WO2001032863A1

WO2001032863A1 - A novel polypeptide, a human apoptosis associated protein 12 and the polynucleotide encoding the polypeptide

Info

Publication number: WO2001032863A1
Application number: PCT/CN2000/000406
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Bio Door Gene Technology Ltd.
Priority date: 1999-10-29
Filing date: 2000-10-30
Publication date: 2001-05-10
Also published as: CN1302886A; AU1378701A

Abstract

The present invention discloses a novel polypeptide, a human apoptosis associated (SAG) protein 12, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammation, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human SAG protein 12.

Description

A new peptide, human apoptosis-associated protein 12, and a polynucleotide encoding the polypeptide

抟术 Spheres

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human apoptosis-associated (SAG) protein 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides.

technical background

Cells have a close relationship with the outside world. Cells need nutrients from the outside world, and they may die due to the poisoning of external conditions. There are many protective systems inside cells that can slow down this toxic effect, and the recently discovered SAG protein is one of them.

SAG is highly conserved in evolution. The homology between human and nematode SAG proteins can reach 75%, and the homology between human and yeast SAG proteins can reach 55%. In human tissues, SAG is highly expressed in skeletal muscle, heart, liver, pancreas and testis, and is expressed in the cytoplasm and nucleus. Human SAG protein expressed and purified in bacteria can bind to metal ions such as zinc and copper to prevent lipid peroxidation caused by metals such as copper. SAG protein can prevent apoptosis due to redox agents when overexpressed in several human cell lines [Duan H, et al, Mol Cell Biol 1999 Apr; 19 (4): 32145-55]. Therefore, SAG Is a cytoprotective molecule.

Analysis of the structure of the SAG protein revealed that the SAG protein contains two hypothetical heme binding sites and a RING zinc finger structure. However, studies have found that SAG does not have the ability to bind heme and lacks transcription factor activity [Swaroop M et al, Free Radic Biol Med 1999 Jul; 27 (1-2): 193-202] ₀ SAG has recently been found to interact with protein kinase CKII The P subunit binds to the binding site in the RING zinc finger domain.

Mutations in the SAG protein cause cells in tissues and organs such as skeletal muscle, heart muscle, liver, pancreas, and testis to lose the buffering effect of SAG protein on metal redox agents such as copper and zinc, resulting in cell death and necrosis of these tissues and organs. Purification of SAG protein helps to produce effective drugs to treat or prevent various diseases caused by the above reasons, such as focal cytoplasmic necrosis, coagulative necrosis, gas gangrene, liquefaction necrosis, and contraction necrosis.

In April 1999, the SAG protein discovered by Duan H et al. Included a RING zinc finger structure, composed of 113 amino acids, and a molecular weight of 12.6 kDa. They found that this SAG protein may prevent apoptosis by preventing or slowing metal ion-induced cytochrome C release. Polypeptides of the invention and those found by Duan et al. The SAG protein has 100% homology from the 1st to the 59th amino acid residue at the protein level, and also has a RING zinc finger structure. The above points indicate that the present invention is a new SAG protein and has similar biological functions, and is named human SAG protein 12,

Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, human SAG protein 12, and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human SAG protein 12. Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human SAG protein 1 2.

Another object of the present invention is to provide a method for producing human SAG protein 12.

Another object of the present invention is to provide antibodies against the polypeptide of the present invention, human SAG protein 1 2. Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, human SAG protein 1 2.

Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a human SAG protein 1 2 abnormality.

Summary of invention

In a first aspect of the present invention, a novel isolated human SAG protein 12 is provided. The polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or its activity Fragments, or their active derivatives, analogs. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

In a second aspect of the present invention, there is provided a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence, the nucleotide sequence having at least 1 with a nucleotide sequence selected from the group consisting of 00% identity: (a) a polynucleotide encoding the aforementioned human SAG protein 12; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of:) a sequence having positions 1 25-45 1 in SEQ ID NO: 1; and (b) a sequence having positions 1-1 in SEQ ID NO: 1 1 52-bit sequence.

In a third aspect of the present invention, there are provided a vector containing the above polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above polynucleotide. Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a comparison diagram of amino acid sequence homology between the SAG protein 12 and the SAG protein of the present inventors. The upper sequence is human SAG protein 12, and the lower sequence is SAG protein. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human SAG protein 12 isolated. 12kda is the molecular weight of the protein. The arrow indicates the isolated protein band.

Summary of the Invention

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human SAG protein 12" means that human SAG protein 12 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human SAG protein 12 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on non-reducing polyacrylamide gels. The purity of the human SAG protein 1 2 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human SAG protein 12, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention may be naturally purified products or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of human SAG protein 12. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human SAG protein 1 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non-conserved amino acid residues (Preferably a conservative amino acid residue) substitution, and the substituted amino acid may or may not be encoded by a genetic codon; or (Π) a type in which one or more of the amino acid residues is a certain group Substitution by other groups contains substituents; or (III) such that the mature polypeptide is fused with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a, Polypeptide sequences in which additional amino acid sequences are fused into mature polypeptides (such as leader sequences or secreted sequences or sequences used to purify this polypeptide or proteinogen sequences) Through the description herein, such fragments, derivatives and analogs are considered It is within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 1152 bases, and its open reading frame 125-451 encodes 108 amino acids. According to the amino acid sequence homology comparison, it was found that the polypeptide has 100% homology with the SAG protein, and it can be deduced that the new human SAG protein 12 has a similar structure and function to the SAG protein family.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not Change the function of the polypeptide it encodes.

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" means: (υ hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60'C; or (2) added during hybridization Denaturing agents, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) the identity between the two sequences is at least 95% or more It is more preferable that hybridization occurs only when 97% or more, and the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human SAG protein 12.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human SAG protein 12 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDM libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but not (Limited to): (l) DNA-DNA or DNA-RM hybridization; (2) appearance or loss of marker gene function; (3) determination of the level of human SAG protein 12 transcripts; (4) through immunological techniques or determination of biological To detect gene expression of protein products. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human SAG protein 12 gene expression.

A method using PCR technology to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human SAG protein 12 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

In the present invention, the polynucleotide sequence encoding the human SAG protein 12 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; in mammalian cells PMSXND expression vectors (Lee and Nathans, J Bio Chem. 263: 3521, 1988) expressed in cells and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human SAG protein 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pairs of SV40 enhancer at a late stage of replication initiation point, polyoma enhancer and adenovirus enhancer at the late side of replication initiation point.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human SAG protein 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; Plague cells such as Fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells. Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l ₂ method used in steps well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

Using conventional recombinant D technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human SAG protein 12 (Sc ience, 1984; 224: 1431). Generally, the following steps are followed:

(1) using the polynucleotide (or variant) encoding human human SAG protein 12 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection and immune diseases.

SAG protein is highly expressed in tissues and organs such as skeletal muscle, heart muscle, liver, pancreas and testis, and protects cells from death due to redox effects of metal ions such as copper and zinc. Therefore, the protein polypeptide of the present invention or a part thereof can treat or prevent diseases caused by cell necrosis in these tissues or organs, including but not limited to: focal cytoplasmic necrosis, coagulative necrosis, gas gangrene, liquefaction Necrosis, Shrinking necrosis and so on.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human SAG protein 12. Agonists enhance biological functions such as human SAG protein 12 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human SAG protein 12 can be cultured with labeled human SAG protein 12 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human SAG protein 12 include selected antibodies, compounds, receptor deletions, and the like. Antagonists of human SAG protein 12 can bind to human SAG protein 12 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

In screening compounds that act as antagonists, human SAG protein 12 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human SAG protein 12 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human SAG protein 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human SAG protein 12 molecule should generally be labeled.

The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human SAG protein 12 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human SAG protein 12 directly into immunized animals (eg rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to human SAG protein 12 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV-hybridoma technology. Technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against human SAG protein 12.

Anti-human SAG protein 12 antibodies can be used in immunohistochemical techniques to detect human SAG protein 12 in biopsy specimens.

Monoclonal antibodies that bind to human SAG protein 12 can also be labeled with radioisotopes and injected into the body You can track its location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human SAG protein 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human SAG protein 12 positive cells.

The antibodies of the present invention can be used to treat or prevent diseases related to human SAG protein 12. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human SAG protein 12.

The invention also relates to a diagnostic test method for quantitative and localized detection of human SAG protein 12 levels. These tests are well known in the art and include F I SH assays and radioimmunoassays. The level of human SAG protein 12 detected in the test can be used to explain the importance of human SAG protein 12 in various diseases and to diagnose diseases in which human SAG protein 12 functions.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human SAG protein 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat cell proliferation, development or metabolic abnormalities caused by the non-expression or abnormal / inactive expression of human SAG protein 12. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human SAG protein 1 2 to inhibit endogenous human SAG protein 1 2 activity. For example, a variant human SAG protein 12 may be a shortened human SAG protein 12 lacking a signaling domain, and although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human SAG protein 12. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, and parvoviruses can be used to transfer polynucleotides encoding human SAG protein 12 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human SAG protein 12 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human SAG protein 12 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on. Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human SAG protein 12 mRNA are also within the scope of the invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the R polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

Polynucleotides encoding human SAG protein 12 are useful in the diagnosis of diseases related to human SAG protein 12. The polynucleotide encoding human SAG protein 12 can be used to detect the expression of human SAG protein 12 or the abnormal expression of human SAG protein 12 in a disease state. For example, the DM sequence encoding human SAG protein 12 can be used to hybridize biopsy specimens to determine the expression of human SAG protein 12. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a micro array or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis of genes and genetic diagnosis in tissues. Human SAG protein 12 specific primers can also be used to detect human SAG protein 12 transcripts by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.

Detection of mutations in the human SAG protein 12 gene can also be used to diagnose human SAG protein 12-related diseases. Human SAG protein 12 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human SAG protein 12 DNA sequence. Mutations can be detected using existing techniques such as Sou thern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, PCR primers (preferably 15-35 bp) are prepared based on cDNA, and the sequences can be mapped on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus i ck, Mende l ian Inher i tance i n Man (available online with Johns Hopk ins Un ivers i ty We l ch Med i cal l bra ry). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all of the affected individuals and the mutation is not observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for changes in scabs in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be combined with other Of therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human SAG protein 12 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human SAG protein 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

example

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually performed according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

Example 1 Cloning of human SAG protein 12

Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0135c07 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results show that the 0135c07 clone contains a full-length cDNA of 2272bp (as shown in Seq IDN0: 1), and has a 327bp open reading frame (0RF) from 125bp to 451bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0135c07, and named the protein as human SAG protein 12. Example 2 Homologous search of cDNA clones

The sequence of the human SAG protein 12 and the encoded protein sequence of the present invention were subjected to the Blast program (Basic local alignment search tool) [Al tschul, SF et a 1. J. Mol. Biol. 1990; 215: 403-10] Perform homology search in Genbank, Swissport and other databases. The gene with the highest homology to the human SAG protein 12 of the present invention is a known SAG protein, and the accession number of the encoded protein in Genbank is AF092878. The protein homology results are shown in Figure 1. The two are highly homologous, with 100% identity; 100% similarity. Example 3 Cloning of a gene encoding human SAG protein 12 by RT-PCR

CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

Primer 1: 5'- ACGGCTGCGAGAAGACGAAGCTT -3 '(SEQ ID NO: 3)

Primer2: 5'- GTTTTAAACTGCACTTTATTTGT -3 '(SEQ ID NO: 4)

Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 μl reaction volume containing 50 μl / L KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mraol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a reaction volume of 50 μ 1 , 1U Taq DNA polymerase (product of Clontech) „Reaction on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min„ During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. DM sequence analysis results showed that the DM sequence of the PCR product was exactly the same as that of 1 to 1152 bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of human SAG protein 12 gene expression

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ) And centrifuge after mixing. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain an R precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with a- ³² P dATP by random priming method. The DNA probe used was the PCR amplified human SAG protein 12 coding region sequence (125bp to 451bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 × 10 ⁶ cpm / ml) was transferred with a nitrocellulose membrane to which RNA was transferred. One solution in ⁴ 2. C hybridization overnight, the solution contains 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) -5 x SSC-5xDenhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, filter was placed in 1 x SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5 In vitro expression, isolation and purification of recombinant human SAG protein 12

According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5'- CCCCATATGATGGCCGACGTGGAAGACGGAGAG -3, (Seq ID No: 5) Primer4: '-CCCGGATCCTTTGTATGCTTCCAATAGGTTGCT -3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences for the 5 ,, and 3 'ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid _P ET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. The PCR reaction was performed using the pBS-0135c07 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0135c07 plasmid in a total volume of 50 μl, primers Primer-3 and Primer-4 were lpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into coliform bacteria DH5α by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0135C07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) by the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 μ ^ 1), the host bacteria BL21 (pET-0135c07) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to a final concentration of 1 mmol / L, and the culture was continued. 5 hours. The bacterial cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography. Purified human protein SAG protein 12. After SDS-PAGE electrophoresis, a single band was obtained at 12kda (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human SAG protein 12 antibodies The following peptides specific to human SAG protein 12 were synthesized using a peptide synthesizer (product of PE company): Leg-Me tA 1 a-Asp-Va 1-G 1 u-As pG 1 yG 1 uG 1 u-Thr-Cys- A 1 a-Leu-A 1 a-Ser-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 pg / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human SAG protein 12.

Claims

1. An isolated polypeptide-human apoptosis-associated (SAG) protein 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof Thing.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID D NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide that is at least 100% identical to (a) or (b).

5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 128-1 078 in SEQ ID NO: 1 or a sequence of positions 1-2272 in SEQ ID NO: 1 sequence.

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6

9. A method for preparing a polypeptide having human SAG protein 12 activity, characterized in that the method comprises:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing human SAG protein 12;

(b) Isolating a polypeptide having human SAG protein 12 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human SAG protein 12.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human SAG protein 12.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence shown in SEQ ID D NO: 1 or a fragment thereof.

13. Use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human SAG protein 12 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human SAG protein 12, or for peptide fingerprinting Identification.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

Π. The use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human SAG protein 12 abnormality.

1 S. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for treating malignant tumors, Hematology, H IV infection and immune diseases and various types of inflammation drugs.