Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/19—Cytokines; Lymphokines; Interferons
  • A61K38/21—Interferons [IFN]
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
  • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
  • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
  • C07K16/3061—Blood cells
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/19—Cytokines; Lymphokines; Interferons
  • A61K38/21—Interferons [IFN]
  • A61K38/212—IFN-alpha
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/19—Cytokines; Lymphokines; Interferons
  • A61K38/21—Interferons [IFN]
  • A61K38/217—IFN-gamma
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
  • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
  • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

• the present invention relates to the use of interferon alpha and interferon and IRF-2 protein as an agent for enhancing the expression of HM1.24 antigen in myeloma.
• Myeloma also called plasmacytoma, or multiple myeloma, is a neoplastic disease characterized by the accumulation of monoclonal plasma cells in the bone marrow.
• Myeloma is a disease in which terminally differentiated B cells, which produce and secrete immunoglobulins, or plasma cells, increase mainly in the bone marrow, mainly in the bone marrow. A single immunoglobulin or its constituent L chain, H chain, etc. is detected.
• chemotherapeutic agents For the treatment of myeloma, chemotherapeutic agents have been used so far No effective therapeutic agent has been found to lead to complete remission of myeloma and prolong the survival of myeloma patients. The emergence of drugs that have a therapeutic effect on myeloma has been awaited.
• HM1.24 antibody has cytotoxic activity against the human myeloma cell line RPM 18226 in vitro.
• the chimeric anti-HM1.24 antibody obtained by chimerizing the mouse anti-HM1.24 antibody and the humanized reshaped anti-HM1.24 antibody specifically bind to myeloma cells. Have been shown to have cytotoxic activity (Blood (1999) 93, 3922-3930).
• the HM1.24 antigen is specifically elevated on myeloma cells, which are terminally differentiated B cells.
• the anti-HM1.24 antibody that expresses and recognizes this antigen exerts cell killing activity in proportion to the number of HM1.24 molecules on the cell surface
• immunotherapy using the anti-HM1.24 antibody Is considered an effective treatment for multiple myeloma. Therefore, if the expression level of the HM1.24 antigen, which is an antigen of the anti-HM1.24 antibody, on the cell surface can be enhanced, the same cytotoxic activity can be expected by administering a smaller amount of the antibody, and side effects are reduced. It is possible to lower it further.
• interferon which was discovered as a substance showing virus growth inhibitory activity, is currently classified into four species in mammals, i.e., h, ⁇ , ⁇ , and ⁇ , and has various physiological activities. This is known (Pest ka, S., et. Al., Ann. Rev. Biochem. (1987) 56, 727-777; Langer, JA, et. Al., Immunology Today (1988) 9, 393-400). However, it has not been reported that IFN- ⁇ and IFN- ⁇ have an effect of increasing the expression level of HM1.24 antigen in myeloma cells. Was.
• interferon regulatory factor (IRF) -1 and 2 have been identified as transcriptional regulators of the IFN-3 gene.
• IRF-1 and 2 generally bind to the same gene regulatory sequence, IRE-1 acts as a transcriptional activator, and IRF-2 acts as a transcriptional repressor.
• IRE-1 acts as a transcriptional activator
• IRF-2 acts as a transcriptional repressor.
• NIH3T3 cells overexpressing IRF-2 show increased cell saturation density, colony formation in methylcellulose gel, and tumorigenicity in nude mice, and IRF-2 functions as an oncogene It is clear what to do.
• IRF-2 is required for the expression of histone H4, which regulates the cell cycle.
• IRF-2 has been shown to increase the expression of vascular cell adhesion molecule-1 (VCAM-1) in muscle cells, and two acidic regions (182 to 218) act on VCAM-1 activation. It is clear what they are doing. From this, it is known that 1RF-2 not only acts as a transcription repressor but also acts as a transcription activator.
• the IRF-2 protein binds to the HM1.24 antigen gene promoter (HM1.24 promoter-1) and activates the promoter. Disclosure of the invention
• Treatment of myeloma with anti-HM1.24 antibody may be a revolutionary therapeutic agent in terms of specificity and efficacy, and there is a way to make the action of anti-HM1.24 antibody more effective. Wanted.
• an object of the present invention is to provide a means for increasing the expression level of HM1.24 antigen in myeloma cells, thereby enhancing the myeloma inhibitory action of anti-HM1.24 antibody.
• the present inventors have searched for a drug that increases the expression level of the HM1.24 antigen in order to provide such a method, and as a result, it has been found that inter, Fluor and inter-Fron have the desired activity. They have found that they have the present invention, and have completed the present invention.
• the present invention relates to a protein (HM1.24 antigen) having an amino acid sequence represented by SEQ ID NO: 2 which contains interferon ⁇ or interferon as an active ingredient in myeloma cells.
• a protein having an amino acid sequence represented by SEQ ID NO: 2 which contains interferon ⁇ or interferon as an active ingredient in myeloma cells.
• the present invention also provides, as an active ingredient,
• a typical example of the above myeloma is multiple myeloma.
• the antibody is preferably a monoclonal antibody, a chimeric antibody or a humanized antibody, and preferably has cytotoxic activity.
• the present inventors have also searched for an activator of the HM1.24 promoter, and as a result, have found that the IRF-2 protein has a desired activity, and have completed the present invention.
• the present invention provides an enhancer for the expression of a protein having the amino acid sequence shown in SEQ ID NO: 2 (HM1.24 antigen) in myeloma cells, which comprises the IRF-2 protein as an active ingredient. .
• the present invention also provides an activator of HM1.24 promoter overnight, comprising an IRF-2 protein as an active ingredient.
• the present invention also provides, as an active ingredient,
• SEQ ID NO: 2 is a protein having the amino acid sequence shown in SEQ ID NO: 2.
• a typical example of the above myeloma is multiple myeloma.
• the antibody is preferably a monoclonal antibody, a chimeric antibody or a humanized antibody, and preferably has cytotoxic activity.
• the present invention also provides an agent for enhancing the expression of HM1.24 antigen in myeloid cells, which contains a compound that enhances the expression of IRF-2 protein as an active ingredient.
• the present invention also provides an activator of the HM1.24 promoter containing, as an active ingredient, a compound that enhances the expression of IRF-2 protein.
• the present invention further provides a method of screening for an HM1.24 antigen expression enhancer.
• the present invention further provides a kit for treating a patient having myeloma.
• an antibody which specifically binds to a protein having the amino acid sequence shown in SEQ ID NO: 2 and has cytotoxic activity
• kit comprising:
• the myeloma is, for example, multiple myeloma.
• the antibody is preferably a humanized anti-HM1.24 antibody.
• the drug that enhances the expression of the protein having the amino acid sequence shown in SEQ ID NO: 2 is preferably interferon- ⁇ or interferon-alpha.
• the present invention further provides a method for treating a patient having myeloma, which comprises an antibody that specifically binds to a protein having the amino acid sequence shown in SEQ ID NO: 2 and has cytotoxic activity.
• the myeloma is, for example, multiple myeloma.
• the antibody is preferably a humanized anti-HM1.24 antibody.
• the agent that enhances the expression of the protein having the amino acid sequence shown in SEQ ID NO: 2 is preferably Interferon or Interferon 7.
• FIG. 1 shows that the myeloma cell line U266 cultured in the absence (top) and in the presence (bottom) of interferon was labeled with human IgG (control) or anti-HM 1.24 antibody as a label.
• FIG. 2 shows the results of the analysis by the one-site method.
• Figure 2 shows that the patient's myeloma cells cultured in the absence (top) or presence (bottom) of interferon were labeled.
• FIG. 3 shows the results of analysis using human IgG (control) or anti-HM 1.24 antibody by single-site measurement.
• FIG. 3 shows the results obtained by introducing the promoter region of the gene encoding the HM1.24 antigen.
• 4 is a graph showing the results of measuring luciferase activity after culturing U266 cells transformed with a reporter plasmid in the absence or presence of various concentrations of insulin.
• Figure 4 shows the transformation of a promoter region of the gene encoding the HM1.24 antigen with a reporter plasmid inserted up to 151 bp or 77 bp upstream from the transcription start site.
• 4 is a graph showing the results of measuring luciferase activity after culturing isolated U266 cells or HEL cells in the presence of interferon (1000 U / ml).
• FIG. 5 shows the absence (top) and presence (bottom) of the interfloor.
• Fig. 6 shows the results of analysis of cultured myeloma cell line U266 by flow cytometry using human IgG (control) or anti-HM1.24 antibody as a label.
• Diagram showing the results of flow cytometry analysis of patient myeloma cells cultured in the presence (top) or in the presence (bottom) using human IgG (control) or anti-HM 1.24 antibody as a label.
• FIG. 7 is an electrophoretogram showing the time-dependent change in the amount of transcription factor produced by adding IFN- ⁇ to U266 cultured cells and binding to the HM 1.24 promoter region, and is a photograph as a substitute for a drawing.
• ⁇ (-) No nuclear extract added.
• nuclear extract without IFN- ⁇ stimulation was added.
• nuclear extract after each time elapse after IFN- ⁇ (lOOOUZml) stimulation was added.
• + c old is 50 ng of unlabeled ISRE2 probe
• + cold unrelated is unlabeled adp with 50 ng of Uro.
• FIG. 8 is an electrophoretogram showing the results of identifying transcription factors that bind to the HM1.24 promoter using various antibodies, and is a photograph as a drawing substitute.
• NE (-) does not include nuclear extract. At 0 h, nuclear extract without IFN- ⁇ stimulation was added. For 8 h, add nuclear extract for 8 h after stimulation with IFN- (100OOZml).
• + cold is 50 ng of unlabeled ISRE2 probe. For + cold unrelated, 50 ng of unlabeled adp sequence was added. 2 / g of each antibody was added.
• FIG. 9 is a graph showing the results when the HM1.24 motor-repo-one-time plasmid and IRF-2 expression plasmid were introduced into U266 cells and the reporter activity was measured. .
• Interpolon and interpolon used in the present invention As a mutant, a mutant can be used as long as it has an activity of increasing the expression level of the HMl.24 antigen.
• detection is performed by flow cytometry using a myeloma cell line or a myeloma cell collected from a myeloma patient.
• Mutants include, for example, interferons and intermers in which one or more or a plurality of amino acid residues have been mutated by deletion, substitution, insertion or addition, etc. It may be one floorer.
• a site-directed mutagenesis method that alters the corresponding gene can be used (Hashimoto-Gotoh, Gene (1995) 152, 271-275, Zoller, Methods Bnzymol. (1983) 100, 468-500, Kramer, Nucleic Acids Res. (1 984) 12, 9441-8456, Kunkel, Pro Natl. Acad. Sci. USA (1985) 82, 488-492. "New Cell Engineering Protocol, Cancer Research Division, Institute of Medical Science, The University of Tokyo (1993) p241-248j).
• amino acids whose properties are conserved.
• hydrophobic amino acids A, I, L, M, F, P, W, ⁇ , V
• hydrophilic amino acids R, D, N, C, E, Q, G, H , K, S, T
• amino acids with aliphatic side chains G, A, V, L, I, P
• amino acids with hydroxyl-containing side chains S , T, Y
• amino acids with sulfur atom-containing side chains C, M
• carboxylic acids and amino acids with amide-containing side chains D, N, E, Q
• bases Amino acid (R, K, ⁇ ) having an aromatic side chain and amino acid (H, F, ⁇ , W) having an aromatic side chain are preferably substituted.
• an interferon ⁇ or a peptide fragment of an interferon it is also possible to use an interferon ⁇ or a peptide fragment of an interferon.
• peptide fragments having a binding site with interferon or interferon receptor are preferable.
• Interferon regulatory factor (IRF) -1 and 2 were identified as transcriptional regulators of the IFN-yS gene. It is known that IRF-1 and 2 generally bind to the same gene regulatory sequence, IRE-1 acts as a transcriptional activator, and IRF-2 acts as a transcriptional repressor. NIH3T3 cells overexpressing IRF-2 show increased cell saturation density, colony formation on methylcellulose gel, and tumorigenicity in nude mice, and IRF-2 functions as an oncogene Is clearly power.
• IRF-2 is required for the expression of histone H4, which regulates the cell cycle.
• IRF-2 has been shown to increase the expression of vascular cell adhesion molecule-1 (VCAM-1) in muscle cells, and the activation of VCAM-1 activates IRF-2 in the acidic region (182 to 218). It is clear that is acting. For this reason, it is known that IRF-2 not only acts as a transcription repressor, but also acts as a transcription activator.
• the hybridoma producing the antibody used in the present invention can be basically produced as follows using a known technique. That is, cells expressing the HM1.24 antigen protein or HM1.24 antigen are used as a sensitizing antigen, and immunized according to a normal immunization method, and the obtained immune cells are known by a normal cell fusion method. It can be produced by fusing with a parental cell of the same and screening monoclonal antibody-producing cells by a usual screening method.
• a monoclonal antibody may be prepared as follows.
• HM1.24 antigen-expressing cells which are sensitizing antigens for obtaining antibodies, include human multiple myeloma cell lines such as KPMM2 (JP-A-7-236475) and KPC-32 (Goto, T. et al.). , Jpn. J. Clin. Hematol. (1991) 32, 1400) can be used.
• a protein having the amino acid sequence shown in SEQ ID NO: 1 or a peptide or peptide containing an epitope recognized by the anti-HM1.24 antibody may be used as the sensitizing antigen.
• the monkey the monkey.
• the cDNA of the protein having the amino acid sequence shown in SEQ ID NO: 1 used as a sensitizing antigen was inserted between the Xbal cleavage sites of the pUC19 vector, and the plasmid pRS38- Prepared as pUC19.
• Escherichia coli (E. coli) containing this plasmid pRS38-pUC19 was obtained in
• a peptide or polypeptide containing an epitope recognized by the anti-HM1.24 antibody is prepared by genetic engineering techniques. Can be.
• Mammals immunized with a sensitizing antigen are not particularly limited. However, it is preferable to select one in consideration of compatibility with the parent cell used for cell fusion. Generally, rodents such as mice, rats, and hamsters are used. Is done.
• Immunization of an animal with a sensitizing antigen is performed according to a known method.
• a sensitizing antigen is injected intraperitoneally or subcutaneously into a mammal.
• the sensitizing antigen is diluted and suspended in an appropriate amount with PBS (Phosphate-Buffered Saline), saline, or the like, and a normal adjuvant, such as Freund's complete adjuvant, is used as desired. It is preferable to mix a suitable amount of the compound and to administer the compound to the mammal several times every 4 to 21 days after milking. In addition, an appropriate carrier can be used at the time of immunization with the sensitizing antigen.
• PBS Phosphate-Buffered Saline
• saline saline
• a normal adjuvant such as Freund's complete adjuvant
• immune cells are removed from the mammal and subjected to cell fusion.
• Preferred immune cells to be subjected to cell fusion include spleen cells in particular.
• Mammalian myeloma cells as the other parent cells fused with the immune cells are already known in various cell lines, for example, P3X63Ag8.653 (J. Immnol. (1979) 123: 1548). -1550), P3X63Ag8U.1 (Current Topics in Microbiology and Immunology (1978) 81: 1-7), NS-1 (Kohler. G. and Milstein, C. Eur. J. Immunol. (1976) 6: 511-519), MPC-11 (Margulies. DH et al., Cell (1976) 8: 405-415), SP2 / 0 (Shulman, M.
• the cell fusion between the immune cells and myeloma cells is basically known.
• the method can be performed according to, for example, the method of Milstin et al. (Kohler. G. and Milstein, C., Methods Enzymol. (1981) 73: 3-46).
• the cell fusion is performed, for example, in a normal nutrient culture in the presence of a cell fusion promoter.
• a cell fusion promoter for example, polyethylene glycol (PEG), Sendai virus (HVJ) and the like are used, and if necessary, an auxiliary agent such as dimethyl sulfoxide may be added to enhance the fusion efficiency. Can also.
• the ratio of the use of the immune cells to the myeloma cells is, for example, preferably 1 to 10 times the number of the immune cells to the myeloma cells.
• Examples of the culture solution used for the cell fusion include RPMI 1640 culture solution, MEM culture solution, and other ordinary culture solutions used for cell culture of this type, which are suitable for the growth of the myeloma cell line. It can be used, and a serum replacement solution such as fetal calf serum (FCS) can be used in combination.
• FCS fetal calf serum
• a predetermined amount of the immune cells and myeloma cells are mixed well in the culture medium, and a PEG solution preliminarily heated to about 37 ° C., for example, an average molecular weight of about 1000 to 6000 Usually, a PEG solution is added at a concentration of 30 to 60% (wZv) and mixed to form a desired fusion cell (hypridoma). Subsequently, by repeatedly adding an appropriate culture solution and centrifuging to remove the supernatant, a cell fusion agent or the like that is not preferable for the growth of the hybridoma can be removed.
• the hybridoma may be prepared using a conventional selective culture medium, for example, a HAT culture medium.
• a culture solution containing hypoxanthine, aminobuterin and thymidine Culture in the HAT culture medium is continued for a period of time sufficient to kill cells other than the target hybridoma (non-fused cells), usually several days to several weeks.
• a conventional limiting dilution method is performed, and the hybridoma screen that produces the desired antibody is screened. And single cloning.
• human lymphocytes are sensitized in vitro with HM1.24 antigen or HM1.24 antigen-expressing cells, and
• the desired human antibody having an activity of binding to HM1.24 antigen or HM1.24 antigen-expressing cells can be obtained by fusing the immunoglobulin with human myeloma cells, for example, U266 (see Japanese Patent Publication No. 1-59878). ).
• HM1.24 antigen or HM1.24 antigen-expressing cells, which are antigens are administered to a transgenic animal having all the repertoires of the human antibody gene, and the desired human Antibodies may be obtained (see International Patent Application Publication Nos. W093 / 12227, W092 / 03918, W094 / 02602, W094 / 258585, W096 / 34096, W096 / 33735).
• the hybridomas producing monoclonal antibodies produced in this way can be subcultured in a normal culture medium, and can be stored for a long time in liquid nitrogen. is there.
• the hybridoma is cultured according to an ordinary method, and the culture supernatant is obtained.
• the hybridoma is obtained from a mammal compatible with the hybridoma.
• a method is used in which the compound is administered to an animal, proliferated and obtained as ascites. The former method is suitable for obtaining high-purity antibodies, while the latter method is suitable for mass production of antibodies.
• a method for purifying anti-HMl.24 antibody from ascites fluid, or using this hybridoma in a suitable medium for example, RPM11640 medium containing 10% fetal calf serum, 5% BM-CondimedHl (Boehringer Mannheim), Hybridoma SFM Culture medium (GIBC0-BRL), PF HM-II medium (GIBCO-BRL), etc., and anti-HM1.24 antibody can be purified from the culture supernatant.
• a suitable medium for example, RPM11640 medium containing 10% fetal calf serum, 5% BM-CondimedHl (Boehringer Mannheim), Hybridoma SFM Culture medium (GIBC0-BRL), PF HM-II medium (GIBCO-BRL), etc.
• an antibody gene is cloned from a hybridoma, incorporated into an appropriate vector, introduced into a host, and produced using a genetic recombination technique.
• Recombinant antibodies can be used (see, eg, Carl, AK Borrebaeck, James, W. Larrick, THERAPEUTIC MONOCLONAL ANTIBODIES, Published in the United Kingdom by MACMILLAN PUBLISHERS LTD, 1990).
• mRNA encoding the variable (V) region of the antibody is isolated from a hybridoma producing the antibody of interest.
• mRNA can be isolated by known methods, for example, guanidine ultracentrifugation (Chirgwin, JM et al., Biochemistry (1979) 18, 5294-5299), and AGPC method (Chmczynski, P. et al., (1987) 162, 156). -159) Prepare total RNA using the procedure described above, and prepare mRNA using the mRNA Purification Kit (Pharmacia). Also, mRNA can be directly prepared by using the QuickPrep mRNA Purification Kit (Pharmacia).
• cDNA for the antibody V region is synthesized using reverse transcriptase.
• the synthesis of c-thigh can be performed using AMV Reverse Transcriptase First-strand cDNA Synthesis Kit or the like.
• AMV Reverse Transcriptase First-strand cDNA Synthesis Kit or the like.
• the 5'-Ampli FINDER RACE Kit (Clontech) and the 5'-RACE method using PCR (Frohman, MA et al., Proc. Natl. Acad. Sci. USA (1988) ) 85, 8998-9002; Belyavsky, A. et al., Nuclei c Acids Res. (1989) 17, 2919-2932) can be used.
• a recombinant vector is prepared from this, introduced into Escherichia coli or the like, and a colony is selected to prepare a desired recombinant vector.
• the nucleotide sequence of the target DNA is confirmed by a known method, for example, the dideoxy method.
• DNA encoding the V region of the desired antibody is obtained, it is ligated to the DNA encoding the desired antibody constant region (C region) and incorporated into the expression vector.
• DNA encoding the V region of the antibody may be incorporated into an expression vector containing the DNA of the C region of the antibody.
• an antibody gene is incorporated into an expression vector so as to be expressed under the control of an expression control region, for example, an enhancer or a promoter, as described later.
• host cells can be transformed with this expression vector to express the antibody.o
• a recombinant antibody artificially modified for the purpose of reducing heterologous antigenicity to a human such as a chimeric antibody, a humanized human (Human iz) ed) Antibodies and the like can be used.
• modified antibodies can be produced using known methods.
• Chimeric antibodies are obtained by ligating the DNA encoding the antibody V region obtained as described above to DNA encoding the human antibody C region, incorporating the DNA into an expression vector, and introducing it into a host. (See European Patent Application Publication No. EP 125023, International Patent Application Publication No. W096 / 02576). Using this known method, chimeric antibodies useful in the present invention can be obtained.
• a plasmid containing the light chain and heavy chain of the Chimera anti-HM1.24 antibody are Escherichia col i DH5a (pUC19-l.24L-g / c) and Escherichia col i DH5a (pUC19-l.24H-g a1), respectively.
• the Institute (Tsukuba-Higashi 1-3-3, Ibaraki Pref.) Entered into an international agreement based on the Budapest Treaty on August 29, 1996 as FERM BP-5646 and FERM BP-5644, respectively. It has been deposited (see Japanese Patent Application No. 8-264475).
• the humanized antibody is also referred to as a reshaped human antibody, and the complementarity determining region (CDR) of a mammalian antibody other than a human, such as a mouse antibody, is replaced with the human antibody. It has been transplanted into the complementarity-determining region, and its general genetic recombination technique is also known (see European Patent Application Publication No. EP 125023, International Patent Application Publication No. W096 / 02576).
• a DNA sequence designed to link the mouse antibody CDR and the framework region (FR) of the human antibody should have an overlapping portion at the end. It is synthesized by PCR from several prepared oligonucleotides. The obtained DNA is ligated to DNA encoding the human antibody C region, then incorporated into an expression vector, introduced into a host, and produced (European Patent Application Publication No. EP 239400; (See Patent Application Publication No. W096 / 02576).
• Human antibody FRs linked via CDRs are selected so that the complementarity-determining regions form an excellent antigen-binding site. If necessary, amino acids in the framework region of the variable region of the antibody may be substituted so that the complementarity determining region of the reconstituted human antibody forms an appropriate antigen-binding site (Sato, K. et al., Cancer Res. (1993) 53, 851-856).
• Escherichia coli having a plasmid containing the light chain and the heavy chain of a humanized anti-HM1.24 antibody is Escherichia coli DH5a (pUC19-RVLa-A
• a chimeric antibody and a humanized antibody use a human antibody C region, and the human antibody C region exhibiting cytotoxic activity is a human C a such as Cy1, Cr2, C r3 and C4 can be used.
• a human C a such as Cy1, Cr2, C r3 and C4
• antibodies having particularly C ⁇ 1, Cr 3 have strong cytotoxic activity, that is, ADCC activity and CDC activity, and are suitably used in the present invention.
• Chimeric antibodies consist of the variable regions of antibodies derived from mammals other than human and C regions derived from human antibodies, and humanized antibodies comprise the complementarity determining regions of antibodies derived from mammals other than human and human antibodies. It is composed of a framework region (FR) and a C region of origin, and has a reduced antigenicity in a human body, and thus is useful as an active ingredient of the therapeutic agent of the present invention.
• FR framework region
• Preferred specific examples of the humanized antibody to be used include a humanized anti-HM1.24 antibody (see Japanese Patent Application No. 8-264756).
• the antibody gene constructed as described above can be expressed and obtained by a known method.
• expression can be carried out using a useful useful promoter commonly used, an antibody gene to be expressed, DNA having a polyA signal operably linked to its 3 ′ downstream, or a vector containing the DNA.
• the promoter Z enhancer may be the human cytomegalovirus immediate early promoter y enhancer / enhancer.
• other promoters that can be used for the expression of antibodies used in the present invention include retroviruses, polio-mauinoses, adenowinores, and simian virus4. 0 (SV40) and the like, and promoters / enhancers derived from mammalian cells, such as virus promoter Z enhancer 1H (HEF1a) may be used.
• expression can be performed by operably linking a useful promoter commonly used, a signal sequence for antibody secretion, and an antibody gene to be expressed.
• the promoter include a lacZ promoter and an araB promoter.
• the lacZ promoter the method of Ward et al. (Nature (1098) 341, 544-546; FA SEB J. (1992) 6, 2422-2427), and when the araB promoter is used, the method of Better et al. (Science (1988) 240, 1041-1043).
• a pelB signal sequence (Lei, SP et al J. Bacteriol. (1987) 169, 4379) may be used when E. coli is produced by periplasm. After isolating the antibody produced in the periplasm, the antibody structure is appropriately refolded (refo Id) and used (see, for example, W096 / 30394).
• Replication sources include SV40, poliovirus, adenovirus
• an expression vector is required.
• APH aminoglycoside trans- ferase
• TK thymidine kinase
• It can contain the lactase (Ecogpt) gene, the dihydrofolate reductase (dhfr) gene, and the like.
• Production systems for producing antibodies include in vitro and in vivo production systems.
• in vitro production systems include production systems using eukaryotic cells and production systems using prokaryotic cells.
• animal cells When eukaryotic cells are used, there are production systems using animal cells, plant cells, and fungal cells.
• animal cells include (1) mammalian cells, for example, CHO, C0S, myeloma, BHK (baby hamster kidney), HeLa, Vero, (2) amphibian cells, for example, African toad frog oocytes, or (3) Insect cells such as sf9, sf21, and Tn5 are known.
• Known plant cells include those derived from the genus Nicotiana, for example, cells derived from Nicotiana tabacum, which can be callus cultured.
• Fungal cells include yeast, for example, the genus Saccharomyces, for example, Saccharomyces serevisiae, filamentous fungi, for example, the genus Aspergillus, for example, Aspergillus niger (Aspergillus niger).
• E. coli Escherichia coli
• Bacillus subtilis Bacillus subtilis
• the desired antibody gene is introduced into these cells by transformation.
• Antibodies can be obtained by culturing the transformed cells in vitro. Culture is performed according to a known method. For example, as a culture solution, DM
• FCS fetal calf serum
• Etc. can be used in combination.
• Introduced antibody gene Antibodies may be produced in vivo by transferring the isolated cells to the abdominal cavity of an animal or the like.
• examples of in vivo production systems include production systems using animals and production systems using plants. When using animals, there are production systems using mammals and insects.
• an antibody gene is introduced into these animals or plants, and antibodies are produced and recovered in the animals or plants.
• an antibody gene is inserted in the middle of a gene encoding a protein specifically produced in milk, such as goat casein, to prepare a fusion gene.
• a DNA fragment containing the fusion gene into which the antibody gene has been introduced is injected into a goat embryo, and this embryo is introduced into a female goat.
• the desired antibody is obtained from the milk produced by the transgenic Nigga or the progeny of the goat that has received the embryo.
• Hormones may be used as appropriate in the transgenic fish to increase the amount of milk containing the desired antibody produced from the transgenic fish (Ebert, KM et al., Bio / Technology (1994) 12 , 699-702).
• baculovirus into which the antibody gene of interest is inserted is infected to the silkworms, and the desired antibody is obtained from the body fluid of the silkworms (Susumu, M. et al., Nature (1985) 315). , 592-594).
• the target antibody gene is introduced into a plant expression vector, for example, PM0N530, and this vector is transferred to Agrobacterium tumefaciens. ens) Introduce to the area.
• the bacteria are infected with tobacco, for example, Nicotian.a tabacum, to obtain the desired antibody from the leaves of this tobacco (Julian, K.-C. Ma et al., Eur. J. Immunol. (1994) 24, 131-138)
• DNA encoding the antibody heavy chain (H chain) or light chain (L chain) is separately incorporated into the expression vector. May be co-transformed, or the DNA encoding the H and L chains may be incorporated into a single expression vector to transform the host (International Patent Application Publication No. W094-11523).
• the antibody obtained as described above can also be used as a modified antibody by binding to various molecules such as polyethylene glycol (PEG).
• PEG polyethylene glycol
• the “antibody” referred to in the claims of the present application also includes these modified antibodies.
• Such a modified antibody can be obtained by subjecting the obtained antibody to chemical modification.
• the antibody produced and expressed as described above can be separated from the host inside and outside the cell and from the host and purified to homogeneity. Separation and purification of the antibody used in the present invention can be performed by affinity chromatography. Columns used for affinity chromatography
• a protein A column and a protein G column can be mentioned.
• a carrier used for a protein A column for example, Hyper D, P0R
• the separation and purification methods used for ordinary proteins may be used, and there is no limitation.
• chromatographic filters other than the above affinity chromatographic filters, filters,
• the antibody used in the present invention can be separated and purified by appropriately selecting and combining ultrafiltration, salting out, dialysis, and the like.
• the chromatography include ion exchange chromatography, hydrophobic chromatography, gel filtration, and the like.
• the concentration of the antibody obtained by the above method can be measured by measuring the absorbance or by ELISA. That is, when the absorbance is measured, the antibody used in the present invention or the sample containing the antibody is appropriately diluted with PBS (-), and the absorbance at 280 nm is measured. 3 Calculate as 50D.
• the measurement can be performed as follows. That is, a 96-well plate (manufactured by Nunc) of goat anti-human IgG (manufactured by BIO SOURCE) diluted to 1 g Zml with 0.1 M bicarbonate buffer (pH 9.6) was used. In addition, perform incubation at 4 ° C to solidify the antibody.
• the reactivity between myeloma cells and the antibody used in the present invention can be determined by FCM (Flow One Site Metric) analysis.
• FCM Flow One Site Metric
• established cell lines or freshly isolated cells can be used.
• myeloma-derived RPMI8226 ATCC CCL 155) and U266 (ATCC TIB 19 6), KPMM2, KPC-32, ARH-77 derived from plasmacytoma (ATCC CRL 1621) and the like can be used.
• HM1.24 antigen for example, measure by FCM analysis using cells that do not express HM1.24 antigen in a non-stimulated state or that express less. be able to.
• the cells described in the examples are incubated with a test substance for 1 to 2 days, and then stained with a mouse anti-human HM1.24 antibody as a primary antibody. The cells are washed and stained with a FITC-labeled anti-mouse IgG antibody as a secondary antibody. Finally, after washing the cells, the FITC fluorescence intensity of the cells may be measured by a flow cytometer.
• the cells are treated with a high concentration of immunoglobulin, the Fc receptor is blocked, and then the direct method is performed using an anti-human HM1.24 antibody labeled with FITC. FCM analysis is also possible.
• the expression enhancer of the HM1.24 antigen can be screened by a repo overnight gene assay using the HM1.24 promoter motor sequence.
• a reporter gene receptase can be used.
• a HM1.24 protein containing a motor sequence upstream of the repo overnight gene After constructing rasmid and then transforming the cells, the obtained cells are cultured for 1-2 days with a test substance, and the recovered cells are subjected to FCM analysis to express the HM1.24 antigen. Drugs that enhance the skin can be screened.
• the antibody used in the present invention is an antibody having, for example, ADCC activity as cytotoxic activity.
• ADCC activity against myeloma cells can be measured as follows. First, mononuclear cells are separated from human peripheral blood and bone marrow by specific gravity centrifugation, and prepared as Effector cells (E).
• Target cells are labeled with 5 'Cr, such as RPMI8226 (ATCC CCL 155), U266 (ATCC TIB 196), KPMM2, KPC-32, ARH-77 (ATCC CRL 1621). And prepare as target cells. Next, an antibody for measuring ADCC activity is added to the labeled target cells, and the mixture is incubated. Thereafter, an effector cell having an appropriate ratio to the target cells is added, and the mixture is incubated.
• 5 'Cr such as RPMI8226 (ATCC CCL 155), U266 (ATCC TIB 196), KPMM2, KPC-32, ARH-77 (ATCC CRL 1621).
• cytotoxic activity (%) can be calculated by (A ⁇ C) / (B ⁇ C) ⁇ 100.
• A is the radioactivity released in the presence of the antibody (cpm)
• B is the radioactivity released by NP-40 (cpm)
• C is the radioactivity released in the culture medium alone without the antibody (cpm). It is.
• cytotoxic activity such as ADCC activity
• As antibody constant region (.region) it is preferable to use Ca, especially Ca1 and Ca3. Further, by partially adding, modifying, or modifying the amino acid in the antibody C region, a stronger ADCC activity or CDC activity can be induced.
• 1 gG is converted into an IgM-like polymer by amino acid substitution (Smith, R. IF & Morrison, SL BIO / TECHNOLOGY (1994) 12, 683-688), and IgM is added by amino acid addition.
• IgM is added by amino acid addition.
• Expression of gG in an IgM-like polymer (SmUh, RIF et al., J. Immunology (1995) 154, 2226-2236), expression in tandem ligation of genes encoding L chains (Shuford, W. et al., Science (1991) 252, 724-727), dimerization of IgG by amino acid substitution (Caron, PC et al., J. Exp. Med.
• oligonucleotide site-directed mutagenesis method using a primer, adding a base sequence using a restriction enzyme cleavage site, and using a chemical modifier that provides a covalent bond.
• One aspect of the present invention relates to a method for treating myeloma, preferably multiple myeloma, by administering to a patient an agent that enhances the expression level of the HM1.24 antigen and an anti-HM1.24 antibody.
• the agent that enhances the expression level of the HM1.24 antigen is preferably interferon or interferon.
• Interferon and the anti-HM1.24 antibody may be administered together or separately. In the latter case, administration of interferon and administration of anti-HM1.24 antibody within 96 hours are the first methods. Good.
• the interval between the administration of interferon and the administration of the anti-HM1.24 antibody is not limited as long as the expression level of the HM1.24 antigen is increased by administering interferon, but it is preferable.
• the administration route is preferably administered directly into the bloodstream, and is preferably administered intravenously or intraarterially. It can be administered continuously or by intravenous drip.
• Another embodiment of the present invention relates to a therapeutic agent for myeloma, which comprises interalpha ⁇ or interferon-y and an anti-HM1.24 antibody.
• the therapeutic agent of the present invention can be prepared by using a pharmaceutically acceptable vehicle, such as physiological saline or 5% dextran, which has been conventionally used in the preparation of an antibody or an antibody.
• the agent can be contained together with the excipient.
• a kit for treating a patient having myeloma which comprises a pharmaceutical composition containing an anti-HM1.24 antibody as an active ingredient, and interferon ⁇ or Provide a kit consisting of instructions containing instructions for combination therapy with Interferon.
• a pharmaceutical composition for treating a patient having myeloma which comprises an anti-HM1.24 antibody as an active ingredient, comprising: Provide a pharmaceutical composition to be used in combination with one fluorophore.
• a pharmaceutical composition to be used in combination with one fluorophore comprising: Provide a pharmaceutical composition to be used in combination with one fluorophore.
• Human myeloma cell line U266 (ATCC TIB 196) and 10% myeloma cells derived from bone marrow of multiple myeloma patients The culture was carried out at 37 ° C in a 5% carbon dioxide incubator using RPM11640 medium (Sigma, St Louis, MO, USA) containing ducts, Inc, Walkersville, MD, USA.
• Hypridoma producing mouse anti-HM1.24 antibody has been deposited with the National Institute of Advanced Industrial Science and Technology, Institute of Biotechnology, Japan (Department No. FERM BP-5233) April 27, 2008).
• Myeloma cells (1 X 1 0 5 / ml ) to 1 0 0 O UZml native Lee printer monounsaturated Erotic down one ⁇ of (Otsuka Pharmaceutical, Tokyo) was cultured for 48 hours under or absence presence, HM1. Changes in 24 antigens (the nucleotide sequence encoding them is shown in SEQ ID NO: 1) were measured by flow cytometry. Cells were incubated with 0.1% serum albumin (Sigma, St Louis, MO, USA) and phosphate buffer (Gibco BRL, Grand Islan) supplemented with 0.02% sodium azide. d, NY, USA), and suspended in PBS (100 ⁇ 1) supplemented with human immunoglobulin (3 mg / ml, green cross, Osaka) for 15 minutes at 4 ° C. Was reacted.
• serum albumin Sigma, St Louis, MO, USA
• phosphate buffer Gibco BRL, Grand Islan
• FITC-human IgGl (1 mg / ml) or FITC-anti-HM 1.24 antibody (1 mgZml) was added, and the cells were stained at 4 ° C for 60 minutes.
• myeloma cells were identified by double staining with 20/1 PE-anti-CD38 (Becton Dickinson, San Jose, CA, USA). After staining, the cells were washed twice with PBS and stored in PBS containing 1% paraformaldehyde (Wako Pure Chemical, Osaka). Thereafter, the expression of the HMl.24 antigen was analyzed using a flow cytometer (EPICS XL, Coulter, Hialeah, FL, USA).
• the expression level of the HM1.24 antigen was further increased.
• Interferon- ⁇ further increases the expression of HMl.24 antigen in myeloma cells
• anti-HM1.24 antibody treatment is administered to myeloma patients after administering insulin- ⁇ . This is expected to enhance the therapeutic effect of the antibody and increase the efficacy.
• the gene for the HM1.24 motor region was obtained by PCR cloning.
• Genomic DNA was prepared from human peripheral blood mononuclear cells using DNAzol reagent (GIBCO).
• GIBCO DNAzol reagent
• primers HM2k aaaggtaccagctgtct t tctgtctgtctgtccc
• BST2B atagtcatacgaagtagatgccatccag
• a plasmid was prepared using a QIAGEN plasmid maxi kit (QIAGEN, Hilden, Germany).
• the obtained plasmid HM-2k / GL3 was treated with restriction enzymes Kpn1 and XhoI, and deleted with ki 10-sequence deletion kit (Takara Shuzo).
• the plasmid HM-493 / GL3 containing up to 4993 bp upstream of the transcription initiation site was obtained.
• HM-2k / GL3 is treated with restriction enzymes KpnI and Af11I, and a deletion clone is prepared by the above-described method. -151 / GL3 and HM-77 / GL3 were obtained.
• Plasmid was introduced into cells using Polyethylenimine-Transferrinfection Kit (Tf PEI-Kit) (Bender MedSystems, Vienna, Austria), and Norecyclase Attathe using Dual-Luciferase Reporter Assay System (Promega).
• the cell line was cultured overnight in RPMI-1640 containing 50zM Defferioxami ne. 10% FBS.
• Tf_PEI Polyethylenimine-Transferrinfection Kit
• a reporter with a final concentration of 20 g / ml—Gene Plus, 0.4 / g Zml pR or SV40, 1 g / ml Tf-PEI
• a reagent mixture was prepared and incubated at room temperature for 20 minutes.
• X 10 5 cells Add 3 ml of Zml cells to Tf-PEI / plasmid mixture, incubate at 37 ° C for 4 hours, wash with medium, then 2 X 10 5 At a concentration of cells / ml, 100 ⁇ 1 per 1 we 11 were cultured in a 96-well flat bottom plate.
• IFN— was added to a final concentration of 0, 10, 100, or 100 01171111 and cultured at 37 ° C for 2 days. After washing the cells with PBS (-), the cells were lysed with 20 z1 of Passive Lysis Buffer, and 6 ⁇ l was applied to a C96 White Po 1 ysorp Fluoronunc plate (Nunc; i). Lumi noskan
• the emission intensity of each of Firefly and Renila was measured at (Labsystems) with a substrate solution of 30 ⁇ 1 and a measurement time of 10 seconds.
• the measured values were corrected by Firefly / Renia, and the relative activity was determined by setting the control (medium) to 1.
• Example 4 Binding of IRF-2 to HM1.24 promoter region
• BMSA Electrophoresis Mobicity Shift Assay
• Myeloma cells U266-Bl (ATCC-TIB196) containing 10% FBS (HyClone)
• the cells were suspended in 10 mM Tris, 10 mM NaCl, 6 mM MgCl 2 , ImM DTT, 0.4 mM PMSF, and ImM Na 3 VO 4 .
• the cells were homogenized on ice using a glass homogenizer, centrifuged at 6000 g for 3 minutes, and the supernatant was discarded.
• Extraction buffer (20% glycerol, 20mM HEPES, 420mM NaCl, 1.5mM MgCl 2, 0.2mM E DTA, 0.2mM PMSF, ImM DTT, 0.
• ImM Na 3 V0 4, 2 mg / ml Apurochini down, 5MgZml Roipe Petit The cells were suspended in ice-water and allowed to stand on ice for 20 minutes. After centrifugation at 12000 g for 10 minutes, the supernatant was collected.
• GAS IFN activation site: GAS consensus sequence is ttncnnnaa (SEQ ID NO: 8)
• ISRE IFN- ⁇ stimulation response factor: ISRE consensus sequence
• HM1.24 promoter region Produced an ISRE2 containing a sequence homologous to ngaaanngaact (SEQ ID NO: 9) (ttcccagaa (SEQ ID NO: 10) and ggaaactgaaact (SEQ ID NO: 11)).
• the oligo fraction ISRE-F2 ( aatttctgggaaactgaaactgaaacct (SEQ ID NO: 12)) and 1SRE-R2 (aattaggtt ttcagtttcagtttcccaga (SEQ ID NO: 13)) were mixed and annealed to obtain double-stranded DNA probe ISRE2.
• reaction mixture without the extract [(NEC-)] the reaction mixture with the extract from the cell culture cultured without stimulation with Interferon 0; [0 h]
• Reaction solution [8 h (icold)] obtained by adding 50 ng of unlabeled ISRE2 probe instead of labeled probe to the extract of the culture solution for 8 hours, and 50 ng of unrelated probe adp to the extract after 8 hours of culture
• a reaction solution [8 h (lcold unrelated)] was prepared, and the above procedure was repeated to detect a signal.
• Figure 7 shows the results. As is evident from Fig. 7, a substance that binds to double-stranded DNA corresponding to a part of the HM1.24 promoter increased over time in U266-B1 cells cultured under interfacial stimulation. .
• myeloma cells U266-Bl (ATCC-TI B196) were cultured in the presence of lOOOUZml of interferon- ⁇ for 8 hours to prepare an extract.
• the following operation was performed according to the standard protocol of the Band Shift Kit (Amercham Pharmacia Biotech). That is, 2 g of the antibody was added to 5 g of the extract, and the mixture was incubated at room temperature for 15 minutes to obtain an extract Z antibody reaction solution.
• the antibody reaction solution 2a1 and the labeled probe 2 ⁇ 1 prepared in the above (2) were added, and water was added to adjust the total volume to 201. Then, the reaction mixture was incubated at room temperature for 20 minutes.
• the reaction mixture was subjected to electrophoresis as described in the above (3) to detect a signal.
• Anti-human STAT2 (C-20): Anti-mouse STAT3 (K-15): Anti-mouse STAT3 (K-15): Anti-mouse ISGF -3a p48 (C-20): Sagipoly oral antibody (SC-496X)
• Anti-human IRF-1 C-20: Sagipoly monoclonal antibody (SC-497X)
• Anti-human IRF-2 C-19
• Sagipoly oral antibody SC-498X
• Anti-mouse ICSAT M-17
• Cat-polyclonal antibody SC-6059X
• Figure 8 shows the results. As is evident from FIG. 8, the components that bind to the labeled ISRE2 probe in extracts from cells cultured under the stimulation of interferon only bind to the anti-IRF-2 antibody and HM1. The factor that binds to and activates the 24 promoter has been shown to be the transcription factor IRF-2.
• HM1.24 promoter activity was measured by a reporter gene assay using U266 cells, and it was found that IRF-2 actually had the transcriptional activation of HM1.24 promoter. Revealed.
• myeloid cell line U266-BKATCC TIB196 was used. Cells, due RPMI -1640 medium with 10% FBS (GIBCO BRL) ( GIBC0) ( hereinafter medi um), and cultured in 5% C0 2 incubator.
• the gene of the HM1.24 promoter region was obtained by PCR clonin.
• Genomic DNA was prepared from human peripheral blood mononuclear cells using DNAzol reagent (GIBCO).
• GIBCO DNAzol reagent
• primers HM2k aaaggtaccagctgtctttctgtctgtctgtccc
• BST2B atag tcatacgaagtagatgccatccag
• TaKaRa Taq was used.
• Cycler 480 Perkin Elmer, CA, US PCR was performed at A) (94 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 1 minute, 30 cycles).
• the obtained fragment of about 2 kb was treated with restriction enzymes Kpnl, Bglll (Takara Shuzo), and DNA was added to Kpnl, Bgl11 site of repo overnight GenePlusmid pGL3-basic (Promega, WI, USA). Cloning was performed using ligation kit ver. II (Takara Shuzo), and the transformant E. coli JM109 (Futsubojin) was transformed. The transformed E. coli was cultured at 37 ° C in an LB medium containing 100 ig / ml ampicillin, and a plasmid was prepared using a QIAGEN pi asm id maxi kit (QLA GEN, Hilden, Germany).
• HM-2k / GL3 is treated with the restriction enzymes Kpnl and Xhol, and a deletion clone is prepared using the deletion kit for kilo-sequence (Takara Shuzo).
• a plasmid containing HM-491 / GL3 was obtained.
• HM-2k / GL3 was treated with restriction enzymes Kpn I and Af III, and a deletion clone was prepared by the above method to obtain HM-151 / GL3 containing up to -151 bp upstream of the transcription start site. .
• HM-2k / GL3 as a type I and primers 10S (111 egg tacc taat t taatcctctgcctg) (SEQ ID NO: 18) and GL primer 2 (ctttatgt ttttggcgtcttcca) (SEQ ID NO: 19)
• TaKaRa Taq PCR 94 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 1 minute, 30 cycles
• Thermal Cycler 480 (Takara Shuzo, Otsu) using Thermal Cycler 480 (Perkin Elmer, CA, USA).
• the obtained fragment was treated with restriction enzymes KpnI and BglII (Takara Shuzo), and ligation high (Toyobo) to Kpnl and Bgl11 sites of reporter gene plus pGL3-basic (Promega, WI, USA). Cloning was performed using E. coli JM109 (Futatsu Gene).
• the transformed Escherichia coli was cultured at 37 ° C in an LB medium containing 100 zg / ml of ampicillin, and the QIAGEN plasmid maxi kit (QIAGEN, Hilden, Ger. Many) prepared a plasmid.
• QIAGEN QIAGEN, Hilden, Ger. Many
• HM-2k / GL3 as a type II and using primers HMP700 (aaaggtaccagagtttacctggtatcctgg) (SEQ ID NO: 20) and GL Primer-12, PCR was performed in the same procedure, and ⁇ , pGL3-bas By introducing the fragment into the Bglll site, HM-700 / GL3 containing up to about 700 bp upstream of the transcription start site was obtained.
• the obtained plasmid was treated with the restriction enzyme Kpnl, a fragment of about 550 bp was recovered, and introduced into the Kpnl site of HM-125 / GL3 using ligation high. In this way, dISRE / GL3 deleted in the vicinity of -125 to -145 upstream of the transcription start site was obtained.
• IRF-2 expression plasmid was prepared as follows. interferon- a
• Total RNA was extracted using GIBC0-BR. Using the First-strand cDNA Synthesis kit (Pharmacia), the obtained RNA was reverse-transcribed into type II and Notl-d (T) as primer. The reaction was performed for 1 hour at 37 ° C.
• NA is type II, IRF2-F2 (ttgtattggtagcgtgaaaaagc) (SEQ ID NO: 2)
• the obtained PCR reaction solution was subjected to type I, IRF2-Fl (agaggg tacca tgccgg tggaa aggatgcg) (SEQ ID NO: 24) and IRF2-R1 (agtcggtaccttaactgctct tga cgcggg) (SEQ ID NO: 25) as primers and PCR (94 ° C 45) using KOD polymerase (Toyobo) again. Second, 60 ° C 45 seconds, 72 ° C 60 seconds, 30 cycles).
• the obtained fragment was treated with the restriction enzyme Kpnl, and introduced into the Kpn I site of the expression plasmid pTracer-CMV (Inv itrogen) using ligation high (Toyobo) using the IRF-2 expression plasmid.
• plRF-2 / ⁇ racer 3 ⁇ 4 ⁇ obtained.
• Tf PEI-Kit Polyethylenimine-Transferrinfection Kit
• Lucifera Seesay use the Dual-Lucif erase Reporter Assay System (Promega).
• the cell line was cultured in RPMI-1640 containing 50 M Def ferrioxamine, 10% FBS.
• reporter gene plasmid at a final concentration of 20 / g / ml, pIRF-20 / g / ml pIRF-2 / Tracer or pTracer-CMV, 0.1 g / ml
• a mixed solution of mlcD PRL-SV40, 1 g / ml Tf-PEI reagent was prepared and incubated at room temperature for 20 minutes.
• Luminoskan (Labsysterns) ⁇ Emission intensity of each of Firefly and Renila was measured with a trowel substrate solution 30/1 and a measurement time of 10 seconds. The measured values were corrected for transfusion efficiency using Firefly / Renila, and the relative activities were determined. (4) Result
• HM1.24 promoter reporter plasmid and IRF-2 expression plasmid were introduced into U266 cells, and the reporter activity was measured (FIG. 9).
• luciferase activity was increased by co-expression of IRF-2 at -700 and -151 containing the ISRE motif sequence, which is an IRF-2 binding site.
• dISRE / GL3 lacking the ISRE sequence showed no change in luciferase activity due to co-expression of IRF-2.
• the above results indicate that IRF-2 binds to the ISRE region of the HM1.24 motor and enhances its transcriptional activity.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Epidemiology (AREA)
• Gastroenterology & Hepatology (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Cell Biology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Biomedical Technology (AREA)
• Hematology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Oncology (AREA)
• Molecular Biology (AREA)
• Marine Sciences & Fisheries (AREA)
• Mycology (AREA)
• Microbiology (AREA)
• Physical Education & Sports Medicine (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Investigating Or Analysing Biological Materials (AREA)

Priority Applications (7)

Applications Claiming Priority (4)

Related Child Applications (2)

Publications (1)

Family

ID=26532447

Family Applications (1)

Country Status (12)

Cited By (4)

Families Citing this family (3)

Citations (1)

Family Cites Families (36)

• 2000
  • 2000-08-22 TW TW089116997A patent/TWI248365B/zh not_active IP Right Cessation
  • 2000-08-22 CN CN00811883A patent/CN1370076A/zh active Pending
  • 2000-08-22 KR KR1020027002259A patent/KR20020025990A/ko not_active Abandoned
  • 2000-08-22 DE DE60039893T patent/DE60039893D1/de not_active Expired - Lifetime
  • 2000-08-22 AU AU65989/00A patent/AU784460B2/en not_active Ceased
  • 2000-08-22 JP JP2001518076A patent/JP4671570B2/ja not_active Expired - Lifetime
  • 2000-08-22 TW TW094109603A patent/TWI290832B/zh not_active IP Right Cessation
  • 2000-08-22 EP EP00953561A patent/EP1213028B1/en not_active Expired - Lifetime
  • 2000-08-22 ES ES00953561T patent/ES2307526T3/es not_active Expired - Lifetime
  • 2000-08-22 CA CA002382587A patent/CA2382587A1/en not_active Abandoned
  • 2000-08-22 AT AT00953561T patent/ATE404216T1/de not_active IP Right Cessation
  • 2000-08-22 WO PCT/JP2000/005617 patent/WO2001013940A1/ja not_active Ceased
• 2006
  • 2006-04-13 US US11/402,927 patent/US8287863B2/en not_active Expired - Fee Related

Patent Citations (1)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events