CN112375143A

CN112375143A - Polyclonal antibody of pichia pastoris UGGT1

Info

Publication number: CN112375143A
Application number: CN202110020699.8A
Authority: CN
Inventors: 王楠; 杨彩峰; 李刚强; 郭文芳; 彭华康; 王梦琪; 刘德虎
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2021-01-08
Filing date: 2021-01-08
Publication date: 2021-02-19

Abstract

The invention discloses a polyclonal antibody of pichia pastoris UGGT 1. The invention clones pichia pastoris UGGT1 gene segments into escherichia coli, obtains pichia pastoris UGGT1 recombinant protein through IPTG induction expression, takes the recombinant protein as antigen to carry out animal immunity, obtains antiserum containing UGGT1 antibody, and the antiserum can be specifically combined with UGGT1 protein in yeast. The antibody provided by the invention can be applied to qualitative or quantitative determination of UGGT1 protein of pichia pastoris. The antibody prepared by the invention has high titer and strong specificity, and supports various experimental operations such as ELISA, Western-blot and the like.

Description

Polyclonal antibody of pichia pastoris UGGT1

Technical Field

The invention belongs to the technical field of genetic engineering antibodies, and particularly relates to a polyclonal antibody of pichia pastoris UGGT 1.

Background

UGGT1, which is localized to the Endoplasmic Reticulum (ER) of eukaryotes, is the only element currently found that can recognize the folded state of glycoproteins, and plays a central role in the glycoprotein amount monitoring system of eukaryotes. Because of its important biological functions, UGGT1 has been a hotspot in research fields such as eukaryotic glycoprotein synthesis, transport, metabolism and the like. In recent years, with the development of immunobiotechnology, ELISA, Western-blot, Co-IP, IF and the like have become conventional methods for protein research, and UGGT1 antibodies derived from different species have been generated, but the UGGT1 antigen of these antibodies has a large amino acid sequence difference, so that UGGT1 antibodies derived from different species cannot be used universally. At present, commercial UGGT1 antibody is mainly prepared by using animal and plant UGGT1 as an antigen, but the antibody capable of combining with yeast UGGT1 is still in the blank of the market, and no related literature report is found.

Pichia pastoris is an important industrial microorganism and is widely applied to the production of foreign proteins in the fields of food, medicine, feed and the like. As a foreign protein expression host, the protein has the specific post-translational modification function of eukaryote, can use cheap inorganic salt as a culture medium for high-density fermentation, has no toxic action on human and livestock by cells, and the like. However, pichia pastoris serving as a recombinant protein expression system still has some bottleneck problems to be broken through, for example, the expression quantity difference of different exogenous proteins is huge, the expression quantity of some proteins can reach more than gram level of fermentation liquor per liter, and the expression quantity of some proteins is as low as microgram level or even cannot be detected; in addition, when pichia pastoris expresses glycoprotein, excessive glycosylation is easy to occur, so that the function and the property of the recombinant glycoprotein are changed, and the problems are caused by that the research on the synthesis and metabolic mechanism of protein in pichia pastoris cells is not thorough and comprehensive at present.

In addition, pichia is also an important eukaryotic model organism, is a unicellular organism with eukaryotic organism characteristics, and is an excellent material for researching other higher eukaryotic organisms. The detailed analysis of the glycoprotein metabolic pathway is not only beneficial to solving the problems encountered by the industrial microorganism, but also beneficial to explaining the glycoprotein synthesis and metabolism mechanisms of other higher eukaryotes.

In eukaryotes, most proteins require post-translational modifications, such as N-glycosylation, O-glycosylation, acetylation, and formation of disulfide bonds, to perform specific biological functions. Among them, N-glycosylation is the most common and one of the most important post-translational modifications. A large number of researches show that N-glycosylation has obvious influence on the biological activity, the thermal stability, the signal recognition, the extracellular release and the like of the protein. In various eukaryotic cells, glycosylation of proteins has a complete and conserved molecular mechanism, which mainly includes (1) specific binding of Oligosaccharide chain Glc3Man9GlcNAc2 to Asn (Asn-Xxx-Ser/Thr, Xxx cannot be Pro) of N-glycosylation binding site of newly synthesized polypeptide under the action of Oligosaccharide transferase (OST), (2) rapid cleavage of terminal three glucoses of Oligosaccharide molecule bound by glycoprotein under the action of glucosidase i and glucosidase ii, reversible interaction of specific endoplasmic reticulum localization chaperone (cnx) or soluble chaperone calreticulin (crt) with glycoprotein having only 1 glucose at terminal, and protein folding under the help of other chaperones (e.g. peptidyl isomerase ERp57, prolyl isomerase CypB, etc.), (3) if the glycoprotein can successfully complete correct folding at this time, the glycoprotein is transported out of ER, enters a subsequent processing step, and is finally transported to a specific organelle or secreted out of the cell; if the glycoprotein does not complete the correct folding, UGGT1 located in the ER will recognize the misfolded glycoprotein and add 1 molecule of glucose back to the oligosaccharide chain, forming GlcMan9GlcNAc2, and be recognized again by the chaperone CNX/CRT, forming the CNX/CRT cycle. During the circulation, proteins that are not always able to form a correct fold will eventually enter the degradation pathway. This process is also called ER-related glycoprotein quantity monitoring system. During the processing of the above glycoproteins, UGGT1 is the only element that can identify the folded state of the glycoprotein, and is the core and rate-limiting element of the process. Due to the key role of UGGT1, studies on UGGT1 have always been a hotspot in the field of eukaryotic protein glycosylation studies.

Studies on UGGT1, focused primarily on animal cells and individual species of plants and yeast, and UGGT1 antibodies also played an important role in these studies, e.g., in mouse embryonic fibroblasts, the effect of misfolded glycoproteins on activation of the CNX/CRT cycle was revealed by identification of UGGT1 deletion mutants by UGGT1 antibodies (maurizoi moliari, 2005). Co-IP and IF experiments demonstrated that UGGT1 is able to promote RNA virus replication and exacerbate infection of human embryonic rhabdomyosarcoma cells by binding to enteroviruses (Peng-Nien Huang, 2017). UGGT1 was found to be essential for the maturation and secretion of pro-sphingolipid activator proteins in CHO cells by Co-IP and IF experiments (Bradley r. Pearse, 2009).

In conclusion, a large number of studies show that UGGT1 plays a very important biological function in cells, but in an important industrial microorganism of Pichia pastoris, the UGGT1 has a large molecular weight and a complex structure, and has no reports on the function and location of UGGT1 because of no available commercial antibody and difficulty in preparing the antibody in a laboratory and the like. The research of pichia pastoris UGGT1 is seriously lagged, and the research aspects such as glycoprotein synthesis and metabolic mechanism and the like do not exert the whole value as a model organism, so that a pichia pastoris UGGT1 antibody with good specificity and high titer is urgently needed to be developed to promote the research of pichia pastoris UGGT1, and further provide necessary experimental materials and technical support for perfecting a pichia pastoris recombinant expression system, expanding the industrial application range of pichia pastoris and exploring the high eukaryotic glycoprotein synthesis and metabolic mechanism.

Disclosure of Invention

The invention aims to provide a polyclonal antibody of pichia pastoris UGGT 1.

A polyclonal antibody of Pichia pastoris UGGT1 is prepared by taking the polypeptide of amino acid sequence at 1133-1430 th site of Pichia pastoris UGGT1 as antigen through animal immunization.

The antigen takes pichia pastoris UGGT1 amino acid sequence polypeptide at 1133-1430 th site as a core sequence, and a plurality of amino acid residues or a plurality of amino acid residues are added at two ends or one end of the core sequence.

The amino acid sequence of UGGT1 is shown in SEQ ID No: 1, the DNA sequence of UGGT1 gene is shown as SEQ ID No: 2, the sequence of the amino acid fragment 1133-1430 of the UGGT1 amplified by PCR is shown as SEQ ID No: 3, the corresponding 3397-4290bp DNA fragment has the sequence shown in SEQ ID No: 4, respectively.

A kit for detecting Pichia pastoris UGGT1 protein is characterized by comprising the polyclonal antibody.

An indirect sandwich ELISA detection kit of Pichia pastoris UGGT1 protein comprises Pichia pastoris UGGT1 standard protein, a washing solution, a confining solution, a substrate developing solution, a stopping solution, an ELISA plate coated with the polyclonal antibody, a detection antibody and an enzyme labeled antibody; the enzyme-labeled antibody is goat anti-rabbit IgG labeled by HRP.

The method for preparing the pichia pastoris UGGT1 polyclonal antibody comprises the following specific steps:

(1) taking a pichia pastoris genome as a template, and carrying out PCR amplification on a DNA fragment of UGGT1 gene;

(2) inserting the DNA fragment into an escherichia coli expression vector, converting the escherichia coli expression vector into escherichia coli, and obtaining a recombinant escherichia coli positive strain carrying a UGGT1 gene fragment through resistance screening and DNA sequencing; the Escherichia coli expression vector and host strain, preferably but not limited to pEASY-Blunt E2 and transetta;

(3) inducing and expressing the recombinant escherichia coli strain by IPTG, breaking the wall by ultrasonic, centrifuging and collecting precipitates to obtain an inclusion body of UGGT1 protein fragments, and dissolving the inclusion body in 8M urea to prepare UGGT1 antigen; the concentration of the IPTG is preferably but not limited to 1mM, the induction condition is preferably but not limited to 37 ℃, the rotating speed is 200rpm/min, and the induction time is 5 h;

(4) mixing the antigen with a proper immunologic adjuvant, immunizing animals for several times, and obtaining an antibody of pichia pastoris UGGT 1; the method for immunizing animals, preferably but not limited to three times, is carried out on days 0, 14 and 28 respectively.

The invention has the beneficial effects that: the UGGT1 antibody prepared by the method has high titer and good specificity, and the UGGT1 protein in the pichia pastoris can be qualitatively or quantitatively detected by adopting a conventional immunobiotechnology method, such as ELISA, Western-blot and the like, so that necessary experimental materials and technical support are provided for the functional research, glycoprotein synthesis and metabolic mechanism research of UGGT1 of pichia pastoris and other higher eukaryotes.

Drawings

FIG. 1 shows the DNA fragment PCR products of 1133-1430 amino acids of Pichia pastoris genome and UGGT1 identified by agarose gel electrophoresis;

in the figure, 1-Pichia genome; 2-UGGT1 of amino acids 1133 and 1430 of DNA fragment PCR product; 3-blank control (in ddH)₂Performing PCR by taking O as a template); M-DNA Marker.

FIG. 2 is a map of an E.coli expression plasmid containing a DNA fragment of 3397-4290bp of UGGT 1; the DNA segment of UGGT1 is located between the T7 promoter and terminator of the vector.

FIG. 3 is an SDS-PAGE identification of UGGT1 expression in E.coli;

in the figure, 1-E.coli inclusion body is dissolved in 8 urea, and the molecular weight is about 33 kD; 2-soluble proteins in the Escherichia coli cells; 3-intracellular protein before IPTG induction of escherichia coli; 4-intracellular protein induced by escherichia coli IPTG; M-Protein Marker.

FIG. 4 ELISA assay of UGGT1 protein in Pichia pastoris; the UGGT1 knockout yeast strain is used as a negative control, and the absorbance value of OD405 is increased along with the increase of the wet weight of the strain.

FIG. 5 shows a Western-blot method for identifying UGGT1 protein in Pichia pastoris;

in the figure, the 1-pichia UGGT1 protein has a molecular weight, which is predicted to be about 170 kD; after the gene of 2-pichia UGGT1 is knocked out, no corresponding band exists; M-Protein Marker.

Detailed Description

In order that the invention may be more fully understood, reference will now be made to the following description. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Example 1: extraction of Pichia pastoris genome and cloning of DNA fragment of 1133-1430 amino acids of UGGT1

Pichia pastoris strain GS115 was inoculated into 20mL YPD medium (1% yeast extract,2% peptone, 2% dextrose), shake-cultured at 28 ℃ and 200rpm/min to OD₆₀₀Collecting thallus by centrifugation at 12000rpm/min at 0.8-1.0, washing cells twice with sterilized deionized water, adding 200. mu.L Tris/SDS buffer (0.2M Tris-HCl pH7.6, 0.5M NaCl, 0.1% (W/V) SDS, 0.01M EDTA), mixing, adding 100. mu.L Tris-equilibrated phenol and 100. mu.L chloroform, adding 50 beads of acidified glass, shaking in ice bath for 30s, adding 200. mu.L TE (pH8.0), mixing, centrifuging at 12000rpm/min for 5min, transferring the upper aqueous phase into another centrifuge tube, adding 1mL ethanol, 1/10 volume of 3M NaAc, slowly mixing, standing at-20 ℃ for 5min, 12000rpm/min, centrifuging at 4 ℃ for 5min, carefully discarding the supernatant, washing with 75% alcohol once, adding 40. mu.L TE containing RNaseA (pH8.0), dissolving, and standing at-37 ℃ for 5min and at-20 ℃ for use.

Taking 1 mu L of the Pichia pastoris genome as a template, and taking p1 and p2 as primers

p1: CTAATTGGCAATACAGCAACTACTG；p2:CTGCACTTGATCATCATACTGGGTC。

The DNA fragment of 1133-1430 amino acids of UGGT1 is amplified by PCR, and the PCR system is as follows: template 1. mu.L, 10 XTaq DNA Polymerase buffer 5. mu.L, 2.5mM dNTP 4. mu.L, p 12. mu.L, p 22. mu.L, Taq DNA Polymerase 0.5. mu.L, ddH2O 36. mu.L. The reaction conditions were as follows: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 50sec, annealing at 50 ℃ for 1min, extension at 72 ℃ for 50sec, and extension at 72 ℃ for 10min, for a total of 30 cycles.

A part of the PCR products are detected by agarose gel electrophoresis (figure 1), and after the molecular weight is correct, the PCR products are stored at-80 ℃ for later use.

Example 2: construction of recombinant Escherichia coli strain containing 3397-4290bp gene fragment of Pichia pastoris UGGT1

Taking 4 mu L of the PCR product described in example 1, mixing with 1 mu L of Escherichia coli expression vector pEASY-Blunt E2 (Beijing Omega Biotechnology Co., Ltd.), water bath at 25 ℃ for 10min, mixing the ligation product with 100 mu L of Escherichia coli expression strain transetta competent cells (Beijing Omega Biotechnology Co., Ltd.), ice-cooling for 10min, heat-shocking at 42 ℃ for 30s, adding 500 mu L of liquid LB culture medium, shaking and culturing at 37 ℃ and 200rpm/min for 1h, coating on a resistant LB plate containing 50 mu g/L ampicillin, culturing at 37 ℃ overnight, picking out single colony for sequencing, and obtaining the positive clone with correct sequencing result, namely the recombinant Escherichia coli strain containing 3397-4290bp gene fragment of Pichia pastoris UGGT1 (figure 2).

Example 3: preparation of pichia UGGT1 antigen

Inoculating the recombinant Escherichia coli strain into 5mL of liquid LB culture medium containing 50. mu.g/L ampicillin, performing shake culture at 37 ℃ overnight, taking 1mL of the liquid LB culture medium, transferring the liquid LB culture medium into 100 mL of liquid LB culture medium containing 50. mu.g/L ampicillin, and performing shake culture at 37 ℃ for about 3h to OD₆₀₀=0.8-1.0, adding IPTG to a final concentration of 1mM, continuing culturing for 5h under the same conditions, centrifuging at 12000rpm/min for 1min to collect thalli, breaking the wall by ultrasonic, centrifuging at 12000rpm/min for 5min to collect precipitates, washing the precipitates with 4M urea for 2 times, dissolving the precipitates in 8M urea, storing at 4 ℃ for later use, and identifying the SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of the antigen expressed in escherichia coli as shown in figure 3.

Example 4: preparation of Pichia pastoris UGGT1 polyclonal antibody

50 mu L of 0.2mg/mL antigen is mixed with an equal volume of complete Freund's adjuvant uniformly, the concentration of the antigen is 0.2mg/mL, 8-week-old male Kunming mice are immunized by abdominal subcutaneous injection, 14 days later, the equal volume of antigen is mixed with the incomplete Freund's adjuvant uniformly, mice are injected by abdominal subcutaneous injection, after 14 days later, the immunization is strengthened for 1 time by the same method, 7 days later, the mouse venous serum is collected, and the antiserum containing the Pichia pastoris UGGT1 polyclonal antibody is obtained and can be directly used for experiments such as ELISA, Western-blot and the like.

Example 5: ELISA (enzyme-Linked immunosorbent assay) for UGGT1 protein in pichia pastoris

Alkaline phosphatase-labeled mouse secondary antibody is purchased from Aibocai (Shanghai) trade company, yeast intracellular protein is extracted by a yeast protein extraction kit (biological engineering (Shanghai) company Limited), UGGT1 knockout yeast strain is used as a negative control, and ELISA detection results are shown in figure 4₄₀₅The raised, i.e., prepared, antibody can bind to the yeast UGGT1 protein.

Example 6: western-blot identification of UGGT1 protein in pichia pastoris

The alkaline phosphatase-labeled mouse secondary antibody is purchased from Aiboc (Shanghai) trade company, a yeast protein extraction kit (biological engineering (Shanghai) corporation) is adopted for extracting the yeast intracellular protein, a yeast strain with UGGT1 gene knockout is used as a negative control, the Western-blot detection result is shown in figure 5, and the result shows that the prepared antibody can be specifically combined with yeast UGGT1 protein.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> a polyclonal antibody of Pichia pastoris UGGT1

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1450

<212> PRT

<213> Pichia pastoris (Pichia pastoris)

<400> 1

Met Ile Asn His Val Leu Ile Leu Leu Thr Tyr Leu Cys Leu Ser Val

1 5 10 15

Phe Ala Ser Glu Lys Phe Val Asp Ile Ser Leu Lys Ala Asn Trp Phe

20 25 30

Lys Thr Pro Phe Pro Leu Leu Leu Leu Glu Thr Val Ala Ser Glu Asn

35 40 45

Glu Ser Gly Phe Tyr Thr Ile Leu Asp Ala Met Phe Asp Val Ser Phe

50 55 60

Glu Ser Leu Glu Leu Glu Asp Glu Asp Leu Gln Phe Glu Ala Val Pro

65 70 75 80

Phe Val Lys Ser Asp Glu Glu Leu Tyr Glu Lys Trp Ser His Arg Ala

85 90 95

Gly Ala Ser Ile Glu Lys Ser Ile Thr Asp Ile Tyr Leu Ala Asn Lys

100 105 110

Tyr Tyr Ala Pro Arg Val Gln Ser His Tyr Gln His Tyr Asn Glu Val

115 120 125

Arg Ser Ser Ile Leu Gly Asp Lys Cys Gly Thr Asn Pro Lys Ala Trp

130 135 140

Leu Tyr Phe Asn Ser Glu Val Tyr Cys Asn Ser Asp Asp Val Phe Ala

145 150 155 160

Leu Lys Thr Gly Gly Lys Thr Gly Pro Pro Gln Ile Leu Pro Phe Asp

165 170 175

Arg Val Ile Gly Val Arg Asn Asp Glu Val Pro Val Ala Ile Ile Tyr

180 185 190

Gly Asp Tyr Arg Ser Pro Leu Phe Ser Gln Phe Ile Ser Asn Leu Ala

195 200 205

Gly Phe Val Lys Asp Gly Arg Leu Arg Leu Ala Trp Arg Tyr Ile Ser

210 215 220

Asp Glu Ser Val Leu Gln Lys Glu Thr Leu Ala Gly Tyr Gly Val Asp

225 230 235 240

Leu Thr Leu Lys Arg Thr Asp Tyr Ile Val Ile Asp Asp Arg Asp Ile

245 250 255

Val Leu Asp Lys Ser Leu Glu Thr Lys Pro Ile Ala Ala Glu Ser Asp

260 265 270

Asn Phe Trp Asp Val Tyr Ser Lys Glu Ile Glu Pro Val Ser Glu Lys

275 280 285

Tyr Ile Arg Ala Leu Gly Tyr Lys Leu Ser Leu Tyr Ile Lys Ser Leu

290 295 300

Glu Val Ser Glu Asn Glu Lys Leu Ala Ile Leu Thr Lys Leu Ile Gln

305 310 315 320

Asp Phe Pro Lys Phe Ala Ser Phe Ile Asp Arg Gln Val Thr Asp Thr

325 330 335

Glu Val Glu Glu Ile Ile Glu Asp Ser Leu Glu Asn Ser Ile Asn Asp

340 345 350

Leu Pro Gln Gly Val Tyr Ile Asn Gly Ala Val Val Asp Gln Ser Lys

355 360 365

Leu Asn Tyr Met Glu Ile Leu Asn Ile Leu Lys Arg Glu Tyr Ala Phe

370 375 380

Ile Asp Asp Ile Thr Lys Phe Gly Val Thr Gly Thr His Ala Gln Asp

385 390 395 400

Ile Met Arg Arg Phe Ala Ala His Ile Ser Asp Arg Ser Val Asn Asn

405 410 415

Thr Met Phe Lys Arg Phe Asp Ile Arg Gly His Gly Glu Ala Val Phe

420 425 430

Tyr Leu Asn Asp Ile Glu Thr Asp Pro Gln Tyr Ser Gly Leu Ser Ser

435 440 445

Ser Arg Lys Tyr Tyr Thr Thr Ser Val Ala Pro Gly Glu Ile Pro Pro

450 455 460

Val Arg Glu Asn Ile His Glu Ser Val Phe Val Ile Asp Leu Ala Asp

465 470 475 480

His Asn Gln Val Tyr Thr Leu Leu Gln Phe Ser Ser Val Met Leu Ser

485 490 495

Asn Arg Ile Pro Gln Arg Val Gly Phe Val Pro Leu Ile Ser Asp Lys

500 505 510

Leu Ser Glu Glu Ile Thr Leu Gln Phe Leu Ser Ile Phe Gln Ala Lys

515 520 525

Gly Ile Asn Gln Gly Ile Lys Tyr Leu His Asp Ile Ala Met Asn Val

530 535 540

Leu Gly Gln Thr Pro Arg Asp Ile Ile Ser Val Glu Ser Ile Thr Lys

545 550 555 560

Val Pro Val Ser Asp Lys Lys Asn Leu Leu Ser Lys Ile Asn Glu Phe

565 570 575

Ile Ser Ser Phe Ser Ile Asp His Pro Leu Leu Ile Thr Asn Gly Lys

580 585 590

Phe Phe Asp Phe Val Gln Asn Trp Gln Tyr His Ser Ala Arg Glu Ile

595 600 605

Phe Leu Asp Ile Leu Asp Leu Ser Asn Ala Ile Ser Ser Gly Ala Leu

610 615 620

Ser Glu Asp Met Arg Ala Gln Asp Tyr Ile Tyr Leu Gly Ser His Thr

625 630 635 640

Ser Arg Asn Val Leu Ile Ile Asn Ala Ile Cys Glu Glu Thr Asn Leu

645 650 655

Pro Ser Leu Val Ser Tyr Asp Asp Leu Glu Val Phe Glu Ser Ile Ser

660 665 670

Gln Asn Gln Asn Arg Ile Ala Thr Val Val Ile Asp Gly Gln Pro Asp

675 680 685

Ser Ile Pro Ile Thr Ser Trp Leu Leu Gly Asn Cys Lys Asp Lys Arg

690 695 700

Phe Leu Gln Gln Leu Arg His Leu Ile Thr Ala Ala Ser Glu Leu Asp

705 710 715 720

Pro Ile Lys Ile Lys Val Tyr Glu Thr Ser Ser Asn Ser Asp Phe Ser

725 730 735

Ser Ser Leu Gln Thr Ala Ile Asn Lys Ser Leu Val Asp Val Ile Ala

740 745 750

Phe Ile Asp Asn Glu Leu Glu Lys Ile Asn Val His Ser Pro Asp Thr

755 760 765

Val Leu Asn Asp Glu Thr Ile Asp Phe Val His Asn Val Phe Lys Ile

770 775 780

Lys Leu Ser Lys Pro Asn Asp Met Tyr Leu Ile Leu Asn Gly Arg Ala

785 790 795 800

Ile Lys Ile Arg Asp Lys Asp Ile Leu Leu Lys Asp Thr Asp Leu Lys

805 810 815

Leu Leu Val Glu Tyr Glu Ile Asp Phe Lys Leu Arg Ile Ala His Glu

820 825 830

Leu Phe Cys Glu Tyr Asn Ile Ser Glu Pro Lys Ser Leu Asp Thr Phe

835 840 845

Glu Leu Phe Glu Tyr Phe Thr Met Gly Ile Ser Asn Thr Tyr Phe Phe

850 855 860

Gly Asp Asn Tyr His Pro Asp Gln Arg Val Phe Pro Arg Tyr Asn Thr

865 870 875 880

Gly Leu Leu Asn Asp Ala Val Ser Ile Glu Val Ser Asn Ser Gly Pro

885 890 895

Ser Ile Met Asp Val Thr Val Ile Ile Asp Pro Leu Gln Glu Glu Ser

900 905 910

Gln Lys Leu Ile Ser Leu Leu Ser Leu Phe Glu Lys Leu Glu Ser Leu

915 920 925

Lys Leu Asn Ile Ile Leu Lys Pro Gln Glu Ala Arg Glu Leu Asn Ile

930 935 940

Lys Arg Phe Tyr Arg Gly Val Phe Pro Asn Ser Val Lys Phe Ser Ser

945 950 955 960

Ala Gly Asp Ala Ile Asp Asn Glu Asp Lys Gly Leu Phe Thr Leu Val

965 970 975

Pro Glu Lys Thr Leu Phe Thr Leu Asp Leu Asp Val Pro Asn Pro Trp

980 985 990

Ile Val Val Ile Lys Glu Ala Ala Thr Asp Leu Asp Asn Val Leu Leu

995 1000 1005

Glu Asn Ser Gly Asp Val Thr Gly Val Tyr Glu Leu Lys Ser Leu Leu

1010 1015 1020

Val Glu Gly Tyr Ala Leu Glu Lys Asn Thr Lys Tyr Pro Pro Val Ala

1025 1030 1035 1040

Leu Pro Ile Glu Leu Val Gly His Ser Asp Thr Ser Ile Met Ala Asn

1045 1050 1055

Tyr Gly Tyr Phe Gln Leu Gln Ala Asn Pro Gly Leu Trp Lys Phe Val

1060 1065 1070

Val Lys Pro His Thr Arg Gly Ser Asp Ile Tyr Arg Leu Ala Asn Val

1075 1080 1085

Thr Ser Lys Ser Asn Gly Asp Thr Leu Gln Tyr Thr Ile Ile Asp Glu

1090 1095 1100

Thr Ala Ile Ile Phe Val Leu Asp Met Asn Gly Asn Val Ile Leu Pro

1105 1110 1115 1120

Val Phe Asp Arg Lys Pro Gly Gln Glu Asn Ala Ser Leu Ile Gly Asn

1125 1130 1135

Thr Ala Thr Thr Glu Lys Asp Thr Gly Leu Ser Lys Phe Leu Ser Ser

1140 1145 1150

Trp Arg Lys Gln Glu Gln Pro Lys Asn Ala Asp Ile Asn Ile Phe Thr

1155 1160 1165

Val Ala Ser Gly His Leu Tyr Glu Arg Phe Leu Ser Ile Met Thr Asn

1170 1175 1180

Ser Val Met Lys His Thr Lys His Thr Val Lys Phe Trp Leu Ile Glu

1185 1190 1195 1200

Asn Tyr Met Ser Pro Thr Phe Lys Lys Asn Leu Pro Phe Leu Ala Arg

1205 1210 1215

Glu Phe Gly Phe Asp Tyr Glu Leu Val Asn Tyr Lys Trp Pro Ala Trp

1220 1225 1230

Leu Arg Gly Gln Arg Glu Lys Gln Arg Thr Ile Trp Gly Tyr Lys Ile

1235 1240 1245

Leu Phe Leu Asp Val Leu Phe Pro Gln Ser Leu Asp Lys Val Ile Phe

1250 1255 1260

Val Asp Ala Asp Gln Ile Val Arg Thr Asp Leu Lys Glu Leu Val Asp

1265 1270 1275 1280

Leu Asp Leu Glu Gly Ala Pro Tyr Gly Tyr Thr Pro Met Cys Asn Asp

1285 1290 1295

Arg Glu Glu Met Glu Gly Phe Arg Phe Trp Lys Gln Gly Tyr Trp Gln

1300 1305 1310

Lys Leu Leu Gly Asp Thr Leu Lys Tyr His Ile Ser Ala Leu Tyr Val

1315 1320 1325

Ile Asp Leu Lys Thr Phe Arg Gln Ile Ala Ala Gly Asp Arg Leu Arg

1330 1335 1340

Gln His Tyr Gln Gln Leu Ser Gln Asp Pro Asn Ser Leu Ser Asn Leu

1345 1350 1355 1360

Asp Gln Asp Leu Pro Asn Asn Leu Gln His Gln Ile Lys Ile Phe Ser

1365 1370 1375

Leu Pro Gln Glu Trp Leu Trp Cys Glu Thr Trp Cys Ser Asp Glu Ser

1380 1385 1390

Leu Lys Lys Ala Lys Thr Ile Asp Leu Cys Asn Asn Pro Leu Thr Lys

1395 1400 1405

Glu Pro Lys Leu Asp Arg Ala Arg Arg Gln Ile Pro Glu Trp Thr Gln

1410 1415 1420

Tyr Asp Asp Gln Val Gln Gln Ile Ile Asn Glu Ala Ser Ala Ser Ala

1425 1430 1435 1440

Arg Glu Ser Ile Thr Glu His Asp Glu Leu

1445 1450

<210> 2

<211> 4353

<212> DNA

<213> Pichia pastoris (Pichia pastoris)

<400> 2

atgattaatc atgtcttaat attgttgaca tacttatgtc tgtccgtgtt tgcatctgaa 60

aagtttgttg atatcagttt gaaggccaat tggttcaaaa ctcctttccc actgttacta 120

ctggagacag ttgcaagtga gaatgaatca ggcttttaca caatacttga cgccatgttt 180

gacgtctcat ttgaatcttt agagctagaa gatgaagatt tgcaatttga agctgttcct 240

tttgttaaat ctgatgaaga attgtacgaa aaatggtctc atagggctgg ggcatcgatt 300

gaaaagtcga taactgatat atatcttgca aacaagtact atgctccaag ggttcaatca 360

cattaccagc actacaatga agttcggtcc tcaattttag gtgacaagtg tggaactaat 420

cctaaggcgt ggctctattt caatagtgaa gtatactgca actccgatga tgtcttcgca 480

ttgaaaactg gcggcaagac gggcccacca caaatcctgc cattcgatag agtcattggt 540

gtcagaaatg atgaagttcc tgttgcaatt atttatgggg attatagaag ccctcttttt 600

tcacagttta tctctaactt ggcgggattc gtcaaagatg gtagactgag attagcttgg 660

aggtatattt ctgacgaatc cgttttgcaa aaagaaactc tagctgggta tggtgttgat 720

ctaactttaa agagaactga ctatattgtt attgacgaca gagatatagt tcttgacaaa 780

tcattagaaa caaagcccat tgcggctgaa tccgataact tttgggatgt ttactccaaa 840

gagattgagc ctgtatctga gaaatacatt agggcattgg gttacaaact ttcactttat 900

atcaagagcc ttgaagtgtc cgagaacgaa aagttggcaa ttctcactaa gttgatccaa 960

gacttcccaa agtttgcatc tttcattgat cgtcaggtaa cggatactga agtggaggag 1020

atcattgagg atagtttgga aaactcaatt aatgatttac ctcagggtgt gtatattaac 1080

ggggctgtag ttgaccaatc caagttaaat tatatggaga tcttgaatat tttgaagaga 1140

gaatatgcat tcatcgatga cataaccaag ttcggagtta caggaaccca tgcacaggat 1200

atcatgaggc gttttgctgc tcacatttcc gataggtcag ttaacaacac tatgttcaag 1260

agatttgata ttagaggcca tggagaagct gttttttact tgaatgatat cgaaactgat 1320

cctcaatatt ctggactttc aagctctaga aaatattata cgacatcagt tgctccaggt 1380

gagattcccc ctgtgagaga gaacattcac gaatcagtgt tcgtcataga tctagcagat 1440

cataatcagg tttacacgtt gctacaattt tcatctgtaa tgctttctaa caggatacca 1500

caaagagtgg gctttgttcc acttatttct gataagttaa gtgaagagat tactttgcag 1560

tttttatcca tctttcaagc taagggcata aaccagggaa taaaatactt gcatgatatt 1620

gccatgaatg tcttaggaca gactccaagg gatataattt ccgttgaatc gatcactaag 1680

gtccctgttt ctgataagaa aaatctgctt tccaaaatca acgagttcat cagttccttt 1740

tcaattgacc acccactact tattacgaat ggtaagtttt ttgatttcgt gcagaactgg 1800

cagtatcatt ccgctagaga gatatttctg gacatacttg acctgagcaa tgcgatctcc 1860

agcggtgcac tttctgaaga tatgagagcc caagactaca tttaccttgg atctcacact 1920

tctaggaatg tccttatcat aaatgcaatt tgtgaagaaa ccaaccttcc atcccttgtt 1980

tcttatgatg atttagaagt cttcgaatca atttcacaga accaaaatcg gattgccaca 2040

gttgtcatag atggccaacc agattcgatc ccaattacgt cctggttact aggaaactgc 2100

aaggataaaa ggtttttgca gcagctccgt catttgataa ctgctgcatc tgagttggac 2160

cctatcaaga tcaaagtcta cgaaacttct tcaaactctg atttttcatc gagcctacag 2220

acagccataa acaagtcttt ggtggatgtg atagcgttca ttgataacga acttgaaaaa 2280

atcaatgtgc attccccaga caccgtattg aacgacgaaa ccatagattt tgtccacaat 2340

gttttcaaaa tcaagctctc caaaccaaat gatatgtact taattcttaa tggaagggct 2400

attaagatta gagataagga catattactg aaagacactg atctcaaact gctagttgaa 2460

tacgaaatag atttcaagtt gagaatcgct catgaactgt tttgcgagta caacatctct 2520

gaacccaaga gtttggatac ttttgaattg tttgagtatt tcactatggg catctccaat 2580

acatacttct ttggtgacaa ttatcaccca gatcaacggg tattcccaag atataatact 2640

ggccttctca atgatgcagt ctccattgaa gtttcaaact ctgggccatc tatcatggat 2700

gtgaccgtga tcatagatcc tcttcaagaa gagtctcaaa agctaatatc gttgctctcg 2760

ttgtttgaaa aattggaaag ccttaagctt aacattatcc tgaaaccaca agaagctagg 2820

gagttaaaca ttaaacgatt ttatcgtgga gtatttccta attcagtgaa attttcctcc 2880

gcaggagatg ctattgataa tgaagataaa ggccttttca cactggtacc agaaaaaacc 2940

ttgtttacat tagacttgga cgttcctaac ccgtggattg ttgtgattaa ggaagctgcc 3000

accgatttgg ataatgtact attggaaaat tcaggtgatg tgacaggtgt ctatgagctg 3060

aaatcgcttc tagttgaagg gtatgcactt gagaagaaca caaaatatcc acctgtagct 3120

ttacccatag agcttgtggg acattccgac acaagtatta tggccaatta tggatatttc 3180

caattgcaag cgaacccagg attgtggaaa tttgttgtca agccccatac taggggctca 3240

gatatctatc gattggcgaa cgttacaagt aagtctaacg gtgatacact tcagtacacc 3300

attattgacg agactgctat aatctttgtc ttggatatga atggaaatgt tattctgcct 3360

gtgtttgaca ggaaacctgg ccaagagaat gcatctctaa ttggcaatac agcaactact 3420

gaaaaagata caggcctcag caaatttttg tcttcatggc gaaaacaaga acaaccgaag 3480

aatgctgata tcaacatttt cacagttgct agtgggcatc tatatgagcg attcttgtca 3540

ataatgacaa actctgtaat gaagcacacc aagcataccg tcaagttttg gctaattgag 3600

aactacatgt cacccacgtt caagaagaat ttacccttcc ttgcccgaga gtttgggttt 3660

gactatgaac tggtcaacta taagtggcca gcatggctga ggggtcaaag ggagaaacaa 3720

cgaactatct ggggatataa gattttgttc ttggatgttt tgttccctca aagcctcgat 3780

aaagtgatat ttgttgacgc ggaccaaata gttagaacag atctaaagga gcttgtggat 3840

ttggaccttg aaggtgcgcc ttatggatat actccaatgt gcaacgacag ggaagagatg 3900

gaagggttta gattttggaa acagggatat tggcagaagc tcttgggtga tactctaaag 3960

tatcacatca gtgccctgta cgtgattgac ttgaaaactt ttaggcagat tgctgccggt 4020

gataggttga gacaacacta ccagcaactt tctcaagatc caaattcttt gtcaaaccta 4080

gatcaagatc taccaaataa tcttcagcac caaatcaaaa ttttttcact ccctcaagag 4140

tggctgtggt gtgaaacttg gtgtagcgat gagagtttaa agaaggcaaa gacgatagac 4200

ctttgcaaca accctttaac caaggaacca aaattagaca gagcacgaag acaaattcca 4260

gaatggaccc agtatgatga tcaagtgcag caaattataa acgaagcatc tgcaagcgct 4320

agggaatcca tcactgaaca tgatgagctt tag 4353

<210> 3

<211> 298

<212> PRT

<213> Pichia pastoris (Pichia pastoris)

<400> 3

Leu Ile Gly Asn Thr Ala Thr Thr Glu Lys Asp Thr Gly Leu Ser Lys

1 5 10 15

Phe Leu Ser Ser Trp Arg Lys Gln Glu Gln Pro Lys Asn Ala Asp Ile

20 25 30

Asn Ile Phe Thr Val Ala Ser Gly His Leu Tyr Glu Arg Phe Leu Ser

35 40 45

Ile Met Thr Asn Ser Val Met Lys His Thr Lys His Thr Val Lys Phe

50 55 60

Trp Leu Ile Glu Asn Tyr Met Ser Pro Thr Phe Lys Lys Asn Leu Pro

65 70 75 80

Phe Leu Ala Arg Glu Phe Gly Phe Asp Tyr Glu Leu Val Asn Tyr Lys

85 90 95

Trp Pro Ala Trp Leu Arg Gly Gln Arg Glu Lys Gln Arg Thr Ile Trp

100 105 110

Gly Tyr Lys Ile Leu Phe Leu Asp Val Leu Phe Pro Gln Ser Leu Asp

115 120 125

Lys Val Ile Phe Val Asp Ala Asp Gln Ile Val Arg Thr Asp Leu Lys

130 135 140

Glu Leu Val Asp Leu Asp Leu Glu Gly Ala Pro Tyr Gly Tyr Thr Pro

145 150 155 160

Met Cys Asn Asp Arg Glu Glu Met Glu Gly Phe Arg Phe Trp Lys Gln

165 170 175

Gly Tyr Trp Gln Lys Leu Leu Gly Asp Thr Leu Lys Tyr His Ile Ser

180 185 190

Ala Leu Tyr Val Ile Asp Leu Lys Thr Phe Arg Gln Ile Ala Ala Gly

195 200 205

Asp Arg Leu Arg Gln His Tyr Gln Gln Leu Ser Gln Asp Pro Asn Ser

210 215 220

Leu Ser Asn Leu Asp Gln Asp Leu Pro Asn Asn Leu Gln His Gln Ile

225 230 235 240

Lys Ile Phe Ser Leu Pro Gln Glu Trp Leu Trp Cys Glu Thr Trp Cys

245 250 255

Ser Asp Glu Ser Leu Lys Lys Ala Lys Thr Ile Asp Leu Cys Asn Asn

260 265 270

Pro Leu Thr Lys Glu Pro Lys Leu Asp Arg Ala Arg Arg Gln Ile Pro

275 280 285

Glu Trp Thr Gln Tyr Asp Asp Gln Val Gln

290 295

<210> 4

<211> 894

<212> DNA

<213> Pichia pastoris (Pichia pastoris)

<400> 4

ctaattggca atacagcaac tactgaaaaa gatacaggcc tcagcaaatt tttgtcttca 60

tggcgaaaac aagaacaacc gaagaatgct gatatcaaca ttttcacagt tgctagtggg 120

catctatatg agcgattctt gtcaataatg acaaactctg taatgaagca caccaagcat 180

accgtcaagt tttggctaat tgagaactac atgtcaccca cgttcaagaa gaatttaccc 240

ttccttgccc gagagtttgg gtttgactat gaactggtca actataagtg gccagcatgg 300

ctgaggggtc aaagggagaa acaacgaact atctggggat ataagatttt gttcttggat 360

gttttgttcc ctcaaagcct cgataaagtg atatttgttg acgcggacca aatagttaga 420

acagatctaa aggagcttgt ggatttggac cttgaaggtg cgccttatgg atatactcca 480

atgtgcaacg acagggaaga gatggaaggg tttagatttt ggaaacaggg atattggcag 540

aagctcttgg gtgatactct aaagtatcac atcagtgccc tgtacgtgat tgacttgaaa 600

acttttaggc agattgctgc cggtgatagg ttgagacaac actaccagca actttctcaa 660

gatccaaatt ctttgtcaaa cctagatcaa gatctaccaa ataatcttca gcaccaaatc 720

aaaatttttt cactccctca agagtggctg tggtgtgaaa cttggtgtag cgatgagagt 780

ttaaagaagg caaagacgat agacctttgc aacaaccctt taaccaagga accaaaatta 840

gacagagcac gaagacaaat tccagaatgg acccagtatg atgatcaagt gcag 894

Claims

1. A polyclonal antibody of Pichia pastoris UGGT1 is characterized in that the antibody is a polyclonal antibody prepared by animal immunization with amino acid sequence polypeptide at 1133-1430 th site of Pichia pastoris UGGT1 as antigen.

2. The polyclonal antibody of the Pichia pastoris UGGT1 according to claim 1, wherein the antigen is the polypeptide of amino acid sequence at 1133-1430 of Pichia pastoris UGGT1 as core sequence, and more amino acid residues or less amino acid residues are added at two ends or one end of the polypeptide.

3. A kit for detecting pichia pastoris UGGT1 protein, comprising the polyclonal antibody of claim 1 or 2.

4. An indirect sandwich ELISA detection kit for Pichia pastoris UGGT1 protein, which is characterized by comprising Pichia pastoris UGGT1 standard protein, washing liquid, confining liquid, substrate developing liquid, stopping liquid, an ELISA plate coated with the polyclonal antibody of claim 1 or 2, a detection antibody and an enzyme labeled antibody; the enzyme-labeled antibody is goat anti-rabbit IgG labeled by HRP.