WO2001031023A1

WO2001031023A1 - A novel polypeptide-human nucleoprotein ii precursor protein 25 and the polynucleotide encoding said polypeptide

Info

Publication number: WO2001031023A1
Application number: PCT/CN2000/000380
Authority: WO
Inventors: Yumin Mao; Yi Xie
Original assignee: Shanghai Bio Door Gene Technology Ltd.
Priority date: 1999-10-28
Filing date: 2000-10-27
Publication date: 2001-05-03
Also published as: CN1302877A; AU1264501A

Abstract

The invention discloses a new poylpeptide-human nucleoprotein II precursor protein 25, the polynucleotide encoding said polypeptide, and a process for producing the polypeptide by recombinant DNA technology. It also discloses methods of applying the polypeptide for the treatment of various diseases, such as malignancy, hemopathy, HIV infection, immune disorders, and inflammation. This invention also discloses antagonist against said polypeptide and thereof therapy uses. In addition, it refers to the use of said polynucleotide encoding said HCPIIP25.

Description

A new polypeptide human nuclear protein I I proteaxin 25 and a polynucleotide encoding the polypeptide Antagonistic field

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human nuclear protein I I precursor protein 25, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.

technical background

The main energy of cell activity comes from ATP. Mitochondria are where sugar, fat, and amino acids eventually release energy. Nutrient substances such as sugar and fat are produced in the cytoplasm through fermentation to produce pyruvate and fatty acids. These substances selectively enter the mitochondrial matrix from the cytoplasm, are degraded into units containing 2 carbon atoms through a series of changes, and are combined with CoA to form Acetyl-CoA enters the tricarboxylic acid cycle, and the hydrogen removed from the tricarboxylic acid cycle passes through the electron transport system on the inner membrane of the mitochondria, the respiratory chain, and is finally passed to oxygen. During this process, electrons with higher energy levels are reduced to lower energy levels through electron transfer. The energy released is in the form of high-energy phosphate bonds, which are phosphorylated by ADP to generate ATP containing high-energy phosphate bonds and stored in the body. It can be seen from the above that the respiratory chain is an important system for supplying energy to living organisms and has great significance for life activities (Editor of Cell Biology Wang Ren et al. Beijing Normal University Press).

The respiratory chain is mainly composed of the following types of molecules: pyridine nucleotide-linked dehydrogenases, flavin-associated dehydrogenases (flavin proteins), iron sulfur protein, coenzyme Q, and cytochromes.

Experiments have shown that the components of the respiratory chain are embedded in the inner membrane of mitochondria in the form of multimolecular complexes (except for Coenzyme Q and Cytochrome C).

Complex I is NADH dehydrogenase, whose role is to catalyze the transfer of 2 electrons of NADH to coenzyme Q;

Complex Π is a succinate dehydrogenase that catalyzes the transfer of electrons from succinate through FAD and iron sulfur protein to coenzyme Q;

Complex II is cytochrome b-c, whose role is to catalyze the transfer of electrons from coenzyme Q to cytochrome c, and the transmembrane transfer of protons occurs at the same time;

Complex IV is a cytochrome c oxidase that catalyzes the transfer of electrons received by cytochrome c to oxygen (Zhai Zhonghe, editor of Cell Biology, Higher Education Press).

Among them, Complex III has about 10-11 subunits. Nucleoprotein II is the second largest nuclear-encoded subunit (Shimomura, Y and Ozawa, T 1982 Biochem Int 5, 1-6); (Methods Enzymol 126, 224-237) _e

A nucleoprotein II precursor was cloned from a mouse liver cDNA library, which is a polypeptide with 438 amino acid residues and a molecular weight of approximately 47KD. Based on the results of existing studies, we have also known the structural similarities and differences of murine, human and yeast nucleoprotein II. For specific research processes and results, please refer to the relevant literature (Biochemistry International 1990 Vol 20 No 4 pp731-737); (J Biol Chem 1989 264, 13483-13488) ₀

Nucleoprotein II does not have a redox center, so it does not directly participate in the electron transfer process. The role of nucleoprotein II in the respiratory chain is still in the research process. Some studies in molecular biology have shown that the lack of nucleoprotein Π will affect the compound Binding of many subunits of Compound III (J Biol Chem 1988 263, 14323-14333); (Eur J Biochem 1987 163, 97-103).

Although the research on the structure and function of nucleoprotein II is not completely clear, basically we can know that nucleoprotein II plays an important role in complex III (cytochrome reductase), which directly affects the normal function of the respiratory chain. It indirectly regulates the oxidative phosphorylation process and mitochondrial function, and has extremely important effects on the energy supply of living organisms and life activities.

Based on the results of amino acid homology comparison, the polypeptide of the present invention was inferred and identified as a new human nucleoprotein II precursor protein 25 (HCPIIP25), and its homologous protein was the human nucleoprotein II precursor with protein number J04973. Object of the invention

It is an object of the present invention to provide an isolated novel polypeptide, human nucleoprotein II precursor protein 25, and fragments, analogs and derivatives thereof.

Another object of the invention is to provide a polynucleotide encoding the polypeptide.

Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human nucleoprotein Π precursor protein 25.

It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a human nucleoprotein Π precursor protein 25.

Another object of the present invention is to provide a method for producing human nucleoprotein Π precursor protein 25.

Another object of the present invention is to provide an antibody against the polypeptide of the present invention, human nucleoprotein II precursor protein 25.

Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention, human nucleoprotein Π precursor protein 25. Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human nucleoprotein Π precursor protein 25.

Summary of invention

In a first aspect of the present invention, a novel isolated human nucleoprotein II precursor protein 25 is provided. The polypeptide is of human origin and includes: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof , Or an active fragment thereof, or an active derivative thereof, or the like. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

In a second aspect of the present invention, there is provided a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 91 nucleotides with a nucleotide sequence selected from the group consisting of »/» Identities: (a) a polynucleotide encoding the aforementioned human nucleoprotein II precursor protein 25; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 2572-3249 in SEQ ID NO: 1; and (b) a sequence having positions 1-3425 in SEQ ID NO: 1 Sequence of bits.

In a third aspect of the present invention, there are provided a vector containing the above polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above polynucleotide.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

Fig. 1 is a comparison diagram of the amino acid sequence homology of the human nucleoprotein Π precursor protein 25 and the human nucleoprotein I I precursor of the present invention. The upper sequence is human nucleoprotein I I precursor protein 25, and the lower sequence is human nucleoprotein I I precursor. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

FIG. 2 is a polyacrylamide gel electrophoresis diagram of isolated human nucleoprotein I precursor protein 25 (303-? Human 08).

25kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.

Summary of the Invention

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. It is separated and purified, and it is isolated and purified.

As used herein, "isolated human nucleoprotein Π precursor protein 25" refers to human nucleoprotein I I precursor protein 25 is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human nucleoprotein Π precursor protein 25 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human nucleoprotein Π precursor protein 25 can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, a nucleoprotein I I precursor protein 25, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The invention also includes fragments, derivatives and analogs of human nucleoprotein Π precursor protein 25. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human nucleoprotein Π precursor protein 25 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: U) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted The amino acid may or may not be encoded by the genetic code; or (Π) such that a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) One, in which the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which the additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3425 bases in length and its open reading frame (2572-3249) encodes 225 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 91% homology with the human nucleoprotein II precursor. It was concluded that the human nucleoprotein Π precursor protein 25 has a similar structure and function as the human nucleoprotein II precursor.

The polynucleotide of the present invention may be in the D form or the RNA form. DNA forms include cDNA, genomic D, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between two sequences Crosses occur only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human nucleoprotein II precursor protein 25. The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human nucleoprotein Π precursor protein 25 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the D-sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spooning Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (1) DM-DM or DM-RNA hybridization; (2) the presence or absence of a marker gene function; (3) measuring the level of the human nucleoprotein II precursor protein 25 transcript; (4) Detecting the protein product of gene expression by immunological technology or measuring biological activity. The above methods can be used singly or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the protein product of human nuclear protein I I precursor protein 25 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

A method using PCR technology to amplify DNA / RNA (Sa iki, et al. Sc ience 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. Especially difficult to get from the library When the full-length cDNA is used, the RACE method (RACE-rapid amplification of cDNA ends) can be preferably used. The primers used for PCR can be appropriately selected according to the polynucleotide sequence information of the present invention disclosed herein, and conventional methods can be used synthesis. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDM sequence of multiple clones in order to splice into a full-length cDNA sequence.

The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human nucleoprotein II precursor protein 25 coding sequence, and the recombinant technology to produce the polypeptide of the present invention Methods.

In the present invention, a polynucleotide sequence encoding the human nucleoprotein III precursor protein 25 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human nucleoprotein II precursor protein 25 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Mol ecular Cloning, a Laboratory Manua 1, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. Expression vector also includes ribosomes for translation initiation Binding sites, transcription terminators, etc. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human nucleoprotein Π precursor protein 25 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a D sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be harvested after exponential growth phase, with (: Treatment 1 _2, steps well known in the art used alternative is to use MgCl _2.. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

The polynucleotide sequence of the present invention can be used to express or produce recombinant human nucleoprotein I I precursor protein 25 by conventional recombinant DNA technology (Scence, 1984; 224: 1431). Generally there are the following steps:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding human human nucleoprotein 11 precursor protein 25 of the present invention, or a recombinant expression vector containing the polynucleotide;

(2) culturing host cells in a suitable medium;

(3) Isolate and purify protein from culture medium or cells. In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

The human nucleoprotein II formed by the polypeptide (human nucleoprotein Π precursor protein) of the present invention is an important component of cytochrome reductase in the respiratory chain, and is one of the subunits of cytochrome reductase encoded by the nucleus. Some studies in molecular biology have shown that if nucleoprotein II is lacking, it will affect the binding of many subunits of complex III. It can be speculated that although nucleoprotein π does not have a redox center and does not directly participate in the electron transfer process, it is important for maintaining Complex III (cytochrome reductase) plays an important role in the stability and normal function.

The research on the function and structure of the polypeptide of the present invention needs to be further deepened. According to the above-mentioned functions of the polypeptide of the present invention, the polypeptide of the present invention can be used to diagnose and treat many diseases, such as malignant tumors, endocrine system diseases, nervous system diseases, immune diseases, Human acquired immune deficiency syndrome (AIDS) and so on.

The polypeptide of the present invention can regulate the expression of some small molecules such as hormones, thereby playing a therapeutic function for diseases of the endocrine system, including: pituitary tumors (prolactinoma), gigantism and acromegaly, adenoid pituitary hypofunction, pituitary Dwarfism, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, hyperthyroidism, hypothyroidism, simple goiter, thyroiditis, hypercortisolism, primary aldosteronism, pheochromocytoma, primary chronic Adrenal insufficiency, primary hyperparathyroidism, hypoparathyroidism, ectopic hormone secretion syndrome, etc.

Various tumors include: including epithelial tissue (such as basal epithelium, squamous epithelium, mucus cells, etc.), (such as fibrous tissue, adipose tissue, cartilage tissue, smooth muscle tissue, vascular and lymphatic endothelial tissue, etc.), hematopoietic tissue ( (Such as B cells, T cells, tissue cells, etc.), central nervous tissue, peripheral nerve tissue, endocrine tissue, gonadal tissue, special tissue (such as dental tissue, etc.) derived tumors, such as gastric cancer, liver cancer, colorectal cancer, breast Cancer, lung cancer, prostate cancer, cervical cancer, pancreatic cancer, esophageal cancer, etc. The polypeptide of the present invention is an immunomodulator and has an immune promoting or immunosuppressing effect. The polypeptide of the present invention can be used for the treatment of diseases including non-response of immune response, or abnormal immune response, or ineffective host defense. The polypeptide of the present invention and its antibody also have effects on damage, defects or disorders of immune tissue, especially for diseases of the hematopoietic system (such as malignant anemia), skin diseases (such as psoriasis), and autoimmune diseases (such as rheumatoid arthritis ), Radiation diseases and the production and regulation of immune lymphocytes are extremely closely related.

The present invention also provides screening compounds to identify amplifying (agonist) or repressing (antagonist) human nuclear proteins

I I Precursor Protein 25 Method of Pharmacy. Agonists enhance human nuclear protein I I precursor protein 25 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human nucleoprotein Π precursor protein 25 can be cultured with labeled human nucleoprotein Π precursor protein 25 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human nucleoprotein Π precursor protein 25 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human nucleoprotein Π precursor protein 25 can bind to human nucleoprotein II precursor protein 25 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

When screening compounds as antagonists, human nucleoprotein II precursor protein 25 can be added to the bioanalytical assay, and the compound can be determined by measuring the effect of the compound on the interaction between human nucleoprotein Π precursor protein 25 and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to human nucleoprotein I I precursor protein 25 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, 25 molecules of human nucleoprotein Π precursor protein should generally be labeled.

The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The present invention also provides antibodies directed against the human nuclear protein 11 precursor protein 25 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human nucleoprotein Π precursor protein 25 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to In Freund's adjuvant. Techniques for preparing monoclonal antibodies to human nucleoprotein Π precursor protein 25 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morrson et al, PNAS, 1985, 81: 6851) and existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human nucleoprotein Π precursor protein 25.

Antibodies against human nucleoprotein I I precursor protein 25 can be used in immunohistochemical techniques to detect human nucleoprotein I I precursor protein 25 in biopsy specimens.

Monoclonal antibodies that bind to human nucleoprotein I I precursor protein 25 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human nucleoprotein Π precursor protein 25 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol crosslinker such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human nucleoprotein II precursor protein 25 positive Cell.

The antibodies of the present invention can be used to treat or prevent diseases related to human nucleoprotein Π precursor protein 25. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human nucleoprotein Π precursor protein 25.

The invention also relates to a diagnostic test method for quantitative and localized detection of human nucleoprotein Π precursor protein 25 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human nucleoprotein II precursor protein 25 detected in the test can be used to explain the importance of human nucleoprotein II precursor protein 25 in various diseases and to diagnose the role of human nucleoprotein II precursor protein 25 disease.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human nucleoprotein II precursor protein 25 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human nucleoprotein Π precursor protein 25. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human nucleoprotein Π precursor protein 25 to inhibit endogenous human nucleoprotein II precursor protein 25 activity. For example, a variant human nucleoprotein II precursor protein 25 may be shortened, deleted The human nucleoprotein Π precursor protein 25, which has a signal transduction domain, lacks signal transduction activity, although it can bind to downstream substrates. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human nuclear protein II precursor protein 25. Virus-derived expression vectors such as retroviruses, adenoviruses, adenovirus-associated viruses, herpes simplex virus, parvoviruses, and the like can be used to transfer polynucleotides encoding human nucleoprotein Π precursor protein 25 into cells. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human nucleoprotein II precursor protein 25 can be found in the existing literature (Sarabrook, et al.). In addition, a polynucleotide encoding human nucleoprotein Π precursor protein 25 can be packaged into liposomes and transferred into cells.

Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human nucleoprotein I precursor protein 25 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of the D sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human nucleoprotein II precursor protein 25 can be used for the diagnosis of diseases related to human nucleoprotein II precursor protein 25. The polynucleotide encoding human nucleoprotein Π precursor protein 25 can be used to detect the expression of human nucleoprotein Π precursor protein 25 or the abnormal expression of human nucleoprotein II precursor protein 25 in a disease state. For example, the DNA sequence encoding human nucleoprotein II precursor protein 25 can be used to hybridize biopsy specimens to determine the expression of human nucleoprotein II precursor protein 25. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarray) or a D chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human nucleoprotein II precursor protein 25 specific primers can be used for RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human nucleoprotein II precursor protein 25. Transcription products.

Detection of mutations in the human nucleoprotein Π precursor protein 25 gene can also be used to diagnose human nucleoprotein I I precursor protein 25-related diseases. Human nucleoprotein I I precursor protein 25 mutations include point mutations, translocations, deletions, recombination, and any other abnormalities compared to the normal wild-type human nucleoprotein Π precursor protein 25 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, D-sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, the specific loci of each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome locations. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to locate D to a specific chromosome. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inherance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If in A mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing diseased and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable with cDM sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human nucleoprotein Π precursor protein 25 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human nucleoprotein Π precursor protein 25 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

Example 1 Cloning of human nucleoprotein Π precursor protein 25

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mT was isolated from total RNA by Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed CDM is formed. Smar t cDNA cloning kit (purchased from C 1 ont ech | ^ cDM fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech)) to transform DH5 α, and bacteria were used to form cDNA library. Dye terminate Cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public D The sequence database (Genebank) was compared, and it was found that the cDNA sequence of one of the clones 0077C07 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragment of the clone in both directions. The results showed that the full length of the 0077C07 clone contained The cDNA is 3425bp (as shown in Seq ID NO: l), and there is a 678bp open reading frame (0RF) from 2572bp to 3249bp, which encodes a new protein (as shown in Seq ID NO: 2). We clone this It was named pBS-0077C07, and the encoded protein was named human nucleoprotein II precursor protein 25. Example 2 Homologous search of cDNA clones

The sequence of the human nucleoprotein Π precursor protein 25 of the present invention and the protein sequence encoded by the nucleoprotein Π precursor protein 25 were analyzed using the Blas t program (Basic local a search search tool) [Al tschul, SF et al.

J. Mol. Biol. 1990; 215: 403-10], homology search was performed in databases such as Genbank, Switzerland, and so on. The gene with the highest homology to the human nucleoprotein I I precursor protein 25 of the present invention is a known human nucleoprotein I I precursor, and its encoded protein has the accession number of J04973 in Genbank. The results of protein homology are shown in Figure 1. The two are highly homologous and their identity is 90%.

Example 3 Cloning of a gene encoding human nucleoprotein I I precursor protein 25 by RT-PCR

CDM was synthesized using fetal brain cell total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification by Qiagene's kit, the following primers were used for PCR amplification:

Pr imer 1: 5'- TGACTACTTCACCCTTGGTGAA -3 '(SEQ ID NO: 3)

Pr imer2: 5,-TTAAACAGAATGTTTTATTGAC -3 '(SEQ ID NO: 4)

Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification reaction conditions: 50 mmol / L KC1, 10 mmol / L Tri s-Cl, (pH 8.5.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, l in a reaction volume of 50 μ 1 Opmol primer, 1U Taq DM polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. Set β-act in at the same time as RT-PCR For positive control and template blank as negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector (Invitrogen product) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-3425 bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of human nucleoprotein II precursor protein 25 gene expression Total RNA extraction in one step [Anal. Biochera 1987, 162, 156-159] ₀ This method involves acid guanidine thiocyanate phenol-chloroform extraction . I.e. with 4M guanidinium isothiocyanate -25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Electrophoresis was performed on a 1.2% agarose gel containing 20 mM ₈ INA on 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation of ct- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the PCR-encoded human nucleoprotein II precursor protein 25 coding region sequence (2572bp to 3249bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7.4) -5 530-5 06111 & ^ 1,3 solution and 20 (^ [111 salmon sperm 0. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30min. Then, Analysis and quantification using Phosphor Imager. Example 5 In vitro expression, isolation and purification of recombinant human nucleoprotein II precursor protein 25

Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Priraer3: 5'- CCCGCTAGCATGACAGCCTGTTCGATACGTTAG-3 'Nhel -3, (Seq ID No: 5) Primer4: 5'- CCCCTCGAGTTACAACTCATCAACAAAAGGTGT-3' Xhol -3, (Seq ID No: 6) The 5 'ends of these two primers contain Nhel and Xhol restriction sites, followed by the coding sequences of the 5 ,, and 3 'ends of the target gene, respectively. Nhel and Xhol restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. .69865.3). PCR was performed using the pBS-0077C07 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0077C07 plasmid, Primer-3 and Primer-4 were included in a total volume of 50 μ1, and ¹ J was 10 pmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, 25 in total Loop. Nhel and Xhol were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed by the calcium chloride method of coliform bacteria DH5 alpha, containing kanamycin

After the LB plate (final concentration 30 g / nil) was cultured overnight, the positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0077C07) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pET-0077C07) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 leg ol / L. , Continue to cultivate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. An affinity chromatography column capable of binding 6 histidines (6His-Tag) was used. Hi s. Bind Quick Cartr idge

(Product of Novagen) was subjected to chromatography to obtain purified human nuclear protein I I precursor protein 25. After SDS-PAGE electrophoresis, a single band was obtained at 25 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human nucleoprotein I I precursor protein 25 antibody

The following peptides specific for human nucleoprotein II precursor protein 25 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Thr-Ala-Phe-Ser-Leu-Thr-Ala-Glu-Arg-Ser-Ser -Ser-Leu-Cys-C00H (SEQ ID NO: 7). Do not combine this peptide with hemocyanin and bovine serum albumin to form a complex. For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43 ₀ 4 mg of the above hemocyanin polypeptide complex plus complete Freund's After 15 days, rabbits were immunized with the drug, and the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human nucleoprotein II precursor protein 25.

Claims

Right

1. An isolated polypeptide-human nucleoprotein Π precursor protein 25, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

(b) a polynucleotide complementary to polynucleotide (a); or

(c) A polynucleotide that is at least 91% identical to (a) or (b).

The polynucleotide according to claim 4, characterized in that said polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 2572-3249 in SEQ ID NO: 1 or the sequence of positions 1-3425 in SEQ ID NO: 1. .

7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

(a) a host cell transformed or transduced with the recombinant vector of claim 7; or

(b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human nucleoprotein Π precursor protein 25 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing human nucleoprotein 11 precursor protein 25;

(b) Isolating a polypeptide having human nucleoprotein 11 precursor protein 25 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to a human nucleoprotein II precursor Protein 25 specifically binds to the antibody.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human nucleoprotein I I precursor protein 25.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human nucleoprotein Π precursor protein 25 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human nucleoprotein II precursor protein 25; or Identification of peptide fingerprints.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of human nucleoprotein II precursor protein 25.

18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.