CN102675433A - Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof - Google Patents
Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof Download PDFInfo
- Publication number
- CN102675433A CN102675433A CN2012101403829A CN201210140382A CN102675433A CN 102675433 A CN102675433 A CN 102675433A CN 2012101403829 A CN2012101403829 A CN 2012101403829A CN 201210140382 A CN201210140382 A CN 201210140382A CN 102675433 A CN102675433 A CN 102675433A
- Authority
- CN
- China
- Prior art keywords
- lys
- glu
- thr
- ala
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a recombinant protein of active segment IsdB2 of decision protein IsdB on the surface of methicillin-resistant staphylococcus aureus iron ion, wherein the amino acid sequence of the recombinant protein is SEQ ID No: 3 or the sequence which has the same or similar function as the SEQ ID No: 3 obtained by adding or deleting a plurality of amino acids at the amino terminal and/or the carboxyl terminal of the SEQ ID No: 3. The invention further discloses a method for preparing the recombinant protein by building the expression vector of the recombinant protein and transforming the host bacteria, and the use of the recombinant protein in the aspect of preparing the subunit vaccine and the related assay kits resisting the methicillin-resistant staphylococcus aureus. By adopting the gene engineering technology, in the invention, the truncated protective antigens component IsdB2 is expressed by cloning through the protein expressing, thereby being high in expression index, convenient to separate and purify, and high-efficiency and safe. Due to the gene engineering, the recombinant polyvaccine has good immune protective effect on resisting the MRSA (methicillin-resistant staphylococcus aureus) infection.
Description
Technical field
The invention belongs to the biotechnological pharmaceutics field, relate to a kind of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB active fragments IsdB2 recombinant protein.
Background technology
Methicillin-resistant staphylococcus aureus refers to oxazole penicillin such as X-1497, Oxazacillin and the drug-fast streptococcus aureus of fluorine cloxacillin; It is a kind of gram positive organism that has body surface, nasopharynx, perineal position and the enteron aisle of humans and animals; Usually cause skin soft-tissue infection, microbemia and shift complication, like pneumonia, endocarditis, septic arthritis and osteomyelitis.Found first by Britain scholar Jevons that from 1961 become one of the highest pathogenic bacteria of infection rates such as global ICU ward, burn, war wound at present, its local infection that causes is prolonged not to heal, the systemic infection mortality ratio is up to 20%.Extensive because of its route of transmission, be prone to outbreak of epidemic, again because it is pathogenic strong; Variability is big; And be multidrug resistant and become clinically the difficult point of treatment, be called as " superbacteria ", these characteristics make it very likely as the bacteriological weapon of following military struggle and the bio-terrorism agent of fighting.Current, MRSA is classified as the world's three the most scabrous greatly infectious diseases with hepatitis B, AIDS, and occupies the first place.
Abroad, the MRSA of the U.S. in 2005 infects monitor data and shows, the annual severe infections number of the U.S. is people more than 9.4 ten thousand, and deadly case is about 1.9 ten thousand people, this numeral even surpass the AIDS number that causes death.At home, Chinese bacterial drug resistance in 2008 detects coorporative network (CHINET) detected result and shows that 12 the average recall rates of the MRSA of teaching hospital in domestic major area are 55.9%, are up to 77.5%, belongs to one of serious country of MRSA infection.In Shanghai, the average recall rate of MRSA is 63.9% in 14 the hospital streptococcus aureuses in this area in 2004, be up to 86.5%, and the average recall rate of MRSA in 2006 is 64.6%, is up to 92.5%.This shows that the methicillin-resistant staphylococcus aureus whole world spreads, its infection rate and mortality ratio are constantly soaring, the serious threat human health.
At present; Vancomyein is the last line of defense of treatment methicillin-resistant staphylococcus aureus; But the methicillin-resistant staphylococcus aureus of vancomycin resistance is separated in succession since 1997; It is thus clear that development of antibiotics does not catch up with the development of bacterial drug resistance far away, make methicillin-resistant staphylococcus aureus be about to face the severe challenge that antibiotic-free can be controlled.Therefore, strengthen study on prevention to the MRSA infection, extremely urgent.At present; The MRSA vaccine of U.S.'s research and development has got into the III clinical trial phase stage; Therefore, it is significant to controlling MRSA infection, resistance development, bio-terrorism defence and improving international competitiveness that research and development have MRSA vaccine independent intellectual property right, efficient, safe, economic.
Because the methicillin-resistant staphylococcus aureus virulence factor comprises tens of kinds of capsular polysaccharide, ClfA, IsdB, enterotoxin, TSST-1, alpha hemolysin and Thrombin coagulases etc.; And content is lower; Directly from full bacterium separation of pure to dissolve the difficulty of protective antigen bigger; Method is loaded down with trivial details, is unfavorable for the industrialization preparation of vaccine.Utilizing genetic engineering technique that the effective protective antigen of thalline is carried out clonal expression improves the feasibility of MRSA vaccine development greatly.
Methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB is a kind of outer membrane protein antigen; IsdB is not only important adventitia holdfast albumen of MRSA; Adhere to the vital role in mid-term in the MRSA field planting, it also is MRSA obtains iron from the host a main tool simultaneously.Bacterial outer membrane albumen has good antigenic activity, and the main target that these outer membrane proteins are attacked as antibody and immunocyte can mediate the most effective killing action of bacterium, is whether the decision immunoreation has protectiveness to human body key factor.
Utilize information biology that IsdB is carried out structural-functional analysis, find that IsdB is twice transmembrane protein, by extracellular region and stride the film district and form.Because the IsdB cell walls anchorin that is, so it is caught oxyphorase and is mainly played a role by the protein of extracellular region.This provides theoretical basis for the design subunit vaccine.
Even subunit vaccine is to remove in the pathogenic agent and excite the protective immunity deleterious composition that has nothing to do, but keeps the new generation vaccine of effective immunogen composition.Yet subunit vaccine is owing to have many limitation, and for example its immunoreation that in acceptor, causes is more is transience, can not cause permanently effective immunity, and the suitable immunogen composition of therefore selecting just becomes the significant problem that needs solution.
Summary of the invention
High drug-resistance to methicillin-resistant staphylococcus aureus; The present invention provides the active fragments IsdB2 recombinant protein of a kind of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB, and it can be applicable to prepare the subunit vaccine of methicillin-resistant staphylococcus aureus resistance infection and relevant detection kit.
In view of IsdB albumen is twice transmembrane protein; The aminoacid sequence of its extracellular region corresponding 34 ~ 628; And it is caught oxyphorase and is mainly played a role by the protein of extracellular region; In order on to greatest extent, to keep the 26S Proteasome Structure and Function of IsdB not have greatly changed; The present invention simultaneously behind 1 ~ 23 amino acid of 1 ~ 33 amino acid of brachymemma IsdB (SEQ IDNO:1) aminoterminal and carboxyl terminal to the IsdB active fragments clone, the evaluation of expression and protective immunity, with the fragment called after IsdB2 after the IsdB brachymemma.
Active fragments IsdB2 according to the invention comprises the proteic extracellular region of IsdB, its aminoacid sequence for for SEQ ID NO:3 or after the aminoterminal of SEQ ID NO:3 and/or carboxyl terminal add or lack several amino acid, obtain have the sequence of same or similar function with SEQ ID NO:3; Preferably; The aminoacid sequence of said active fragments is SEQ ID NO:3; The aminoterminal of sequence promptly and carboxyl terminal lack the sequence that is shown in SEQ ID NO:4 that is obtained behind 33 and 23 amino acid respectively, the sequence that promptly obtains behind 23 amino acid of while brachymemma IsdB 33 amino acid of (SEQ ID NO:1) aminoterminal and carboxyl terminal.
The present invention also provides a kind of recombinant expression vector that is used to express the IsdB2 recombinant protein, and it comprises the nucleotide sequence and the carrier sequence of the said IsdB2 recombinant protein of encoding.
The nucleotide sequence of said coding IsdB2 recombinant protein can be SEQ ID NO:4 or add in the one or both ends of SEQ ID NO:4 or lack that albumen has the sequence of same or similar functional protein shown in the coding that obtains behind several Nucleotide and the SEQ ID NO:3; Preferably, said nucleotides sequence is classified the SEQ ID NO:4 of coding SEQ ID NO:3 aminoacid sequence as.
The present invention preferably adopts the pGEX-6p-2 carrier to make up recombinant expression vector; Express the IsdB2 recombinant protein; PGEX is the carrier of the expressed fusion protein that made up in 1987 by Smith and Johnson; Its principal feature is the glutathione-S-transferase (GST) that to be connected to a molecular weight on the carrier be 26kDa, just contains a GST label in the expressed fusion protein, and this label is the mark of protein purification.Compare with other fusion vectors, the pGEX serial carrier has the adding that purification condition gentleness, step simply, do not need denaturing agent, thereby makes the albumen behind the purifying can keep its space conformation and immunogenicity to greatest extent.
Therefore, the present invention also provides a kind of host bacterium, and its importing has the recombinant expression vector of above-mentioned structure.
The present invention also provides a kind of method of the IsdB2 of expression recombinant protein, and it comprises following steps: 1) nucleotide sequence according to coding IsdB2 recombinant protein designs forward primer isdB2-F and reverse primer isdB2-R; 2) use the forward primer and the reverse primer of step 1) design, through pcr amplification go out the to encode gene fragment of IsdB2 recombinant protein; 3) with step 2) gene fragment clone to the expression vector that obtained, be converted into the host bacterium then; And 4) induce the host bacterium after the conversion to express the IsdB2 recombinant protein.
The forward primer of the present invention's design and the preferred nucleotide sequence of reverse primer are shown in SEQID NO:5 and SEQ ID NO:6 respectively.
The preferred intestinal bacteria XL1bule of employed host bacterium.
The present invention also provides the application of a kind of IsdB2 recombinant protein in the subunit vaccine of preparation methicillin-resistant staphylococcus aureus resistance.
The present invention also provides the application of a kind of IsdB2 recombinant protein in preparation methicillin-resistant staphylococcus aureus detection kit.
The present invention adopts the protective antigen composition IsdB2 albumen of this brachymemma of genetic engineering technique clonal expression, and expression amount is high, is convenient to separation and purification, and highly effective and safe.The IsdB2 recombinant protein can be directly and adjuvant (like Al (OH)
3Adjuvant, MF59, AS0
3, AS0
4, incomplete Freund's adjuvant, complete Freund's adjuvant, mycobacterium BCG-CWS adjuvant etc.) be used, be applicable to the injecting immune inoculation.
