WO2001068823A1 - Nouveau polypeptide, lipoxydase humaine 9, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, lipoxydase humaine 9, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001068823A1 WO2001068823A1 PCT/CN2001/000168 CN0100168W WO0168823A1 WO 2001068823 A1 WO2001068823 A1 WO 2001068823A1 CN 0100168 W CN0100168 W CN 0100168W WO 0168823 A1 WO0168823 A1 WO 0168823A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- human
- lipoxygenase
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide ⁇ ⁇ lipoxygenase 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Lipids contain many different types of compounds, which have the following biological functions: U) In all cells, the main structural component of the membrane is lipids; (2) some lipids can effectively store energy; (3) Many vitamins and hormones found in animals are lipids or lipid derivatives; (4) Bile acids help dissolve other lipids during digestion.
- Arachidonic acid is the main C 2 in most mammals. Polyunsaturated fatty acids, which can be catalyzed by enzymes into many compounds, such as prostaglandins, thromboxane and leukotrienes. In the above-mentioned catalytic process, lipoxygenase plays an important role.
- Lipoxygenase is a type of iron-bound dioxygenase, which can catalyze the hydroperoxidation of lipids. Its catalytic substrate includes cis, cis-1, 4-pentane in addition to arachidonic acid. Ene and so on. Lipid oxidase has an important catalytic function for the oxidation of lipids, so it is of great significance for the metabolism of lipids and the physiological and physiological functions of lipids and their derivatives.
- soybean lipoxygenase The nucleotide sequence of the gene encoding soybean lipoxygenase has been obtained, and three types of soybean lipoxygenase have been found, L0X1, L0X2, and L0X3. Although they differ in nucleotide sequence, they all have a conserved sequence of about 40 amino acid residues. This conserved sequence contains 6 histidines and 2 tyrosines. This conserved sequence is in soybean The three lipoxygenases are highly conserved and are presumed to be involved in possible iron atom binding (J Biol Chem 1988 May 15; 263 (14): 6816-21).
- lipoxygenase activity plays an important role (Boyington JC, Gaffney BJ, Amze l LM Sc ience 260: 1482-1486 (1993)); (Steczko J., Donoho GP, Cl emens JC, Dixon JE, Axe l rod B.
- Leukotriene is a very strong muscle contractor, which can shrink the lung trachea, which is of great significance for the treatment of asthma.
- leukotrienes are found in leukocytes and mast cell tumor cells.
- the mechanism of action of prostaglandins and thromboxane is not very clear, but they have important effects on blood coagulation and activation of adenylate cyclase.
- lipoxygenase is involved in the metabolism of substances such as prostaglandins, thromboxane and leukotriene. Therefore, lipoxygenase can regulate some of the important physiological processes mentioned above (Needleman P., Turk J., Jakschik ⁇ .
- the human lipoxygenase 9 protein plays an important role in regulating important functions of vanadium, such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need to identify more involved in these processes
- the human lipoxygenase 9 protein, especially the amino acid sequence of this protein was identified. Isolation of the novel human lipoxygenase 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human lipoxygenase 9 Body.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding human lipoxygenase 9.
- Another object of the present invention is to provide a method for producing human lipoxygenase 9.
- Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human lipoxygenase 9.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human lipoxygenase 9 directed against the polypeptide of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of human lipoxygenase 9. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 40-291 in SEQ ID NO: 1; and (b) a sequence having 1-1860 in SEQ ID NO: 1 Sequence of bits.
- the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human lipoxygenase 9 protein, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human lipoxygenase 9 protein in vitro, comprising detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human lipoxygenase 9.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human lipoxygenase 9 and human lipoxygenase 10 according to the present invention.
- the upper graph is a graph of the expression profile of human lipoxygenase 9, and the lower graph is the graph of the expression profile of human lipoxygenase 10.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human lipoxygenase 9. 9 Da is the molecular weight of the protein. The arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it.
- the changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
- Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine.
- Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring tampon.
- “Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human lipoxygenase 9, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind human lipoxygenase 9.
- Antagonist refers to a molecule that, when combined with human lipoxygenase 9, can block or regulate the biological or immunological activity of human lipoxygenase 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human lipoxygenase 9.
- “Regulation” refers to a change in the function of human lipoxygenase 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human lipoxygenase 9.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify human lipoxygenase 9 using standard protein purification techniques. Essentially pure human lipoxygenase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human lipoxygenase 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wi s.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Cluster method checks all pairs The distance between the two groups of sequences is arranged into clusters. Then the clusters are allocated in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: sequence ⁇ and sequence Number of matching residues
- the number of residues in the sequence ⁇ -the number of spacer residues in the sequence-the number of spacer residues X in the sequence S can also be determined by the C l ter method or using methods known in the art, such as Jo tun He in Sex percentage (He in J., (1990) Me thods in enzymo logy 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? (& 1) ') 2 and? It can specifically bind to the epitope of human lipoxygenase 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated means that the substance is separated from its original environment (if it is natural Natural material, the original environment is the natural environment).
- natural Natural material the original environment is the natural environment.
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated human lipoxygenase 9 means that human lipoxygenase 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human lipoxygenase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human lipoxygenase 9 polypeptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human lipoxygenase 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptide of the present invention may be a naturally purified product, or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (such as bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human lipoxygenase 9.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human lipoxygenase 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be edited by the genetic code; or (II) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or ( ⁇ ⁇ ) such that the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such that the additional amino acid sequence is fused into the mature polypeptide to form (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence).
- such fragments, and their derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of I 860 bases, and its open reading frame 40-291 encodes 83 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile as human lipoxygenase 10, and it can be inferred that human lipoxygenase 9 has a similar function as human lipoxygenase 10.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be encoded Chain or non-coding chain.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences Crosses occur at least 95% or more, and more preferably 97% or more.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human lipoxygenase 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human lipoxygenase 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the D fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Q i agene). Construction of cDNA libraries is also a common method (Sambrook, et al., Mo Lecu l ar C loning, A Labora tory Manua 1, Cold Spr ing Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human lipoxygenase 9 transcripts; (4) Detection of gene-expressed protein products by immunological techniques or determination of biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human lipoxygenase 9 gene.
- a method (Sa ik i, e t a l. Sc ience 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention.
- the RACE method RACE-cDM terminal rapid amplification method
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human lipoxygenase 9 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding human lipoxygenase 9 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al.
- pMSXND expression vectors expressed in mammalian cells Lee and Na thans, J Bio Chem. 263: 3521, 1988
- baculovirus-derived vectors expressed in insect cells in short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human lipoxygenase 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, etal. Mo l ecu lar C l on ing, a Labora tory Manua l, Co ld Spr ing Harbor Labora tory. New York, 1989) .
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
- GFP fluorescent protein
- tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human lipoxygenase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced to constitute a genetically engineered host cell containing the polynucleotide or a recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf 9
- animal cells such as CH0, COS, or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l 2 method used in steps well known in the art. The alternative is to use MgC l 2 .
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods, such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant human lipoxygenase 9 (Scence, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.
- Lipoxygenase is a type of iron-bound dioxygenase, which can catalyze the hydroperoxidation of lipids.
- its catalytic substrate also includes cis, cis-1, 4-pentadiene and the like. It is of great significance to the metabolism of lipids and the physiological functions of lipids and their derivatives.
- Arachidonic acid can be catalyzed by lipoxygenase into many compounds, such as prostaglandins, thromboxane and leukotriene. It plays an important role in regulating human inflammation and allergic diseases' (Proc Nat l Acad Sci USA 1988 Jan; 85 (2): 416-20).
- Prostaglandin is the most widely distributed and most effective biologically active substance in the human body. It has effects on the reproductive, cardiovascular, respiratory, digestive, and nervous systems. It does not act as a hormone in the body, but through certain hormones. The adjustment works. Abnormal metabolism of prostaglandins in the human body can cause unhealthy uterine contractions and dystocia, persistent corpus luteum, vasodilation-related cardiovascular diseases, bronchospasm, gastric ulcer caused by hyperacidity, and impaired blood supply to the organs. Leukotriene is involved in various physiological and pathological processes such as inflammatory response, coagulation, and asthma. Coagulation is also involved in the coagulation process.
- the abnormal expression of the specific lipoxygenase mot if will cause the abnormal function of the polypeptide containing this mot if, resulting in metabolic disorders of lipids and their derivatives, affecting the metabolism of arachidonic acid, and producing the prostate Metabolism of hormones, thromboxane and leukotriene are abnormal, and related diseases such as lipid metabolism disorders, inflammation, coagulopathy, respiratory diseases, and diseases related to prostaglandin metabolism abnormalities are generated.
- human lipoxygenase 9 of the present invention will produce various diseases, especially lipid metabolic disorders, inflammation, coagulopathy, respiratory diseases, and diseases related to abnormal prostaglandin metabolism. These diseases include but are not Limited to:
- Fatty deposition disease fatty liver, steatosis cardiomyopathy, steatosis nephropathy
- Cardiovascular diseases coronary atherosclerotic heart disease such as occult heart disease, heart pain, myocardial infarction, dying coronary heart disease, hypertension
- Sterol derivatives such as bile acids, sex hormones (testosterone, estradiol, estriol, progesterone) metabolic disorders: (1) bile acid disorders such as biliary cirrhosis, cholelithiasis ( 2) Sexual developmental disorders during growth and development: precocious puberty, delayed sexual development, sexual differentiation disorders, other defects in external genital development (3) Endocrine and metabolic syndromes: Hyperadrenal cortical diseases such as Cushing syndrome, hyperaldosteronism, adrenal glands Cortical dysfunction such as acute adrenal insufficiency, chronic adrenal insufficiency
- Various inflammations allergic reactions, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, bone Osteoporosis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, Graves' disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, myasthenia gravis, cerebral spinal cord multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulation Swelling, autoimmune thyroiditis, autoimmune interstitial nephritis, ulcerative colitis, anemia, pancreatitis, segmental ileitis, myocarditis, atheros
- Respiratory diseases bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, pulmonary eosinophilia, sarcoidosis
- dystocia-induced dystocia persistent corpus luteum
- vasoconstriction and diastolic disorders-related cardiovascular disease bronchospasm
- gastric ulcer caused by hyperacidity organ blood supply disorder
- the abnormal expression of the human lipoxygenase 9 of the present invention will also cause certain hereditary and immune diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or inhibit (antagonist) human lipoxygenase 9.
- Agonists enhance human lipoxygenase 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or a membrane preparation expressing human lipoxygenase 9 can be cultured with labeled human lipoxygenase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of human lipoxygenase 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human lipoxygenase 9 can bind to human lipoxygenase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions. '
- human lipoxygenase 9 When screening compounds as antagonists, human lipoxygenase 9 can be added to a bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between human lipoxygenase 9 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human lipoxygenase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 9 molecules of human lipoxygenase should be labeled.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human lipoxygenase 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human lipoxygenase 9 directly into immunized animals (such as rabbits, mice, Rats, etc.), a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- immunized animals such as rabbits, mice, Rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant.
- Techniques for preparing monoclonal antibodies to human lipoxygenase 9 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc.
- Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851).
- the existing technology for producing single chain antibodies (US Pat. No. 4946778) can also be used to produce single chain antibodies against human lipoxygenase 9.
- Antibodies against human lipoxygenase 9 can be used in immunohistochemistry to detect human lipoxygenase 9 in biopsy specimens.
- Monoclonal antibodies that bind to human lipoxygenase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human lipoxygenase 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human lipoxygenase 9 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to human lipoxygenase 9.
- Administration of an appropriate amount of antibody can stimulate or block the production or activity of human lipoxygenase 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human lipoxygenase 9 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human lipoxygenase 9 detected in the test can be used to explain the importance of human lipoxygenase 9 in various diseases and to diagnose diseases in which human lipoxygenase 9 functions.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, more preferably mass spectrometry analysis.
- the polynucleotide encoding human lipoxygenase 9 can also be used for a variety of therapeutic purposes.
- Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human lipoxygenase-9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human lipoxygenase 9 to inhibit endogenous human lipoxygenase 9 activity.
- a mutant human lipoxygenase 9 may be a shortened human lipoxygenase 9 lacking a signal transduction domain. Although it can bind to a downstream substrate, it lacks signal transduction activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human lipoxygenase-9.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to encode human lipids
- the polynucleotide of fat oxidase 9 is transferred into the cell.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding human lipoxygenase 9 can be found in the existing literature (Sambrook, etal.).
- recombinant polynucleotide encoding human lipoxygenase 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human lipoxygenase 9 raRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific R. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA and performs endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.
- the polynucleotide encoding human lipoxygenase 9 can be used for the diagnosis of diseases related to human lipoxygenase 9.
- the polynucleotide encoding human lipoxygenase 9 can be used to detect the expression of human lipoxygenase 9 or the abnormal expression of human lipoxygenase 9 in a disease state.
- the DNA sequence encoding human lipoxygenase 9 can be used to hybridize biopsy specimens to determine the expression status of human lipoxygenase 9.
- Hybridization techniques include Sout hern, Int blot, in situ hybridization, and so on. These technical methods are all mature technologies that are publicly available, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray) or a D chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- a microarray Microray
- a D chip also known as a "gene chip”
- Human lipoxygenase 9 specific primers can also be used to detect the transcription products of human lipoxygenase 9 by performing RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Detection of mutations in the human lipoxygenase 9 gene can also be used to diagnose human lipoxygenase 9-related diseases.
- Human lipoxygenase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human lipoxygenase 9 DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, few chromosome markers based on actual sequence data (repeating polymorphisms) are available. Used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
- PCR primers (preferably 15-35 bp) are prepared from cDNA, which can be used to localize the sequence to only those hybrid cells that correspond to the human genes of the primers to produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is 'observed' in some or all diseased individuals, and the mutation is not observed in any normal individual, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- containers containing one or more ingredients of the pharmaceutical composition of the present invention.
- instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which instructions reflect production, use Or a government agency that sells it allows it to be administered to humans.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human lipoxygenase 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human lipoxygenase 9 to be administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- RNA Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multicloning site of pBSK (+) vector (Clontech) and transformed into DH5 ⁇ . The bacteria formed a cDNA library.
- Dye terminate cycle reaction ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0317e04 was new DNA.
- the inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers.
- CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Pr imerl 5'- TCTTAATGTTGAGACTAGGTTACA -3, (SEQ ID NO: 3)
- Primer2 5'- ACACAAGCATTTATTCTCTTACAG -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.
- Conditions for the amplification reaction 50 mmol / L KC1, 10 mmol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl 2 , 200 ⁇ 1 / ⁇ dNTP, lOpmol primer, 1U Taq DNA polymerase in a 50 ⁇ 1 reaction volume (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min.
- ⁇ -act in was set as positive during RT-PCR. Controls and template blanks were negative controls.
- the amplified products were purified using a QIAGEN kit and linked to a pCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis showed that the DNA sequence of the PCR product was in accordance with SEQ ID NO: The l-1860bp shown in Figure 1 are identical.
- Example 3 Northern blot analysis of human lipoxygenase 9 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] rempliThis method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M acetic acid Sodium (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol (0.8 Volume) and the mixture was centrifuged to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- RNA in 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7. 0) was electrophoresed on a 1.2% agarose gel -5mM -ImM EDTA-2.2M sodium acetate, formaldehyde and then transferred to a nitrocellulose membrane.
- 32 ⁇ - DNA labeled with a- 32 P dATP by random priming Preparation Method probe is shown in Figure 1 PCR amplified human lipoxygenase (40bp to 291bp).
- Primer3 5'- CATGCTAGCATGAAGGTAGAGGGAAGGTGCTCA -3, (Seq ID No: 5)
- Primer4 5'- CATGGATCCTCATCCTGTTGCTTGTAGAATAAG -3, (Seq ID No: 6)
- the 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Nhel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the pBS-0317e04 plasmid of the target gene was used as a template for PCR reaction.
- the PCR reaction conditions are as follows: a total volume of 50 ⁇ 1 contains 10 pg of pBS-0317e04 plasmid, primers? 1: 111 ⁇ ]: -3 and? ]: 111 ⁇ ]: 4 are 10 [1101, Advantage polymerase Mix (product of Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH5a by the calcium chloride method, and cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), and positive clones were selected by colony PCR method and sequenced. Positive sequence correct clone (pET-0317e04) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- NH2-Met-Lys-Val-Glu-Gly-Arg-Cys-Ser-Glu-Leu-Ser-Tyr-Lys-His-Ser-C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Protein A-Sepharose was used to isolate total IgG from antibody-positive rabbit sera.
- the peptide was bound to a cyanogen bromide-activated Sepharos B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method demonstrated that the purified antibody specifically bound to human lipoxygenase 9.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to Identifying whether it contains the polynucleotide sequence of the present invention and detecting a homologous polynucleotide sequence, further The probe can also be used to detect whether the polynucleotide sequence of the present invention or a homologous polynucleotide sequence is abnormally expressed in cells of normal tissue or pathological tissue.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and synthetic polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used in general;
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps
- the film was washed with high-strength conditions and strength conditions, respectively.
- the 32 P-Probe (the second peak is free ⁇ - 32 P-dATP) is prepared.
- the sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (OxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution OxDenhardt's; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)
- Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; finding and screening for tissue specificity New genes, especially those related to diseases such as tumors; Diagnosis of diseases, such as hereditary diseases.
- a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA), between the points. The distance is 280 ⁇ m. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to D to fix the slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) using a one-step method, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP 5-Amino-propargyl-2'-deoxyuridine 5--triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissue, and Cy5dUTP (5-Amino-propargyl-2'-deoxyuridine 5) was used as a fluorescent reagent.
- the probes from the above two tissues were hybridized with the chip in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (1 ⁇ SSC, 0.2 SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from Genera Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, draw a bar graph ( Figure 1). It can be seen from the figure that the expression profiles of human lipoxygenase 9 and human lipoxygenase 10 according to the present invention are very similar.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Genetics & Genomics (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU42225/01A AU4222501A (en) | 2000-03-15 | 2001-02-26 | A new polypeptide-human lipoxidase 10 and the polynucleotide encoding it |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN00114912A CN1313389A (zh) | 2000-03-15 | 2000-03-15 | 一种新的多肽——人脂肪氧化酶9和编码这种多肽的多核苷酸 |
CN00114912.1 | 2000-03-15 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001068823A1 true WO2001068823A1 (fr) | 2001-09-20 |
Family
ID=4584387
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000168 WO2001068823A1 (fr) | 2000-03-15 | 2001-02-26 | Nouveau polypeptide, lipoxydase humaine 9, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1313389A (zh) |
AU (1) | AU4222501A (zh) |
WO (1) | WO2001068823A1 (zh) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0038750A1 (en) * | 1980-04-17 | 1981-10-28 | Merck & Co. Inc. | Immunologically active dipeptidyl 4-0-, 6-0-acyl-2-amino-2-deoxy-D-glucose derivatives and methods for their preparation |
WO1994005777A1 (en) * | 1992-08-28 | 1994-03-17 | City Of Hope | Inhibition of the formation or activity of human leukocyte 12-lipoxygenase pathway |
WO1996034943A1 (en) * | 1995-05-04 | 1996-11-07 | City Of Hope | Human leukocyte 12-lipoxygenase and its role in the pathogenesis of disease states |
-
2000
- 2000-03-15 CN CN00114912A patent/CN1313389A/zh active Pending
-
2001
- 2001-02-26 WO PCT/CN2001/000168 patent/WO2001068823A1/zh active Application Filing
- 2001-02-26 AU AU42225/01A patent/AU4222501A/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0038750A1 (en) * | 1980-04-17 | 1981-10-28 | Merck & Co. Inc. | Immunologically active dipeptidyl 4-0-, 6-0-acyl-2-amino-2-deoxy-D-glucose derivatives and methods for their preparation |
WO1994005777A1 (en) * | 1992-08-28 | 1994-03-17 | City Of Hope | Inhibition of the formation or activity of human leukocyte 12-lipoxygenase pathway |
WO1996034943A1 (en) * | 1995-05-04 | 1996-11-07 | City Of Hope | Human leukocyte 12-lipoxygenase and its role in the pathogenesis of disease states |
Also Published As
Publication number | Publication date |
---|---|
CN1313389A (zh) | 2001-09-19 |
AU4222501A (en) | 2001-09-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (fr) | Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide | |
WO2001068689A1 (fr) | Nouveau polypeptide, 1alpha sous-unite 13 humaine du facteur adaptatif de l'hypoxie, et polynucleotide codant pour ce polypeptide | |
WO2001092514A1 (fr) | Nouveau polypeptide, interleukine humaine 13 (il-13), et polynucleotide codant ce polypeptide | |
WO2001068823A1 (fr) | Nouveau polypeptide, lipoxydase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001088084A2 (fr) | Nouveau polypeptide, superoxyde dismutase 11, et polynucleotide codant pour ce polypeptide | |
WO2001083538A1 (fr) | Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide | |
WO2001068684A1 (fr) | Nouveau polypeptide, protocadherine humaine 14, et polynucleotide codant pour ce polypeptide | |
WO2001055380A1 (fr) | Nouveau polypeptide, 3-beta-hydroxysteroide deshydrogenase/5-ene-4-ene isomerase 57, et polynucleotide codant pour ce polypeptide | |
WO2001046240A1 (fr) | Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide | |
WO2001072980A1 (fr) | Nouveau polypeptide, peroxydase humaine 18, et polynucleotide codant pour ce polypeptide | |
WO2001068873A1 (fr) | Nouveau polypeptide, molecule humaine d'adhesion intercellulaire 12, et polynucleotide codant pour ce polypeptide | |
WO2001048167A1 (fr) | Nouveau polypeptide, lipoxygenase 10, et polynucleotide codant pour ce polypeptide | |
WO2001075023A2 (fr) | Nouveau polypeptide, phosphatidylinositol-3 (ptdins 3) kinase humaine 9, et polynucleotide codant pour ce polypeptide | |
WO2001088158A1 (fr) | Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001064721A1 (fr) | Nouveau polypeptide, adenosine triphosphatase 30, et polynucleotide codant pour ce polypeptide | |
WO2001072790A1 (fr) | Nouveau polypeptide, proteine humaine p40 12 de facteur l1, et polynucleotide codant pour ce polypeptide | |
WO2001083760A1 (fr) | Nouveau polypeptide, sous-unite humaine 9 d'alpha-cetone acidohydrogenase ramifiee e1-beta, et polynucleotide codant pour ce polypeptide | |
WO2001073045A1 (fr) | Nouveau polypeptide, quinine reductase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001072788A1 (fr) | Nouveau polypeptide, pterine-molybdene oxydoreductase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001090174A1 (fr) | Nouveau polypeptide, peroxisome acide gras acetyl-coa oxydase humaine 46,97, et polynucleotide codant ce polypeptide | |
WO2001081395A1 (fr) | Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide | |
WO2001064732A1 (fr) | Nouveau polypeptide, facteur humain associe a la retrotransposition 14, et polynucleotide codant pour ce polypeptide | |
WO2001079435A2 (en) | A new polypeptide- human flavoprotein subunit 14 and the polynucleotide encoding it | |
WO2001074995A2 (en) | A novel polypeptide - human ataxia-telangiectasia mutant protein 15 and a polynucleotide encoding the same | |
WO2001068692A1 (fr) | Nouveau polypeptide, proteine humaine conjuguee du cancer de la retine 9, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
122 | Ep: pct application non-entry in european phase | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase |
Ref country code: JP |