WO2001029229A1

WO2001029229A1 - Novel polypeptide, human retinoblastoma binding protein 20 and polynucleotide encoding it

Info

Publication number: WO2001029229A1
Application number: PCT/CN2000/000331
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Bio Road Gene Development Ltd.
Priority date: 1999-10-18
Filing date: 2000-10-16
Publication date: 2001-04-26
Also published as: AU7769200A

Abstract

The invention concerns human retinoblastoma binding protein 20 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and pruritus utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes the human retinoblastoma binding protein 20.

Description

A new polypeptide-human retinal tumor binding protein 20 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human omental tumor binding protein 20, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing the polynucleotide and polypeptide.

technical background

Retinoma (RB) protein plays an important role in the proliferation and differentiation of normal cells. Cell division requires cells to go through multiple stages in the cell cycle. RB is thought to inhibit cell division by maintaining cells at the G1 and GO stages of the cell cycle [Weintraub SJ et al. Nature 1995; 375: 812-5].

RB can control cell growth. For some tissues that have stopped growing due to the action of RB, this feature can be used to stimulate their growth. For example: Myocardial tissue loses function due to cell death and can be repaired by the proliferation of living cells. Therefore, blocking the cellular control function of RB can help induce tissue repair in the event of myocardial or neuronal death [Wiman KG. FASEB J 1993; 7: 841-5].

Inactivation of RB can lead to abnormal growth of cancer cells, so RB is a tumor suppressor gene that has been widely studied. This inactivation can be caused by a mutation, or it can be caused by a combination of a viral proto-oncoprotein (a product of a pro-oncovirus). This inactivation occurs in a specific region of the RB protein, which is important for growth control and is called the "RB pocket region". Many factors, including viral proto-oncoproteins, can bind to the RB pocket region to control the function of the RB protein. The discovery of protein-binding factors that bind to RBs can help find new ways to control RB-mediated cell proliferation and differentiation in disease states, including (but not limited to) loss of heart and nerve function or the occurrence of malignant tumors. Therefore, it is necessary to find new protein factors that bind and regulate RB. The present invention provides a new RB-binding protein that meets this requirement.

Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, human retinoma binding protein 20, and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human retinal tumor binding protein 20.

Another object of the present invention is to provide a polynucleotide comprising a human retinoma binding protein 20 Genetically engineered host cells.

Another object of the present invention is to provide a method for producing human retinoma binding protein 20.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human retinoma binding protein 20.

Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human retinoma binding protein 20.

Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human retinoma binding protein 20.

Summary of invention

In a first aspect of the present invention, a novel isolated human retinoma binding protein 20 is provided. The polypeptide is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or Its active fragment, or its active derivative, analog. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

In a second aspect of the present invention, there is provided a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 95 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the above-mentioned human retinoma binding protein 20; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 32-592 in SEQ ID NO: 1; and (b) a sequence having 1-2861 in SEQ ID NO: 1 Sequence of bits.

In a third aspect of the present invention, there are provided a vector containing the above polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above polynucleotide.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

Fig. 1 is a comparison diagram of the amino acid sequence homology of human retinal tumor-binding protein 20 and mouse retinal tumor-binding protein. The upper sequence is human retinoma-binding protein 20, and the lower sequence is mouse retinoma-binding protein. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+, '. ^

Figure 2 is a polyacrylamide gel electrophoresis image of isolated human retinoma binding protein 20 (SDS- PAGE). 20. 5 kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.

Summary of the Invention

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

As used herein, "isolated human retinoma binding protein 20" means that human retinoma binding protein 20 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human retinoma binding protein 20 using standard protein purification techniques. Substantially pure peptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human retinoma binding protein 20 peptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, human retinoma binding protein 20, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of human retinoma binding protein 20. As used in the present invention, the terms "fragment", "derivative", and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human retinal tumor binding protein 20 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such A type in which a mature polypeptide is fused to another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene glycol); or (IV) a type of polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of an amino acid encoding SEQ ID NO: 2 Polynucleotide composition of a polypeptide of the amino acid sequence. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2861 bases, and its open reading frame (32-592) encodes 186 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide is 94% identical to the mouse retinal tumor binding protein. It can be concluded that the new human retinal tumor binding protein 20 has similar structure and function to the mouse retinal tumor binding protein.

The polynucleotide of the present invention may be in the form of DNA or RM. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID D NO: 2 but different from the coding region sequence shown in SEQ ID D NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° /. SDS, 60 'C; or (2) adding a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1 ° /. F i co ll, 42 'C, etc .; or (3) hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2. The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human retinoma binding protein 20.

The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human retinoma binding protein 20 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of D-sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of transcripts of human retinoma binding protein 20; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human retinoblastoma binding protein 20 gene expression. A method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) can be preferably used. The primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human retinal tumor binding protein 20 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology .

In the present invention, a polynucleotide sequence encoding the human retinal tumor binding protein 20 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human retinoma binding protein 20 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known controllable genes in prokaryotic cells Promoters expressed in cells or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding a human retinal tumor binding protein 20 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the D sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l ₂ method used in steps well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human retinoma binding protein 20 (Sc ience, 1984; 224: 1431). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human human retinoma binding protein 20 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat cancer, cardiovascular diseases, neurological diseases, immune diseases, inflammation and the like.

The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human retinoma binding protein 20. Agonists enhance biological functions such as human retinoma binding protein 20 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human retinoma binding protein 20 can be cultured with labeled human retinoma binding protein 20 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human retinoma binding protein 20 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human retinoma binding protein 20 can bind to human retinoma binding protein 20 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

In screening compounds that act as antagonists, human retinal tumor binding protein 20 can be added to bioanalytical assays to determine whether a compound is an antagonist by measuring the effect of the compound on the interaction between human retinal tumor binding protein 20 and its receptor . Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human retinoma binding protein 20 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 20 molecules of human retinoma binding protein should generally be labeled.

The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human retinoma binding protein 20 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments and Fab expression libraries. Raw fragment.

Polyclonal antibodies can be produced by injecting human retinoma binding protein 20 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human retinoma binding protein 20 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma Technology, EBV-hybridoma technology, etc. Chimeric antibodies combining human constant regions and non-human variable regions can be produced using existing techniques (Morr et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pa t No. 4946778) can also be used to produce single chain antibodies against human retinoma binding protein 20.

Antibodies against human retinoma binding protein 20 can be used in immunohistochemical techniques to detect human retinoma binding protein 20 in biopsy specimens.

Monoclonal antibodies that bind to human retinoma binding protein 20 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. Such as human retinoma binding protein 20 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a sulfhydryl crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human retinoblastoma binding protein 20 positive cells .

The antibodies of the present invention can be used to treat or prevent diseases related to human retinoma binding protein 20. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human retinoma binding protein 20.

The invention also relates to a diagnostic test method for quantitative and localized detection of human retinoma binding protein 20 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The levels of human retinoma binding protein 20 detected in the test can be used to explain the importance of human retinoma binding protein 20 in various diseases and to diagnose diseases in which human retinoma binding protein 20 plays a role.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

The polynucleotide encoding human retinoma binding protein 20 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human retinoma binding protein 20. Recombinant gene therapy vectors (such as viral vectors) can be designed for It is used to express variant human retinoma binding protein 20 to inhibit endogenous human retinoma binding protein 20 activity. For example, a variant human retinoma-binding protein 20 may be a shortened human retinoma-binding protein 20 lacking a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human retinoma binding protein 20. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, and the like can be used to transfer a polynucleotide encoding human retinoma binding protein 20 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human retinoma binding protein 20 can be found in the existing literature (Sambrook, eta l.). In addition, a recombinant polynucleotide encoding human retinal tumor binding protein 20 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human retinoma binding protein 20 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained by any existing RNA or D synthesis technology. For example, the technology of solid phase phosphoramidite synthesis of oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human retinoma binding protein 20 can be used for the diagnosis of diseases related to human retinoma binding protein 20. Polynucleotides encoding human retinal tumor binding protein 20 can be used to detect the expression of human retinal tumor binding protein 20 or the abnormal expression of human retinal tumor binding protein 20 in a disease state. For example, the DNA sequence encoding human retinoma binding protein 20 can be used to hybridize biopsy specimens to determine the expression of human retinoma binding protein 20. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis. Human Retinoma Binding Protein 20 Specific Primers for RT-PCR Amplification in Vitro Can Also Detect Transcription of Human Retinoma Binding Protein 20 Product.

Detection of mutations in the human retinoma-binding protein 20 gene can also be used to diagnose human retinoma-binding protein 20-related diseases. Human retinoma binding protein 20 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human retinoma binding protein 20 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first finding Structural changes in the chromosome, such as deletions or translocations that are visible from the chromosome level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the disease-related chromosomal region can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human retinoma binding protein 20 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dosage range of human retinoma binding protein 20 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Labora tory Pres s, 1989), Or as recommended by the manufacturer.

Example 1 Cloning of Human Retinoma Binding Protein 20

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA I solat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the 00 fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α to form a cDNA library. The sequences at the 5 'and 3' ends of all clones were determined using Dye terminate cyc le react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer). CDNA The sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0490b02 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the 0490b02 clone contained a full-length cDNA of 2861bp (as shown in Seq IDN0: 1), and a 561bp open reading frame (0RF) from 32bp to 592bp, encoding a new protein (such as Seq ID NO: 2). We named this clone pBS-0490b02 and the encoded protein was named human retinoma binding protein 20. Example 2 Homologous search of cDNA clones

The sequence of the human retinoma binding protein 20 of the present invention and the protein sequence encoded by the same are performed using the Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], Homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human retinal tumor-binding protein 20 of the present invention is a known mouse retinal tumor-binding protein, and the accession number encoded by the protein in Genbank is AF039563. The results of protein homology are shown in Figure 1. The two are highly homologous and their identity is 94%. Example 3 Cloning of a gene encoding human retinoma binding protein 20 by RT-PCR

CDNA was synthesized using fetal brain total RM as a template and oligo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:

Primerl: 5'- GGCGCTGGGGAACTCTGGCCTCGCTGCAC -3 '(SEQ ID NO: 3) Primer2: 5'- TGGTATGTTTTTAAATTCTGAAAATTAACTG -3' (SEQ IDNO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting with the lbp ;

Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Conditions for the amplification reaction: 50 μl of Kol, KCl, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol in a reaction volume of 50 μ 1 Primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2861bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of human retinoma binding protein 20 gene expression Total RNA was extracted in one step [Anal. Biochera 1987, 162, 156-159]. The method includes acid sulfur Guanidinium cyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g RM, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with oc- ³² P dATP by random priming method. The D probe used was the PCR-encoded human retinoma binding protein 20 coding region sequence (32bp to 592bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25raM KH ₂ P0 ₄ (pH 7.4)-5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DM. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5 In vitro expression, isolation and purification of recombinant human retinoma binding protein 20

According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

Primer3: 5'-CAACCATGGCTTCTCCTAGCAAGGCAGTGATTG-3 '(Seq ID No: 5) Primer4: 5'- GGATCCGCTGGTACTTTCAGCAAAGAAAGACTTTACAAC -3, (Seq ID No: 6)

The 5 'ends of these two primers contain Ncol and BamHI restriction sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively. The Ncol and BamHI restriction sites correspond to the expression vector plasmid pET-28b ( +) (Novagen, Cat. No. 69865.3). The PCR reaction was performed using the pBS-0490b02 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0490b02 plasmid in a total volume of 50 μl, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Ncol and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5C using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-0490b02) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration 30 g / ml) of LB liquid medium, host strain BL21 _(P ET-0490b02) were cultured to logarithmic growth phase, IPTG was added to a final concentration lramol / L at 37 ° C, Continue incubation for 5 hours. Collect bacterial cells by centrifugation The supernatant was collected by centrifugation, and chromatography was performed using an affinity chromatography column His. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag) to obtain a purified target protein human retinal tumor binding protein. 20. After SDS-PAGE electrophoresis, a single band was obtained at 20.5 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of Anti-Human Retinoma Binding Protein 20 Antibody

Polypeptide synthesizer (product of PE company) was used to synthesize the following human retinal tumor binding protein 20-specific peptides: NH ₂ -Met-Ala-Ser-Pro-Ser-Lys-Ala-Val-Ile-Val-Pro-Gly- Asn-Gly-Gly-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 μ ₈ / π1 bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in serum-free serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The polypeptide bound to cyanogen bromide activated Sepharose4B column, by affinity chromatography from total i _{g G} isolated anti-polypeptide antibody. The immunoprecipitation method proved that the purified antibody could specifically bind to human retinoma binding protein 20.

Claims

1. An isolated polypeptide-human retinoma binding protein 20, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID O: 2, or an active fragment, analog, or derivative of a polypeptide thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID D NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide that is at least 95% identical to (a) or (b).

The polynucleotide according to claim 4, characterized in that said polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence at positions 32-592 in SEQ ID NO: 1 or a sequence at positions 1-2861 in SEQ ID NO: 1. .

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Recombinant vector.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human retinoma binding protein 20 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing human retinoma binding protein 20;

(b) Isolating a polypeptide having human retinoma binding protein 20 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human retinoma binding protein 20.

16

Replacement page (Article 26)

1 1. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human retinoblastoma binding protein 20.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID D NO: 1.

13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human retinoma binding protein 20 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of the polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human retinoma binding protein 20; or Identification of peptide fingerprints.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used to make a gene Chip or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose and a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human retinoma binding protein 20.

18. The use of the polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for treating cancer, Drugs for cardiovascular disease, nervous system disease, immune disease, inflammation.

17

Replacement page (Article 26)