WO2001047994A1 - Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide - Google Patents
Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide Download PDFInfo
- Publication number
- WO2001047994A1 WO2001047994A1 PCT/CN2000/000674 CN0000674W WO0147994A1 WO 2001047994 A1 WO2001047994 A1 WO 2001047994A1 CN 0000674 W CN0000674 W CN 0000674W WO 0147994 A1 WO0147994 A1 WO 0147994A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- pep
- protein
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- a new peptide ⁇ PEP utilizes protein 10 and a polynucleotide encoding this polypeptide
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a PEP utilization protein 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide.
- PPDK orthophosphate dikinase
- PPDK In some bacteria, the function of PPDK is the direct synthesis of ATP; PEP synthetase, which reversibly phosphorylates pyruvate through ATP, thereby forming PEP, AMP and phosphate, This reaction is a basic step of glycolysis; PEP protein phosphotransferase, which is the first PEP-dependent enzyme of the sugar phosphotransferase system, is the main carboxytransferase in bacteria.
- All enzymes have a common catalytic mechanism: they bind PEP and transfer their phosphate group to a histidine residue.
- the sequence surrounding this histidine residue is highly conserved and can be represented by a characteristic pattern.
- At the C-terminus of the PEP there is also a conservative pattern of features.
- the two characteristic modes are: [1] G- [GA] -X- [TN] -X-H- [STA]-[STAV]-[L IVM] (2)-[STAV]-[RG].
- H means phosphorylated.
- PEP utilizes family proteins that are widely found in bacteria, plants, and humans. They are involved in various metabolic pathways such as glycolysis, and are an important step in these metabolic pathways. Therefore, the abnormal expression of PEP utilization family proteins will lead to a series of metabolic diseases, namely some related glucose metabolism disorders, amino acid metabolism disorders and some related substance metabolism disorders.
- PEP utilization protein 10 protein plays an important role in important functions of the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more PEP utilization protein 10 proteins involved in these processes. In particular, the amino acid sequence of this protein is identified.
- the new PEP utilizes the isolation of protein 10 protein-encoding genes, which also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for developing diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is very important.
- PEP polypeptide utilizing protein 10 and its fragments, analogs and derivatives.
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a PEP utilization protein 10.
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a PEP utilization protein 10.
- Another object of the present invention is to provide a method for producing PEP utilization protein 10.
- Another object of the present invention is to provide an antibody against the polypeptide-pEP utilization protein 10 of the present invention.
- Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the polypeptide- "PEP utilization protein 10" of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in PEP utilization protein 10. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 270-5 to 33 in SEQ ID NO: 1; and (b) a sequence having 1- in SEQ ID NO: 1 2237-bit sequence.
- the invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- a vector in particular an expression vector, containing the polynucleotide of the invention
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell
- a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit PEP utilization protein 10 protein activity, which comprises utilizing the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or susceptibility to disease associated with abnormal expression of PEP utilization protein 10 protein in vitro, comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the amount or biological activity of a polypeptide of the invention comprising detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of PEP utilization protein 10.
- Fig. 1 is a comparison diagram of the amino acid sequence homology of the characteristic proteins of the PEP utilization protein 10 of the present invention in a range of 4-75 to 72 amino acids and domains.
- the upper sequence is the PEP utilization protein 10
- the lower sequence is the characteristic protein domain of the PEP utilization protein.
- ⁇ "and”: “and”. “Indicate that the probability of the same amino acid decreasing between the two sequences decreases in sequence.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated PEP using protein 10.
- OkDa is the molecular weight of the protein.
- the arrow indicates the isolated protein band.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a “variant" of a protein or polynucleotide is one that has one or more amino acid or nucleotide changes Amino acid sequence or polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- Insertion means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature.
- Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with PEP utilization protein 10, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can utilize protein 10 in combination with PEP.
- Antagonist refers to a molecule that can block or regulate the biological or immunological activity of PEP utilization protein 10 when combined with PEP utilization protein 10.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can utilize protein 10 in combination with PEP.
- Regulation refers to a change in the function of PEP utilization protein 10, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of PEP utilization protein 10.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
- Those skilled in the art can purify PEP using protein 10 using standard protein purification techniques. Basically pure PEP utilizes protein 10 to produce a single main band on a non-reducing polyacrylamide gel. The purity of PEP utilization protein 10 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T
- the complementarity between two single-stranded molecules can be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of this hybridization can be achieved by hybridization under conditions of reduced stringency (Southern blotting or Nor thern Blot, etc.) to detect. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences.
- the percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madi son Wis.).
- the MEGALIGN program can compare two or more sequences according to different methods, such as the Clus ter method (Higg ins, D. G. and P. M. Sharp (1988) Gene 73: 237-244).
- the Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
- the percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of residues matching between sequence and sequence ⁇
- the number of residues in the sequence-the number of spacer residues in the sequence ⁇ -the number of spacer residues in the sequence ⁇ X can also be determined by the Clus ter method or using methods known in the art such as Jotun Hein (Hein J (1990) Methods in enzymology 183: 625-645).
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence.
- the "antisense strand” refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. Such a chemical modification may be a substitution of a hydrogen atom with a fluorenyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to an intact antibody molecules and fragments thereof, such as Fa, F (a b ') 2 and F V, which specifically binds to an antigen protein using PEP 10 determinant.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally).
- a naturally-occurring polynucleotide or polypeptide exists in a living animal. It is not isolated, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .
- isolated PEP utilization protein 10 means that PEP utilization protein 10 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify PEP utilizing protein 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. PEP utilizes the purity of protein 10 polypeptides that can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide "PEP utilization protein 10", which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. Recombinant polypeptides.
- Polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated or may be non-glycosylated.
- the polypeptide of the invention may also include or not include the initial methionine residue.
- the invention also includes fragments, derivatives and analogs of PEP utilization protein 10.
- fragment refers to a polypeptide that substantially maintains the same biological function or activity of the PEP utilization protein 10 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or ( ⁇ ⁇ ) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify this polypeptide or protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes a nucleoside of SEQ ID NO: 1 Acid sequence.
- the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2237 bases in total length and its open reading frame 270-533 encodes 87 amino acids.
- This polypeptide has the characteristic sequence of the characteristic protein of the PEP utilization protein, and it can be deduced that the PEP utilization protein 10 has the structure and function represented by the characteristic protein of the PEP utilization protein.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant.
- These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions.
- “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1Vj, bovine serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding PEP utilization protein 10.
- the polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- polynucleotide sequence encoding the PEP utilization protein 10 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- mRNA extraction There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene;).
- the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of transcripts of protein 10 utilized by PEP; (4) by Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.
- the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the PEP 10 protein.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DNA / RM using PCR technology is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
- the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using PEP using a protein 10 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.
- a polynucleotide sequence encoding a PEP utilization protein 10 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain origins of replication, promoters, marker genes, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a PEP utilization protein 10 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
- the expression vector preferably contains one or more selectable marker genes to provide for selection
- selectable marker genes to provide for selection
- the phenotypic traits of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.
- GFP green fluorescent protein
- a polynucleotide encoding a PEP utilization protein 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as insect cells such as Fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The steps used are well known in the art. Alternatively, MgCl 2 is used. If necessary, transformation can also be performed by electroporation.
- the host is a eukaryotic organism, the following D transfection methods can be used: calcium phosphate co-precipitation, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- polynucleotide sequence of the present invention can be used to express or produce recombinant PEP utilization protein 10 (Science, 1984; 224: 1431). Generally there are the following steps:
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
- recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.
- Phosphate-type pyruvate utilizes an enzyme to bind phosphate-type dipyruvate (PEP) to transfer its phosphate group to a histidine residue.
- Phosphoric acid dilute pyruvate is important in the reversible phosphorylation of pyruvate and phosphoric acid, the reversible phosphorylation of pyruvate by ATP, and the phosphorylation of PEP proteins. It involves glycolysis, energy use, substances Aspects of circulation.
- Phosphate-pyruvate utilizes an enzyme-specific conserved sequence that is required to form its active mot if.
