WO2001032699A1 - Novel human udp-glucose: glycoprotein glucosyltransferase and a polynucleotide encoding the same - Google Patents

Abstract

The present invention discloses a novel polypeptide - novel human UDP-glucose: glycoprotein glucosyltransferase ('BioHUGTR') and a polynucleotide encoding the same, as well as a method of producing the polypeptide by DNA recombinant technology. The present invention also discloses methods of using the polypeptide and polynucleotide in treatment of various diseases such as immunological disorder, tumor and the like. The present invention also discloses an antagonist against the polypeptide and the therapeutic use of the same. The present invention also discloses methods of identifying mutations in the BioHUGTR nucleic acid sequence and determinating changes in the BioHUGTH expression level. The present invention also discloses the use of such polynucleotide encoding such novel BioHUGTR.

Description

 Explanation book

 New human UDP glucose-glycoprotein glucosyltransferase and coding sequence thereof TECHNICAL FIELD

 The present invention belongs to the field of biotechnology and genetic engineering. Specifically, the present invention relates to a novel polypeptide human UDP glucose-glycoprotein glucosyltransferase (Novel Human UDP-glucose: gl ycoprotein glucosyl tr disorder sferase, referred to as " BioHUGTR "), and a polynucleotide sequence encoding this polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 Glycosyltransferase is a Golgi-specific enzyme that transfers oligosaccharides to proteins to form glycoproteins. Most glycosyltransferases are type II membrane-bound proteins. Its N-terminus is in the cytoplasm and is rich in basic amino acids; its transmembrane part contains a higher proportion of hydrophobic amino acids: its longer C-terminus is in the lumen of the endoplasmic reticulum or Golgi apparatus, which is spherical and Catalytic activity; a characteristic structure is present between the transmembrane peptide and the catalytic part, with glycine and proline concentrated. The transmembrane part and the partial amino acid sequence of the adjacent region constitute a delivery signal, so that the enzyme is localized in the Golgi apparatus. If the sequence is absent or absent, it will be localized on the cell surface or secreted outside the cell.

UDP glucose-glycoprotein glucosyltransferase is a soluble protein in the endoplasmic reticulum, which is involved in regulating the folding of glycoproteins. It glycosylates the protein-linked Man7-9G1 _C NN _C 2 to a monoglycosylated derivative. This enzyme can glycosylate misfolded glycoproteins and participate in the regulation so that correctly folded glycoproteins can emerge from the endoplasmic reticulum. It recognizes two factors of the receptor substrate: the N-acetylglucosamine unit of the oligosaccharide and the protein domain exposed in the denatured conformation [Sousa M, et al. EMBO J 1995: 14: 4196-203]. It catalyzes the glycosylation of protein-linked oligosaccharides with high mannose content and requires Ca ^:- , in which UDP-Glc is used as a sugar donor [Trombetta SE, et al. J Biol Chem 1992; 267: 9236-40].

 The absence or mutation of the glycosyltransferase, the reduction or the increase of its activity will affect the structural abnormality of the sugar chain. And sugar chain structural abnormalities may be common in many diseases. For example, an increase in glycosyltransferase activity will cause an increase in the number of sugar chain branches, which is positively related to the metastatic potential of many malignancies. Ras gene over-expressed in hepatocellular carcinoma cells regulates the high activity of glycosyltransferases and induces carcinogenesis [edited by Wang Keyi et al., "Front-end molecular biology technology-modern biomedical series" pages 231-237, 1998, Beijing Medical University and Concord Jointly published by Medical University].

Studies have shown that glycosyltransferases are closely related to some diseases, such as abnormalities in cell differentiation, adhesion, proliferation, and recognition reactions, disorders in the regulation of the immune system, tumorigenesis, and oncogene transfer. Therefore, it is of great significance to study and develop transmembrane glycosyltransferases for therapeutic purposes. Disclosure of invention

 It is an object of the present invention to provide an isolated novel polypeptide, human UDP glucose-glycoprotein glucosyltransferase (referred to as "BioHUGTR"), and fragments, analogs and derivatives thereof.

 Another object of the present invention is to provide a polynucleotide encoding the Bi HUGTR polypeptide.

 It is another object of the present invention to provide a recombinant vector containing a polynucleotide encoding BioHUGTR.

 Another object of the invention is to provide a genetically engineered host cell containing a polynucleotide encoding a BioHUGTR.

 Another object of the present invention is to provide a method for producing BioHUGTR.

 Another object of the present invention is to provide antibodies against the BioHUGTR polypeptide of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the BioHUGTR polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities in BioHUGTR.

 In a first aspect of the present invention, a novel isolated human UDP glucose-glycoprotein glucosyltransferase (BioHUGTR) is provided. The polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2; Or its conservative variant polypeptide, or its active fragment, or its active derivative, analog. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a derivative thereof having no more than 5% amino acid variation.

 In a second aspect of the present invention, there is provided a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 70 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the above BiHUGTR; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is selected. Species: (a) a sequence having 2-1604 positions in SEy ID NO: 1; and (b) having 1 ϋ, \ U: J A sequence of 1-2430 bits.

 In a third aspect of the present invention, there are provided a vector containing the above-mentioned polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above-mentioned polynucleotide.

 Other inventions will be apparent to those skilled in the art from the disclosure of the technology herein.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in the natural state in a living cell are not separated, but the same polynucleotides or polypeptides are separated from other substances that coexist in the natural state. , It is isolated and purified. As used herein, "isolated BioHUGTR protein or polypeptide" means that BioHUGTR is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify BioHUGTR using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. BioHUGTR peptide purity can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, BioHUGTR polypeptide, which basically consists of the amino acid sequence shown in SEQ ID. \ '0: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide: The polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or it may be obtained from a prokaryotic or eukaryotic host using recombinant technology (for example, Bacteria, yeast, higher plants, insects and mammalian cells). Depending on the host used in the recombination protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The present invention may also include or exclude the initial methionine residue.

 The invention also includes fragments, derivatives and analogs of BioHUGTR. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the natural BioHUGTR of the present invention: a fragment, derivative, or analog of the polypeptide of the present invention It can be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be a genetic codon Encoded: or (II) one in which a group on one or more amino acid residues is substituted with another group to contain a substituent; or (II) one in which a mature polypeptide is related to another (E.g., compounds that extend the half-life of a polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence (such as a leader sequence or secretory sequence or To purify the sequence of this polypeptide or protein sequence). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art. The present invention also provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino group sequence of SEQ ID NO: 2. Preferably, the polynucleotide sequence of the present invention has a nucleotide sequence of SEQ ID NO: 1.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic D. \ A, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant-as used in the present invention, a "degenerate variant" refers to a gene encoding an (JID NU: white matter or polypeptide, but a nucleic acid sequence different from the coding region sequence shown in SEQ ID NO: 1.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) And non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the polypeptide encoding it. Features.

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only between two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding BioHUGTR.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.

 The specific polynucleotide sequence encoding the BioHUGTR of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynuclear clones with common structural characteristics Nucleotide fragments.

 The wake fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDXA library. There are many mature techniques for extracting π Α, and kits can also be used. Commercially available ((aagene). C libraries are also common methods (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) D AD 'A or DNA-RNA hybridization; (2) the presence or absence of marker gene function; (3) determination of the level of BioHUGTR transcripts; (4) through immunology Technology or measurement of biological activity to detect protein products expressed by genes. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of BioHUGTR gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method for amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-cDNA terminal rapid amplification method) may be preferably used, and primers for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PAS, 1977, 74: 5463-5467). Such polynucleotide sequencing can also be performed using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a BioHUGTR coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

In the present invention, a polynucleotide sequence encoding BioHUGTR can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and \ athans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells Body. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding BioHUGTR and appropriate transcriptional translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold

Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: l ac of E. coli; or trp promoter; p _l promoter of lambda phage; eukaryotic promoters include CMV immediate early promoter,

HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductol for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcriptional regulatory elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding Bi oHUGTR or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples of host cells are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium: fungal cells such as yeast; plant cells; insect cells such as fly S2 or Si'9: animal cells such as CH0, COS, or Bowes melanin Tumor cells and so on.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl method. The steps used are well known in the art. It can also be performed with M _g Cl ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electrophoresis Wells, liposome packaging, etc.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant BioHLGTR (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) transforming or transducing a suitable host cell with the polynucleotide (or variant) encoding human BiohuGTR of the present invention, or with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), the medium used in the culture may be selected from various conventional culture media depending on the host cell used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of human UDP glucose-glycoprotein glycosyltransferase Bi oHUGTR and UDP glucose-glycoprotein glycosyltransferase (Q09332) of the fruit fly {Drosophila meh ogas ter) according to the present invention. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+". The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Press, 1989), or Conditions recommended by the manufacturer.

Example 1: Cloning of BIHUGTR cDNA Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is formed by reverse transcription ci), \ A. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the BSK (+) vector (Glontech) to transform the DH5a bacteria into a cDNA library. The sequence of the 5 'and 3' ends of all clones was determined using a dye-stop sequencing reaction kit (Perkin-Elmer) and ABI 377 automated sequencing protocol (Perkin-Elmer). The determined cDNA sequence was compared with the existing public leg sequence database (Genebank), and it was found that the cDNA sequence of one of the clones (0818dl0) was new DNA. A series of primers were synthesized for the bidirectional determination of the inserted cDNA fragments contained in the clone. The results showed that the 0818dl0 clone contained a full-length cDNA of 2430bp (as shown in SEQ ID N0: 1), and a 160.3bp open reading frame (0RF) from 2bp to 1604bp, encoding a new protein (such as SEQ ID NO: 2). This clone was named pBS-0818dlO, and its encoded protein was named human UDP glucose-glycoprotein glucosyltransferase (referred to as "BioHUGTR"). Example 2: Homologous search of cDNA clones

 The sequence of the human BioHUGTR gene of the present invention and the protein sequence encoded by the same were subjected to the Blast program (Basic local Alignment search tool) [Altschul, SF et al. J. ol. Biol. 1990; 215: 403-10] in Genbank , Swissport and other databases for homology search. The gene with the highest homology to the human BioHUGTR gene of the present invention is a known UDP glucose-glycoprotein glucosyltransferase gene of Drosophila melanogaster), and the accession number of the encoded protein in Genbank is Q09: W2. The results of protein homology comparison are shown in Figure I. The two are highly homologous, with an identity of 64%; a similarity of 77%. This indicates that the novel polypeptide of the present invention has the structure and function of UDP glucose-glycoprotein glucosyltransferase. Example 3: Cloning of BioHUGTR gene by RT-PCR

CDNA was synthesized using fetal brain total RNA as a template and oli _g0 -dT as a primer for reverse transcription reaction.

After purification of Qia ^ ne's kit, PCR amplification was performed with the following primers:

 Primer 1: 5 '-TATGAA TGCCAATCCAAA -.r (SEQ W U.3)

 Bow I Object 2: 5 '-AGATACAAAAATTGTTTTCA-3' (SEQ ID NO.4)

 Primer 1 is the forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1; Primer 2 is the 3' end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: reaction containing 50μ] volume 50mmolZL KC1, lOmmol / L Tri.s- Cl , (P H «.5), 1.5 Implicit _{ol / L MgC12 (200μπιο1 / Χ} dNTP, lOptnol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C, 30sec; 72 ° C 2tnin. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA clone kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2424bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of BioHUGTR gene expression:

 Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) After mixing, centrifuge. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RN'A precipitate. The resulting RNA precipitate was washed with 70% ethanol, dried and dissolved in water.

Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified BioHUGTR coding region sequence (2bp to 1604bp) shown in SEQ. The ³² P-labeled probe (about 2 × ^{10 6} cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred in a solution at 42 ° C. overnight, the solution containing 50% formamide-25mM KH ₂ P (). (pH7.4) 's solution and 200μ ₈ / πι1 salmon sperm DNA -5xSSC-5xDenhardt. After hybridization, the filter was washed in lxSSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant BioHUGTR

 Based on the S'EQ ID N0: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed. The sequences are as follows:

 Primer 3: 5 '-CCCGAATTCATGAACTGCCAATCCAAACT-3' (SEQ ID No 5)

 Primer 4: 5 '-CCCGCGGCCGCATAATTCTTCACGTTTCTGA-3' (SEQ ID No 6)

The 5 'ends of these two primers contain EcoRI and Notl digestion sites, respectively, followed by the coding sequences of the 5 and 3' ends of the target gene, respectively. The EcoRI and Notl digestion sites correspond to the expression vector plasmid pET-28b (+ ) (Novagen product, Cat. No. 69865.3). The PCR reaction was performed using the pBS-0818dl0 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: pBS-0818dl0-containing plasmid 1 () ρκ, primer 3, and primer 4 in a total volume of 50 μ1 were lpmraol and Advantage pol merase Mix (product of LunLeh Company) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. EcoRI and Notl were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4. Enzyme linked. The ligation product was transformed into Escherichia coli Dh5a by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 3 (^ g / ml)), positive clones were selected by colony PCR method and sequenced. Correct positive clone (pET-0818dl 0) The recombinant plasmid was transformed into E. coli BL21 (DE3) pl ySs (product of Novagen) by calcium chloride method. In LB liquid containing kanamycin (final concentration 30 g / ml) In the medium, the host bacteria BL21 (pET-0818dl 0) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of lmino LL, and the culture was continued for 5 hours. The bacteria were collected by centrifugation, and the bacteria were centrifuged and collected by centrifugation The purified target protein BioHUGTR was purified by chromatography using His. Bind Quick Cartridge (Novagen) affinity chromatography column capable of binding 6 histidines (6HisT; ig). SDS-PAGE electrophoresis A single band was obtained at 59 kDa. The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, 15 amino acids at the N-terminus and N-terminal shown in SEQ ID NO: 2 The 15 terminal amino acid residues are exactly the same. Example 6: Production of anti-BioHUGTR antibodies

 The following peptides specific to BioHUGTR were synthesized using a peptide synthesizer (product of PE):

et-Asn-Cys-Gln-Ser-Lys-Leu-Ser-Asp-Met-Pro-Leu-Lys-Ser-Phe (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avramea.s, et al. Immunochemi stry, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex and complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex and incomplete Freund's adjuvant were used to boost immunity once. A titer plate coated with g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total _Ig G was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and anti-peptide antibodies were separated from total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to Bi HUGTR. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases. BioHLGTR protein or peptide can be used as medicine to treat diseases caused by low or loss of UDP glucose-glycoprotein glucosyltransferase function. Antagonists of BioHUGTR can be used to treat or prevent immune disorders, including (but not limited to): systemic lupus erythematosus, rheumatoid arthritis, scleroderma, myasthenia gravis, autoimmune gastritis, insulin autoimmune Syndrome, autoimmune thyroid disease, autoimmune heart disease, allergy, blood disease, gastrointestinal disease, immunodeficiency disease, cancer, etc. Antibodies that specifically bind to BioHUGTR can be used directly as antagonists or indirectly to bring the agent to cells or tissues expressing Bi HUGTR by targeting or delivery mechanisms.

BioHUGTR antagonists can be used to treat or prevent diseases related to cell differentiation. These diseases include (but are not limited to): Aldosterone excess, Addison's disease (ie chronic adrenal insufficiency), or adrenal cortex Hyperfunction, adrenal genital syndrome, alcoholic liver cirrhosis, various tumors, such as adenocarcinoma, leukemia, lymphoma, dystrophin, sarcoma, etc.

 Antagonists or fragments or derivatives of BioHUGTR can be used to treat or prevent cancer. Cancers include (but are not limited to): benign thyroid tumors, thyroid cancer, neurological cancer, fibroids, fibrosarcoma, lipomas, breast cancer, kidneys Cancer, primary small cell carcinoma of the esophagus, gastric cancer, gastric malignant lymphoma, colorectal cancer, colon cancer, intestinal malignant lymphoma, primary liver cancer, hepatoblastoma, gallbladder cancer, pancreatic cancer, brain cancer, myeloma Etc .; especially related to the following cancers: neuroma, glioma, neuroblastoma, neuroblastoma, lung, esophagus, colon, bladder, kidney, liver, adrenal gland, prostate, penis, uterus, ovary and breast Cancer etc. Antibodies that specifically bind to BioHUGTR can be used directly as antagonists or indirectly to bring the agent to cells or tissues expressing BioHUGTR in a targeting or delivery mechanism. Antagonists or fragments or derivatives of BioHUGTR can be used to treat or prevent cancer immune disorders.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) BioHUGTR. Agonists enhance biological functions such as BioHUGTR to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing BioHUGTR are cultured together with labeled BioHUGTR in the presence of a drug, and then the ability of the drug to increase or suppress this interaction is determined to identify agonists or antagonists.

 BioHUGTR antagonists include antibodies, compounds, receptor deletions, and analogs. The antagonist of BioHUGTR can bind to BioHUGTR and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, BioHUGTR can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring its effect on the interaction between BioHUGTR and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. BioHLGTR-binding peptides can be obtained by screening random polytitanium libraries consisting of various possible combinations of amino acids bound to the solid phase. When screening, the BioHUGTR molecule should generally be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the BioHUGTR epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

The production of polyclonal antibodies can be obtained by direct injection of BioHUGTR into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing BioHUGTR monoclonal antibodies include (but are not limited to): Hybridoma technology (Kohler and Milstein. 75 1 256: 495-497), two tumor technology, human B-cell hybridoma technology, EBV-hybridoma technology, etc. chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing techniques (Morrison et al. al, PA AS, 1985, 81: 6851) o The existing technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against BioHUGTR.

 Anti-BioHUGTR antibodies can be used in immunohistochemistry to detect BioHUGTR in biopsy specimens. Monoclonal antibodies that bind to BioHUGTR can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, BioHUGTR high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill BioHUGTR positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to BioHUGTR. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of BioHUGTR.

 The invention also relates to a diagnostic test method for quantitative and localized detection of BioHUGTR levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of BioHUGTR detected in the test can be used to explain the importance of BioHUGTR in various diseases and to diagnose diseases in which BioHUGTR plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding Bi oHUGTR can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of BioHUGTR. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated BioHUGTR to inhibit endogenous BioHUGTR activity. For example, a mutated BiHUGTR can be a shortened BioHUGTR that lacks the signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of BioHUGTR. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer the polynucleotide encoding BioHUGTR into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding BioHUGTR can be found in the existing literature (Sambrook. Et al.). In addition, the recombinant polynucleotide encoding BioHUGTR can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit BioHUGTR mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically breaks down specific RNAs. Its mechanism of action is a ribozyme molecule. After specific hybridization with a complementary target RNA, endonucleation is performed. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense medicine molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This wake sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding BioHUGTR can be used for the diagnosis of diseases related to BioHUGTR. The polynucleotide encoding BioHUGTR can be used to detect the expression of BioHUGTR or the abnormal expression of BioHUGTR in a disease state. For example, the DNA sequence encoding BioHUGTR can be used to hybridize biopsy specimens to determine the expression status of BioHUGTR. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. BioHUGTR-specific primers can also be used to detect the transcription products of BioHUGTR by performing RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the BioHUGTR gene can also be used to diagnose BioHUGTR-related diseases. BioHUGTR mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type BioHUGTR DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

 The PCR localization method of hybrid cells of this cell is a quick method to locate DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of c-fiber clones with metaphase chromosomes can be accurately performed in one step Perform chromosomal mapping. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheri tance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier (pharmaceutically acceptable carrier). These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of a polypeptide or antagonist of the present invention and a carrier and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. BioHUGTR is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of BioHUGTR administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

 In one example of the present invention, an isolated polynucleotide is provided, which encodes a mature polypeptide having the amino acid sequence shown in SEQ ID NO: 2. The polynucleotide was found from a cDNA library of human fetal brain tissue. The total length of the polynucleotide sequence was 2430 bases, and its open reading frame (2-1604) encoded 534 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 64% homology with the UDP glucose-glycoprotein glucosyltransferase of Drosophila (Drosophi la melanogaster), and it is inferred that the new human BioHUGTR of the present invention has UDP glucose-sugar Similar structure and function of the protein glucosyltransferase gene family.

The cDNA, oligonucleotides, peptides and antibodies of human BioHUGTR provided by the present invention are different for research The role of UDP-glucose-glycoprotein glucosyltransferase in tissues and cells, diagnosis of diseases associated with UDP-glucose-glycoprotein glucosyltransferase disorders, screening inhibitors or drugs to treat these diseases are of great value.

 Sequence Listing

 0) —General information:

 (i) Name of invention: New human UDP glucose-glycoprotein glucosyltransferase and its coding sequence

(i i) sequence number: 7

(2) Information of SEQ I D NO: 1:

 (i) Sequence characteristics:

 (A) Length: 2430bp

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (i i) Molecular type: cDNA

 (i i i) sequence description: SEQ ID NO: 1:

 1 TATGAACTGCCAATCCAAACTTTCTGACATGCCTTTAAAAAGCTTTTACCGTTATGTCTT

 6 1 AGAACCAGAGATTTCTTTCACTTCAGACAATAGTTTTGCTAAGGGTCCAATCGCAAAATT

 121 TTTGGATATGCCTCAGTCTCCACTGTTCACTCTGAATTTGAACACACCTGAGAGCTGGAT

 181 GGTAGAATCTGTCAGAACACCATATGATCTTGATAATATTTATTTAGAAGAGGTGGACAG

 241 TGTAGTGGCTGCTGAGTATGAGCTGGAATACCTGTTACTGGAAGGTCATTGCTACGACAT

 301 CACCACAGGCCAGCCTCCACGGGGACTACAGTTTACCTTAGGAACTTCAGCCAACCCGGT

 361 CATTGTGGACACCATTGTTATGGCCAATCTGGGCTACTTTCAGCTGAAAGCCAACCCAGG

 421 AGCTTGGATCCTCAGACTTAGGAAGGGACGCTCTGAAGATATTTATAGAATTTACAGCCA

 481 CGATGGCACTGATTCTCCCCCTGATGCTGATGAGGTGGTTATCGTCCTCAACAACTTCAA

 541 AAGCAAAATTATTAAAGTGAAGGTTCAGAAGAAGGCAGATATGGTGAACGAAGACTTGCT

 601 GAGTGATGGAACGAGTGAGAATGAATCTGGATTTTGGGATTCCTTCAAATGGGGCTTTAC

 661 AGGACAGAAGACTGAGGAAGTGAAGCAAGATAAAGATGACATAATTAATATTTTCTCCGT

 721 TGCATCTGGTCATCTCTACGAAAGATTTCTTCGCATAATGATGCTATCCGTGCTGAAGAA

 781 TACCAAGACTCCTGTGAAATTCTGGTTCTTGAAGAATTACTTGTCCCCCACATTTAAGGA

 841 GTTTATACCTTACATGGCAAATGAATACAATTTCCAGTATGAGCTTGTTCAGTACAAATG

 901 (iCCCCGGTGGCTTCATCAACAAACTGAAAAACAGCGTATCATCTGGGGTTACAAGATCCT

 961 CTTCCTGGATGTACTTTTCCCACTAGTTGTTGACAAGTTCCTGTTTGTGGATGCTGATCA

1021 (iATTGTACGAACAGATCTGAAAGAGTTAAGAGATTTCAATTTGGATGGTGCTCCTTATGG

1081 TTACACTCCTTTCTGTGACAGCCGAAGAGAAATGGACGGCTACAGGTTCTGGAAGTCAGG

1 141 GTACTGGGCCAGTCATTTAGCCGGGCGAAAGTATCATATCAGTGCACTATATGTTGTGGA

1 01 TCTGAAGAAGTTTAGGAAAATAGCTGCTGGTGACAGACTCAGGGGACAGTACCAAGGTCT

1 61 GAGTCAGGACCCTAACAGCCTTTCAAATCTTGATCAAGATCTGCCCAATAACATGATTCA

1321 TCAGGTGCCAATTAAATCCCTCCCTCAAGAATGGCTTTGGTGTGAAACGTGGTGTGATGA 1381 CGCCTCTAAGAAAAGGGCAAAAACCATTGATTTGTGTAATAATCCGATGACCAAAGAGCC 1441 GAAACTGGAAGCAGCTGTGCGGATTGTCCCGGAGTGGCAGGACTACGACCAAGAGATCAA

1501 ACAGCTACGGATCCGCTTTCAGAAGGAGAAAGAAACGGGAGCACTGTACAAAGAGAAGAC

1561 AAAAGAACCAAGCCGAGAAGGTCCTCAGAAACGTGAAGAATTATGATCTCTGGAGAAGGA

1621 CAGGAAATCACCCCATTTGAAAAACAGTTTTTATAATAAATGCTAGTTTTTTCTGATCTG

1681 TCTATACAACTGCTGATAAGCCGGCTGGGCAGGAGTGCCACACCTTTTGATTCTGAGCAT

1741 TTGATTCTGACTTCTGTACTCTGGTGGCCACTGGATCTTTGGGATTAAAGCTCTGTTGGA

1801 TTTGTACCTCAGAGGAAGACCAAGTGGCTGATCCTTTGGACTCTGTAAAGAGCATTCTTC

1861 TAGTCAGAGGGTGGAATGGCAGCAGCAACTGGAAGAAAATGAGTTTTTTGGTGCCCACAC

1921 CCAAGAGCACACACATGCTGCACTGTCTCGGAAAGCAGGGCCAGCTAGAGCCACCATGTT

1981 CTTCCTTACCTCAGTTTACCTGCGGCCTGCGCTGCACTGCAGATGCCCACCCTGCCCTGG

2041 GTCTGGCCGGCGGAAGCTCTGTCCAAGGTCCACACACCTCCAGGTTTACGCCAACATCCT

2101 TGTGCCCTCCCCACCTTCTCTTCACACGCATTAGGTGCATTGTTTAATTGAAATCCAACC

2161 AACAATTGTGTGTCAAGGCTGGTTTGGTGCAGTGGCTGGGCAAATTAATTTTGGGCCAGG

2221 ATGGGGGTGGGTTGCAGTGAGGGTAGGGAAAATGTCAGGAGTAGGAAGGTTCGGGGGTTA

2281 AGGGAAGGGAAGGAAGACCAGAACTGGCCATCCTCTTTTATAATCCATTAGTAGCACCAT

2341 GGCTCATTTGAAATGAAAATATTACACTTATTCCCCACCCAACCGCAGTGAACTTTCTAG

2401 GTAATTGTTTTGAAAACAATTTTTGTATCT

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 534 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

 (i i) molecular type: peptide

 (i i i) Sequence description: SEQ ID NO: 2:

 1 Met Asn Cys Gin Ser Lys Leu Ser Asp Met Pro Leu Lys Ser Phe

16 Tyr Arg Tyr Val Leu Glu Pro Glu He Ser Phe Thr Ser Asp Asn

31 Ser Phe Ala Lys Gly Pro l ie Ala Lys Phe Leu Asp Met Pro Gin

46 Ser Pro Leu Phe Thr Leu Asn Leu Asn Thr Pro Glu Ser Trp Met

61 Vul Glu Ser Val Arg Thr Pro Tyr Asp Leu Asp Asn lie Tyr Leu

76 Glu Glu Val Asp Ser Val Val Ala Ala Glu Tyr Glu Leu Glu Tyr

91 Leu Leu Leu Glu Gl y His Cys Tyr Asp l ie Thr Thr Gly Gin Pro

106 \ 'm Arg Gly Leu Gin Phe Thr Leu Gly Thr Ser Ala Asn Fro Val

121 l i e Val Asp Thr l ie Val Met Ala Asn Leu Gly Tyr Phe Gin Leu

Π6 Lys Ala Asn Pro Gly Ala Trp l ie Leu Arg Leu Arg Lys Gly Arg

151 Ser Glu Asp l ie Tyr Arg l ie Tyr Ser His Asp Gly Thr Asp Ser

166 Pro Pro Asp Ala Asp Glu Val Val l ie Val Leu Asn Asn Phe Lys

181 Ser Lys l ie l ie Lys Val Lys Val Gin Lys Lys Ala Asp Met Val

1% Asn lu Asp Leu Leu Ser Asp Gly Thr Ser Glu Asn Glu Ser G ly

21 1 Fhe Trp Asp Ser Phe Lys Trp Gly Phe Thr Gly Gin Lys Thr Gl u

226 Glu Val Lys Gin Asp Lys Asp Asp l ie l ie Asn lie Phe Ser Val 241 Ala Ser Gly His Leu Tyr Glu Arg Phe Leu Arg l ie Met Met Leu

256 Ser Val Leu Lys Asn Thr Lys Thr Pro Val Lys Phe Trp Phe Leu

271 Lys Asn Tyr Leu Ser Pro Thr Phe Lys Glu Phe He Pro Tyr Met

286 Ala Asn Glu Tyr Asn Phe Gin Tyr Glu Leu Val Gin Tyr Lys Trp

301 Pro Arg Trp Leu His Gin Gin Thr Glu Lys Gin Arg lie l ie Trp

316 (; iy Tyr Lys l ie Leu Phe Leu Asp Val Leu Phe Pro Leu Val Val

331 Asp Lys Phe Leu Phe Val Asp Ala Asp Gin lie Val Arg Thr Asp

346 Leu Lys Glu Leu Arg Asp Phe Asn Leu Asp Gly Ala Pro Tyr Gly

361 Tyr Thr Pro Phe Cys Asp Ser Arg Arg Glu Met Asp Gly Tyr Arg

376 Phe Trp Lys Ser Gly Tyr Trp Ala Ser His Leu Ala Gly Arg Lys

391 Tyr His l ie Ser Ala Leu Tyr Val Val Asp Leu Lys Lys Phe Arg

406 Lys l ie Ala Ala Gly Asp Arg Leu Arg Gly Gin Tyr Gin Gly Leu

421 Ser Gin Asp Pro Asn Ser Leu Ser Asn Leu Asp Gin Asp Leu Pro

436 Asn Asn Met l ie Hi s Gin Val Pro l ie Lys Ser Leu Pro Gin Glu

451 Trp Leu Trp Cys Glu Thr Trp Cys Asp Asp Ala Ser Lys Lys Arg

466 Ala Lys Thr He Asp Leu Cys Asn Asn Pro Met Thr Lys Glu Pro

481 Lys Leu Glu Ala Ala Val Arg l ie Val Pro Glu Trp Gin Asp Tyr

496 Asp Gin Glu l ie Lys Gin Leu Arg l ie Arg Phe Gin Lys Glu Lys

51 1 Glu Thr Gly Ala Leu Tyr Lys Glu Lys Thr Lys Glu Pro Ser Arg

526 Glu Gly Pro Gin Lys Arg Glu Glu Leu

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 20 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (i i) Molecular type: Oligonucleotide

 (i i i) Sequence description: SEQ ID NO

 TATGAACTGCCAATCCAAAC

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 20 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

(U) Molecular type: Oligonucleotide (iii) Sequence description: SEQ

 AGATACAAAAATTGTTTTCA 20

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 29 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 ω) topology: linear

 (ii) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID NO

 CCCGAATTCATGAACTGCCAATCCAAACT

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 31 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID NO: 6:

 CCCGCGGCCGCATAATTCTTCACGTTTCTGA

(8) Information of SEQ ID NO: 7:

 (i) Sequence characteristics-

(A) Length: 15 amino acids

 (B) Type: Amino acid

 (D) Topological structure: linear

 (ii) Molecular type: peptide

 (iii) Sequence description: SEQ ID NO: 7:

et-A.sn-Cys-Gln-vSer-Lys-Leu-Ser-Asp-Met-Pro-Leu-Lys-Ser-Phe

Claims

Claim

1. An isolated human BioHUGTR polypeptide, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO. 2, or a fragment, analog, or derivative of the polypeptide.

 2. The polypeptide according to claim 1, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO. 2 or a derivative thereof having an amino acid variation not exceeding 5%.

 3. The polypeptide according to claim 2, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO.

 4. An isolated polynucleotide, characterized in that said polynucleotide is selected from the group consisting of:

( _a ) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO. 2 or a fragment, analog, or derivative thereof;

 (h) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide is a polynucleotide encoding an amino acid sequence represented by SEQ ID NO. 2.

 6. The polynucleotide according to claim 4, wherein the sequence of the polynucleotide is a sequence having positions 2-1604 in SEQ ID NO. 1 or having positions 1-2430 in SEQ ID NO. 1. the sequence of.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant vector constructed from the polynucleotide of claim 4 and a plasmid, virus or vector expression vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7;

 (b) a host cell transformed or transduced with the polynucleotide of claim 4.

 9. A method for preparing a polypeptide having BioHUGTR activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under conditions suitable for expression of BioHUGTR;

 (b) Isolating a polypeptide with Bi HUGTR activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to BioHUGTR.

1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that it is an active compound that mimics BioHUGTR, or a compound that promotes BioHUGTR activity, or a compound that antagonizes BioHUGTR activity, or inhibits BioHUGTR active compound.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO.1.

 13. An application of the compound according to claim 11, wherein the compound is used for a method for regulating the activity of BioHUGTR in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a BioHUGTR polypeptide according to claim 1, wherein the method is to detect the susceptibility to a related disease or disease by a method selected from the group consisting of

 (a) indirectly or directly detecting whether the expression level of the polypeptide is abnormal;

 (b) indirectly or directly detecting whether the activity of the polypeptide is abnormal;

 (c) detecting, directly or indirectly, a polynucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of the polypeptide according to claim 1, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of BioHUGTR; or for identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to claim 4, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip or a microarray.

 17. A pharmaceutical composition, characterized in that it contains a safe and effective amount of the polypeptide according to claim 1 and / or the polynucleotide according to claim 4 and a pharmaceutically acceptable carrier.

 18. The use of the polypeptide according to claim 1, wherein the polypeptide is used to prepare a medicament for treating diseases such as immune disorders and cancer.