Genetically engineered Recombinant Protein Expression method of the present invention has the following advantages: 1) IsdB2 expression of recombinant proteins plasmid abduction delivering in prokaryotic expression system-intestinal bacteria; When 2) selecting pGEX carrier series, the IsdB2 recombinant protein is with fusion protein form expression; The glutathione-S-transferase (GST) that to be connected to a molecular weight on the expression vector be 26kDa; Just contain a GST label in the expressed fusion protein; This label just becomes the mark of protein purification; Make purification condition gentleness, step simply, not need the adding of denaturing agent, thereby the albumen behind the purifying can keep its space conformation and immunogenicity to greatest extent; Expression rate is about 30%, and the IsdB2 recombinant protein purity that purifying comes out is greater than 95%; 3) the IsdB2 recombinant protein all can produce specific antibody by induced animal.
Utilize the subunit vaccine of IsdB2 recombinant protein preparation of the present invention to carry out immunization through subcutaneous (muscle) injecting pathway, excitating organism produces high titre IgG antibody and cellullar immunologic response.And through the experimentation on animals confirmation, said genetically engineered recombinant multivalent vaccine has the immune protective effect that good anti-MRSA infects.For further combined vaccine and the fusion bacterin research of many subunits lay the first stone, development and the application for control vaccine and diagnostic kit simultaneously has important effect.
In order to make the object of the invention, technical scheme and advantage clearer,, the present invention is further elaborated below in conjunction with accompanying drawing and embodiment.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.
Description of drawings
Fig. 1 is the pcr amplification result of IsdB2 gene fragment, wherein
Swimming lane M: nucleic acid (DNA) molecular weight standard (Marker);
The pcr amplification product of swimming lane 1 ~ 3: target gene fragment IsdB2 (1785bp).
Fig. 2 cuts qualification result for the enzyme of expression vector pGEX-6p-2-IsdB (1785bp):
Swimming lane M: nucleic acid (DNA) molecular weight standard (Marker);
Swimming lane 1-6: the qualification result of recombinant expression plasmid pGEX-6p-2-IsdB after enzyme is cut, wherein swimming lane 4 expressed enzymes are cut isolating fragment 4000bp in back and 1785bp;
Fig. 3 representes inducible protein expression of results under the differing temps:
Swimming lane M: molecular weight of albumen standard (Marker)
Fig. 4 representes recombinant expression vector behind 16 ℃ of abduction deliverings that spend the night, and obtains to contain the fusion rotein of GST label, wherein
Swimming lane M: molecular weight of albumen standard (Marker);
Fig. 5 representes that the fusion protease that contains the GST label cuts the result
Swimming lane M: molecular weight of albumen standard (Marker);
Swimming lane 1: before enzyme is cut, contain the fusion rotein of GST label;
Swimming lane 2: after enzyme is cut, the target protein that obtains at supernatant;
Swimming lane 3: after enzyme was cut, washing for the first time was used for combining to express the target protein that proteic GlutathioneSepharose 4B gel column (beads) obtains;
Swimming lane 4: after enzyme is cut, wash the target protein that beads obtains for the second time;
Swimming lane 5: after enzyme was cut, non-specific binding was combined in enzyme and GST label on the beads in target protein and the specificity of beads.
Fig. 6 utilizes online bioinformation software that IsdB albumen is striden the film district figure that predicts the outcome.
Fig. 7 utilizes Porter software to IsdB secondary structure prediction figure as a result, wherein " H " expression α spiral " E " expression βZhe Die " C " expression random coil " T " expression βZhuan Jiao.
Fig. 8 utilizes SWISS-MODEL software to build in the PDB DB through the homology mould and seeks template, and IsdB is carried out the tertiary structure prediction.
Fig. 9 utilizes SWISS-MODEL software to build in the PDB DB through the homology mould and seeks template, and IsdB is carried out the tertiary structure prediction.
Figure 10 is the nucleotide sequence comparing result of recombinant expression vector order-checking back and IsdB2.
Embodiment
Bacterial strain used in the present invention and all ingredients are following:
1. bacterial strain, plasmid
The strain of streptococcus aureus MRSA-252 international standard is provided by American ACT T;
Strain X L-1blue intestinal bacteria are U.S.'s Agilent Company products;
Plasmid pGEX-6p-2 is a U.S. GE Healthcare Company products;
Plasmid pET-22b is a U.S. merck Company products;
2. reagent
PrimeSTAR HS DNA Polymerase, DNA Marker, restriction enzyme BamHI and Not I, albumen Marker are Dalian TakaRa Company products;
It is U.S. Omega Company products that plasmid extraction kit and gel reclaim test kit;
It is a day root Company products that bacterial genomes is extracted test kit, ultra-thin recovery test kit and colour developing liquid;
T4DNA Ligase is the Fermentas Company products;
Gsh-sepharose Glutathione Sepharose 4B is a U.S. GE Healthcare Company products.
Bright peptide Leupeptin hemisulfate and the Pepsin suppressor factor PepstatinA of pressing down is available from German AppliCh company;
PMSF PMSF is from the green skies, Shanghai biotechnology research institute.
Chemical reagent such as the PBS that uses, Tris are commercially available analytical pure among the present invention;
Use TB substratum, MH substratum etc. to be commercially available biochemical product among the present invention.
Embodiment 1: the clone of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB active fragments IsdB2
1. at first according to MRSA-252IsdB albumen full-length gene order, the applying biological information software carries out structural analysis, and analytical results is referring to accompanying drawing 6-9, thus definite IsdB2 target gene fragment that needs amplification.
2. according to analytical results, adopt PCR method from MRSA-252 genome amplification IsdB2 target gene fragment, amplification step is following:
1) design PCR primer is following, is respectively SEQ ID NO:5-6 (underscore shows the restriction enzyme site base sequence)
isdB2-F：SEQ ID NO：5
5'-CGC
GGATCCATGAATGGCGAAGCAAAAGCAGC-3'
BamH Ⅰ
isdB2-R：SEQ ID NO：6
5'-TTTTCCTTTT
GCGGCCGCCTATGTCATATCTTTATTAGATTCTTC
-3'Not Ⅰ
To the encode nucleotide sequence SEQ ID NO:3 of IsdB2 aminoacid sequence shown in the SEQ ID NO:4 of present embodiment carries out pcr amplification as target gene fragment; But it should be appreciated by those skilled in the art that and to select derived from nucleotide sequence shown in the SEQ ID NO:2, lack the arbitrary sequence that obtained behind 1-33 and 1-23 the codon respectively as target gene fragment at its corresponding proteins encoded aminoacid sequence (shown in SEQ ID NO:1) aminoterminal and carboxyl terminal.
2)-80 taking out the methicillin-resistant staphylococcus aureus MRSA-252 bacterial strain of preserving in ℃ freezer coats on the MRSA-252 special solid substratum; In 37 ℃ of overnight cultures; Picking list colony inoculation was cultivated 8 hours in the special liquid bulk substratum of MRSA-252 again, with reference to bacterial genomes extraction agent box extracting MRSA genome.
3) be template pcr amplification IsdB2 gene fragment PCR system with the MRSA-252 complete genome DNA:
94 ℃ of preparatory sex change 5min of pcr amplification reaction condition, 94 ℃ of sex change 20s, 58 ℃ of annealing 40s, 72 ℃ are extended 2.5min, 30 circulations, 72 ℃ are extended 10min fully.Use 1% sepharose detection pcr amplification result after reaction finishes, pcr amplification is the result be shown among Fig. 1.
4) use gel to reclaim test kit and reclaim the IsdB2PCR product.
3.PCR the evaluation of product and clone, step is following:
1) BamH I and Not I enzyme are cut pGEX-6P-2 plasmid and IsdB2PCR product endonuclease reaction system:
37 ℃ of enzymes are cut 4h.
2) the PCR product that uses ultra-thin recovery test kit to reclaim the pGEX-6P-2 plasmid and cut through BamH I and Not I enzyme.
3) connection and conversion
Measure the switchback of IsdB2 enzyme through ultraviolet spectrophotometer and receive the product nucleic acid concentration: 30ng/ μ l; The product nucleic acid concentration is received in the switchback of pGEX-6P-2 enzyme: 60ng/ μ l; General according to carrier and exogenous segment mole number than being 1: 2 ~ 10, design following ligation system.
The ligation system:
Mixing, 16 ℃ connect 1.5h.
4) get 3 pipe intestinal bacteria XL1blue competent cells from-80 ℃ of refrigerators, first pipe adds the pGEX-6P-2 plasmid, makes positive control; Second pipe adds DNA and connects product; The 3rd pipe does not add source DNA, makes negative control.Ice bath 50min, thermal shock 90s in 42 ℃ of metal baths, ice bath min rapidly.Add the blank substratum of 600ul LB, mixing places 37 ℃ of shaking table 200rp jolting 1h.
Each pipe discards the 300ul supernatant with the centrifugal 3min. of 5000rpm room temperature, and resuspended again thalline is got 150 μ l and coated Amp resistance LB flat board.Flat board is inverted in 37 ℃ of incubators and cultivates 24h.
5) screening, the evaluation of the positive recombinant plasmid of pGEX-6p-2/IsdB2
1. the negative control flat board does not have bacterium colony to occur; The positive control flat board covers with bacterium colony, explains that the competent cell making is correct, credible result.Picking transforms dull and stereotyped going up and separates good bacterium colony, is inoculated in the Amp resistance LB substratum, and 37 ℃ of shaking culture are spent the night;
2. plasmid extraction: carry out with reference to the plasmid extraction kit specification sheets;
3. DNA carries out BamH I and Not I double digestion;
The double digestion reaction system:
37 ℃ of enzymes are cut 2h;
4. 1% agarose gel electrophoresis detects the double digestion result, result such as Fig. 2, and visible swimming lane 4 samples are for making up successful pGEX-6p-2/IsdB2 recombinant plasmid;
5. the pGEX-6p-2/IsdB2 recombinant plasmid is sent to the order-checking of the handsome company in Shanghai, and the sequencing result comparison result is shown in Figure 10, and the sequence of the target gene fragment of visible recombinant plasmid is correct.
The evaluation of embodiment 2:MRSA-252 IsdB subunit active segment IsdB2 abduction delivering, purifying and expression-form in prokaryotic expression system-intestinal bacteria
1. target protein abduction delivering
1) get double digestion and identify that correct pGEX-6P-2-IsdB2/XL-1blue bacterium liquid 100 μ L add in the TB substratum of 10mL Amp resistance, 37 ℃ of incubated overnight of 80rpm, the bacterium liquid 400 μ L that get incubated overnight respectively add in the TB substratum of 20mLAmp resistance (remaining bacterium liquid is kept in 4 ℃ of refrigerators subsequent use); Cultivate 2 ~ 3h for 37 ℃; Rotating speed 200rpm, re-activation is 0.6 ~ 0.8 o'clock to OD600, adding IPTG 40 μ L; Making its final concentration is 200 μ M; Place 30 ℃ of 3h of shaking table abduction delivering again, 25 ℃ of 5h, 18 ℃, 16 ℃, 12 ℃ are the abduction delivering that spends the night.
2) the bacterium liquid behind the abduction delivering is taken out, with the centrifugal 15min of 6000rpm, supernatant discarded adds 1mL lysis buffer mixing, ultrasonic degradation 3min (ultrasonic 6 times 30s/ time), 4 ℃ of centrifugal 1 5min of 14000rpm again, cleer and peaceful deposition in the separation.
2. processing supernatant
Get Glutathione Sepharose 4B 20 μ l, after PBS washing 3 times, ready supernatant is added among the Glutathione Sepharose 4B, 4 ℃ of rotations combinations (or room temperature combination 1h) of spending the night.Behind the centrifugal 3min, using PBS-0.25% polysorbas20 washing 2 times with 14000rpm under 4 ℃, PBS washs once.Glutathione Sepharose 4B after combining adds appearance buffer on 20ul 5 * protein, boils 5min, the centrifugal 30s of 14000rpm.
3. handle deposition
In deposition, add the resuspended thalline of 500 μ L lysis buffer, get the resuspended bacterium liquid of 80uL and add appearance buffer on 20 μ L5 * protein, boil 5min, the centrifugal 30s of 14000rpm.
4.SDS-PAGE electrophoresis pours into 5% concentrated glue in the glue version, at adding zero(ppm) water glue is flattened, room temperature is placed 30min solidifies it, and the zero(ppm) water on upper strata is done, and pours into 12% separation gel again, plugs comb immediately, and it is subsequent use that room temperature placement 30min solidifies it.
5. the last cleer and peaceful precipitation that will handle well is not got appearance on the 10 μ L, carries out the SDS-PAGE electrophoresis.The voltage 80v of elder generation electrophoresis 30min transfers to 180v, behind electrophoresis 1 ~ 2h again; Glue is taken out, places coomassie brilliant blue staining liquid vibration dyeing, place destainer vibration decolouring again after; Observations under the imaging system, the result is shown in Fig. 3, and PGEX-6P-2-isdB2/XL-1blue only just can give expression to the IsdB2 that contains the GST label that the molecular weight size is about 95kDa under 18 ℃, 16 ℃, 12 ℃ conditions; And recombinant protein is all in the supernatant of ultrasonic degradation; Therefore said recombinant protein is a soluble proteins, and the expression amount of 16 ℃ of following target proteins is the highest, and its purity reaches more than 95%.
The antigenic preparation of embodiment 3:IsdB2
1. amplification culture is obtained albumen
Go bail for and exist subsequent use pGEX-6P-2-isdB2/XL-1blue bacterium liquid 400 μ L in 4 ℃ of refrigerators to join 20mL to contain in the TB substratum of Amp resistance and carry out an activation; Behind 37 ℃ of cultivations of 200rpm, 5 ~ 6h; Getting an activatory bacterium of 8mL liquid joins 400mL and contains in the TB substratum of Amp resistance and carry out re-activation; 37 ℃ are cultivated 3 ~ 4h to OD600 is 0.8 o'clock; Add after 80 Μ l IPTG (final concentration is 200uM) place 16 ℃ of shaking tables to spend the night to induce, the centrifugal 15min of 6000rpm collects thalline, add the resuspended thalline of 20mL lysis buffer again after; Bacterium liquid is carried out ultrasonic degradation 3min (200V), collect supernatant and be used to combine the Glutathione Sepharose 4B gel beads (beads) of gst fusion protein to combine to handle with 800 μ L; Carry out the SDS-PAGE gel electrophoresis again, the result is shown in Fig. 4, and visible target protein in an embodiment obtains a large amount of expression.
Lysate lysis buffer prescription: Leupeptin 2ul, PepstatinA 10ul, Pepstetin A1.6ul, PmSF 100ul, 10%Triton 1ml and PBS 10ml mix.
2. use the enzyme blanking method, target protein and GST label are separated, obtain the IsdB2 target protein
In the protein-bonded Glutathione Sepharose of the about 800 μ L of remainder 4B, add 800 μ L PBS and 120 μ L PreScission protease (PP enzyme), after the vertical gyrase of room temperature is cut 5h, behind the centrifugal absorption supernatant; Respectively with 800 μ L PBS washing 3 times; After getting 10 μ L sample denaturing treatment after each, last appearance 5 μ L carry out protein electrophoresis (method is the same), are being observations under the phase system; The gst fusion protein molecular weight was about 96kDa before enzyme was cut; The IsdB2 molecular weight of albumen that enzyme scales off is consistent with expection molecular weight of albumen size about 70kDa, and electrophoresis result is shown in Fig. 5; Before wherein swimming lane 1 expressed enzyme is cut, contain the fusion rotein of GST label; After swimming lane 2 expressed enzymes are cut, because target protein separates the target protein that therefore obtains at supernatant with the GST label of gel beads with combination; After swimming lane 3 expressed enzymes are cut, wash the target protein of non-specific binding on beads that Glutathione Sepharose 4B gel beads (beads) is obtained for the first time; After swimming lane 4 expressed enzymes are cut, wash the target protein of non-specific binding on beads that beads obtains for the second time; After swimming lane 5 expressed enzymes were cut, non-specific binding was combined in enzyme and GST label on the beads at target protein on the beads and specificity.
3.Lowry method is measured protein content, maximum concentration is 4.039mg/mL.
Embodiment 4: infect the foundation with staphylococcus aureus strains (international standard strain MRSA-252) standard quantitative curve
Place 37 ℃ to hatch 24 hours in the MH flat board inoculation; Picking list bacterium colony is inoculated in the MH liquid nutrient medium on flat board, places 37 ℃ of constant temperature shaking table concussions to cultivate the centrifugal 10min collection of 6000rpm thalline after 6 hours, washs thalline 2 times with saline water; Again bacterium liquid is carried out 10 times and 1.25 times of dilutions, and under the ultraviolet spectrometry system, measure the absorbancy at the 600nm place (OD600) of each bacterium liquid, and get each dilution bacterium liquid 100ul and coat the MH flat board, place 37 ℃ to hatch after 24 hours and count bacterium colony; The quantitative curve of OD600 value drawing standard according to each flat-plate bacterial colony number and bacterium liquid.
The result: the typical curve formula is Y=2.3065X+0.0051 (10
9CFU/ml), relation conefficient is 0.9999.
Embodiment 5: the structure of pyemia animal model
1. place 37 ℃ to hatch 24 hours in the MH flat board inoculation; Picking list bacterium colony is inoculated in the MH liquid nutrient medium on flat board, and place 37 ℃ of constant temperature shaking table concussions to cultivate after 6 hours and collect thalline, and utilize the typical curve formula to carry out quantitatively, be 2.0 * 10 with bacterium liquid dilution (or concentrating) again
10CFU/mL, 1.5 * 10
10CFU/mL, 1.25 * 10
10CFU/mL, 1.0 * 10
10CFU/mL different concns group is that the BALB/C mice (100 μ l/ only) of 18 ~ 20g carries out systemic infection with each group bacterium liquid through 6 ~ 8 ages in week of tail vein injection, body weight again, and the saline water control group is set simultaneously, observes also to add up in 7 days and respectively organizes mortality of mice;
2, infecting the back timing whenever adopts colony counting method that the bacteria planting amount is detected at a distance from 24 hours (to infecting back 7 days): 3 mouse of picked at random from each infected group and control group; Utilize the eyeball excise method; Get mouse blood sample 0.5 ~ 1mL, get 20 μ L blood samples and be used for bacterial count, get 50 μ L and be applied to flat board with after 10 times of the 180 μ L heparin dilutions; Place 37 ℃, counting clone number behind the 24h; Got behind the blood sample with mouse put to death put into 75% alcohol soaking disinfection after; Its four limbs are fixed in taking-up; With its dissection, take out spleen, kidney, liver, place the aseptic PBS of 2mL; In the glass homogenizer of cleaning, carry out homogenate, get the 1mL homogenate and dilute according to 1: 10,1: 100,1: 1000 ratio; Every extent of dilution is got 100 μ L and is coated gently on the solid medium, places 37 ℃, cultivates 24h, does enumeration.
The result is shown in table 1:
Confirming of table 1MRSA-252 minimum lethal dose and sublethal dose
2.0 * 10
912 hours (h) interior mouse death rates of CFU dose groups are 100%; 1.5 * 10
9Mouse death rate is 90% in the CFU dose groups 48h, and mortality ratio is 100% in the 72h; 1.25 * 10
9Mouse death rate is 80% in the CFU dose groups 48h, and mortality ratio is that mouse death rate is 90% in the 96h, and mortality ratio is that mouse death rate is 100% in the 120h; 1.0 * 10
9Mouse death rate is 10% in the CFU dose groups 48h, and mortality ratio is that mouse death rate is that 20%, 7 day (d) interior mortality ratio is that mouse death rate is 70% in the 72h; This shows that the MRSA-252 minimum lethal dose is about 1.25 * 10
9CFU, sublethal dose are 1.0 ~ 1.25 * 10
9CFU.
3.MRSA-252 the field planting amount behind the infection BALB/C mice in blood and each internal organs:
That infects bacterium in the blood of back reaches peak value when 48h, maximum field planting amount reaches 8.0 * 10
9CFU/ml, amount of bacteria begins to reduce in the blood when 72h, does not detect bacterium in the blood during to 96h; The bacterium that infects field planting in back spleen, kidney, the liver all reached peak value at 72 o'clock, maximum field planting amount all reaches 8.0 * 10
9CFU/ml; Bacteria planting detected result in the blood of control group mice, spleen, kidney, the liver is zero.
Above result has carried out the evaluation of animal model to survival rate and blood, spleen, kidney, the liver major organs bacteria planting amount of mouse, for the successful development of the single subunit vaccine of MRSA and many subunits of MRSA fusion bacterin and the Study on Pathogenesis of MRSA infection are laid a good foundation.
Embodiment 6: immune animal and detection of antibodies
1. immune animal
1) first immunisation, with PBS dilution IsdB2 proteantigen, adding concentration is the Al (OH) of 1mg/mL
3, regulate IsdB2 proteantigen final concentration to 0.4mg/mL; With No. 5 half mould syringe needles, bilateral inguinal region, vola and back are subcutaneous to an injection, and every BALB/C mice injection volume is 100uL, and positive controls, negative control group and blank group are set;
2) immunity was for the second time carried out the immunity second time on the 14th day, and immune component is the same, and injection volume proteantigen amount is 1/2 of a first immunisation, and immunization route is the same;
3) immunity was for the third time carried out immunity for the third time on the 21st day, and immune component is the same, and injection volume proteantigen amount is identical with immunity for the second time, and immunization route is the same;
2. immune for the third time back the 7th and 14 day, the blood of collection BALB/C mice, behind ELISA detection mouse immune, IgG, IgG1, IgG2
aThe humoral response level.
1) preparation liquid
1. the preparation of coating buffer: take by weighing NaHCO
31.6g, Na
2CO
32.9g, be dissolved in 1L ddH
2O transfers to 9.6 with the PH meter with pH;
2. the preparation of confining liquid: 1g Ox blood serum V is dissolved in 100mL antibody diluent (1: 100);
3. the preparation of antibody diluent: phosphoric acid salt is dissolved in 1L ddH
2O adds 500uL Tween20 again, with the PH meter pH is transferred to 7.4 again;
4. the preparation of washings: take by weighing 2.42g Tris and be dissolved in 1L ddH
2O adds 500uL Tween20 again, with the PH meter pH is transferred to 7.4 again;
5. the liquid (TMB) that develops the color is sky root Company products;
6. stop buffer (2M H
2SO
4) preparation: the 22.2mL vitriol oil is poured into 177.8mLddH
2Among the O.
2) ELISA detects the antibody titer that IsdB2 recombinant protein immune mouse produces
1. the IsdB2 recombinant protein dilution after using coating buffer with purifying is: 1ug/mL, 5ug/mL, 10ug/mL;
2. encapsulate: the recombinant protein diluent is added enzyme plate, the 200uL/ hole, 4 ℃ of backs of spending the night are with washings washing 3 times, and wrap with preservative film the empty back of doing, and places 4 ℃ of refrigerators subsequent use;
3. sealing: enzyme plate adds confining liquid 100uL/ hole, places 37 ℃ of incubators 2 hours, washs 3 times;
4. serum such as was carried out 1: 100,1: 500,1: 1000,1: 2000,1: 4000,1: 8000 at doubling dilution;
5. get the good enzyme plate of sealing, add dilute serum successively, the 100uL/ hole,, place 37 ℃ of incubator 30min, wash empty doing 3 times;
Goat anti-mouse igg, IgG1, the IgG2a antibody that 6. will add the HRP mark are preserved liquid, dilute 1: 5000, process the antibody working fluid;
7. add dilution antibody working fluid, the 100uL/ hole places 37 ℃ of incubator 1h, washs three times, empty doing;
8. add substrate colour developing liquid (TMB) 100uL/ hole, room temperature lucifuge reaction 5min;
9. add stop buffer (2M H
2SO
4), place immediately on the ELIASA and measure the OD value with the 450nm wavelength;
10. the result judges: A
Sample/ A
NegativeZhi ≧ 2.1 positive (negative control is 1: 1000 times of dilution of serum before the mouse immune).
The result: the antibody titer that detects the generation of IsdB2 proteantigen immune mouse reaches 1: 256000; The 7th day the antibody positive rate in immunity back reaches 90%, and the 7th day the antibody positive rate in immunity back reaches 95%; Explain that the IsdB subunit active segment IsdB2 recombinant protein that the present invention makes up can make generation antibody in the immune mouse body.
Embodiment 7: confirm the malicious protection of attacking of IsdB2 recombinant protein immune animal through immune mouse
With the immunization protocol of embodiment 6, behind the immune mouse, adopted lethal dose, tail vein injection MRSA-252 viable bacteria to attack the poison experiment for the third time at the 14th day, every BALB/C mice injection bacterium liquid measure is 1.25 * 10
9CFU observed 10 days, and statistics is respectively organized the survival rate of mouse.The result is shown in table 2.
Table 2
Table 2 shows: be four animal immune tests (each experiment is 15 ~ 20 mouse) result; The result shows that the average immune protective rate of positive controls, negative control group and blank group is respectively 38.71%, 14.92% and 2.98% in the table; The immune protective of the independent protein groups of IsdB active function fragment IsdB2 is 22.72%, and IsdB active fragments IsdB2 adds Al (OH)
3The average immune protective rate of adjuvant group is 62.68%.
Therefore; IsdB active fragments IsdB2 recombinant protein of the present invention has good immunogenicity; And can infect playing a protective role to MRSA-252, can induce body to produce immunne response, can for example be aided with aluminium adjuvant and prepare the infection that subunit vaccine is used to prevent streptococcus aureus.
Through above embodiment; Those skilled in the art utilize ordinary skill knowledge can obviously use the prepared recombinant protein of the present invention and other related reagents; For example encapsulate reagent, detect preparation related kits such as antibody, developer, terminator; For example detection kit is used for diagnosis and whether infects golden yellow staphylococcus, confirms prognosis etc.
Those skilled in the art can be used for other any suitable purposes with IsdB2 recombinant protein of the present invention.
The above is merely preferred embodiment of the present invention, is not to be used for limiting practical range of the present invention; If do not break away from the spirit and scope of the present invention, the present invention is made amendment or is equal to replacement, all should be encompassed in the middle of the protection domain of claim of the present invention.
Sequence table
Sequence table
< 110>Chongqing Yuanlun Biotechnology Co., Ltd., Military Medical Univ No.3, P.L.A
< 120>recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active fragment, and preparation method thereof and
Use
<130> 12P99139-CN
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 652
<212> PRT
< 213>aminoacid sequence of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 1
Met Asn Lys Gln Gln Lys Glu Phe Lys Ser Phe Tyr Ser Ile Arg Lys
1 5 10 15
Ser Ser Leu Gly Val Ala Ser Val Ala Ile Ser Thr Leu Leu Leu Leu
20 25 30
Met Ser Asn Gly Glu Ala Lys Ala Ala Glu Glu Thr Gly Val Thr Asn
35 40 45
Thr Glu Ala Gln Pro Lys Thr Glu Ala Val Ala Ser Pro Thr Thr Thr
50 55 60
Thr Thr Glu Lys Ala Pro Glu Ala Lys Pro Val Ala Lys Pro Val Ala
65 70 75 80
Asn Ala Val Ser Val Ser Asn Lys Glu Val Val Ala Pro Thr Thr Glu
85 90 95
Thr Lys Glu Ala Lys Glu Val Lys Ala Val Lys Glu Val Lys Ala Pro
100 105 110
Lys Glu Ala Lys Glu Glu Lys Pro Ala Ala Lys Ala Asp Asn Asn Thr
115 120 125
Tyr Pro Ile Leu Asn Gln Glu Leu Arg Glu Ala Ile Lys Asn Pro Ala
130 135 140
Ile Lys Asp Lys Asp His Ser Ala Pro Asn Ser Arg Pro Ile Asp Phe
145 150 155 160
Glu Met Lys Lys Lys Asp Gly Thr Gln Gln Phe Tyr His Tyr Ala Ser
165 170 175
Ser Val Lys Pro Ala Arg Val Ile Phe Thr Asp Ser Lys Pro Glu Ile
180 185 190
Glu Leu Gly Leu Gln Ser Gly Gln Phe Trp Arg Lys Phe Glu Val Tyr
195 200 205
Glu Gly Asp Lys Lys Leu Pro Ile Lys Leu Val Ser Tyr Asp Thr Val
210 215 220
Lys Asp Tyr Ala Tyr Ile Arg Phe Ser Val Ser Asn Gly Thr Lys Ala
225 230 235 240
Val Lys Ile Val Ser Ser Thr His Phe Asn Asn Lys Glu Glu Lys Tyr
245 250 255
Asp Tyr Thr Leu Met Glu Phe Ala Gln Pro Ile Tyr Asn Ser Ala Asp
260 265 270
Lys Phe Lys Thr Glu Glu Asp Tyr Lys Ala Glu Lys Leu Leu Ala Pro
275 280 285
Tyr Lys Lys Ala Lys Thr Leu Glu Arg Gln Val Tyr Glu Leu Asn Lys
290 295 300
Ile Gln Asp Lys Leu Pro Glu Lys Leu Lys Ala Glu Tyr Lys Lys Lys
305 310 315 320
Leu Glu Glu Thr Lys Lys Ala Leu Asp Glu Gln Val Lys Ser Ala Ile
325 330 335
Thr Glu Phe Gln Asn Val Gln Pro Thr Asn Glu Lys Met Thr Asp Leu
340 345 350
Gln Asp Thr Lys Tyr Val Val Tyr Glu Ser Val Glu Asn Asn Glu Ser
355 360 365
Met Met Asp Ala Phe Val Lys His Pro Ile Lys Thr Gly Met Leu Asn
370 375 380
Gly Lys Lys Tyr Met Val Met Glu Thr Thr Asn Asp Asp Tyr Trp Lys
385 390 395 400
Asp Phe Met Val Glu Gly Gln Arg Val Arg Thr Ile Ser Lys Asp Ala
405 410 415
Lys Asn Asn Thr Arg Thr Ile Ile Phe Pro Tyr Val Glu Gly Lys Thr
420 425 430
Leu Tyr Asp Ala Ile Val Lys Val His Val Lys Thr Ile Asp Tyr Asp
435 440 445
Gly Gln Tyr His Val Arg Ile Val Asp Lys Glu Ala Phe Thr Lys Ala
450 455 460
Asn Ala Asp Lys Thr Asn Lys Lys Glu Gln Gln Asp Asn Ser Ala Lys
465 470 475 480
Lys Glu Thr Thr Pro Ala Met Pro Ser Lys Pro Thr Thr Pro Pro Val
485 490 495
Glu Lys Glu Ser Gln Lys Gln Asp Ser Gln Lys Asp Asp Asn Lys Gln
500 505 510
Ser Pro Ser Val Glu Lys Glu Asn Asp Ala Ser Ser Glu Ser Gly Lys
515 520 525
Asp Lys Met Pro Val Thr Lys Pro Ala Lys Ala Glu Val Glu Ser Ser
530 535 540
Ser Thr Thr Pro Thr Lys Val Val Ser Thr Thr Gln Asn Val Ala Lys
545 550 555 560
Pro Thr Thr Ala Ser Ser Glu Thr Thr Lys Asp Val Val Gln Thr Ser
565 570 575
Ala Gly Ser Ser Glu Ala Lys Asp Ser Ala Pro Leu Gln Lys Ala Asn
580 585 590
Ile Lys Asn Thr Asn Asp Gly His Thr Gln Ser Gln Asn Asn Lys Asn
595 600 605
Thr Gln Glu Asn Lys Ala Lys Ser Leu Pro Gln Thr Gly Glu Glu Ser
610 615 620
Asn Lys Asp Met Thr Leu Pro Leu Met Ala Leu Ile Ala Leu Ser Ser
625 630 635 640
Ile Val Ala Phe Val Leu Pro Arg Lys Arg Lys Asn
645 650
<210> 2
<211> 1959
<212> DNA
< 213>nucleotide sequence of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 2
atgaacaaac agcaaaaaga atttaaatca ttttattcaa ttagaaagtc atcactaggc 60
gttgcatctg tagcgattag tacactttta ttattaatgt ccaatggcga agcaaaagca 120
gctgaagaaa caggtgttac aaatacagaa gcacaaccaa aaactgaagc agttgcaagt 180
ccaacaacaa caacaactga aaaagctcca gaagctaaac cagtagctaa accagtagct 240
aatgctgtct cagtatctaa taaagaagtt gtggccccta ctactgaaac aaaagaagct 300
aaagaagtta aagcagttaa agaagttaaa gcccctaagg aagcaaaaga ggaaaaacct 360
gcagcaaaag ctgacaacaa tacatatcct attttgaatc aggaactaag agaagcgatt 420
aaaaaccctg caataaaaga caaagatcat agcgcaccaa actctcgtcc aattgatttt 480
gaaatgaaaa agaaagatgg cactcaacag ttttatcatt atgcaagttc tgttaaacct 540
gctagagtta ttttcactga ttcaaaacca gaaattgaat taggattaca atcagggcaa 600
ttttggagaa aatttgaagt ttatgaaggt gacaaaaagt tgccaattaa attagtatca 660
tacgatactg ttaaagatta tgcttacatt cgcttctctg tttcaaatgg aacaaaagca 720
gttaaaatcg taagttcaac tcacttcaat aacaaagaag aaaaatacga ttacacatta 780
atggaattcg cacaaccaat ttataacagt gcagataaat tcaaaactga agaagattat 840
aaagctgaaa aattattagc gccatataaa aaagcgaaaa cactagaaag acaagtttat 900
gaattaaata aaattcaaga taaacttcct gaaaaattga aagctgaata caagaagaaa 960
ttagaagaga cgaaaaaagc tttagatgaa caagtgaaat ccgcgataac tgaattccaa 1020
aatgtacaac caacaaatga aaaaatgacc gatttacaag atacaaaata tgttgtttat 1080
gaaagtgttg agaataacga atctatgatg gatgcttttg ttaaacaccc tattaaaaca 1140
ggtatgctta atggcaaaaa atatatggta atggaaacta ctaatgacga ttactggaaa 1200
gatttcatgg ttgaaggtca acgtgttaga acaattagca aagatgctaa aaataacact 1260
agaacgatta tcttcccata tgttgaaggt aaaactctat atgatgctat cgttaaagtt 1320
cacgtaaaaa cgattgatta tgatggacaa taccatgtca gaatcgttga taaagaagca 1380
tttactaaag ccaatgccga taaaactaat aaaaaggaac aacaagacaa ctcagctaag 1440
aaggaaacta ctccagctat gcctagcaaa ccaacaacac cacctgttga aaaagaatca 1500
caaaaacaag acagccaaaa agatgacaat aaacaatcac caagtgttga aaaagaaaat 1560
gacgcatcta gtgagtcagg taaagacaaa atgcctgtta caaaaccagc taaagctgaa 1620
gtagaatcaa gtagtacaac tccaactaag gtagtatcta cgactcaaaa tgttgcaaaa 1680
ccaacaactg cttcttcaga aacaacaaaa gatgttgttc aaacttcagc aggttctagc 1740
gaagcaaaag atagtgctcc attacaaaaa gcaaacatta aaaacacaaa tgatggacac 1800
actcaaagcc aaaataataa aaatacacaa gaaaataaag ctaaatcatt accacaaact 1860
ggtgaagaat ctaataaaga tatgacatta ccattaatgg cattaatagc tttaagtagt 1920
atcgttgcat tcgtattacc tagaaaacgt aaaaactaa 1959
<210> 3
<211> 595
<212> PRT
< 213>aminoacid sequence of the active fragments IsdB2 recombinant protein of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 3
Asn Gly Glu Ala Lys Ala Ala Glu Glu Thr Gly Val Thr Asn Thr Glu
1 5 10 15
Ala Gln Pro Lys Thr Glu Ala Val Ala Ser Pro Thr Thr Thr Thr Thr
20 25 30
Glu Lys Ala Pro Glu Ala Lys Pro Val Ala Lys Pro Val Ala Asn Ala
35 40 45
Val Ser Val Ser Asn Lys Glu Val Val Ala Pro Thr Thr Glu Thr Lys
50 55 60
Glu Ala Lys Glu Val Lys Ala Val Lys Glu Val Lys Ala Pro Lys Glu
65 70 75 80
Ala Lys Glu Glu Lys Pro Ala Ala Lys Ala Asp Asn Asn Thr Tyr Pro
85 90 95
Ile Leu Asn Gln Glu Leu Arg Glu Ala Ile Lys Asn Pro Ala Ile Lys
100 105 110
Asp Lys Asp His Ser Ala Pro Asn Ser Arg Pro Ile Asp Phe Glu Met
115 120 125
Lys Lys Lys Asp Gly Thr Gln Gln Phe Tyr His Tyr Ala Ser Ser Val
130 135 140
Lys Pro Ala Arg Val Ile Phe Thr Asp Ser Lys Pro Glu Ile Glu Leu
145 150 155 160
Gly Leu Gln Ser Gly Gln Phe Trp Arg Lys Phe Glu Val Tyr Glu Gly
165 170 175
Asp Lys Lys Leu Pro Ile Lys Leu Val Ser Tyr Asp Thr Val Lys Asp
180 185 190
Tyr Ala Tyr Ile Arg Phe Ser Val Ser Asn Gly Thr Lys Ala Val Lys
195 200 205
Ile Val Ser Ser Thr His Phe Asn Asn Lys Glu Glu Lys Tyr Asp Tyr
210 215 220
Thr Leu Met Glu Phe Ala Gln Pro Ile Tyr Asn Ser Ala Asp Lys Phe
225 230 235 240
Lys Thr Glu Glu Asp Tyr Lys Ala Glu Lys Leu Leu Ala Pro Tyr Lys
245 250 255
Lys Ala Lys Thr Leu Glu Arg Gln Val Tyr Glu Leu Asn Lys Ile Gln
260 265 270
Asp Lys Leu Pro Glu Lys Leu Lys Ala Glu Tyr Lys Lys Lys Leu Glu
275 280 285
Glu Thr Lys Lys Ala Leu Asp Glu Gln Val Lys Ser Ala Ile Thr Glu
290 295 300
Phe Gln Asn Val Gln Pro Thr Asn Glu Lys Met Thr Asp Leu Gln Asp
305 310 315 320
Thr Lys Tyr Val Val Tyr Glu Ser Val Glu Asn Asn Glu Ser Met Met
325 330 335
Asp Ala Phe Val Lys His Pro Ile Lys Thr Gly Met Leu Asn Gly Lys
340 345 350
Lys Tyr Met Val Met Glu Thr Thr Asn Asp Asp Tyr Trp Lys Asp Phe
355 360 365
Met Val Glu Gly Gln Arg Val Arg Thr Ile Ser Lys Asp Ala Lys Asn
370 375 380
Asn Thr Arg Thr Ile Ile Phe Pro Tyr Val Glu Gly Lys Thr Leu Tyr
385 390 395 400
Asp Ala Ile Val Lys Val His Val Lys Thr Ile Asp Tyr Asp Gly Gln
405 410 415
Tyr His Val Arg Ile Val Asp Lys Glu Ala Phe Thr Lys Ala Asn Ala
420 425 430
Asp Lys Thr Asn Lys Lys Glu Gln Gln Asp Asn Ser Ala Lys Lys Glu
435 440 445
Thr Thr Pro Ala Met Pro Ser Lys Pro Thr Thr Pro Pro Val Glu Lys
450 455 460
Glu Ser Gln Lys Gln Asp Ser Gln Lys Asp Asp Asn Lys Gln Ser Pro
465 470 475 480
Ser Val Glu Lys Glu Asn Asp Ala Ser Ser Glu Ser Gly Lys Asp Lys
485 490 495
Met Pro Val Thr Lys Pro Ala Lys Ala Glu Val Glu Ser Ser Ser Thr
500 505 510
Thr Pro Thr Lys Val Val Ser Thr Thr Gln Asn Val Ala Lys Pro Thr
515 520 525
Thr Ala Ser Ser Glu Thr Thr Lys Asp Val Val Gln Thr Ser Ala Gly
530 535 540
Ser Ser Glu Ala Lys Asp Ser Ala Pro Leu Gln Lys Ala Asn Ile Lys
545 550 555 560
Asn Thr Asn Asp Gly His Thr Gln Ser Gln Asn Asn Lys Asn Thr Gln
565 570 575
Glu Asn Lys Ala Lys Ser Leu Pro Gln Thr Gly Glu Glu Ser Asn Lys
580 585 590
Asp Met Thr
595
<210> 4
<211> 1785
<212> DNA
< 213>nucleotide sequence of the active fragments IsdB2 recombinant protein of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 4
aatggcgaag caaaagcagc tgaagaaaca ggtgttacaa atacagaagc acaaccaaaa 60
actgaagcag ttgcaagtcc aacaacaaca acaactgaaa aagctccaga agctaaacca 120
gtagctaaac cagtagctaa tgctgtctca gtatctaata aagaagttgt ggcccctact 180
actgaaacaa aagaagctaa agaagttaaa gcagttaaag aagttaaagc ccctaaggaa 240
gcaaaagagg aaaaacctgc agcaaaagct gacaacaata catatcctat tttgaatcag 300
gaactaagag aagcgattaa aaaccctgca ataaaagaca aagatcatag cgcaccaaac 360
tctcgtccaa ttgattttga aatgaaaaag aaagatggca ctcaacagtt ttatcattat 420
gcaagttctg ttaaacctgc tagagttatt ttcactgatt caaaaccaga aattgaatta 480
ggattacaat cagggcaatt ttggagaaaa tttgaagttt atgaaggtga caaaaagttg 540
ccaattaaat tagtatcata cgatactgtt aaagattatg cttacattcg cttctctgtt 600
tcaaatggaa caaaagcagt taaaatcgta agttcaactc acttcaataa caaagaagaa 660
aaatacgatt acacattaat ggaattcgca caaccaattt ataacagtgc agataaattc 720
aaaactgaag aagattataa agctgaaaaa ttattagcgc catataaaaa agcgaaaaca 780
ctagaaagac aagtttatga attaaataaa attcaagata aacttcctga aaaattgaaa 840
gctgaataca agaagaaatt agaagagacg aaaaaagctt tagatgaaca agtgaaatcc 900
gcgataactg aattccaaaa tgtacaacca acaaatgaaa aaatgaccga tttacaagat 960
acaaaatatg ttgtttatga aagtgttgag aataacgaat ctatgatgga tgcttttgtt 1020
aaacacccta ttaaaacagg tatgcttaat ggcaaaaaat atatggtaat ggaaactact 1080
aatgacgatt actggaaaga tttcatggtt gaaggtcaac gtgttagaac aattagcaaa 1140
gatgctaaaa ataacactag aacgattatc ttcccatatg ttgaaggtaa aactctatat 1200
gatgctatcg ttaaagttca cgtaaaaacg attgattatg atggacaata ccatgtcaga 1260
atcgttgata aagaagcatt tactaaagcc aatgccgata aaactaataa aaaggaacaa 1320
caagacaact cagctaagaa ggaaactact ccagctatgc ctagcaaacc aacaacacca 1380
cctgttgaaa aagaatcaca aaaacaagac agccaaaaag atgacaataa acaatcacca 1440
agtgttgaaa aagaaaatga cgcatctagt gagtcaggta aagacaaaat gcctgttaca 1500
aaaccagcta aagctgaagt agaatcaagt agtacaactc caactaaggt agtatctacg 1560
actcaaaatg ttgcaaaacc aacaactgct tcttcagaaa caacaaaaga tgttgttcaa 1620
acttcagcag gttctagcga agcaaaagat agtgctccat tacaaaaagc aaacattaaa 1680
aacacaaatg atggacacac tcaaagccaa aataataaaa atacacaaga aaataaagct 1740
aaatcattac cacaaactgg tgaagaatct aataaagata tgaca 1785
<210> 5
<211> 32
<212> DNA
< 213>forward primer of the gene order of amplification IsdB2 recombinant protein
<400> 5
cgcggatcca tgaatggcga agcaaaagca gc 32
<210> 6
<211> 45
<212> DNA
< 213>reverse primer of the gene order of amplification IsdB2 recombinant protein
<400> 6
ttttcctttt gcggccgcct atgtcatatc tttattagat tcttc 45
Sequence table
< 110>Chongqing Yuanlun Biotechnology Co., Ltd., Military Medical Univ No.3, P.L.A
< 120>recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active fragment, and preparation method thereof and
Use
<130> 12P99139-CN
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 652
<212> PRT
< 213>aminoacid sequence of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 1
Met Asn Lys Gln Gln Lys Glu Phe Lys Ser Phe Tyr Ser Ile Arg Lys
1 5 10 15
Ser Ser Leu Gly Val Ala Ser Val Ala Ile Ser Thr Leu Leu Leu Leu
20 25 30
Met Ser Asn Gly Glu Ala Lys Ala Ala Glu Glu Thr Gly Val Thr Asn
35 40 45
Thr Glu Ala Gln Pro Lys Thr Glu Ala Val Ala Ser Pro Thr Thr Thr
50 55 60
Thr Thr Glu Lys Ala Pro Glu Ala Lys Pro Val Ala Lys Pro Val Ala
65 70 75 80
Asn Ala Val Ser Val Ser Asn Lys Glu Val Val Ala Pro Thr Thr Glu
85 90 95
Thr Lys Glu Ala Lys Glu Val Lys Ala Val Lys Glu Val Lys Ala Pro
100 105 110
Lys Glu Ala Lys Glu Glu Lys Pro Ala Ala Lys Ala Asp Asn Asn Thr
115 120 125
Tyr Pro Ile Leu Asn Gln Glu Leu Arg Glu Ala Ile Lys Asn Pro Ala
130 135 140
Ile Lys Asp Lys Asp His Ser Ala Pro Asn Ser Arg Pro Ile Asp Phe
145 150 155 160
Glu Met Lys Lys Lys Asp Gly Thr Gln Gln Phe Tyr His Tyr Ala Ser
165 170 175
Ser Val Lys Pro Ala Arg Val Ile Phe Thr Asp Ser Lys Pro Glu Ile
180 185 190
Glu Leu Gly Leu Gln Ser Gly Gln Phe Trp Arg Lys Phe Glu Val Tyr
195 200 205
Glu Gly Asp Lys Lys Leu Pro Ile Lys Leu Val Ser Tyr Asp Thr Val
210 215 220
Lys Asp Tyr Ala Tyr Ile Arg Phe Ser Val Ser Asn Gly Thr Lys Ala
225 230 235 240
Val Lys Ile Val Ser Ser Thr His Phe Asn Asn Lys Glu Glu Lys Tyr
245 250 255
Asp Tyr Thr Leu Met Glu Phe Ala Gln Pro Ile Tyr Asn Ser Ala Asp
260 265 270
Lys Phe Lys Thr Glu Glu Asp Tyr Lys Ala Glu Lys Leu Leu Ala Pro
275 280 285
Tyr Lys Lys Ala Lys Thr Leu Glu Arg Gln Val Tyr Glu Leu Asn Lys
290 295 300
Ile Gln Asp Lys Leu Pro Glu Lys Leu Lys Ala Glu Tyr Lys Lys Lys
305 310 315 320
Leu Glu Glu Thr Lys Lys Ala Leu Asp Glu Gln Val Lys Ser Ala Ile
325 330 335
Thr Glu Phe Gln Asn Val Gln Pro Thr Asn Glu Lys Met Thr Asp Leu
340 345 350
Gln Asp Thr Lys Tyr Val Val Tyr Glu Ser Val Glu Asn Asn Glu Ser
355 360 365
Met Met Asp Ala Phe Val Lys His Pro Ile Lys Thr Gly Met Leu Asn
370 375 380
Gly Lys Lys Tyr Met Val Met Glu Thr Thr Asn Asp Asp Tyr Trp Lys
385 390 395 400
Asp Phe Met Val Glu Gly Gln Arg Val Arg Thr Ile Ser Lys Asp Ala
405 410 415
Lys Asn Asn Thr Arg Thr Ile Ile Phe Pro Tyr Val Glu Gly Lys Thr
420 425 430
Leu Tyr Asp Ala Ile Val Lys Val His Val Lys Thr Ile Asp Tyr Asp
435 440 445
Gly Gln Tyr His Val Arg Ile Val Asp Lys Glu Ala Phe Thr Lys Ala
450 455 460
Asn Ala Asp Lys Thr Asn Lys Lys Glu Gln Gln Asp Asn Ser Ala Lys
465 470 475 480
Lys Glu Thr Thr Pro Ala Met Pro Ser Lys Pro Thr Thr Pro Pro Val
485 490 495
Glu Lys Glu Ser Gln Lys Gln Asp Ser Gln Lys Asp Asp Asn Lys Gln
500 505 510
Ser Pro Ser Val Glu Lys Glu Asn Asp Ala Ser Ser Glu Ser Gly Lys
515 520 525
Asp Lys Met Pro Val Thr Lys Pro Ala Lys Ala Glu Val Glu Ser Ser
530 535 540
Ser Thr Thr Pro Thr Lys Val Val Ser Thr Thr Gln Asn Val Ala Lys
545 550 555 560
Pro Thr Thr Ala Ser Ser Glu Thr Thr Lys Asp Val Val Gln Thr Ser
565 570 575
Ala Gly Ser Ser Glu Ala Lys Asp Ser Ala Pro Leu Gln Lys Ala Asn
580 585 590
Ile Lys Asn Thr Asn Asp Gly His Thr Gln Ser Gln Asn Asn Lys Asn
595 600 605
Thr Gln Glu Asn Lys Ala Lys Ser Leu Pro Gln Thr Gly Glu Glu Ser
610 615 620
Asn Lys Asp Met Thr Leu Pro Leu Met Ala Leu Ile Ala Leu Ser Ser
625 630 635 640
Ile Val Ala Phe Val Leu Pro Arg Lys Arg Lys Asn
645 650
<210> 2
<211> 1959
<212> DNA
< 213>nucleotide sequence of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 2
atgaacaaac agcaaaaaga atttaaatca ttttattcaa ttagaaagtc atcactaggc 60
gttgcatctg tagcgattag tacactttta ttattaatgt ccaatggcga agcaaaagca 120
gctgaagaaa caggtgttac aaatacagaa gcacaaccaa aaactgaagc agttgcaagt 180
ccaacaacaa caacaactga aaaagctcca gaagctaaac cagtagctaa accagtagct 240
aatgctgtct cagtatctaa taaagaagtt gtggccccta ctactgaaac aaaagaagct 300
aaagaagtta aagcagttaa agaagttaaa gcccctaagg aagcaaaaga ggaaaaacct 360
gcagcaaaag ctgacaacaa tacatatcct attttgaatc aggaactaag agaagcgatt 420
aaaaaccctg caataaaaga caaagatcat agcgcaccaa actctcgtcc aattgatttt 480
gaaatgaaaa agaaagatgg cactcaacag ttttatcatt atgcaagttc tgttaaacct 540
gctagagtta ttttcactga ttcaaaacca gaaattgaat taggattaca atcagggcaa 600
ttttggagaa aatttgaagt ttatgaaggt gacaaaaagt tgccaattaa attagtatca 660
tacgatactg ttaaagatta tgcttacatt cgcttctctg tttcaaatgg aacaaaagca 720
gttaaaatcg taagttcaac tcacttcaat aacaaagaag aaaaatacga ttacacatta 780
atggaattcg cacaaccaat ttataacagt gcagataaat tcaaaactga agaagattat 840
aaagctgaaa aattattagc gccatataaa aaagcgaaaa cactagaaag acaagtttat 900
gaattaaata aaattcaaga taaacttcct gaaaaattga aagctgaata caagaagaaa 960
ttagaagaga cgaaaaaagc tttagatgaa caagtgaaat ccgcgataac tgaattccaa 1020
aatgtacaac caacaaatga aaaaatgacc gatttacaag atacaaaata tgttgtttat 1080
gaaagtgttg agaataacga atctatgatg gatgcttttg ttaaacaccc tattaaaaca 1140
ggtatgctta atggcaaaaa atatatggta atggaaacta ctaatgacga ttactggaaa 1200
gatttcatgg ttgaaggtca acgtgttaga acaattagca aagatgctaa aaataacact 1260
agaacgatta tcttcccata tgttgaaggt aaaactctat atgatgctat cgttaaagtt 1320
cacgtaaaaa cgattgatta tgatggacaa taccatgtca gaatcgttga taaagaagca 1380
tttactaaag ccaatgccga taaaactaat aaaaaggaac aacaagacaa ctcagctaag 1440
aaggaaacta ctccagctat gcctagcaaa ccaacaacac cacctgttga aaaagaatca 1500
caaaaacaag acagccaaaa agatgacaat aaacaatcac caagtgttga aaaagaaaat 1560
gacgcatcta gtgagtcagg taaagacaaa atgcctgtta caaaaccagc taaagctgaa 1620
gtagaatcaa gtagtacaac tccaactaag gtagtatcta cgactcaaaa tgttgcaaaa 1680
ccaacaactg cttcttcaga aacaacaaaa gatgttgttc aaacttcagc aggttctagc 1740
gaagcaaaag atagtgctcc attacaaaaa gcaaacatta aaaacacaaa tgatggacac 1800
actcaaagcc aaaataataa aaatacacaa gaaaataaag ctaaatcatt accacaaact 1860
ggtgaagaat ctaataaaga tatgacatta ccattaatgg cattaatagc tttaagtagt 1920
atcgttgcat tcgtattacc tagaaaacgt aaaaactaa 1959
<210> 3
<211> 595
<212> PRT
< 213>aminoacid sequence of the active fragments IsdB2 recombinant protein of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 3
Asn Gly Glu Ala Lys Ala Ala Glu Glu Thr Gly Val Thr Asn Thr Glu
1 5 10 15
Ala Gln Pro Lys Thr Glu Ala Val Ala Ser Pro Thr Thr Thr Thr Thr
20 25 30
Glu Lys Ala Pro Glu Ala Lys Pro Val Ala Lys Pro Val Ala Asn Ala
35 40 45
Val Ser Val Ser Asn Lys Glu Val Val Ala Pro Thr Thr Glu Thr Lys
50 55 60
Glu Ala Lys Glu Val Lys Ala Val Lys Glu Val Lys Ala Pro Lys Glu
65 70 75 80
Ala Lys Glu Glu Lys Pro Ala Ala Lys Ala Asp Asn Asn Thr Tyr Pro
85 90 95
Ile Leu Asn Gln Glu Leu Arg Glu Ala Ile Lys Asn Pro Ala Ile Lys
100 105 110
Asp Lys Asp His Ser Ala Pro Asn Ser Arg Pro Ile Asp Phe Glu Met
115 120 125
Lys Lys Lys Asp Gly Thr Gln Gln Phe Tyr His Tyr Ala Ser Ser Val
130 135 140
Lys Pro Ala Arg Val Ile Phe Thr Asp Ser Lys Pro Glu Ile Glu Leu
145 150 155 160
Gly Leu Gln Ser Gly Gln Phe Trp Arg Lys Phe Glu Val Tyr Glu Gly
165 170 175
Asp Lys Lys Leu Pro Ile Lys Leu Val Ser Tyr Asp Thr Val Lys Asp
180 185 190
Tyr Ala Tyr Ile Arg Phe Ser Val Ser Asn Gly Thr Lys Ala Val Lys
195 200 205
Ile Val Ser Ser Thr His Phe Asn Asn Lys Glu Glu Lys Tyr Asp Tyr
210 215 220
Thr Leu Met Glu Phe Ala Gln Pro Ile Tyr Asn Ser Ala Asp Lys Phe
225 230 235 240
Lys Thr Glu Glu Asp Tyr Lys Ala Glu Lys Leu Leu Ala Pro Tyr Lys
245 250 255
Lys Ala Lys Thr Leu Glu Arg Gln Val Tyr Glu Leu Asn Lys Ile Gln
260 265 270
Asp Lys Leu Pro Glu Lys Leu Lys Ala Glu Tyr Lys Lys Lys Leu Glu
275 280 285
Glu Thr Lys Lys Ala Leu Asp Glu Gln Val Lys Ser Ala Ile Thr Glu
290 295 300
Phe Gln Asn Val Gln Pro Thr Asn Glu Lys Met Thr Asp Leu Gln Asp
305 310 315 320
Thr Lys Tyr Val Val Tyr Glu Ser Val Glu Asn Asn Glu Ser Met Met
325 330 335
Asp Ala Phe Val Lys His Pro Ile Lys Thr Gly Met Leu Asn Gly Lys
340 345 350
Lys Tyr Met Val Met Glu Thr Thr Asn Asp Asp Tyr Trp Lys Asp Phe
355 360 365
Met Val Glu Gly Gln Arg Val Arg Thr Ile Ser Lys Asp Ala Lys Asn
370 375 380
Asn Thr Arg Thr Ile Ile Phe Pro Tyr Val Glu Gly Lys Thr Leu Tyr
385 390 395 400
Asp Ala Ile Val Lys Val His Val Lys Thr Ile Asp Tyr Asp Gly Gln
405 410 415
Tyr His Val Arg Ile Val Asp Lys Glu Ala Phe Thr Lys Ala Asn Ala
420 425 430
Asp Lys Thr Asn Lys Lys Glu Gln Gln Asp Asn Ser Ala Lys Lys Glu
435 440 445
Thr Thr Pro Ala Met Pro Ser Lys Pro Thr Thr Pro Pro Val Glu Lys
450 455 460
Glu Ser Gln Lys Gln Asp Ser Gln Lys Asp Asp Asn Lys Gln Ser Pro
465 470 475 480
Ser Val Glu Lys Glu Asn Asp Ala Ser Ser Glu Ser Gly Lys Asp Lys
485 490 495
Met Pro Val Thr Lys Pro Ala Lys Ala Glu Val Glu Ser Ser Ser Thr
500 505 510
Thr Pro Thr Lys Val Val Ser Thr Thr Gln Asn Val Ala Lys Pro Thr
515 520 525
Thr Ala Ser Ser Glu Thr Thr Lys Asp Val Val Gln Thr Ser Ala Gly
530 535 540
Ser Ser Glu Ala Lys Asp Ser Ala Pro Leu Gln Lys Ala Asn Ile Lys
545 550 555 560
Asn Thr Asn Asp Gly His Thr Gln Ser Gln Asn Asn Lys Asn Thr Gln
565 570 575
Glu Asn Lys Ala Lys Ser Leu Pro Gln Thr Gly Glu Glu Ser Asn Lys
580 585 590
Asp Met Thr
595
<210> 4
<211> 1785
<212> DNA
< 213>nucleotide sequence of the active fragments IsdB2 recombinant protein of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB
<400> 4
aatggcgaag caaaagcagc tgaagaaaca ggtgttacaa atacagaagc acaaccaaaa 60
actgaagcag ttgcaagtcc aacaacaaca acaactgaaa aagctccaga agctaaacca 120
gtagctaaac cagtagctaa tgctgtctca gtatctaata aagaagttgt ggcccctact 180
actgaaacaa aagaagctaa agaagttaaa gcagttaaag aagttaaagc ccctaaggaa 240
gcaaaagagg aaaaacctgc agcaaaagct gacaacaata catatcctat tttgaatcag 300
gaactaagag aagcgattaa aaaccctgca ataaaagaca aagatcatag cgcaccaaac 360
tctcgtccaa ttgattttga aatgaaaaag aaagatggca ctcaacagtt ttatcattat 420
gcaagttctg ttaaacctgc tagagttatt ttcactgatt caaaaccaga aattgaatta 480
ggattacaat cagggcaatt ttggagaaaa tttgaagttt atgaaggtga caaaaagttg 540
ccaattaaat tagtatcata cgatactgtt aaagattatg cttacattcg cttctctgtt 600
tcaaatggaa caaaagcagt taaaatcgta agttcaactc acttcaataa caaagaagaa 660
aaatacgatt acacattaat ggaattcgca caaccaattt ataacagtgc agataaattc 720
aaaactgaag aagattataa agctgaaaaa ttattagcgc catataaaaa agcgaaaaca 780
ctagaaagac aagtttatga attaaataaa attcaagata aacttcctga aaaattgaaa 840
gctgaataca agaagaaatt agaagagacg aaaaaagctt tagatgaaca agtgaaatcc 900
gcgataactg aattccaaaa tgtacaacca acaaatgaaa aaatgaccga tttacaagat 960
acaaaatatg ttgtttatga aagtgttgag aataacgaat ctatgatgga tgcttttgtt 1020
aaacacccta ttaaaacagg tatgcttaat ggcaaaaaat atatggtaat ggaaactact 1080
aatgacgatt actggaaaga tttcatggtt gaaggtcaac gtgttagaac aattagcaaa 1140
gatgctaaaa ataacactag aacgattatc ttcccatatg ttgaaggtaa aactctatat 1200
gatgctatcg ttaaagttca cgtaaaaacg attgattatg atggacaata ccatgtcaga 1260
atcgttgata aagaagcatt tactaaagcc aatgccgata aaactaataa aaaggaacaa 1320
caagacaact cagctaagaa ggaaactact ccagctatgc ctagcaaacc aacaacacca 1380
cctgttgaaa aagaatcaca aaaacaagac agccaaaaag atgacaataa acaatcacca 1440
agtgttgaaa aagaaaatga cgcatctagt gagtcaggta aagacaaaat gcctgttaca 1500
aaaccagcta aagctgaagt agaatcaagt agtacaactc caactaaggt agtatctacg 1560
actcaaaatg ttgcaaaacc aacaactgct tcttcagaaa caacaaaaga tgttgttcaa 1620
acttcagcag gttctagcga agcaaaagat agtgctccat tacaaaaagc aaacattaaa 1680
aacacaaatg atggacacac tcaaagccaa aataataaaa atacacaaga aaataaagct 1740
aaatcattac cacaaactgg tgaagaatct aataaagata tgaca 1785
<210> 5
<211> 32
<212> DNA
< 213>forward primer of the gene order of amplification IsdB2 recombinant protein
<400> 5
cgcggatcca tgaatggcga agcaaaagca gc 32
<210> 6
<211> 45
<212> DNA
< 213>reverse primer of the gene order of amplification IsdB2 recombinant protein
<400> 6
ttttcctttt gcggccgcct atgtcatatc tttattagat tcttc 45
Claims (9)
1. the active fragments IsdB2 recombinant protein of methicillin-resistant staphylococcus aureus iron ion surface decision protein I sdB, its aminoacid sequence be SEQ ID NO:3 or after the aminoterminal of SEQ ID NO:3 and/or carboxyl terminal add or lack several amino acid, obtain have the sequence of same or similar function with SEQ ID NO:3.
2. the recombinant expression vector of the said IsdB2 recombinant protein of claim 1 is characterized in that, comprises the nucleotide sequence and the carrier sequence of the said IsdB2 recombinant protein of encoding.
3. recombinant expression vector as claimed in claim 2; It is characterized in that said nucleotides sequence is classified SEQ ID NO:4 as or added in the one or both ends of SEQ ID NO:4 or lack that albumen has the sequence of same or similar functional protein shown in the coding that obtains behind several Nucleotide and the SEQ ID NO:3.
4. recombinant expression vector as claimed in claim 2 is characterized in that, said carrier sequence is a pGEX-6p-2 carrier sequence.
5. a host bacterium is characterized in that, imports the requirement 2 described recombinant expression vectors of having the right.
6. a method of expressing the said IsdB2 recombinant protein of claim 1 is characterized in that, comprises following steps:
1) nucleotide sequence according to coding IsdB2 recombinant protein designs forward primer and reverse primer;
2) use the forward primer and the reverse primer of step 1) design, through pcr amplification go out the to encode gene fragment of IsdB2 recombinant protein;
3) with step 2) gene fragment clone to the expression vector that obtained, be converted into the host bacterium then; And
4) induce the host bacterium after the conversion to express the IsdB2 recombinant protein.
7. method as claimed in claim 6 is characterized in that, the forward primer that is designed in the step 1) and the nucleotide sequence of reverse primer are shown in SEQ ID NO:5 and SEQ ID NO:6 respectively.
8. the application of the described IsdB2 recombinant protein of claim 1 in the subunit vaccine of preparation methicillin-resistant staphylococcus aureus resistance.
9. the application of the described IsdB2 recombinant protein of claim 1 in preparation methicillin-resistant staphylococcus aureus detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101403829A CN102675433A (en) | 2012-05-04 | 2012-05-04 | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101403829A CN102675433A (en) | 2012-05-04 | 2012-05-04 | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102675433A true CN102675433A (en) | 2012-09-19 |
Family
ID=46808034
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101403829A Pending CN102675433A (en) | 2012-05-04 | 2012-05-04 | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102675433A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103059139A (en) * | 2012-09-29 | 2013-04-24 | 重庆原伦生物科技有限公司 | Methicillin-resistant Staphylococcus aureus (MRSA) vaccine recombinant proteantigen I12C, and preparation method and application thereof |
| CN112646828A (en) * | 2020-12-25 | 2021-04-13 | 武汉艾迪康医学检验所有限公司 | Staphylococcus aureus protein A recombinant expression method |
| CN113980127A (en) * | 2021-10-20 | 2022-01-28 | 南京中爱人工智能与生命科学研究院有限公司 | Nano antibody for resisting methicillin-resistant staphylococcus and preparation method and application thereof |
| CN114369150A (en) * | 2022-01-24 | 2022-04-19 | 上海市儿科医学研究所 | Mptx2 protein and application thereof in treating methicillin-resistant staphylococcus aureus infection-related diseases |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1980692A (en) * | 2003-07-24 | 2007-06-13 | 麦克公司 | Polypeptides for inducing a protective immune response against staphylococcus aureus |
| CN101843899A (en) * | 2010-05-24 | 2010-09-29 | 中国人民解放军第三军医大学 | Methicillin-resistant staphylococcus aureus (MRSA) recombinant multivalent subunit genetic engineering vaccine and method for preparing same |
| CN102276730A (en) * | 2011-08-12 | 2011-12-14 | 黑龙江八一农垦大学 | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof |
-
2012
- 2012-05-04 CN CN2012101403829A patent/CN102675433A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1980692A (en) * | 2003-07-24 | 2007-06-13 | 麦克公司 | Polypeptides for inducing a protective immune response against staphylococcus aureus |
| CN101843899A (en) * | 2010-05-24 | 2010-09-29 | 中国人民解放军第三军医大学 | Methicillin-resistant staphylococcus aureus (MRSA) recombinant multivalent subunit genetic engineering vaccine and method for preparing same |
| CN102276730A (en) * | 2011-08-12 | 2011-12-14 | 黑龙江八一农垦大学 | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof |
Non-Patent Citations (7)
| Title |
|---|
| AMY M. PALAZZOLO-BALLANCE 等: "Neutrophil Microbicides Induce a Pathogen Survival Response in Community-Associated Methicillin-Resistant Staphylococcus aureus", 《THE JOURNAL OF IMMUNOLOGY》, vol. 180, no. 1, 1 January 2008 (2008-01-01), pages 500 - 509 * |
| FELDGARDEN,M.等: "ZP_05601606.1", 《GENBANK》, 10 June 2010 (2010-06-10), pages 1 - 2 * |
| FELDGARDEN,M.等: "ZP_06311565.1", 《GENBANK》, 9 June 2010 (2010-06-09), pages 1 - 2 * |
| KENNY,J.G.等: "YP_040515.1", 《GENBANK》, 22 January 2012 (2012-01-22), pages 1 - 2 * |
| 崔莉 等: "金黄色葡萄球菌isdB基因克隆、表达及其抗原性鉴定", 《河北科技师范学院学报》, vol. 25, no. 1, 31 March 2011 (2011-03-31), pages 16 - 20 * |
| 王宁: "金黄色葡萄球菌IsdB3与TRAP融合蛋白免疫保护作用研究", 《中国优秀硕士学位论文全文数据库（农业科技辑）》, no. 2, 31 December 2011 (2011-12-31) * |
| 马金柱 等: "金黄色葡萄球菌isdb 基因的克隆表达及其小鼠免疫试验", 《生物工程学报》, vol. 27, no. 4, 25 April 2011 (2011-04-25), pages 566 - 571 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103059139A (en) * | 2012-09-29 | 2013-04-24 | 重庆原伦生物科技有限公司 | Methicillin-resistant Staphylococcus aureus (MRSA) vaccine recombinant proteantigen I12C, and preparation method and application thereof |
| CN112646828A (en) * | 2020-12-25 | 2021-04-13 | 武汉艾迪康医学检验所有限公司 | Staphylococcus aureus protein A recombinant expression method |
| CN113980127A (en) * | 2021-10-20 | 2022-01-28 | 南京中爱人工智能与生命科学研究院有限公司 | Nano antibody for resisting methicillin-resistant staphylococcus and preparation method and application thereof |
| CN114369150A (en) * | 2022-01-24 | 2022-04-19 | 上海市儿科医学研究所 | Mptx2 protein and application thereof in treating methicillin-resistant staphylococcus aureus infection-related diseases |
| CN114369150B (en) * | 2022-01-24 | 2023-10-31 | 上海市儿科医学研究所 | Mptx2 protein and application thereof in treating methicillin-resistant staphylococcus aureus infection related diseases |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104877019B (en) | Acinetobacter bauamnnii assumes the albumen and preparation method and application of albumin A 1S_1523 | |
| CN103694323A (en) | MntC recombinant protein of staphylococcus aureus and preparation method and application thereof | |
| CN101724605B (en) | Foot-and-mouth disease virus (FMDV) resistant monoclonal antibody and identified epitope and application thereof | |
| CN102558313A (en) | Enterovirus 71 type specific recombinant protein antigen and application thereof | |
| CN104861049B (en) | Acinetobacter bauamnnii 1A1S_1969 recombinant proteins and its preparation method and application | |
| CN102993308B (en) | Methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen HI2 and preparation method and application thereof | |
| CN102675433A (en) | Recombinant protein of methicillin-resistant staphylococcus aureus IsdB protein active segment, preparation method thereof and application thereof | |
| CN108753798A (en) | A kind of preparation method and application of Evaluation of Aeromon As Hydrophila Vaccine candidate outer membrane protein | |
| CN114524862B (en) | Construction and application of avian influenza (H5 + H7) trivalent DNA vaccine | |
| CN103694321B (en) | Streptococcus aureus mSEB mutant and its preparation method and application | |
| CN109293750B (en) | Pseudomonas aeruginosa vaccine recombinant protein SBP and preparation method and application thereof | |
| CN109293749B (en) | Pseudomonas aeruginosa vaccine recombinant protein rExoU and preparation method thereof | |
| CN104861050A (en) | Acinetobacter baumannii zinc dependent oligopeptide A1S-1610 recombinant protein and preparation method and application thereof | |
| CN102690336A (en) | Bat SARS-like coronavirus spike protein immunity determining area and preparation method and application thereof | |
| CN103087198B (en) | MRSA (Methicillin Resistant Staphylococcus Aureus) vaccine recombinant protein antigen I1C and preparation method and application thereof | |
| CN101838658A (en) | O type foot-and-mouth disease virus variant as well as coding gene and application thereof | |
| CN113603754A (en) | Waterfowl H5N8 subtype influenza virus HA recombinant protein and preparation method and application thereof | |
| CN116478953B (en) | Acinetobacter baumannii DlaT recombinant protein, preparation method and application | |
| CN104651376A (en) | Application of acinetobacter baumannii membrane protein A1S_0851 as antigen | |
| US11767356B1 (en) | Canine parvovirus nanobody CPV-VHH-E3 and application thereof | |
| CN103012568B (en) | Methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein FnbA1 and preparation method and application thereof | |
| CN105505973A (en) | Preparation method of Burkholderia pseudomallei recombined BLF1 protein, product prepared through preparation method and application of Burkholderia pseudomallei recombined BLF1 protein | |
| CN102993278A (en) | Purification method of methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen FnbA1 | |
| CN103570835B (en) | Streptococcus aureus ITC fusion rotein and preparation method and application | |
| CN102977214B (en) | Recombinant protein HF2 used for methicillin-resistant staphylococcus aureus (MRSA) vaccine, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20120919 |