoding same and methods of generating same
AU2018200222B2 (en) Engineering T-cell receptors
Holler et al. TCRs with high affinity for foreign pMHC show self-reactivity
KR101442209B1 (ko) 융합 단백질, 이의 용도 및 이의 제조방법
KR102488477B1 (ko) 신속하고 포괄적인 t-세포 면역 모니터링을 위한 세포 플랫폼
CA2451353C (en) Methods and pharmaceutical compositions for immune deception, particularly useful in the treatment of cancer
Malarkannan et al. A rare cryptic translation product is presented by Kb major histocompatibility complex class I molecule to alloreactive T cells.
Denkberg et al. Recombinant human single‐chain MHC‐peptide complexes made from E. coli by in vitro refolding: functional single‐chain MHC‐peptide complexes and tetramers with tumor associated antigens
NO333840B1 (no) Bakteriofagpartikkel som fremviser T-cellereseptorer, et bibliotek av slike bakteriofagpartikler og en fremgangsmåte for påvisning av T-cellereseptor med en spesifikk egenskap
US20030166057A1 (en) Method and apparatus for the production of soluble MHC antigens and uses thereof
CN110776562A (zh) 一种识别afp抗原的t细胞受体
US7521202B2 (en) Method and apparatus for the production of soluble MHC antigens and uses thereof
AU2007203607A1 (en) Single Chain Class I Major Histo-Compatibility Complexes, Constructs Encoding Same and Methods of Generating Same
AU6286599A (en) Isolated peptides which bind to hla-b35 molecules
Hayball et al. The immune function of MHC class II molecules mutated in the putative superdimer interface
Lee et al. A recombinant single-chain HLA-A2. 1 molecule, with a cis active β-2-microglobulin domain, is biologically active in peptide binding and antigen presentation
US20060035338A1 (en) Method and apparatus for the production of soluble MHC antigens and uses thereof
WO2004101607A2 (en) Comparative ligand mapping from mhc class i positive cells
CA2880098C (en) Engineering t-cell receptors
WO2007053644A2 (en) Comparative ligand mapping from mhc class i positive cells
Bowerman The use of high-affinity T cell receptors to study specificity in the 2C T cell system
CA2438376A1 (en) Method and apparatus for the production of antigens and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 39534/01

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2002/07515

Country of ref document: ZA

Ref document number: 200207515

Country of ref document: ZA

WWE Wipo information: entry into national phase

Ref document number: 151860

Country of ref document: IL

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 571699

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2404489

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2001914159

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2001914159

Country of ref document: EP

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WR Later publication of a revised version of an international search report
WWG Wipo information: grant in national office

Ref document number: 39534/01

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 204140

Country of ref document: IL