WO2001018198A1 - Clonage, expression et caracterisation du gene spg4 responsable de la forme la plus frequente de paraplegie spastique autosomique dominante - Google Patents
Clonage, expression et caracterisation du gene spg4 responsable de la forme la plus frequente de paraplegie spastique autosomique dominante Download PDFInfo
- Publication number
- WO2001018198A1 WO2001018198A1 PCT/FR2000/002433 FR0002433W WO0118198A1 WO 2001018198 A1 WO2001018198 A1 WO 2001018198A1 FR 0002433 W FR0002433 W FR 0002433W WO 0118198 A1 WO0118198 A1 WO 0118198A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- seq
- nucleic acid
- sequences
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
Definitions
- the invention relates to the identification and characterization of the SPG4 gene coding for spastin, responsible for the most frequent form of autosomal dominant familial spastic paraplegia (PSF), the cloning and characterization of its cDNA and the corresponding polypeptides.
- the invention also relates to vectors, transformed cells and transgenic animals as well as diagnostic methods and kits, and methods of selecting a chemical or biochemical compound capable of interacting directly or indirectly with a polypeptide according to the invention. .
- PSF Family spastic paraplegias
- PSF can be transmitted in the autosomal dominant (PSF-AD), autosomal recessive (PSF-AR) or linked to the X chromosome (PSF-X) mode.
- PSF-AD autosomal dominant
- PSF-AR autosomal recessive
- PSF-X linked to the X chromosome
- PSFs are also characterized by significant genetic heterogeneity.
- loci In the case of PSF-AD, four loci have been identified to date on the chromosomes 14 (locus SPG3) (Hazan et al., 1993), 2 (locus SPG4) (Hazan et al., 1994; Hentali et al., 1994), 15 (locus SPG6) (Fink et al., 1995) and 8 (locus SPG8) (Hedera et al., 1999).
- locus SPG7 which codes for paraplegin, a mitochondrial ATPase of the protein family of AAA (for “ATPases Associated with diverse cellular Activities”) (Confalonieri et al., 1995 ) have been associated with complex and pure forms of PSF-AR (Casari et al., 1998).
- the subject of the invention is therefore the identification and characterization of the SPG4 (or SPAST) gene coding for a new nuclear member of the AAA family, responsible for the most frequent form of PSF-AD.
- the subject of the present invention is a purified or isolated nucleic acid from the SPG4 gene, characterized in that it comprises at least 15 consecutive nucleotides, preferably 20, 25, 30, 35, 40, 45, 50, 75, 100 or 200 consecutive nucleotides, of a sequence chosen from the group comprising: - the sequence SEQ ID No. 1, genomic sequence of the human SPG4 gene;
- the present invention relates, of course, to both the DNA and RNA sequences as well as the sequences which hybridize with them, as well as the corresponding double-stranded DNAs.
- nucleic acid nucleic or nucleic acid sequence, polynucleotide, oligonucleotide, polynucleotide sequence, nucleotide sequence, terms which will be used interchangeably in the present description, is intended to denote both double-stranded DNA, single-stranded DNA and products of transcription of said DNAs, and / or a fragment of RNA, said isolated natural fragments, or of synthesis, comprising or not non-natural nucleotides, designating a precise sequence of nucleotides, modified or not, making it possible to define a fragment or a region of a nucleic acid.
- DNA fragment and / or of isolated or synthetic natural RNA comprising or not non-natural nucleotides, a precise sequence of nucleotides, modified or not, making it possible to define a fragment, a segment or a region of a nucleic acid.
- genomic nucleotide sequences in their natural chromosomal environment, that is to say in the natural state.
- sequences which have been isolated and / or purified that is to say that they have been taken directly or indirectly, for example by copying, their environment having been at least partially modified.
- “Homologous nucleic acid sequence” will be understood to denote the nucleic acid sequences exhibiting, with respect to the reference nucleic acid sequence, certain modifications such as in particular a deletion, a truncation, an elongation, a chimeric fusion, and / or a mutation, notably a point mutation, and whose nucleic sequence has at least 80%, preferably 90% or 95%, of identity after alignment with the reference nucleic sequence.
- percentage of identity between two nucleic acid or amino acid sequences within the meaning of the present invention is meant a percentage of identical nucleotides or amino acid residues between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length.
- Sequence comparisons between two nucleic acid or amino acid sequences are traditionally carried out by comparing these sequences after having optimally aligned them, said comparison being carried out by segment or by "comparison window” to identify and compare the regions. sequence similarity locale.
- the optimal alignment of the sequences for comparison can be achieved, besides manually, by means of the local homology algorithm of Smith and Waterman (1981) [Ad. App. Math.
- the percentage of identity between two nucleic acid or amino acid sequences is determined by comparing these two optimally aligned sequences per comparison window in which the region of the acid sequence nucleic acid or amino acid to be compared can include additions or deletions with respect to the reference sequence for optimal alignment between these two sequences.
- the percentage of identity is calculated by determining the number of identical positions for which the nucleotids or the amino acid residue is identical between the two sequences, by dividing this number of identical positions by the total number of positions in the comparison window. and multiplying the result obtained by 100 to obtain the percentage of identity between these two sequences.
- BLAST 2 sequences (Tatusova et al., "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol. Lett. 174: 247-250) available on the site http://www.ncbi.nlm.nih.gov/gorf/bl2.html, the parameters used being those given by default (in particular for the parameters "open gap penaltie”: 5, and “extension gap penaltie” : 2; the chosen matrix being for example the “BLOSUM 62” matrix proposed by the program), the percentage of identity between the two sequences to be compared being calculated directly by the program.
- sequences whose complementary sequences are capable of hybridizing specifically with one of the sequences of the invention are preferably sequences whose complementary sequences are capable of hybridizing specifically with one of the sequences of the invention.
- the specific hybridization conditions or high stringency will be such that they ensure at least 80%, preferably 90% or 95% identity after alignment between one of the two sequences and the complementary sequence of the other.
- Hybridization under conditions of high stringency means that the conditions of temperature and ionic strength are chosen in such a way that they allow hybridization to be maintained between two complementary DNA fragments.
- conditions of high stringency of the hybridization step for the purpose of defining the polynucleotide fragments described above are advantageously as follows.
- DNA-DNA or DNA-RNA hybridization is carried out in two stages: (1) prehybridization at 42 ° C for 3 hours in phosphate buffer (20 mM, pH 7.5) containing 5 x SSC (1 x SSC corresponds to a 0.15 M NaCl + 0.015 M sodium citrate solution), 50% formamide, 7% sodium dodecyl sulfate (SDS), 10 x Denhardt's, 5% dextran sulfate and 1% salmon sperm DNA; (2) actual hybridization for 20 hours at a temperature depending on the size of the probe (ie: 42 ° C, for a probe of size> 100 nucleotides) followed by 2 washes of 20 minutes at 20 ° C in 2 x SSC + 2% SDS, 1 wash for 20 minutes at 20 ° C in 0.1 x SSC + 0.1% SDS.
- the last wash is carried out in 0.1 x SSC + 0.1% SDS for 30 minutes at 60 ° C for a probe of size> 100 nucleotides.
- the high stringency hybridization conditions described above for a polynucleotide of defined size will be adapted by a person skilled in the art for oligonucleotides of larger or smaller size, according to the teaching of Sambrook et al., 1989.
- the term “variant nucleic acid sequence” or “variant nucleic acid” of a reference nucleic acid sequence is intended to denote the set of nucleic acid sequences corresponding to allelic variants, that is to say individual variations of the nucleic acid sequence of reference. These natural mutated sequences correspond to polymorphisms present in mammals, in particular in humans and, in particular, to polymorphisms which can lead to the occurrence and / or development of pathology.
- sequences according to the invention relate to the normal sequences, they also relate to the mutated sequences insofar as they comprise at least one point mutation and preferably at most 10% of mutations with respect to the normal sequence.
- the variant nucleic sequences will comprise any sequence of at least 15 consecutive nucleotides, preferably 20, 25, 30, 50, 100 or 200 consecutive nucleotides, of a polymorphic sequence of the genomic sequence of the human SPG4 gene of sequence SEQ ID No. 1, and whose nucleic acid sequence has, with respect to the sequence SEQ ID No. 1, at least one mutation corresponding in particular to a truncation, deletion, substitution and / or addition of amino acid residue.
- the variant nucleic sequences presenting at least one mutation will here be linked to pathologies of the PSF-AD type linked to the SPG4 locus.
- the present invention relates to mutated nucleic acid sequences in which the mutations lead to a modification of the amino acid sequence of the polypeptide encoded by the normal sequence.
- the invention relates to a purified or isolated nucleic acid from the SPG4 gene according to the invention, characterized in that it comprises a sequence chosen from the group comprising: a) the sequence SEQ ID No. 1, the sequence SEQ ID No. 2, the sequence SEQ ID No. 72, the sequence SEQ ID No. 106 or the sequence of at least 15, preferably 20, 25, 30, 35, 40, 45, 50, 75, 100 or 200 consecutive nucleotides of the sequence SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 72 or SEQ ID No. 106; b) the homologous nucleic sequences or variants of the sequences SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 72 or SEQ ID No. 106; and c) the complementary sequence or the RNA sequence corresponding to the sequences as defined in a) and b), preferably with the exception of the nucleic acid identified in the GenBank database under the accession number AB029006.
- the nucleic acid whose sequence is disclosed in the GenBank database under the accession number AB029006, corresponds to the sequence of one of the 100 cDNAs from a human brain mRNA library identified by the
- the invention relates to a purified or isolated nucleic acid according to the invention, characterized in that it comprises at least one sequence of at least 15 consecutive nucleotides, preferably 20, 25, 30, 50 or 75 consecutive nucleotides of the nt 714-809 fragment, ends included, of the sequence SEQ ID No. 2, of its complementary sequence or of the sequence of its corresponding RNA.
- the invention preferably relates to a purified or isolated nucleic acid according to the present invention, characterized in that it comprises a sequence chosen from the following group:
- sequence SEQ ID No. 72 representing the sequence of the incomplete cDNA coding for the murine spastin represented in FIG. 5, line "Mouse” and SEQ ID No 106 its complete sequence;
- the invention relates to a purified or isolated nucleic acid according to the invention, characterized in that it comprises at least one mutation corresponding to a natural polymorphism in humans, in particular whose position and nature are identified in the table 5.
- the primers or probes characterized in that they comprise a sequence of a nucleic acid according to the invention, also form part of the invention.
- the present invention thus relates to all of the primers which can be deduced from the nucleotide sequences of the invention and which can make it possible to demonstrate said nucleotide sequences of the invention, in particular the mutated sequences, using in particular a method of amplification such as the PCR method, or a related method.
- the present invention also relates to all of the probes which can be deduced from the nucleotide sequences of the invention, in particular sequences capable of hybridizing with them, and which can make it possible to demonstrate said nucleotide sequences, in particular to discriminate between normal sequences of the mutated sequences.
- the present invention relates in particular to the probes or primers of sequences chosen from the sequences SEQ ID No. 4 to SEQ ID No. 71.
- the invention also relates to the use of a nucleic acid sequence according to the invention as probe or primer, for the detection, identification, assay or amplification of nucleic acid sequence.
- the polynucleotides which can be used as probe or as primer in methods of detection, identification, assay or amplification of nucleic sequence will have a minimum size of 15 bases, preferably 20 bases, or better from 25 to 30 bases.
- probes and primers according to the invention can be labeled directly or indirectly with a radioactive or non-radioactive compound by methods well known to those skilled in the art, in order to obtain a detectable and / or quantifiable signal.
- the unlabeled polynucleotide sequences according to the invention can be used directly as a probe or primer.
- sequences are generally marked to obtain sequences which can be used for numerous applications.
- the labeling of the primers or probes according to the invention is carried out with radioactive elements or with non-radioactive molecules.
- Non-radioactive entities are selected from ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, agents luminescent such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
- the polynucleotides according to the invention can thus be used as a primer and / or probe in methods using in particular the technique of PCR (polymerase chain reaction) (Erlich, 1989; Innis et al., 1990, and Rolfs and al., 1991).
- This technique requires the choice of pairs of oligonucleotide primers framing the fragment which must be amplified.
- the amplified fragments can be identified, for example after agarose or polyacrylamide gel electrophoresis, or after a chromatographic technique such as gel filtration or ion exchange chromatography, and then sequenced.
- the specificity of the amplification can be controlled by using, as primer, the nucleotide sequences of polynucleotides of the invention as template, plasmids containing these sequences or else the derived amplification products.
- the amplified nucleotide fragments can be used as reagents in hybridization reactions in order to demonstrate the presence, in a biological sample, of a target nucleic acid of sequence complementary to that of said amplified nucleotide fragments.
- the invention also relates to the nucleic acids capable of being obtained by amplification using primers according to the invention.
- PCR-like will be understood to mean all the methods implementing direct or indirect reproductions of the nucleic acid sequences, or else in which the labeling systems have been amplified, these techniques are of course known, in general these are amplification of DNA with a polymerase; when the original sample is an RNA, a reverse transcription should be carried out beforehand.
- thermostable ligase in 1991, which uses a thermostable ligase, the RCR technique (Repair Chain Reaction) described by Segev in 1992, the CPR technique (Cycling Probe Reaction) described by Duck et al. in 1990, the Q-beta-replicase amplification technique described by Miele et al. in 1983 and improved in particular by Chu et al. in 1986 and Lizardi et al. in 1988, then by Burg et al. as well as by Stone et al. in 1996.
- RCR Repair Chain Reaction
- CPR Cycling Probe Reaction
- the target polynucleotide to be detected is an mRNA
- an enzyme of reverse transcriptase type in order to obtain a cDNA from the mRNA contained in the biological sample.
- the cDNA obtained will then serve as a target for the primers or probes used in the amplification or detection method according to the invention.
- the probe hybridization technique can be carried out in various ways
- the most general method consists in immobilizing the nucleic acid extracted from cells of different tissues or cells in culture on a support (such as nitrocellulose, nylon, polystyrene) and incubating, under well defined conditions, the target nucleic acid immobilized with the probe. After hybridization, the excess probe is eliminated and the hybrid molecules formed are detected by the appropriate method (measurement of radioactivity, fluorescence or enzymatic activity linked to the probe).
- a support such as nitrocellulose, nylon, polystyrene
- the latter can be used as a capture probe.
- a probe called a “capture probe”
- a probe is immobilized on a support and is used to capture by specific hybridization the target nucleic acid obtained from the biological sample to be tested and the target nucleic acid is then detected.
- a second probe called a “detection probe”, marked by an easily detectable element.
- sequences according to the present invention of splice acceptor or donor site identified in Table 3 also form part of the present invention.
- the invention includes a method for screening cDNA or genomic DNA libraries, or for cloning isolated cDNA or genomic coding for spastin, characterized in that it implements a nucleic sequence according to the invention.
- these methods we can cite in particular: - screening of cDNA libraries and cloning of isolated cDNAs (Sambrook et al., 1989; Suggs et al., 1981; Woo et al., 1979), using nucleic acid sequences according to the invention; - screening of genomic libraries, for example BACs (Chumakov et al., 1992; Chumakov et al., 1995) and possibly a genetic analysis in FISH (Cherif et al., 1990) using sequences according to invention, allowing the isolation and the chromosomal localization, then the complete sequencing of the SPG4 gene coding for the spastin.
- these methods according to the invention may be used for the identification and thus the obtaining of the genomic
- screening and / or cloning methods will in particular comprise a step of hybridization of a nucleic acid according to the invention with a nucleic acid contained in a genomic or cDNA library.
- the invention also includes a method for identifying the nucleic acid sequences which promote and / or regulate the expression of the SPG4 gene of sequence SEQ ID No. 1, characterized in that it uses a nucleic acid according to the invention. 'invention.
- the computer tools available to those skilled in the art allow him easily to identify, from the genomic nucleic sequences according to the invention, the promoter regulatory boxes necessary and sufficient for the control of gene expression, in particular the TATA, CCAAT boxes, GC, as well as the stimulatory (“enhancer”) or inhibitory (“silent”) regulatory sequences which control in CIS the expression of the genes according to the invention; among these regulatory sequences, mention should be made of TIRE, MRE, CRE.
- the invention also relates to methods for the identification of mutations carried by the human SPG4 gene, characterized in that they use a nucleic sequence according to the invention, in particular of mutations responsible for autosomal dominant familial spastic paraplegia.
- These methods of identifying these mutations will in particular include the following steps: (i) isolation of the DNA from the biological sample to be analyzed, or obtaining a cDNA from the mRNA of the biological sample ; (ii) specific amplification of the target DNA capable of presenting a mutation using primers according to the invention; (iii) analysis of the amplification products, in particular the size and / or the sequence of the amplification products, with respect to a reference sequence.
- the expression mutation identification methods according to the invention is also intended to denote a method making it possible to obtain the nucleic acid on which said mutation has been identified.
- Also part of the invention are the promoter and / or regulatory sequences of the SPG4 gene according to the invention having mutations capable of modifying the expression of the corresponding protein.
- Spg4 is intended to denote the mouse gene homologous to the human SPG4 gene.
- the use of a nucleic acid sequence according to the invention as probe or primer for the screening of genomic library or cDNA is of course part of the object of the present invention.
- the invention comprises a purified or isolated polypeptide encoded by a nucleic acid according to the invention, preferably with the exception of the peptide of 584 amino acids whose sequence is identified in the GenBank database under the number of accession AB029006.
- polypeptide will be used to also denote a protein or a peptide.
- the present invention relates to a polypeptide according to the invention, characterized in that it comprises an amino acid sequence chosen from the following group:
- sequence SEQ ID No. 3 corresponding to the human spastin coded by the sequence SEQ ID No. 2 of the cDNA of the human SPG4 gene;
- sequence SEQ ID No. 73 corresponding to a fragment of the murine spastin encoded by the sequence SEQ ID No. 72 of the incomplete cDNA of the mouse Spg4 gene, the sequence SEQ ID No. 73 is represented in FIG. 4A , line "SPAST_MOUSE";
- the invention relates to a polypeptide according to the invention, characterized in that it comprises an amino acid sequence chosen from the group comprising: a) the sequence SEQ ID No. 3, the sequence SEQ ID No. 73, the sequence SEQ ID No. 107 or the sequence of at least 10 consecutive amino acids of one of these sequences; and b) the homologous sequences or variants of the sequences SEQ ID No. 3, SEQ ID No. 73 or SEQ ID No; 107.
- the invention relates to a polypeptide according to the invention, characterized in that it comprises the sequence of at least 8, preferably at least 10, 15, 20 or 30 consecutive amino acids of the sequence of fragment aa 197-228, ends included, of the sequence SEQ ID No. 3.
- the subject of the invention is a polypeptide according to the invention, characterized in that it comprises an amino acid sequence chosen from the following group: - the sequence SEQ ID No. 3, the sequence SEQ ID No. 73 and the sequence SEQ ID No.
- the invention does not relate to polypeptides in natural form, that is to say that they are not taken in their environment. Indeed, the invention relates to peptides obtained by purification from natural sources, or else obtained by genetic recombination, or else by chemical synthesis and which can then comprise unnatural amino acids.
- the production of a recombinant polypeptide, which can be carried out using one of the nucleotide sequences according to the invention is particularly advantageous since it makes it possible to obtain an increased level of purity of the desired polypeptide.
- homologous polypeptide is intended to denote the polypeptides exhibiting certain modifications with respect to the reference polypeptide, such as in particular one or more deletions, truncations, an elongation, a chimeric fusion, and / or one or more substitutions, and the sequence of which is amino acids has at least 80%, preferably 90% or 95%, identity after alignment with the reference amino acid sequence.
- variant polypeptide (or protein variant) is intended to denote all of the polypeptides encoded by the variant nucleic sequences as defined above.
- the variant polypeptides will include any polypeptide encoded by the mutated genomic sequence of the SPG4 gene of sequence SEQ ID No. 1, and whose amino acid sequence has at least one mutation corresponding in particular to truncation, deletion, substitution and / or addition of amino acid residues relative to the sequence SEQ ID No. 3.
- the variant polypeptides having at least one mutation will be linked to pathologies of the PSF-AD type.
- variant polypeptide will also be understood to mean any polypeptide resulting from mutation of a splicing site in the genomic nucleic sequence SEQ ID No. 1.
- the invention also includes the cloning and / or expression vectors containing a nucleic acid sequence according to the invention.
- the vectors according to the invention characterized in that they comprise the elements allowing the expression and / or the secretion of said sequences in a host cell, or even a cell addressing sequence, also form part of the invention.
- Said vectors will preferably comprise a promoter, translation initiation and termination signals, as well as suitable regions for regulating transcription. They must be able to be maintained stably in the cell and may possibly have particular signals specifying the secretion of the translated protein.
- control signals are chosen according to the cellular host used.
- the nucleic acid sequences according to the invention can be inserted into vectors with autonomous replication within the chosen host, or vectors integrative of the chosen host.
- plasmid or viral type systems will preferably be used depending on the host cell, the viral vectors possibly being in particular adenoviruses (Perricaudet et al., 1992), retroviruses, lentiviruses, poxvirus or herpesvirus (Epstein et al., 1992).
- viruses When it is desired to integrate the sequence into the chromosomes of the host cell, use may be made, for example, of systems of the plasmid or viral type; such viruses will be, for example, retroviruses (Temin, 1986), or AAVs (Carter, 1993).
- naked polynucleotides such as naked DNA or naked RNA are preferred according to the technique developed by the company VICAL, artificial yeast chromosomes (YAC) for expression in yeast, mouse artificial chromosomes (MAC) for expression in murine cells and preferably human artificial chromosomes (HAC, human artificial chromosome) for expression in human cells.
- YAC artificial yeast chromosomes
- MAC mouse artificial chromosomes
- HAC human artificial chromosomes
- Such vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into an appropriate host by standard methods, such as for example lipofection, electroporation, heat shock.
- the invention furthermore comprises the host cells, in particular the eukaryotic and prokaryotic cells, transformed by the vectors according to the invention as well as the transgenic animals, except Man, comprising one of said cells transformed according to the invention.
- a preferred cellular host for the expression of the proteins of the invention consists of CHO cells.
- mice such as mice, rats or rabbits are preferred, expressing a polypeptide according to the invention.
- those comprising a transformed cell characterized in that the sequence of at least one of the two alleles of the SPG4 gene contains at least one of the mutations corresponding to a natural polymorphism in humans, in particular those whose nature and location are identified in Table 5 below or those which can be identified by the identification methods of mutation of the SPG4 gene according to the present invention.
- mice such as mice, rats or rabbits are also preferred, characterized in that the gene coding for the spastin according to the invention, is not functional or is invalidated.
- transgenic animals having at least one of their two allelic sequences of the SPG4 gene, at least one of the mutations whose position and nature are identified in Table 5 or identified by a method according to the present invention.
- These transgenic animals are obtained for example by homologous recombination on embryonic stem cells, transfer of these stem cells to embryos, selection of the affected chimeras at the level of the reproductive lines, and growth of said chimeras; - transgenic animals (preferably mice) overexpressing the SPG4 gene into which one of said mutations according to the invention may be introduced.
- mice are obtained for example by transfection of a copy of this gene under the control of a strong promoter of ubiquitous nature, or selective for a type of tissue, or after viral transcription; - transgenic animals (preferably mice) rendered deficient for the SPG4 gene according to the invention, by inactivation using the LOXP / CRE recombinase system (Rohlmann et al., 1996) or any other system for inactivation of the expression of this gene.
- LOXP / CRE recombinase system Roshlmann et al., 1996) or any other system for inactivation of the expression of this gene.
- the cells and mammals according to the invention can be used in a method for producing a polypeptide according to the invention, as described below, and can also serve as an analytical template and for DNA library screening
- the transformed cells or mammals as described above can thus be used as models in order to study the interactions between the polypeptides according to the invention, and the chemical or protein compounds, involved directly or indirectly in the activities of the polypeptides according to the invention, this in order to study the different mechanisms and interactions involved.
- the polypeptides according to the invention can be used for the selection of products interacting with the polypeptides according to the invention, in particular the human spastin of sequence SEQ ID No. 3 or its variants according to the invention, as cofactor, or inhibitor, in particular competitive, or else having an agonist or antagonist activity of the activity of the polypeptides according to the invention.
- said transformed cells or transgenic animals will be used as a model allowing, in particular, the selection of products making it possible to combat the pathology linked to the SPG4 gene mentioned above.
- the invention also relates to the use of a cell, mammal or polypeptide according to the invention for the screening of chemical or biochemical compound which can interact directly or indirectly with the polypeptides according to the invention, and / or capable of modulating the expression or the activity of these polypeptides.
- the invention also relates to the use of a nucleic acid sequence according to the invention for the synthesis of recombinant polypeptides.
- the method for producing a polypeptide of the invention in recombinant form is itself included in the present invention, and is characterized in that the transformed cells, in particular the cells or mammals of the present invention, are cultivated in conditions allowing the expression of a recombinant polypeptide encoded by a nucleic acid sequence according to the invention, and that said recombinant polypeptide is recovered.
- Recombinant polypeptides characterized in that they are capable of being obtained by said production method, also form part of the invention.
- the recombinant polypeptides obtained as indicated above can be both in glycosylated and non-glycosylated form and may or may not have the natural tertiary structure.
- polypeptides can be produced from the nucleic acid sequences defined above, according to the techniques for producing recombinant polypeptides known to those skilled in the art.
- the acid sequence nucleic acid used is placed under the control of signals allowing its expression in a cellular host.
- An efficient system for producing a recombinant polypeptide requires having a vector and a host cell according to the invention. These cells can be obtained by introducing into host cells a nucleotide sequence inserted into a vector as defined above, then culturing said cells under conditions allowing replication and / or expression of the transfected nucleotide sequence.
- the recombinant polypeptide purification methods used are known to those skilled in the art.
- the recombinant polypeptide can be purified from cell lysates and extracts, from the culture medium supernatant, by methods used individually or in combination, such as fractionation, chromatography methods, immunoaffinity techniques using 'specific monoclonal or polyclonal antibodies, etc.
- the polypeptides according to the present invention can be obtained by chemical synthesis and this using one of the many known peptide syntheses, for example the techniques using solid phases or techniques using partial solid phases, by condensation of fragments or by synthesis in conventional solution.
- the solid phase synthesis technique is well known to those skilled in the art. See in particular Stewart et al. (1984) and Bodansky (1984).
- polypeptides obtained by chemical synthesis and which may contain corresponding unnatural amino acids are also included in the invention.
- polyclonal antibodies can be obtained from a serum of an animal immunized against the polypeptides according to the invention, in particular produced by genetic recombination or by peptide synthesis, according to the usual procedures.
- the specific monoclonal antibodies can be obtained according to the conventional method of culture of hybridomas described by K ⁇ hler and Milstein, 1975.
- the antibodies according to the invention are, for example, chimeric antibodies, humanized antibodies, Fab or F (ab ′) 2 fragments. They can also be in the form of immunoconjugates or labeled antibodies in order to obtain a signal. detectable and / or quantifiable.
- the invention also relates to methods for the detection and / or purification of a polypeptide according to the invention, characterized in that they use an antibody according to the invention.
- the invention further comprises purified polypeptides, characterized in that they are obtained by a method according to the invention.
- the antibodies of the invention in particular the monoclonal antibodies, can also be used for the detection of these polypeptides in a biological sample.
- polypeptides according to the invention in particular the polypeptide of sequence SEQ ID No. 3 or one of its variants, on sections of specific tissues, by example by immunofluorescence, gold labeling, enzyme immunoconjugates.
- polypeptides may in particular make it possible to demonstrate an abnormal expression of these polypeptides in tissues or biological samples, which makes them useful for monitoring the evolution of the disease and molecular diagnosis.
- the antibodies of the invention can be advantageously used in any situation where the expression of a polypeptide according to the invention, normal or mutated, must be observed.
- Also forming part of the invention are the methods for determining an allelic variability, a mutation, a deletion, a loss of heterozygosity or any genetic anomaly of the SPG4 gene according to the invention, characterized in that they use a nucleic acid sequence or an antibody according to the invention.
- the present invention thus comprises a method for genotypic diagnosis of the pathology associated with the SPG4 gene, characterized in that a nucleic acid sequence according to the invention is used.
- the invention relates to a method for genotypic diagnosis of the disease associated with the presence of at least one mutation in a sequence of the SPG4 gene from a biological sample from a patient, characterized in that it comprises the following steps: a) where appropriate, isolation of the genomic DNA from the biological sample to be analyzed, or obtaining cDNA from the RNA of the biological sample; b) specific amplification of said DNA sequence of the SPG4 gene capable of containing a mutation using primers according to the invention; c) analysis of the amplification products obtained and comparison of their sequence with the corresponding normal sequence of the SPG4 gene.
- the invention also includes a method for diagnosing the disease associated with an abnormal expression of a polypeptide coded by the SPG4 gene, in particular the polypeptide of sequence SEQ ID No. 3, characterized in that one or antibodies according to the invention with the biological material to be tested, under conditions allowing the possible formation of specific immunological complexes between said polypeptide and said antibody (s), and in that any immunological complexes possibly formed are detected and / or quantified .
- These methods aim, for example, at methods of diagnosing PSF-AD associated with the presence of a mutation in the SPG4 gene according to the invention, in particular antenatal, by determining from a biological sample from the patient the presence of mutations in at least one of the sequences described above.
- the nucleic acid sequences analyzed may as well be genomic DNA, cDNA, or mRNA.
- Nucleic acids or antibodies based on the present invention could also be used to allow a positive diagnosis in a patient or a pre-symptomatic diagnosis in a subject at risk, in particular with a family history.
- the methods which make it possible to demonstrate a mutation in a gene relative to the wild-type gene are, of course, very numerous. They can basically be divided into two main categories.
- the first type of method is that in which the presence of a mutation is detected by comparison of the mutated sequence with the corresponding wild-type sequence
- the second type is that in which the presence of the mutation is detected indirectly, for example by evidence of mismatches due to the presence of the mutation.
- These methods can use the probes and primers of the present invention described. They are generally purified hybridization nucleic sequences comprising at least 15 nucleotides, preferably 20, 25 or 30 nucleotides, characterized in that they can hybridize specifically with a nucleic sequence according to the invention. Preferably, the specific hybridization conditions are such as those defined above or in the examples.
- the length of these nucleic acid hybridization sequences can vary from 15, 20 or 30 to 200 nucleotides, particularly from 20 to 50 nucleotides.
- methods for determining an allelic variability, a mutation, a deletion, a loss of heterozygosity or a genetic abnormality preference is given to methods comprising at least one amplification step called PCR.
- the amplified products may be treated with the appropriate restriction enzyme before detecting or assaying the targeted product.
- the mutations in the SPG4 gene according to the invention may be responsible for various modifications to its translation product, modifications which can be used for a diagnostic approach. Indeed, the modifications of antigenicity linked to these mutations can allow the development of specific antibodies. Discrimination of the mutated gene product can be achieved by these methods. All these modifications can be used in a diagnostic approach using several well-known methods based on the use of mono- or polyclonal antibodies recognizing the normal polypeptide or mutated variants, such as for example by RIA or by ELISA.
- the subject of the invention is also a kit or kit necessary for the diagnosis, in particular for the diagnosis of PSF-AD associated with the presence of mutation in the SPG4 gene according to the invention, characterized in that it comprises at least a compound chosen from the following group of compounds: a) a nucleic acid, in particular as a primer or probe, according to the present invention; and b) an antibody according to the invention.
- the invention comprises a method of selecting a chemical or biochemical compound capable of preventing and / or treating PSF-AD associated with the SPG4 gene, characterized in that a sequence d nucleic acid according to the invention, a polypeptide according to the invention, a vector according to the invention, a cell according to the invention, a mammal according to the invention or an antibody according to the invention.
- nucleic acids coding for proteins interacting with the promoter and / or regulatory sequences of the SPG4 gene according to the invention can be screened and / or selected using a simple hybrid system such as that described in the manual accompanying the Matchmaker One kit. -Hybrid System from Clontech
- the invention includes the use of nucleic acid or polypeptide according to the invention, a vector according to the invention, a cell according to the invention, or a mammal according to the invention, for studying the expression or activity of the SPG4 gene.
- FIGURES 1A, 1B and 1C Physical map of the SPG4 interval and genomic organization of SPG4.
- FIGURE 1A The 1.5 Mb candidate region is delimited by the genetic markers D2S352 and D2S2347 indicated in bold characters. The position of polymorphic markers and other STSs is indicated in standard characters while the position of ESTs is indicated in italics.
- the LAC clones constituting the pre-sequencing card are represented by rectangles whose names appear above. above and the precise size of the clone below if it could be determined. The name of BACs A, B, C, ...
- FIGURE 1B Schematic representation of the SPG4 gene which overlaps the
- BACs D (b336P14) and G (B563N4).
- the exons are depicted as black rectangles with their names above.
- FIGURE 1C The five mutations identified in seven families of PSF-AD linked to the SPG4 locus are positioned in exons 7, 11, 13 and in the acceptor splice site of intron 15.
- FIGURE 2 Nucleic and protein sequence of the SPG4 cDNA and of the spastin.
- the 17 vertical bars with a number located below represent the junctions between the different exons.
- the initiating ATG codon is located in position nt 126-128 and the termination STOP codon in position nt 1974-1976.
- Five of the mutations identified to date, including the loss of exon 16, are indicated in italics (nt 1210, nt 1468, nt 1520, nt 1620 and for the loss of exon 16: nt 1813-1853).
- the polyadenylation site is in italics and underlined.
- the putative nuclear location signal (NLS), RGKKK, as well as the three conserved domains predicted by analysis in the ProDom database are respectively located at positions aa7-11 (NLS), aa342-409 (domain 92), aa411 -509 (domain 179) and aa512-599 (domain 6226).
- the four motifs predicted by the sequence comparison in the Prosite database are: two "leucine zippers” motifs at positions aa50-78 and aa508-529, the ATP binding site (or Walker motif A) at positions aa382-389 and the "helix-loop-helix” dimerization domain at positions aa478-486.
- Motives A and B by Walker, "GPPGNGKT” and "IIFIDE”, as well as the minimum AAA consensus are underlined.
- FIGURES 3A and 3B Characterization of a mutation at a splicing site in individuals with three families of PSF-AD linked to the SPG4 locus.
- FIGURE 3A PCR amplification of fragment IV of the SPG4 cDNA from lymphoblast cDNA: well M, size marker VII (Boehringer); well 1, member not affected by family 2992; well 2, patient of family 2992; well 3, non-affected family member 5330; well 4, patient of family 5330; well 5, patient of family 5226; well 6, negative control (human genomic DNA).
- FIGURE 3B Sequence graph of the intron 15 splice acceptor site mutation. Genomic sequence of the control individual above and of a patient in family 2992 below. The asterisk at position nt 1813-4 indicates an A-> C polymorphism which affects an unconserved nucleotide of the intron 15 splice acceptor site in the patient.
- FIGURES 4A and 4B Homologies of the spastin.
- FIGURE 4A Multiple alignment created by CLUSTAL W of eight proteins from various organisms and showing strong sequence homology with human and murine spastins (SEQ ID No. 73).
- FIGURE 4B Alignment by yeast metalloproteases by CLUSTAL W
- FIGURE 5 Alignment by BLASTN of the nucleic sequences of the cDNA SPG4 and of its mouse ortholog Spg4 (SEQ ID No. 72).
- the murine cDNA polyadenylation site is underlined and in italics.
- the STOP codon is located in position nt 1515-1517 in murine cDNA and in position nt 1974-1976 in human cDNA.
- FIGURES 6A, 6B and 6C PCR analysis of the expression of SPG4 and its murine orthologue Spg4.
- FIGURE 6A Collection of cDNAs from multiple mouse tissues.
- Well M size V marker (Boehringer); well 1, heart; well 2, brain; well 3, spleen; well 4, lung; well 5, liver; well 6, skeletal muscle; well 7, kidney; well 8, testicle; well 9, 7-day embryo E7; well 10, 11 day embryo
- FIGURE 6B Collection of cDNAs from multiple human tissues.
- Well M size VII marker (Boehringer); well 1, brain; well 2, heart; well 3, kidney; well 4, liver; well 5, lung; well 6, pancreas; well 7, placenta; well 8, skeletal muscle; well 9, negative control (human genomic DNA); well 10, negative control (no DNA).
- FIGURE 6C Collection of cDNAs from multiple tissues of human fetus.
- Well M size VII marker (Boehringer); well 1, brain; well 2, heart; well 3, kidney; well 4, liver; well 5, lung; well 6, skeletal muscle; well 7, spleen; well 8, thymus; well 9, negative control (human genomic DNA); well 10, negative control (no DNA).
- BACs from two human genomic libraries CITB_978_SKB (marketed by Research Genetics) and RPCI-11 (Osoegawa et al., 1998), and covering the SPG4 interval were selected to be sequenced (Hazan et al., Genomics, 60 (3), 309-19, 1999).
- 40 ⁇ g of the DNA of each BAC was partially digested with the restriction enzyme CviJI (CHIMERx) and separated by electrophoresis on 0.4% LMP agarose gel (FMC).
- DNA fractions varying in size around 3, 5 and 10 kb were eluted with ⁇ -agarase (Biolabs) and ligated to a plasmid vector pBAM3 previously digested with SmaI and dephosphorylated in an IXinsert to 5Xvector ratio. Electrocompetent E. coli DH10B bacteria (GIBCO-BRL) were transformed by electroporation with the different ligations. About 1000 to 1500 subclones per BAC (8 to 10 equivalent genomes) composed of 20% of clones with 10 kb inserts, 40% of clones with 5 kb inserts and 40% of clones with 3 kb inserts have been isolated .
- the ends of the inserts of these clones were sequenced on a LICOR 4200 automatic sequencer.
- the sequences were assembled into a skeleton made up of several contigs using Phred and Phrap software.
- the holes between each contig were sequenced with dideoxynucleotides labeled on an ABI 377 sequencer (PE-Applied Biosystems).
- the exons contained in these sequence contigs have been predicted by the computer programs GRAIL II, GENSCAN, FGENEH and Génie.
- the sequences were also compared in the nucleic and protein databases of the EMBL and GenBank with the BLASTN and BLASTX programs.
- the determination of the promoter sequences was carried out by the computer programs TSSG and TSSW. The results of all these sequence analyzes were visualized by the Genotator sequence annotation program.
- the SPG4 gene cDNA was isolated by 5 'and 3' RACE-PCR experiments on polyA + RNA from fetal brain, adult brain and adult liver using the Marathon cDNA amplification kit (Clontech ), according to the supplier's instructions. A first PCR, followed by an internal PCR were carried out with different pairs of primers whose sequences are indicated in Table 1 below: Table 1 Primers used for RACE-PCR and cDNA amplifications
- SPA_3RACE1 AGGAGCAAGCTGTGGAATGGTATAAG (SEQ ID No.7) nt 550
- SPA_Db TAGCAGTGGCTGCCGCCGT (SEQ ID No.15) nt 45 b + m 655 pb SPA_Dm AAGCGGTCCTTGGCCATAAC (SEQ ID No.16) nt 700 SPA_Dc GGCGGCAGTGAGAGCTGTG (SEQ ID No.17) nt 106 c + n 543ACTTTTBTCTTBTTCTTBTTCT 18) nt 649 SPA_Ad AACAGGCCTTCGAGTACATC (SEQ ID No.19) nt 487 d + n 746 pb SPA_Am CTGTGAACAACTCAGGCCTC (SEQ ID No.20) nt 1233 SPA_Ac ATGAGAAAGCAGGACAGAAG (SEQ ID No.21) ntGAGTAG2A ) nt 1175 SPA_Ba CTACAACTGCTACTCGTAAG (SEQ ID No.23) nt 1036 a + m 763
- SPA_Ca TGGAGATGACAGAGTACTTG (SEQ ID No.27) nt 1550 a + m 766 bp SPA_Cm CTGGAATACTTTCATCTGC (SEQ ID No.28) nt 2316 SPA_Cb ATGAGGCTGTTCTCAGGCG (SEQ ID No.29) nt 1603
- the RACE-PCR products were cloned with the TA-cloning kit (Invitrogen) and the corresponding clones were sequenced on an ABI 377 (PE-Applied Biosystems).
- the sequence of the SPG4 transcript was verified by the sequencing of PCR products amplified from a population of cDNA originating from the lymphoblasts of 6 healthy individuals.
- RNAs were extracted from the lymphoblast lines of an individual affected by the family studied and from 6 control individuals using the RNA PLUSR kit (bioprobe System).
- the synthesis of the cDNA was carried out on 500 ng to 1 ⁇ g of RNA with 100 pmoles of random hexamer primers (Pharmacia) and 200 units of reverse transcriptase Superscript II (Gibco BRL) under standard conditions.
- Four amplifications by PCR, generating overlapping fragments which cover the entire open reading phase of SPG4 were carried out on the cDNAs of the patients and controls.
- Fragment I was amplified with the primers SPA_Db / SPA_Dm, then in internal PCR with the primers SPA_Dc / SPA_Dn. Fragments II, III, and IV were respectively amplified with the primers SPA_Ad / SPA_Am, SPA_Ba / SPA_Bm and SPA_Ca / SPA_Cm (cf. the sequences of these primers in Table 1).
- Each amplification was carried out in a total volume of 50 ⁇ l containing 4 ⁇ l of cDNA ( ⁇ 1 / 7th of the prep.), 20 pmol of each primer, 200 ⁇ M of dNTPs, 50 mM of KCI, 10 mM of Tris pH9, 1.5 mM MgCI2, 0.1% triton X-100, 0.01% gelatin and 2.5 units of Taq polymerase (Cetus-PE).
- the PCR reactions were carried out according to the "hot start” method: Taq polymerase is added at 92 ° C after a first denaturation step of 5 min at 94 ° C.
- the samples are then subjected to 35 cycles of denaturation (94 ° C for 40 sec), hybridization (55 ° C for 50 sec, with the exception of fragment I: 58 ° C for 50 sec) and elongation (72 ° C for 1 min), followed by a final elongation step (5 min at 72 ° C).
- the PCR products are sequenced on an ABI 377 automatic sequencer (PE-Applied Biosystems) with the primers SPA_Dc / SPA_Dn, SPA_Ac / SPA_An, SPA_Bb / SPA_Bn and SPA_Cb / SPA_Cm for fragments I, II, III and IV respectively.
- exon 1 amplified using the Advantage GC genomic PCR kit (Clontech) according to the supplier's instructions, four slightly different PCR programs (1, 2, 3 and 4) were used to amplify SPG4 exons (see table 2).
- the amplifications were all carried out in a volume of 50 ⁇ l containing 100 ng of genomic DNA, 50 pmol of each primer, 250 ⁇ M of dNTPs, 1 ⁇ of Takara buffer and 1 unit of Taq polymerase Takara La Taq (Shuzo Co.).
- the PCR reactions were carried out according to the “hot start” method: the Taq polymerase is added at 94 ° C. after a first denaturation step of 5 min at 96 ° C.
- the samples are then subjected to 30 cycles of denaturation (94 ° C for 40 sec), of hybridization (prog. 1: 60 ° C for 50 sec; prog. 2, 58 ° C for 50 sec, prog. 3 and 4: 55 ° C for 50 sec) and elongation (prog. 1 and 4: 72 ° C for 1 min, prog. 2 and 3: 72 ° C for 40 sec), followed by a final step of elongation (10 min at 72 ° C).
- the sequencing of these PCR products was carried out on an ABI 377 sequencer (PE-Applied Biosystems) using either the PCR primers or the internal primers denoted “b” and “n” (see Table 2). 4) Characterization of SPG4
- CDNA clones 977312 (EST AA560327) and 568234 (EST AA107866) from the blastocyst and mouse E8 embryo cDNA libraries, both of which correspond to the murine orthologue of SPG4, were isolated by the IMAGE consortium and sequenced in the laboratory on an ABI 377 sequencer (PE-Applied Biosystems).
- the cDNA collections of different fetal and adult human tissues, as well as mouse tissues were tested by PCR according to the supplier's protocol with the pair of primers SPA_Ca / SPA_Cm for human cDNAs and the pair SPA_Ca / spam (spam: 5'-ACCGAAGTCAAGAGCCTATC-3 ') for mouse cDNAs.
- the PCR conditions are those used for the amplification of SPG4 from cDNA from lymphoblast lines (cf.
- Histological and histo-enzymatic analyzes were carried out using a muscle biopsy from a patient from a family linked to the SPG4 locus according to the standard techniques described in Casari et al., 1998.
- SPG4 (or SPAST) cDNA and the deduced protein sequence GenBank / EMBL AJ246001; the incomplete Spg4 cDNA clone, GenBank / EMBL AJ246002; the SPG4 (or SPAST) gene, GenBank EMBL AJ246003.
- sequences of these 7 BACs were compared with those of nucleic and protein databases, and analyzed with four exon prediction programs. These preliminary sequence analyzes revealed 14 potential transcription units, three of which correspond to the genes coding for xanthine dehydrogenase, the steroid 5 ⁇ -reductase 2 and a protein binding TGF ⁇ . Of the 14 genes detected by sequence analysis, 9 had been previously identified in EST databases (for “Expressed Sequence Tag”) and located within the SPG4 interval (Hazan et al., in press in Genomics); the 5 remaining genes could only be identified by sequencing the candidate region.
- SPG4 or SPAST
- SPG4 was composed of 17 exons and spanned a region of around 90 kb, covered by two adjacent BAC clones, D and G (cf. Fig. 1 B).
- the first three predicted exons of this gene were identified in BAC D by two of the four exon prediction programs used, GRAIL II and GENSCAN; they have a strong homology with a EST of mouse blastocyst, AA560327.
- the last 14 exons are found in BAC G.
- the protein sequence deduced from exons 7 to 17 is significantly homologous to a subclass of the AAA family, comprising the yeast proteins Yta6p (Schnall et al., 1994), TBP6 (Schnall et al, 1994) and End 13, as well as the mouse protein SKD1 (Perier et al., 1994).
- the intron / exon junctions are shown in table 3 below: the size of the exons varies from 41 bp (exon 16) to 1.410 kb (exon 17), that of the introns varying from 140 bp (intron 11) to 23.247 kb ( intron 1).
- SPG4 cDNA Heterozygous mutations were sought in the SPG4 cDNA originating from lymphoblasts of 14 patients from families linked to the SPG4 locus (1 affected individual per family).
- Four overlapping PCR fragments I, II, III and IV covering the open reading phase of the SPG4 cDNA were amplified and sequenced in the 14 patients as well as in 6 healthy control individuals.
- Agarose gel electrophoresis of the PCR IV fragment showed three bands of equal intensity in 3 patients of families 2992, 5226 and 5330 from the same region of Switzerland, which suggested a microdeletion or a mutation of a site d 'splicing; the two additional bands were not present in 2 healthy individuals from families 2992 and 5330 (Fig. 3A).
- the genomic sequence of exon 16 revealed a heterozygous mutation A-> G of the splice acceptor site (AG) of intron 15 in individuals with these three families (Fig. 3B); this mutation generates the loss of exon 16 followed by a shift in the reading phase in the abnormal transcript. None of the healthy members including husbands and wife carry this mutation of the splicing site. The identification of the same mutation in all members affected by these three Swiss families demonstrates the existence of a common ancestor, which had previously been suggested by the study of haplotypes.
- nt positions refer to the sequence of the SPG4 cDNA.
- b The positions in aa refer to the sequence of the spastin.
- PTC + 7 aa "premature termination codon" at 7 aa downstream of exon 16.
- nt positions refer to the sequence of the SPG4 cDNA.
- b The positions in aa refer to the sequence of the spastin.
- the bases of exons are indicated in upper case, those of introns in lower case.
- the open reading phase of SPG4 codes for a protein of 616 aa which we have called spastin and whose molecular weight is approximately 67.2 kDaltons (kD).
- the comparison of this amino acid sequence in protein databases using BLAST programs made it possible to highlight a zone of strong homology with several members of the AAA family at the C-terminal end of the spastin. .
- the "typical" motifs of the AAA family, included in the AAA cassette, are located between positions aa342 and aa599 (see FIG. 2) according to the sequence comparisons in the protein domain databases ProDom and Prosite.
- the three conserved type domains including the A and B Walker motifs as well as the minimal consensus motif of the AAA proteins are located respectively within the AAA cassette at positions aa382-389, aa437-442 and aa480-498 (Fig. 2) .
- Walker motif A "GPPGNGKT” also called p-loop (or loop-p) which corresponds to the ATP binding domain and motif B "IIFIDE” are very conserved among all members of the AAA family including the spastin.
- AAA cassettes present in 150 proteins of this family of ATPase coming from very distant organisms in evolution made it possible to classify this set of proteins in several subgroups, according to the number of AAA cassettes identified (1 or 2) and sequence homologies between these different cassettes (Beyer, 1997).
- the spastin has a stronger homology with a particular subclass of AAA, and more specifically with the following proteins, most of which have been identified by complete sequencing of the genome of the organism considered.
- the spastin has a sequence identity of 52%, 51% and 50% with the yeast protein Yta6p (Q02845), the nematode protein 016299 and the protein of yeast TBP6 (P40328) respectively. Similar results were obtained by analyzing the protein sequence of the spastin in the ProDom database which showed the existence of three domains of homology (named 92, 179 and 6226 and corresponding to positions aa342-409, aa411-509 and aa512-599) found in putative 26S proteasome subunits yeast.
- members of this AAA subgroup most often contain leucine-zipper motifs, two of which could be detected in the protein sequence of the spastin at positions aa50-78 and aa508-529 by analysis of the sequence in the Prosite database (see Fig. 2). This analysis was also able to predict the presence of a propeller-loop-helix (“helix-loop-helix”) dimerization pattern located between positions aa478 and aa486.
- helix-loop-helix propeller-loop-helix
- the open mouse reading phase is followed by a 3 bp non-coding region (3 'UTR) of 175 bp containing a polyadenylation site located ⁇ 20 bp upstream of the polyA tail (Fig. 5).
- the nucleic acid sequence of SPG4 and the protein sequence of human spastin have an identity of 89% (between positions nt 460 and nt 1982) and 96% respectively (between positions aa113 and aa616) with the sequences of the cDNA and of the protein deduced from the mouse. This significant degree of homology makes it possible to affirm that this mouse transcript corresponds to the murine ortholog of SPG4, which was therefore baptized Spg4.
- oxidative phosphorylation OXPHOS
- a muscle biopsy was performed on a patient from one of the families of PSF-AD linked to the SPG4 locus. Morphological and histo-enzymatic analyzes of this muscle biopsy did not reveal any RRF (“ragged red fibers”) muscle fiber, characteristic of OXPHOS defects in the mitochondria.
- spastin is a new member of the AAA protein family, the localization of which appears to be nuclear and which has a strong homology with the yeast proteasome 26S subunits.
- AAA cassette Despite a large homology restricted to a domain of 230 to 250 aa, known as the AAA cassette, the numerous members of this protein family can participate in very varied cellular mechanisms such as the transport of proteins within vesicles, the regulation of the cycle. cellular, organogen biogenesis, ie transcription control, .... However, all these cellular mechanisms involve the assembly, function or degradation of protein complexes, which suggests that members of the AAA family are proteins called "chaperones".
- Bodansky M. Principles of peptide synthesis, (1984). Bruyn, R.P.M. & Scheltens, P.H. Hereditary spastic paraparesis (Strumpell-Lorrain) in
- Hereditary Spastic Paraplegia Working Group Hereditary spastic paraplegia: advances in genetic research. Neurology 46, 1507-1514 (1996).
- Saugier-Veber, P. et al. X-linked spastic paraplegia and Pelizaeus-Merzbacher disease are allelic disorders at the proteolipid protein locus. Nature Broom. 6, 257-262 (1994).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2348657A CA2348657C (fr) | 1999-09-03 | 2000-09-04 | Clonage, expression et caracterisation du gene spg4 responsable de la forme la plus frequente de paraplegie spastique autosomique dominante |
| US09/830,902 US6924126B1 (en) | 1999-09-03 | 2000-09-04 | Cloning, expression and characterization of the SPG4 gene responsible for the most frequent form of autosomal spastic paraplegia |
| JP2001521734A JP2003508074A (ja) | 1999-09-03 | 2000-09-04 | 最も一般的な形態の常染色体性優性遺伝性痙性対麻痺に応答し得るspg遺伝子のクローニング、発現および同定 |
| US11/155,492 US20050266479A1 (en) | 1999-09-03 | 2005-06-20 | Cloning, expression and characterization of the SPG4 gene responsible for the most common form of autosomal dominant spastic paraplegia |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR9911097A FR2798138B1 (fr) | 1999-09-03 | 1999-09-03 | Clonage, expression et caracterisation du gene spg4 responsable de la forme la plus frequente de paraplegie spastique autosomique dominante |
| FR99/11097 | 1999-09-03 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/155,492 Division US20050266479A1 (en) | 1999-09-03 | 2005-06-20 | Cloning, expression and characterization of the SPG4 gene responsible for the most common form of autosomal dominant spastic paraplegia |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2001018198A1 true WO2001018198A1 (fr) | 2001-03-15 |
Family
ID=9549552
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/FR2000/002433 Ceased WO2001018198A1 (fr) | 1999-09-03 | 2000-09-04 | Clonage, expression et caracterisation du gene spg4 responsable de la forme la plus frequente de paraplegie spastique autosomique dominante |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US6924126B1 (https=) |
| JP (2) | JP2003508074A (https=) |
| CA (2) | CA2848454C (https=) |
| FR (1) | FR2798138B1 (https=) |
| WO (1) | WO2001018198A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009127211A1 (en) * | 2008-04-14 | 2009-10-22 | Aarhus Universitet | Methods and kits for determining spinal dysmyelination |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5312314B2 (ja) * | 2006-03-30 | 2013-10-09 | デューク ユニヴァーシティー | 家族性痙性対麻痺の根底にある新規遺伝子の同定 |
| EP1897891A1 (en) * | 2006-09-11 | 2008-03-12 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Diagnosis of hereditary spastic paraplegias (HSP) by detection of a mutation in the KIAA1840 gene or protein |
| JP6208104B2 (ja) * | 2014-09-16 | 2017-10-04 | 株式会社日立製作所 | 生体認証システム、生体認証処理装置、生体認証方法、生体情報取得端末および情報端末 |
| KR101889072B1 (ko) | 2017-09-15 | 2018-08-16 | 한국생명공학연구원 | 디지털 PCR을 이용한 유전성 강직성 대마비(Hereditary spastic paraplegia, HSP) 관련 유전자 SPG4의 거대결손 검증법 |
| CN117820470B (zh) * | 2024-03-04 | 2024-05-31 | 暨南大学 | 人源性重组抗Spastin抗体及其制备方法和应用 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6197551B1 (en) * | 1998-01-27 | 2001-03-06 | Millennium Pharmaceuticals, Inc. | Spoil-1 protein and nucleic acid molecules and uses therefor |
| WO1998046743A1 (en) * | 1997-04-15 | 1998-10-22 | The Wellcome Trust Limited As Trustee To The Wellcome Trust | Novel ldl-receptor |
| CA2321119A1 (en) * | 1998-02-23 | 1999-08-26 | Dana-Farber Cancer Institute, Inc. | Method for identifying mismatch repair glycosylase reactive sites, compound and uses thereof |
-
1999
- 1999-09-03 FR FR9911097A patent/FR2798138B1/fr not_active Expired - Lifetime
-
2000
- 2000-09-04 US US09/830,902 patent/US6924126B1/en not_active Expired - Lifetime
- 2000-09-04 CA CA2848454A patent/CA2848454C/fr not_active Expired - Lifetime
- 2000-09-04 CA CA2348657A patent/CA2348657C/fr not_active Expired - Lifetime
- 2000-09-04 JP JP2001521734A patent/JP2003508074A/ja not_active Withdrawn
- 2000-09-04 WO PCT/FR2000/002433 patent/WO2001018198A1/fr not_active Ceased
-
2005
- 2005-06-20 US US11/155,492 patent/US20050266479A1/en not_active Abandoned
-
2011
- 2011-07-19 JP JP2011158305A patent/JP5965594B2/ja not_active Expired - Lifetime
Non-Patent Citations (5)
| Title |
|---|
| DATABASE EMBL 4 August 1999 (1999-08-04), OHARA O.: "Homo sapiens mRNA for KIAA1083 protein", XP002140994 * |
| DATABASE EMBL SEQUENCES 29 March 1997 (1997-03-29), MYERS R.M.: "human STS SHGC-44567", XP002156510 * |
| HAZAN J. ET AL.: "Spastin, a new AAA protein, is altered in the most frequent form of autosomal dominant spastig paraplegia", NAT. GENET., vol. 23, November 1999 (1999-11-01), pages 296 - 303, XP000914979 * |
| HEINZLEF O. ET AL.: "Mapping of a complicated familial spastic paraplegia to locus SPG4 on chromosome 2p", J. MED. GENET., vol. 35, no. 2, February 1998 (1998-02-01), pages 89 - 93, XP000914971 * |
| KIKUNO R. ET AL.: "Prediction of the coding sequences of unidentfied human genes. XIV. The complete sequences of 100 cDNA clones from brain which code for large proteins in vitro.", DNA RES., vol. 6, 30 June 1999 (1999-06-30), pages 197 - 205, XP000852618 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009127211A1 (en) * | 2008-04-14 | 2009-10-22 | Aarhus Universitet | Methods and kits for determining spinal dysmyelination |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2348657C (fr) | 2014-07-08 |
| FR2798138A1 (fr) | 2001-03-09 |
| JP2011254824A (ja) | 2011-12-22 |
| FR2798138B1 (fr) | 2004-05-21 |
| CA2848454A1 (fr) | 2001-03-15 |
| US6924126B1 (en) | 2005-08-02 |
| JP5965594B2 (ja) | 2016-08-10 |
| CA2848454C (fr) | 2018-04-17 |
| JP2003508074A (ja) | 2003-03-04 |
| US20050266479A1 (en) | 2005-12-01 |
| CA2348657A1 (fr) | 2001-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1100825B1 (en) | Human mink gene mutations associated with arrhythmia | |
| EP1268784B1 (fr) | Genes impliques dans les maladies inflammatoires de l'intestin et leur utilisation | |
| WO2001032704A1 (fr) | Proteines membranaires ctl (choline transporter like) impliquees dans le transport de la choline | |
| JP5965594B2 (ja) | 最も一般的な形態の常染色体性優性遺伝性痙性対麻痺に応答し得るspg遺伝子のクローニング、発現および同定 | |
| JP2004504054A (ja) | 薬物誘導型心臓不整脈に関係するscn5a中の一般的多型 | |
| JP3449419B2 (ja) | KVLQT1をコードするQT延長症候群遺伝子およびそのminKとの関連 | |
| DE69936781T2 (de) | Kvlqt1 - im zusammenhang mit 'long qt syndrom' | |
| AU2004201496A1 (en) | DB the receptor for leptin nucleic acids encoding the receptor, and uses thereof | |
| US20090275024A1 (en) | Novel centrerosome-associated protein and applications thereof | |
| FR2800388A1 (fr) | Clonage, expression et caracterisation d'un gene exprime dans des cellules tumorales et implique dans la regulation de la reponse immune | |
| US20070048836A1 (en) | Db, the receptor for leptin, nucleic acids encoding the receptor, and uses thereof | |
| WO2003025177A2 (fr) | Sequences impliquees dans les phenomenes de suppression tumorale, reversion tumorale, apoptose et/ou resistance aux virus et leur utilisation comme medicaments | |
| WO2000078948A2 (fr) | Clonage, expression et caracterisation d'un adnc codant pour un recepteur gamma-hydroxybutyrate (ghb) de cerveau de rat | |
| WO1997043415A1 (en) | Cyclin d binding factor, and uses thereof | |
| WO1997043415A9 (en) | Cyclin d binding factor, and uses thereof | |
| CA2432214A1 (fr) | Gene implique dans la regulation de l'apoptose | |
| JP2002360260A (ja) | Bタンパク質をコードする遺伝子 | |
| WO2002090545A2 (fr) | Acide nucleique codant le polypeptide cgl1 et application de cet acide nucleique et du polypeptide cgl1 au diagnostic et en therapeutique | |
| CA2357987A1 (en) | Genetic sequence related to bone diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): CA JP US |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
| ENP | Entry into the national phase |
Ref document number: 2348657 Country of ref document: CA Ref country code: CA Ref document number: 2348657 Kind code of ref document: A Format of ref document f/p: F |
|
| ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 521734 Kind code of ref document: A Format of ref document f/p: F |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 09830902 Country of ref document: US |
|
| 122 | Ep: pct application non-entry in european phase |