- the abnormal expression of the specific phospho-ol-pyruvate utilization enzyme mot if will cause the function of the polypeptide containing the mot if of the present invention to be abnormal, thereby causing abnormalities such as glycolysis, energy utilization, and material circulation. And produce related diseases such as energy and material metabolism disorders, tumors, embryonic development disorders, growth and development disorders.
- the abnormal expression of the PEP utilization protein 10 of the present invention will produce various diseases, especially energy and material metabolism disorders, embryonic development disorders, growth and development disorders, and various tumors. These diseases include, but are not limited to:
- Energy and substance metabolism disorders isovalerate, propionate, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, phenylketonuria, albinism, tryptamine Disease, glycineemia, hypersarcosineemia, glutamate metabolism deficiency disease, metabolic deficiency disease of the urea cycle, histidine metabolism deficiency disease, lysine metabolism deficiency disease, mucopolysaccharidosis type I-VII, mucus Lipid storage disease, Ray-niney syndrome, xanthineuria, orotic aciduria, adenine hyperlipoproteinemia, congenital lactose intolerance, galactoseemia, fructose metabolism deficiency, glycogen storage Disease
- Embryonic disorders congenital abortion, cleft palate, limb loss, limb differentiation disorder, hyaline membrane disease, atelectasis, polycystic kidney, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, suburethral Fissure, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, arterial duct occlusion, neural tube defect, congenital hydrocephalus, iris defect, congenital cataract, congenital glaucoma or cataract, congenital deafness
- Growth and development disorders mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation
- Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, Thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer , Brain cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroma, fibrosarcoma, lipoma, liposarcoma, leiomyoma
- the abnormal expression of the PEP utilization protein 10 of the present invention will also produce certain inflammations, certain hereditary, blood diseases, and immune system diseases.
- the polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially energy and material metabolism disorders, embryonic development disorders, growth and development disorders, Various tumors, some inflammations, some hereditary, hematological diseases, and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) PEP utilization protein 10.
- Agonists increase the biological functions of PEP by stimulating cell proliferation using protein 10, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing PEP utilization protein 10 can be cultured together with labeled PEP utilization protein 10 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.
- Antagonists of PEP using protein 10 include antibodies, compounds, receptor deletions, and the like that have been screened.
- the antagonist of PEP utilization protein 10 can bind to PEP utilization protein 10 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.
- PEP utilization protein 10 When screening compounds as antagonists, PEP utilization protein 10 can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between PEP utilization protein 10 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds.
- Peptide molecules capable of binding to PEP utilization protein 10 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. During screening, PEP should generally be labeled with 10 molecules of protein.
- the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies directed against the PEP utilization protein 10 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.
- polyclonal antibodies can be obtained by immunizing animals (such as rabbits, mice, rats, etc.) directly with PEP using protein 10, and a variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing PEP monoclonal antibodies using protein 10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, EBV-hybridoma Technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). And existing techniques for producing single-chain antibodies (US Pat No. .4946778) can also be used to produce single chain antibodies against PEP utilization protein 10.
- Antibodies against PEP utilization protein 10 can be used in immunohistochemical techniques to detect PEP utilization protein 10 in biopsy specimens.
- Monoclonal antibodies that bind to PEP utilization protein 10 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- PEP uses protein 10 with high affinity monoclonal antibodies that can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill PEP using protein 10 positive cells.
- the antibodies of the present invention can be used to treat or prevent diseases related to PEP utilization protein 10.
- Administration of an appropriate dose of antibody can stimulate or block the production or activity of PEP utilization protein 10.
- the invention also relates to a diagnostic test method for quantitative and localized detection of PEP utilization protein 10 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of PEP utilization protein 10 detected in the test can be used to explain the importance of PEP utilization protein 10 in various diseases and to diagnose diseases in which PEP utilization protein 10 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- Polynucleotides encoding PEP utilization protein 10 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of PEP utilization protein 10.
- Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant PEP utilization protein 10 to inhibit endogenous PEP utilization protein 10 activity.
- a mutated PEP utilization protein 10 may be a shortened PEP utilization protein 10 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of PEP using protein 10.
- Virus-derived expression vector Such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding PEP utilization protein 10 into cells.
- a method for constructing a recombinant viral vector carrying a polynucleotide encoding a PEP utilization protein 10 can be found in the existing literature (Sambrook, et al.).
- the polynucleotide encoding the PEP utilization protein 10 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit PEP utilization protein 10 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation.
- Antisense RNA, DNA, and ribozymes can be obtained using any existing R or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides.
- Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA.
- This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding PEP utilization protein 10 can be used for the diagnosis of diseases related to PEP utilization protein 10.
- Polynucleotides encoding PEP utilization protein 10 can be used to detect the expression of PEP utilization protein 10 or the abnormal expression of PEP utilization protein 10 in a disease state.
- the DNA sequence encoding PEP utilization protein 10 can be used to hybridize biopsy specimens to determine the expression of PEP utilization protein 10.
- Hybridization techniques include Southern blotting, Northern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available.
- a part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray (Microarray) or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
- PEP utilizes protein 10 specific primers for RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect PEP utilization protein 10 transcripts.
- PEP utilization protein 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type PEP utilization protein 10 D sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these D sequences on a chromosome.
- PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
- the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
- there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- PEP utilizes protein 10 in an amount effective to treat and / or prevent a specific indication.
- the amount and range of PEP utilization protein 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RNA using Quik raRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms CDM by reverse transcription.
- the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragments into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 cc.
- the bacteria formed a cDNA library.
- the sequences at the 5 'and 3' ends of all clones were determined using Dye termina te cyc le react ion sequencing kit (Perk in-Elmer) and ABI 377 automatic sequencer (Perk in-Elmer).
- the determined cDNA sequence was compared with the existing public DM sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0094g08, was new DNA.
- a series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions.
- the PEP of the present invention utilizes the sequence of protein 10 and its encoded protein sequence, using the profil scan program (Basic loca l al ignment search tool) in GCG [Al tschul, SF et a l. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as prosite.
- the PEP utilization protein 10 of the present invention has homology with the characteristic protein of the domain PEP utilization protein at 4-75. The homology result is shown in FIG. 1, the homology rate is 0.23, and the score is 12.15; the threshold value is 11.14.
- Example 3 Cloning of a gene encoding PEP utilization protein 10 by RT-PCR
- CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- CTCTTCGATTTCTTTCAGGCCTGA -3 '(SEQ ID NO: 3)
- Primer2 5'- TATAATACTCATATTAAAGTTTTA -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
- Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.
- Amplification conditions 50 ⁇ l reaction volume containing 50 ⁇ l / L KC1, 10 mmol / L Tris- HC1, pH 8.5, 1.5 mmol / L MgCl 2 , 200 mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech).
- the reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min.
- ⁇ -act in was set as a positive control and template blank was set as a negative control.
- the amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit.
- the DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2237bp shown in SEQ ID NO: 1.
- Example 4 Northern blot analysis of PEP utilization protein 10 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (about 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (pH 7.4) -5 x SSC- 5 x Denhardt's solution and 200 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filters were placed in 1x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification.
- Example 5 In vitro expression, isolation and purification of recombinant PEP using protein 10
- Primer3 5'- CCCCATATGATGATCTCTTTTAAAAAGAAATTAA -3 '(Seq ID No: 5)
- Primer4 5'- CCCGAATTCTCATGGAGAGGAATTTCTCCATACC -3' (Seq ID No: 6)
- the 5 'ends of these two primers contain Ndel and EcoRI restriction sites, respectively.
- the coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively.
- the Ndel and EcoRI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site.
- the PCR reaction was performed using the pBS-0094g08 plasmid containing the full-length target gene as a template.
- the PCR reaction conditions were as follows: a total volume of 50 ⁇ 1 containing 10 pg of pBS-0094g08 plasmid, primers Primer-3, and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligated product was transformed into E. coli DH5 CC using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 ( ⁇ g / ml)), positive clones were screened by colony PCR method and sequenced. Positive sequence correct clone (pET-0094g08) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method.
- a peptide synthesizer (product of PE company) was used to synthesize the following PEP-specific peptides:
- NH 2 -Met-Ile-Ser-Phe-Lys-Lys-Lys-Leu-Asn-Gln-Thr-Pro-His-Gly-Gly-COOH SEQ ID NO: 7
- the polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex.
- Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
- a titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum.
- Using protein A-Sepharose from antibody-positive rabbit serum Total IgG was isolated.
- the peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography.
- the immunoprecipitation method proved that the purified antibody could specifically bind to PEP utilization protein 10.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- the GC content is 30 ° /. -70%, non-specific hybridization increases
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomes The sequence and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;
- Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt)
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membranes nitrocellulose membranes
- Two NC membranes are required for each probe, so that it can be used in the following experimental steps.
- the film was washed with high-strength conditions and strength conditions, respectively.
- the sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ral CT DNA (calf thymus DNA)
- probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues.
- Gene microarray or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific methods and steps have been reported in the literature for various references.
- a total of 4,000 polynucleotide sequences of various full-length cDs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from normal liver and liver cancer by one-step method, and the mRNA was purified by Oligotex mRNA Midi Kit (purchased from QiaGen).
- the fluorescent reagent Cy3dUTP (5_Amino- propargy 1-2 '-deoxyur i dine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased (Amersham Phamacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Am ino-propargy 1-2 ⁇ -deoxyur i dine 5'-tr iphate coupled to Cy5 f luorescent dye was purchased from Amersham Phamacia Biotech. ) Label liver cancer tissue mRNA and prepare probes after purification. For specific steps and methods, see
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed at room temperature with a washing solution (1 x SSC, 0.2% SDS) Then scan with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images are analyzed by Imagene software (Biodi scovery, USA), and the Cy3 / Cy5 ratio of each point is calculated. The ratio is less than 0. Points greater than 5 are considered genes with differential expression.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU21440/01A AU2144001A (en) | 1999-12-27 | 2000-12-25 | A novel polypeptide - pep-utilizing protein 10 and a polynucleotide encoding thesame |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99125392.2 | 1999-12-27 | ||
CN 99125392 CN1301727A (zh) | 1999-12-27 | 1999-12-27 | 一种新的多肽——pep利用蛋白10和编码这种多肽的多核苷酸 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001047994A1 true WO2001047994A1 (fr) | 2001-07-05 |
Family
ID=5283919
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2000/000674 WO2001047994A1 (fr) | 1999-12-27 | 2000-12-25 | Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1301727A (zh) |
AU (1) | AU2144001A (zh) |
WO (1) | WO2001047994A1 (zh) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPH07184657A (ja) * | 1993-12-28 | 1995-07-25 | Japan Turf Glass:Kk | イネにおけるc4光合成関連遺伝子およびそのプロモーター |
JPH08168375A (ja) * | 1994-12-19 | 1996-07-02 | Kikkoman Corp | ピルベートオルトホスフェートジキナーゼ及びその製造方法 |
GB2317892A (en) * | 1996-10-03 | 1998-04-08 | Kikkoman Corp | Gene encoding pyruvate orthophosphate dikinase |
US5856177A (en) * | 1987-11-18 | 1999-01-05 | Mycogen Corporation | Promoters derived from the maize phosphoenolpyruvate carboxylase gene involved in C4 photosynthesis |
-
1999
- 1999-12-27 CN CN 99125392 patent/CN1301727A/zh active Pending
-
2000
- 2000-12-25 WO PCT/CN2000/000674 patent/WO2001047994A1/zh active Application Filing
- 2000-12-25 AU AU21440/01A patent/AU2144001A/en not_active Abandoned
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5856177A (en) * | 1987-11-18 | 1999-01-05 | Mycogen Corporation | Promoters derived from the maize phosphoenolpyruvate carboxylase gene involved in C4 photosynthesis |
JPH07184657A (ja) * | 1993-12-28 | 1995-07-25 | Japan Turf Glass:Kk | イネにおけるc4光合成関連遺伝子およびそのプロモーター |
JPH08168375A (ja) * | 1994-12-19 | 1996-07-02 | Kikkoman Corp | ピルベートオルトホスフェートジキナーゼ及びその製造方法 |
GB2317892A (en) * | 1996-10-03 | 1998-04-08 | Kikkoman Corp | Gene encoding pyruvate orthophosphate dikinase |
Also Published As
Publication number | Publication date |
---|---|
CN1301727A (zh) | 2001-07-04 |
AU2144001A (en) | 2001-07-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001090169A1 (fr) | Nouveau polypeptide, antigene nucleaire de proliferation cellulaire (pcna) 13, et polynucleotide codant ce polypeptide | |
WO2001090378A1 (fr) | Nouveau polypeptide, proteine humaine hexokinase 11, et polynucleotide codant ce polypeptide | |
WO2001038540A1 (fr) | Nouveau polypeptide, la methionyl arnt synthetase humaine de 29 kda, et polynucleotide codant pour ledit polypeptide | |
WO2001047994A1 (fr) | Nouveau polypeptide, proteine 10 utilisant pep, et polynucleotide codant pour ce polypeptide | |
WO2001075085A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 11.3, et polynucleotide codant pour ce polypeptide | |
WO2001048159A1 (fr) | Nouveau polypeptide, dihydroorotase 9, et polynucleotide codant pour ce polypeptide | |
WO2001072793A1 (fr) | Nouveau polypeptide, proteine humaine de regulation 12 de la proteine hydrolase, et polynucleotide codant pour ce polypeptide | |
WO2001085923A1 (fr) | Nouveau polypeptide, serine hydrolase humaine atp-dependante 9.2, et polynucleotide codant pour ce polypeptide | |
WO2001083681A2 (fr) | Nouveau polypeptide, dihydroorotase humaine 21, et polynucleotide codant pour ce polypeptide | |
WO2001047984A1 (fr) | Nouveau polypeptide, proteine 10 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001048199A1 (fr) | Nouveau polypeptide, proteine ribosomale s10 14, et polynucleotide codant pour ce polypeptide | |
WO2001049723A1 (en) | A novel polypeptide-atpase 9 and the polynucleotide encoding said polypeptide | |
WO2001047974A1 (fr) | Nouveau polypeptide, dihydroorotase humaine 10, et polynucleotide codant pour ce polypeptide | |
WO2001049853A1 (fr) | Phosphoribosyle glycinamide synthase 9 et polynucleotide codant ce polypeptide | |
WO2001048166A1 (fr) | Nouveau polypeptide, ribonucleotide reductase 10, et polynucleotide codant pour ce polypeptide | |
WO2001075024A2 (fr) | Nouveau polypeptide, facteur humain 13 associe a nf-e2, et polynucleotide codant pour ce polypeptide | |
WO2001072810A1 (fr) | Nouveau polypeptide, proteine humaine 12 de la famille des amidases, et polynucleotide codant pour ce polypeptide | |
WO2001073065A1 (fr) | Nouveau polypeptide, glycinamide ribonucleotide synthetase humaine 12, et polynucleotide codant pour ce polypeptide | |
WO2001047987A1 (fr) | Nouveau polypeptide, gene $g(s)-54, et polynucleotide codant pour ce polypeptide | |
WO2001085776A1 (fr) | Polypeptide humain dihydro-orotase 12 et polynucleotide codant pour ce polypeptide | |
WO2001073041A1 (fr) | Nouveau polypeptide, adn ligase humaine 15, et polynucleotide codant pour ce polypeptide | |
WO2001090373A1 (fr) | Nouveau polypeptide, sous-unite de regulation 37 de la proteine phosphatase 4, et polynucleotide codant ce polypeptide | |
WO2001074885A1 (fr) | Nouveau polypeptide, spase i humaine 8, et polynucleotide codant pour ce polypeptide | |
WO2001046425A1 (fr) | Nouveau polypeptide, adn ligase 10, et polynucleotide codant pour ce polypeptide | |
WO2001094402A1 (fr) | Nouveau polypeptide, proteine npat humaine 12, et polynucleotide codant pour ce polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |