WO2000064944A1 - Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains - Google Patents
Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains Download PDFInfo
- Publication number
- WO2000064944A1 WO2000064944A1 PCT/US2000/011612 US0011612W WO0064944A1 WO 2000064944 A1 WO2000064944 A1 WO 2000064944A1 US 0011612 W US0011612 W US 0011612W WO 0064944 A1 WO0064944 A1 WO 0064944A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tissue
- seq
- acid sequence
- amino acid
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
- A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/38—Drugs for disorders of the endocrine system of the suprarenal hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to the treatment and inhibition of fibrosis by antagonism of the interaction of IL- 13 with its receptor and receptor components.
- IL-13 interleukin-13
- IL-13 interleukin-13
- IL-13 Various protein forms of IL-13 and DNA encoding various forms of IL-13 activity are described in McKenzie et al., Proc. Nati. Acad. Sci. USA 90:3735 (1993); Minty et al., Nature 362:248 (1993); and Aversa et al., WO94/04680.
- the term "IL-13” includes proteins having the sequence and/or biological activity described in these documents, whether produced by recombinant genetic engineering techniques; purified from cell sources producing the factor naturally or upon induction with other factors; or synthesized by chemical techniques; or a combination of the foregoing.
- IL-13 is a cytokine that has been implicated in production of several biological activities including: induction of IgG4 and IgE switching, including in human immature B cells (Punnonen et al., J. Immunol. 152: 1094 (1994)); induction of germ line IgE heavy chain ( €) transcription and CD23 expression in normal human B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730 (1993)); and induction of B cell proliferation in the presence of CD40L or anti-CD40 rnAb (Cocks et al., Int. Immunol. 5:657 (1993)).
- IL-13 Although many activities of IL-13 are similar to those of IL-4, in contrast to IL-4, IL- 13 does not have growth promoting effects on activated T cells or T cell clones (Zurawski et al., EMBO J. 12:2663 (1993)). Like most cytokines, IL-13 exhibits certain biological activities by interacting with an IL-13 receptor ("IL-13R") on the surface of target cells. IL- 13R and the IL-4 receptor (“IL-4R”) sharing a common component, which is required for receptor activation; however, IL-13 does not bind to cells transfected with the 130 kD IL-4R (Zurawski et al., supra). Thus, the IL-13R must contain at least one other ligand binding chain.
- Cytokine receptors are commonly composed or two or three chains .
- the cloning of one ligand binding chain for IL- 13 has been recently reported (Hilton et al., Proc. Natl. Acad. Sci. 93:497-501).
- IL-13R proteins can be produced for various reasons, including production of therapeutics and screening for inhibitors of IL-13 binding to the receptor and receptor signaling.
- the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence of SEQ ID NO: 1 from nucleotide 256 to nucleotide 1404;
- nucleotide sequence encoding a species homologue of the sequence specified in (a) or (b); and (f) an allelic variant of the nucleotide sequence specified in (a) or (b).
- the nucleotide sequence encodes a protein having a biological activity of the human IL-13 receptor.
- the nucleotide sequence may be operably linked to an expression control sequence.
- the polynucleotide comprises the nucleotide sequence of SEQ ID NOJ from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO: 1 from nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ ID NOJ from nucleotide 1324 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242 ; the nucleotide sequence of SEQ ID NO : 3 from nucleotide 178 to nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from nucleotide 1189 to nucleotide 1242.
- the invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of:
- SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
- Host cells preferably mammalian cells, transformed with the polynucleotides are also provided.
- the invention provides a process for producing a E -
- the process comprises: (a) growing a culture of the host cell of the present invention in a suitable culture medium; and
- the present invention also provides for an isolated IL-13bc protein comprising an amino acid sequence selected from the group consisting of:
- the protein comprises the amino acid sequence of SEQ ID NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the sequence of SEQ ID NO:2; the sequence of SEQ ID NO:2
- the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from IL-13bc).
- Prefe ⁇ ed fusion proteins comprise an antibody fragment, such as an Fc fragment.
- Particularly prefe ⁇ ed embodiments comprise the amino acid sequence of SEQ ID NO: 1
- compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
- the present invention further provides for compositions comprising an antibody which specifically reacts with a protein of the present invention.
- Methods of identifying an inhibitor of IL- 13 binding to the IL- 13bc or IL- 13 receptor are also provided. These methods comprise:
- Methods of inhibiting binding of IL-13 to the IL-13bc proteins or IL-13 receptor in a mammalian subject comprise administering a therapeutically effective amount of a composition containing an IL- 13bc protein, an IL-13bc or IL-13R inhibitor or an antibody to an IL-13bc protein.
- Methods are also provided for potentiating IL- 13 activity, which comprise combining a protein having IL-13 activity with a protein of the present invention and contacting such combination with a cell expressing at least one chain of IL- 13R other than IL-13bc.
- the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject.
- Further methods are provided for treating an IL-13-related condition in a mammalian subject, said method comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
- Other methods provide for a method of inhibiting the interaction of IL- 13 with an IL- 13bc protein in a mammalian subj ect comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
- the antagonist is selected from the group consisting of an IL-13bc protein, a soluble form of IL-13R ⁇ l, an antibody to IL-13 or an IL-13-binding fragment thereof, an antibody to IL-13bc or an IL-13bc-binding fragment thereof, an antibody to IL-13R0J or an IL-13R ⁇ l -binding fragment thereof, IL-13R- binding mutants of IL-4, a small molecule capable of inhibiting the interaction of IL-13 with IL-13bc and a small molecule capable of inhibiting the interaction of IL-13 with IL-13R ⁇ l.
- the invention provides for a method of treating tissue fibrosis in a mammalian subject.
- the method comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a protein and a pharmaceutically acceptable carrier, wherein the protein comprises an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2; (b) the amino acid sequence of SEQ ID NO:2 from amino acids 22 to 334;
- the invention also provides for a method of inhibiting formation of tissue fibrosis in a mammalian subject.
- the method comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a protein and a pharmaceutically acceptable carrier, wherein the protein comprises an amino acid sequence selected from the group consisting of:
- inventions provide for a method of treating or inhibiting tissue fibrosis in a mammalian subject.
- the method comprises administering a therapeutically effective amount of a composition comprising (a) a molecule selected from the group consisting of an IL-13 antagonist and an IL-4 antagonist, and (b) a pharmaceutically acceptable carrier.
- the tissue fibrosis affects a tissue selected from the group consisting of liver, skin epidermis, skin endodermis, muscle, tendon, cartilage, cardiac tissue, pancreatic tissue, lung tissue, uterine tissue, neural tissue, testis, ovary, adrenal gland, artery, vein, colon, small intestine, biliary tract and gut; most preferably, liver tissue (including tissue infected with schistosoma).
- the fibrois results from the healing of a wound (including a surgical incision).
- an antagonist is selected from the group consisting of an IL-13bc protein, a soluble form of EL-13R ⁇ l, an antibody to EL- 13 or an EL- 13- binding fragment thereof, an antibody to IL-13bc or an IL-13bc-binding fragment thereof, an antibody to EL-13R ⁇ l or an IL-13R ⁇ l -binding fragment thereof, EL- 13R-binding mutants of IL-4, a small molecule capable of inhibiting the interaction of IL-13 with IL-13bc and a small molecule capable of inhibiting the interaction of IL- 13 with EL- 13R ⁇ 1.
- the antagonist is an EL-13bc protein comprising an amino acid sequence selected from the group consisting of:
- the antagonist is selected from the group consisting of a soluble form of EL-4R, an antibody to EL-4 or an EL-4-binding fragment thereof, an antibody to EL-4R or an
- EL-4R-binding fragment thereof and a small molecule capable of inhibiting the interaction of EL-4 with EL-4R.
- FIG. 1 The figure presents photographs of EL-13, EL-4, EL-11 and mock transfected COS cells after exposure to IL-13bc-Fc as described in Example 4 below.
- Fig. 2 Characterization of the roles of EL-4 and EL-13 in schistosomiasis pathogenesis.
- C57BL/6 WT and EL-4-deficient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and then sacrificed at week 8 post-infection to evaluate the size of liver granulomas (panel A), tissue eosinophilia (panel B), and hepatic fibrosis (panel C).
- Separate groups of mice were treated with control-Fc or sEL-13Rcc2-Fc as described in the Methods section.
- the data shown are measurements from individual mice and the lines designate the means for each group.
- Statistical comparisons were made by Student' s t-test (panels A and B) and by Analysis of Covariance (panel C). Significant comparisons and their p values are indicated in the figure. All data were reproduced in a second study.
- FIG. 3 Liver collagen is reduced in sEL-13R ⁇ 2-Fc-treated /infected mice. Liver sections were prepared 8 weeks after challenge infection. Sections from control Fc-treated (panels A and B) and sIL-13R ⁇ 2-Fc-treated WT infected mice that contained nearly identical tissue egg burdens were stained with picrosirius red (panels A and C) and illuminated using polarized light to highlight the areas rich in collagen (panels B and D). Birefringent areas indicate positive collagen staining and the areas shown are representative for each liver (magnification, X 40). Liver sections from sLL-13R ⁇ 2-Fc-treated mice showed only very slight granuloma and portal tract-associated collagen, in comparison with control animals.
- Fig. 4 The Thl Th2-type cytokine profile is unaffected by sEL-13R ⁇ 2-Fc treatment.
- C57BL/6 WT and EL-4-deficient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and separate groups of mice were treated with control-Fc or sEL-13R ⁇ 2-Fc as described in the Methods section.
- Mesenteric lymph node cells were isolated from individual mice and single cell suspensions were prepared (3 x 10 6 cells/well in 24 well plates) and stimulated with medium alone (squares), SEA at 20 ug/ml (circles), or with SEA and 50 ug/ml of anti-CD4 mAb (triangles). All cytokines were assayed in culture supematants by ELISA 72 hrs post-stimulation as described in the Methods section. The symbols represent values for individual mice and the bars indicate the means within each group.
- Fig. 5 Th2-type cytokine mRNA expression is reduced in the livers of infected EL-4-deficient mice but unaffected by EL-13 blockade.
- C57BL/6 WT and EL-4-deficient (4KO) mice were infected with 25 cercariae o ⁇ Schistosoma mansoni and separate groups of mice were treated with control-Fc or sEL-13R ⁇ 2-Fc as described in the Methods section. All animals were sacrificed on wk 8 postinfection and liver specimens were prepared for RT-PCR analysis as described in the Methods section. The data shown are the individual values of 9 to 10 animals per group and the bar indicates the average within each group.
- mice C57BL/6 WT and IL-4-deficient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and separate groups of mice were treated with control-Fc or sEL-13R ⁇ 2-Fc as described in the Methods section. All animals were sacrificed on wk 8 postinfection and liver specimens were prepared for RT-PCR analysis as described in the Methods section. The data shown are the individual values of 9 to 10 animals per group and the bar indicates the average within each group. The * symbol indicates that the data are significantly different from the WT and IL-4- deficient control-Fc groups as determined by Student's t-test (p ