WO2001030836A1 - Novel human atpases and encoding sequences thereof - Google Patents

Abstract

The invention discloses a novel polypeptide, human ATPase (for short, 'BioATPase'), the polynucleotide encoding the polypeptide, and the method of production thereof by DNA recombinant techniques. Methods of using the polypeptide and the polynucleotide for treating diseases such as nerve retrograde affection, muscle disease, immune disorder, cancer, and the like are also disclosed. Furthermore, the invention discloses the antagonist of the polypeptide and the effects thereof. Using of the polynucleotide encoding the novel BioATPase is also disclosed.

Description

 Explanation book

 New human ATP synthase and its coding sequence technology field

 The present invention belongs to the field of biotechnology and genetic engineering. Specifically, the present invention relates to a novel polypeptide-human ATI) synthase (Nove) Human ATPase ("Bi oATPase"), and a polynucleotide encoding the polypeptide. sequence. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 ATP provides energy for the demand response of any cell. ΑΓΡ synthase is a membrane-intrinsic protein, a unit of biofilm energy conversion, and is involved in the key steps of oxidative phosphorylation of the mitochondrial respiratory chain. It is a multi-component complex with a three-part structure, namely the head, handle, and membrane. The head (F1 coupling factor) is composed of five kinds of 10 peptides, including a nucleic acid domain (binding ATP) and a thermostable small protein molecule, which has a catalytic function and can synthesize or hydrolyze ATP. The handle contains several Other proteins, one of which is sensitive to oligomycin. The membrane part (F0 coupling factor) is composed of a hydrophobic polypeptide chain and lipoprotein, which is embedded in the membrane lipid bilayer and has a proton conductor function.

ATP synthase is coupled with Ca ²⁺ pump or Na ⁺ -k ⁺ pump, and participates in the transport of Ca ²⁺ or Na ⁺ -k ^τ and the hydrolysis of ATP. The Na k ion pump can promote the conformational transformation of AΓP synthase in E1 and E2 types. The ion-binding site of E1 faces the inner moon and has a high affinity with Na ^; the ion-binding site of E2 faces extracellularly and has a low affinity. In most ATP hydrolysis reaction cycles, intracellular Na ^ binds to the ATP synthase E1 configuration, triggering the phosphorylation of E1, so that the ion-binding site flips outwards into the E2 configuration, and releases Na ⁺ outside the cell, and then Binding to trigger E2 dephosphorylation into the E1 configuration [Gasset M, et al. J Biol Chem 1997; 272: 1608-14] The normal function of Na-k ATP synthase is active to maintain the reverse concentration gradient of the substance very necessary.

The bound ATP synthase can pump Ca ^2T out of the cytoplasm, keep the Ca ²⁺ concentration low in the cytoplasm, and maintain basic cell functions [Arrondo JL, et al .. J Biol Chem 1987; 262: 9037-43]. For example, Ca can be transported in the sarcoplasmic reticulum ^: from the cytoplasm to the sarcoplasmic reticulum, Ca ²⁺ is stored in the sarcoplasmic reticulum. The release of Ca ²⁺ from the sarcoplasmic reticulum into the myocyte fluid causes contraction.

 Based on the homology comparison, the polypeptide of the present invention can be deduced to be a new human ATP synthase, which contains characteristic domains of the ATP synthase family and has similar biological functions. Studies have found that ATP synthase and its encoded polynucleotides have been linked to diseases such as neurological degenerative diseases, muscle diseases, immune disorders, and cancer. Therefore, research and development of human ATP synthase for therapeutic purposes is of great significance. Public open

 It is an object of the present invention to provide an isolated novel polypeptide, human ATP synthase (referred to as "Bi oATPase") and fragments, analogs and derivatives thereof.

 Another object of the present invention is to provide a polynucleotide encoding the Bi oATPase polypeptide.

 It is another object of the present invention to provide a recombinant vector containing a polynucleotide encoding a BioATPase.

Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding Bi oATPase. Cell.

 Another object of the present invention is to provide a method for producing BioATPase.

 Another object of the present invention is to provide an antibody against the BioATPase polypeptide of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of the BioATPase polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of BioATPase. In a first aspect of the present invention, a novel and isolated human ATP synthase (BioATPase) is provided. The polypeptide is of human origin. It comprises: a polypeptide having the amino acid sequence of SEQ ID NO: 2, or a conservative variant polypeptide thereof, or an active fragment thereof, or an active derivative thereof, and the like. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a derivative thereof having no more than 5% amino acid variation.

 In a second aspect of the present invention, there is provided a polynucleotide encoding these isolated polypeptides, the polynucleotide comprising a nucleotide sequence having at least 70 nucleotides with a nucleotide sequence selected from the group consisting of % Identity: (a) a polynucleotide encoding the above Bi oATPa.se; (b) a polynucleotide complementary to the polynucleotide (a). Preferably, the polynucleotide encodes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence of positions 97-1 to 137 in SEQ ID NO: 1; and (b) a sequence of 1-in SEQ ID NO: 1 :-! A sequence of S4n bits.

 In a third aspect of the present invention, there are provided a vector containing the above-mentioned polynucleotide, and a host cell transformed or transduced by the vector or a host cell directly transformed or transduced by the above-mentioned polynucleotide.

 Other aspects of the invention will be apparent to those skilled in the art from the technical disclosure herein. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state. of.

 As used herein, "isolated BioATPase protein or polypeptide" means that BioATPase is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify BioATPase. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of BioATPase polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, BioATPase polypeptide, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. Polypeptides of the invention may be naturally purified products or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using a set of techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of BioATPase. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to essentially maintaining the same biological function of the natural Bi oATPase of the present invention

^ ^T ; '^ peptide, a fragment, derivative or analog of the peptide of the present invention may be: (1) such a species' One or more amino acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or (II) such a, One of the one or more amino acid residues is substituted with another group to include a substituent; or (in) a type in which the mature polypeptide is associated with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene Diol) fusion; or (IV) a polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) in which an additional amino acid sequence is fused into a mature polypeptide. As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The invention also provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ: NO: 2. Preferably, the polynucleotide sequence of the present invention has a nucleotide sequence of SEQ ID NU: 1.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence of the encoded mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is a replacement form of a polynucleotide, which may be one or more than 1, a nucleotide substitution, deletion, or insertion, but does not substantially change the polypeptide encoded by it Functions.

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturing agent during hybridization, such as 50% (v / v) formamide, 0. small blood pupa / 0.1% F i co l I, etc .; or (3) only the same between the two sequences Sex is at least 9 ":, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID I) NU: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleosides. Ii preferably at least ion t nucleosides Acid above. Nucleic acid fragments can also be amplified using f nucleic acid (such as

Identify and or isolate a polynucleotide encoding a BioAT ase. The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.

 The specific polynucleotide sequence encoding the BioATPa.se of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect polynuclear clones with common structural characteristics Nucleotide fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) Isolating a double-stranded DNA sequence from genomic DNA: 2) Chemically synthesizing a DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are a variety of mature methods for extracting mRXA, and kits are also commercially available (Qiagene and cDNA libraries are also common methods (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (D DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of Bi oATPase transcripts; (4) through immunological techniques Or measure the biological activity to detect the protein product of gene expression. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and has a length of at least 10 nucleotides, preferably at least 3 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2,000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a IAΛ sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of BioATPase gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method for amplifying DNA / RNA using PCR technology (Saiki, et al. Science 1985; 230: 1350-1.354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, the RACE method (RACE-rapid cDNA end rapid amplification method) can be preferably used, and the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

The polynucleotide sequence of the gene of the present invention, or various DNA fragments and the like obtained as described above can be determined by a conventional method such as the de-stranding method (Sanger et ul. PNAS, 1977, 74: 5463-5467). ¾'i nucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence. The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the Bi oATPa.se coding sequence, and a method for producing the peptide of the present invention by recombinant technology.

 In the present invention, a polynucleotide sequence encoding Bi oATPa.se can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125): pMSXND expression vectors expressed in mammalian cells ( e an d Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a wake sequence encoding BioATPa.se and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et ul. Molecular Cloning, a Laboratory Manual, co. Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the l ac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter,

HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 30 () base pairs that act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select the appropriate vector / transcription control element (such as promoter, enhancer, etc.) and selectable marker gene ..

In the present invention, a polynucleotide encoding Bi oATPase or a recombinant vector containing the polynucleotide is transformed or introduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples of host cells are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9 _: animal fine I H0, U) S or Bowes melanin Tumor cells and so on. Transformation of a host cell with a warship sequence or a recombinant vector containing the DNA sequence of the present invention can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing NA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. It can also be performed with M _S C 1 ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant Biatotiase (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) transforming or transducing a suitable host cell with the polynucleotide (or variant) encoding human BioATPase of the present invention, or with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 Isolate and purify proteins from culture media or cells.

 In step (2), the medium used in the culture may be selected from various conventional culture media depending on the host cell used. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods. Brief explanation of attached picture

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of the amino acid sequence homology between human ATP synthase Bi oATPa.se and nematode ATP synthase (AF099920). Identical amino acids are represented by single-character amino acids between the two sequences, similar amino acids are represented by "+", and industrial applicability

The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases. BioATPase protein or polypeptides can be used as drugs to treat diseases caused by low or loss of ATP synthase function. B i uAT ast 'antagonists can be used to treat or prevent immune disorders, including but not limited to: glomerulonephritis, lupus erythematosus, Graves' disease, diabetes, anemia, emphysema, pancreatitis , Atrophic gastritis, Sjogren's syndrome, Addison's disease, osteoarthritis, gout, polymyositis, myasthenia gravis, atopic dermatitis, asthma, bronchitis, autoimmune thyroiditis, etc. Antibodies that specifically bind to B o oATPase can be used directly as antagonists, Or indirectly, agents are brought into cells or tissues expressing BioATPase by targeting or delivery mechanisms.

 Antagonists or fragments or derivatives of ioATPase can be used to treat or prevent degenerative neurological diseases, including (but not limited to): Alzheimer's disease, Huntington's disease, Parkinson's disease, epilepsy, Down syndrome, multiple sclerosis, etc.

 Antagonists or fragments or derivatives of BioATPase can be used to treat or prevent muscle disorders including (but not limited to): progressive peripheral ophthalmoplegia, Kearns-Sayre syndrome, myoclonus, encephalopathy, myocarditis, Lactic acidosis and so on.

 BioATPase antagonists or fragments or derivatives can be used to treat or prevent cancer. Cancers include (but are not limited to): adenocarcinoma, leukemia, lymphoma, melanoma, sarcoma, etc .; especially kidney, bladder, pancreas, bone, Brain, breast, uterus, gallbladder, liver, lung, thyroid, esophagus, testis, skin, mesentery and other cancer-related antibodies that specifically bind to BwATPase can be used directly as antagonists, or indirectly through the targeting or delivery mechanism of the agent Taken into cells or tissues that express BioATPase. Antagonists or fragments or derivatives of BioATPase can be used to treat or prevent cancer immune disorders.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) BioATPase. Agonists enhance biological functions such as BioATPase to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing BinATPa.se are cultured with labeled BioATPase in the presence of a drug, and then the ability of the drug to increase or suppress this interaction is determined to identify an agonist or antagonist.

 BioATPase antagonists include antibodies, compounds, receptor deletions, and analogs that have been screened. BioATPase antagonists can bind to BioATPase and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

 When screening compounds as antagonists, BioATPase can be added to the bioanalytical assay to determine whether the compound is an antagonist by measuring the effect of the compound on the interaction between BioATPase and its receptor. Using the same method of screening compounds described above, Receptor deletions and analogues that act as antagonists are screened out. Polypeptide molecules that can bind to BioATPase can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally respond BioATPase molecules are labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The present invention also provides

Antibodies to the BioATPase epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fah fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting BioATPase directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing BiuAri 'st. Monoclonal antibodies include (but are not limited to): Hybridoma technology (Kohler and i lst _t , i .. Nature, 1975, 256: 495-497), triple tumor technology, human beta cells Hybridoma technology, EBV-hybridoma technology, etc., chimeric antibodies that combine human constant regions with non-human variable regions can be produced using existing technologies (Morrison el a J, NAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (US Pat No. 4% 77H) is also available. Used to produce single chain antibodies against BioATPase.

Anti-BioATPase antibodies can be used in immunohistochemical techniques to detect BioATP in biopsy specimens _; ise. Monoclonal antibodies that bind to BioATPase can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, BioATPase high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of the antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill BioATPase positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases associated with BioATPase. Administration of appropriate doses of antibodies can stimulate or block BioATPase production or activity.

 The invention also relates to a diagnostic test method for quantitative and localized detection of BioATPase levels. These tests are well known in the art and include FISH and radioimmunoassays. The level of BioATPa.se measured in the test can be used to explain the importance of BioATPa.se in various diseases and to diagnose diseases where BioATPase works.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding BioATPase can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of Bi oATPa.se. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated BioATPase to inhibit endogenous BioATPas activity. For example, a mutated BioATPase can be a shortened B ioATPase that lacks the signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of BioATPase. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding BioATPase into cells. The method of constructing a recombinant viral vector carrying a polynucleotide encoding BioATPase can be found in the existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding BioATPase can be packaged into liposomes and transferred into cells.

 Methods for introducing polynucleotides into tissues or cells include: Injecting the polynucleotides directly into tissues in the body: Or, first introduce the polynucleotides into cells through a vector (such as a virus, phage, or plasmid) in vitro, and then transfer the cells. Pull into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit BioATPase mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by using ^: Ho KNA or UNA synthesis techniques, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This IAA sequence has been integrated downstream of the RNA polymerase promoter of the vector. To increase the stability of nucleic acid molecules, It can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding BioATPase can be used for the diagnosis of diseases related to BioATPase. Polynucleotides encoding BioATPase can be used to detect the expression of BioATPase or abnormal expression of BioATPas in disease states. For example, the DNA sequence encoding BioATPase can be used to hybridize biopsy specimens to determine the expression of BioATPase. Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (hereinafter referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. BioATPas specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect BioATPase transcripts.

 Detection of mutations in the BioATPase gene can also be used to diagnose BioATPase-related diseases. BioATPase mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type BioATPa.se DNA sequences. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position of a human chromosome and can hybridize with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) can be used to mark chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells that contain the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to locate DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones to metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Ve Jin et al., Human Chromosomes: a Manual o Has i Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick. Mendelian Inheritance in Man (:: |] "jfiii-J Johns Hopkins University Welch Medical Library available online) 'Then, linkage analysis can be used to determine genes and genes that have been mapped to chromosomal regions Relationship between diseases.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If in some or A mutation is observed in all diseased individuals, and the mutation is not observed in any normal individuals, then the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier (pharmaceutically acceptable carrier). These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of a polypeptide or antagonist of the present invention and a carrier and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. BioATPa.se is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of BioATPa.se administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

 In one example of the present invention, an isolated polynucleotide is provided, which encodes a mature polypeptide having the amino acid sequence shown in SEQ ID NO: 2. The polynucleotide was found from a cDNA library of human fetal brain tissue. The polynucleotide sequence is 3845 bases in length and its open reading frame (97-1 137) encodes 346 amino acids. According to the amino acid sequence homology comparison, it was found that this polypeptide has 41% homology with the ATP synthase of Caenorhabdi tis el egans, and it can be inferred that the new human BiOATPase of the present invention has a similar structure to the ATP synthase gene family. and function.

 The cDNA, oligonucleotides, peptides, and antibodies of the human BioATPase provided by the present invention are useful for studying the role of ATP synthase in different tissues and cells, diagnosing diseases related to ATP synthase disorders, screening inhibitors or drug treatment. These diseases have important value. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally based on conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Laborat ory Press, 1989), or Follow the conditions recommended by the manufacturer. Male 'Example 1: Bi oATPase d) Cloning of NA

Isolation of total human fetal brain RNA with guanidine isothiocyanate / phenol / chloroform-isocyanate method o Quik mRNA I so l at i on K it (QieKen Company) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA. The Smart. CDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multicloning site of pBSK (+> vector (Gk tech)) to transform the DH5a bacteria to form a cDNA library. The dye was used to terminate the cycle reaction sequencing reagent Cassette (Perkin nE 1 mer company) and AB I 377 automatic sequencing protocol (Perkin-E 1 mt 'r company) to determine the sequence of the 5' and 3 'ends of all clones. The determined cDNA sequence was compared with Some public I) NA sequence databases (Genebank) were compared and found that the cDNA sequence of one of the clones (0504g02) was new DNA. A series of primers were synthesized for the bidirectional determination of the inserted cDNA fragments contained in the clone. The results show that the 0n04 _ff 0 clone contains a full-length cDNA of 3845bp (as shown in SEQ ID N0: 1), from 97bp to 17hp has a 1041bp open reading frame (0RF), which encodes a new protein (such as (SEQ ID NO: 2) This clone was named _P BS-0504g02, and its encoded protein was named human ATP synthase (referred to as "BioATPase"). Example 2: Homologous search of cDNA clones

 The sequence of the human BioATPase gene of the present invention and the protein sequence encoded by the bioATPase gene of the present invention were performed using the B 1 as t program (Has ic 1 oca J Alignment search tool) [Altschul, SF et al. ; 215: 403-10] for homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human BioATPase gene of the present invention is a known nematode Caenorhabdi ti s e¾ ", s') ATP synthase gene, and the accession number encoded by the protein in Genbank is AF099920. The results of the source comparison are shown in Figure 1. The two are highly homologous, with an identity of 41% and a similarity of 59%. This indicates that the novel polypeptide of the present invention has the structure and function of ATP synthase. RT-PCR is used in the examples Methods to clone BioATPase gene

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Q gt'ne's kit, PCR amplification was performed with the following primers:

 Primer 1: 5 '-GGGGGTCCCGGCTGCTCGGC -3' (SEQ ID NO.3)

 Primer 2: 5 '-TGCAGTAATTTAATTTAATA -3' (SEQ ID NO.4)

 Primer 1 is the forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1; Primer 2 is the reverse sequence of the: ') end in SEQ ID NO: 1.

Amplification reaction conditions: 50μ1 reaction volume containing 50mmol / L KC1, 10mmol / L Tris-Cl, (pHH. N), 1.5mmol / L MgC12, 200μπιο1 / ί dNTP, lOpmol primer, 1U Taq DNA polymerization Enzyme ((Ίπη ι L'uh ^ company products) „25 cycles on the PE% 00 DM thermal cycler (Perkin-Elmer) under the following conditions: 94 ° C 30sec; 55 ° C, 30sec; 72 ° C 2min. At the same time, set β-actin as a positive control and template blank as a negative control at the time of RT-PCR. The amplification product was purified using a QIAGEN kit and connected to a pCR vector using a TA clone kit (Invitrogen product). ). The DNA sequence analysis results show that the [) NA sequence of the PCR product is exactly the same as the 1-3845bp shown in SEQ ID NO: 1. Example 4: Analysis of BioATPase gene expression by Northern blotting:

 Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue was homogenized with 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49 : 1), centrifuge after mixing. The aqueous phase was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RNA precipitate. The resulting precipitate was washed with 70% ethanol, dried and dissolved in water.

Using 20 μ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-1 mM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. Preparation ³² P- DNA probe labeled with α_ ³² Ρ dATP by random priming method. The DNA probe used was the PCO amplified Bi oATPase coding region sequence (97bp to 1137bp) shown in SEQ. Hybridize a ³² P-labeled probe (approximately 2 x 10 ⁶ cpm / m) with an RNA-transferred nitrocellulose membrane at 42 ° C overnight in a solution containing 50% formamide-25mM KH, P () _ _; (pH7.4.) -5xSSC-5xDenhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSOO. 1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant BioATPase

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

 Primers: 3: 5,-CCCGGATCCCGGGCGGAGGGGCTGGGGAC -3 '(SEQ ID No 5)

 Primer 4: 5 '-CCCGCGGCCGCAACTCACTGTGTCGCCCCAT -3' (SEQ ID No 6)

The 5 'ends of these two primers contain BamHI and Ncol restriction sites, respectively, followed by the coding sequences of the 5 and 3' ends of the target gene, respectively. The BamHI and Ncol restriction sites correspond to the expression vector plasmid pET_28b (+) ( Novagen product, Cat. No. 69865. 3). The PCR reaction was performed using the pBS 0504ίΐϋ2 plasmid containing the full-length target gene as a template. PCR reaction conditions were: total volume of 50μ1 containing pBS_0504g () 2 Plasmid 10pg, Wo port bow Bow I was 3 I was 4 points to another lj l Opmmol, Advantage polymerase Mi x ( Cl ontech _Products) ΐ μ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. The amplified product and plasmid pET-28 (+) were double-digested with BamH I and Nco l, respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli Dh5a using the calcium chloride method. After being cultured overnight on an LB plate containing kanamycin (final concentration 3 (^ _g / ml)), positive clones were screened by colony PCR method and sequenced. Correct positive clone (pET-0504 _g 02) The recombinant plasmid was transformed into E. coli BL21 (I) E3) pl ySs (product of Novagen) by the calcium chloride method. In a LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21 (pET-0504 _g 02) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 υ Ι Ι Λ, continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain chromatograms. Purified the target protein BioATPase. After SDS-PAGE electrophoresis, a single band was obtained at 38 kl) a. The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6: Production of anti-BioATPa.se antibodies

 The following peptides specific to BioATPase were synthesized using a peptide synthesizer (product of PE):

Met-Lys-Cys-Thr-Ala-Val-Leu-Cys-Cys-Arg-Met-Ala-Pro-Leu-Gln (SEQ ID NO: 7). The polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: _{Avr ameiiS} , et aJ. Immunochemistry, 1969; 6:43. Rabbits were immunized with ½ _{g of} the hemocyanin-peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. The titer of antibody in rabbit serum was determined by ELISA using a titer plate coated with _15μK ^ / ml bovine serum albumin polypeptide complex. Total protein Ig was isolated from antibody-positive rabbit serum using protein A-Sepharo.se. The peptide was bound to a cyanogen bromide-activated Sepharose 4B column, and anti-peptide antibodies were isolated from total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to BioATPase.

 (1) General information:

 (i) Title of invention: New human ATP synthase and its coding sequence

 (ii) Number of sequences: 7

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

 (A) Length: 3845bp

 (B) Type: Nucleic acid

 (C) Chain: double stranded

 (D) Topological structure: linear

 (ii) Molecular type: cDNA

 (iii) Sequence description: SEQ ID NO: 1:

4 I (; L 'CCAGGTGTCI ^'ATC'rGACTTGGGG'rGTGCrGCAGGAAAGAG'rGATGACCCGCAGC'rA

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 34S amino acids

 (B) Type: Amino acid

 (()) Topology: Linear

 (ii) Molecular type: peptide

 (iii) Sequence description: SE (J ID NO: 2:

1 Met Lys Cys Thr Ala Val Leu Cys Cys Arg Met Ala Pro Leu GJn6 L.ys Ala Gin He Val Arg Met Val Lys Asn Leu Lys Gly Ser Pro1 J l Thr Leu Ser JJ e Gly Asp Gly Ala Asn Asp Val Ser Mel lieB L, eu Glu Ser His Val Gly lie Gly He Lys Gly Lys Glu (; J y Ar «1 (iln Ala Ala Ar ^ Asn Ser Asp Tyr Ser Val Pro Lys Phe Lys His 76 Leu Lys Lys Leu Leu Leu Ala His Gly His Leu Tyr Tyr Val Aru

91 lie Ala His Leu Val Gin Tyr Phe Phe Tyr Lys Asn Leu Cys Phe

106 H Leu Pro Gin Phe Leu Tyr Gin Phe Phe Cys Gly Phe Ser Gin

121 Gin Pro Leu Tyr Asp Ala Ala Tyr Leu Thr Met Tyr Asn lie Cys

1 6 Phe Thr Ser Leu Pro lie Leu Ala Tyr Ser Leu Leu Glu Gin His

151 He Asn lie Asp Thr Leu Thr Ser Asp Pro Arg Leu Tyr Met Lys

166 He Ser Gly Asn Ala Met Leu Gin Leu Gly Pro Phe Leu Tyr Trp

181 Thr Phe Leu Ala Ala Phe Glu Gly Thr Val Phe Phe Phe Gly Thr

196 Tyr Phe Leu Phe Gin Thr Ala Ser Leu Glu Glu Asn Gly Lys Val

211 Tyr Gly Asn Trp Thr Phe Gly Thr lie Val Phe Thr Val Leu Val

226 Phe Thr Val Thr Leu Lys Leu Ala Leu Asp Thr Arg Phe Trp Thr

241 Trp He Asn His Phe Val lie Trp Gly Ser Leu Ala Phe Tyr V J

256 Phe Phe Ser Phe Phe Trp Gly Gly lie lie Trp Pro Phe Leu Lys

271 Gin Gin Arg Met Tyr Phe Val Phe Ala Gin Met Leu Ser Ser Val

286 Ser Thr Trp Leu Ala lie lie Leu Leu lie Phe lie Ser Leu Phe

301 Pro Glu lie Leu Leu lie Val Leu Ly-s Asn Val Arg Arg Arg Ser

316 Ala Arg Val Thr Lys Arg Leu Pro Ser Ser Gly Thr Ser Ala He

331 Phe Met Leu Ser Gin Thr Ser Ser Asn His Ser Phe Ser Trp Ser

Glu

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 20 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID 3:

 (; GGGGTCCCGGCTGCTCGGC 20

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 20 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

(1)) Topological structure: linear (ii) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID NO 4:

 TGCAGTAATTTAATTTAATA 20

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 29 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID NO

 CC; (; ATCCCGGGCGGAGGGGCTGGGGAC

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 31 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (ii) Molecular type: Oligonucleotide

 (iii) Sequence description: SEQ ID NO: 6

 CCaiCGGCCGCAACTCACTGTGTCGCCCCAT

Information of (H) SEg ID NO: 7:

 (i) Sequence characteristics:

 (A) Length: 15 amino acids

 (B) Type: Amino acid

 (1)) Topological structure: linear

 (Π) Molecular type: Polypeptide

 (iii) Sequence description: SEQ ID NO: 7:

Met-Lys-Cys-Thr-Ala-Val-Leu-Cys-Cys-Arg-Met-Ala-Pro-Leu-Gln 15

Claims

 Request for Rights

1. An isolated human BioATPase polypeptide, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO. 2, or a fragment, analog, or derivative of a polypeptide thereof.

 2. The polypeptide according to claim 1, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO. 2 or a derivative thereof with an amino acid variation not exceeding 5%.

 3. The polypeptide according to claim 2, characterized in that it is a polypeptide having the amino acid sequence shown in SEQ ID NO.

 4. An isolated polynucleotide, characterized in that said polynucleotide is selected from the group consisting of:

( _a ) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO. 2 or a fragment, analog, or derivative thereof;

 (h) a polynucleotide complementary to polynucleotide (a);

 () A polynucleotide that is at least 70% identical to (a) or (h).

 5. The polynucleotide according to claim 4, wherein the polynucleotide is a polynucleotide encoding an amino acid sequence represented by SEQ ′ ′.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide is a sequence having positions 97-1 to Π7 in SEQ ID NO. 1 or 1 to 3845 in SEQ ID NO. 1. Sequence of bits.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant vector constructed from the polynucleotide according to claim 4 and a plasmid, virus or carrier expression vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7;

 (b) a host cell transformed or transduced with the polynucleotide of claim 4.

 A method for preparing a polypeptide having BioATPa.se activity, characterized in that the method includes:

 (u) culturing the engineered host cell of claim 8 under conditions suitable for expression of BioATPase; (b) isolating a polypeptide having BioATPase activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to BioATPase.

 1 1. A compound that mimics or regulates the activity or expression of a polypeptide, characterized by f, which is an active compound that mimics Bi A'I'pM s, or a compound that promotes the activity of BioATPa.se, or a compound that antagonizes the activity of BioATPase, Or a compound that inhibits the activity of Bi oATPase.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO.1.

 1: The application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of BinATPs in vivo and in vitro.

14. A method for detecting a disease or disease susceptibility related to the Bi oATPa.se polypeptide according to claim 1, It is characterized by detecting the related disease or susceptibility of the disease by a method selected from the group consisting of: (a) indirectly or directly detecting whether the expression level of the polypeptide is abnormal;

 (h) detecting indirectly or directly whether the activity of the polypeptide is abnormal;

 (c) directly or indirectly detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide 15 5. The use of the polypeptide according to claim 1, characterized in that it is used to screen a simulation of Bi oATPase Substances, agonists, antagonists or inhibitors; or for identification of peptide fingerprints.

 1. The use of a nucleic acid molecule according to claim 4, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or used for manufacturing a gene chip or a microarray.

 17. A pharmaceutical composition, characterized in that it contains a safe and effective amount of the polypeptide according to claim 1 and / or the polynucleotide according to claim 4 and a pharmaceutically acceptable carrier.

 1 «The use of the polypeptide according to claim 1, characterized in that the polypeptide is used to prepare a medicament for treating diseases such as degenerative diseases of the nervous system, muscle diseases, immune disorders, cancer and the like.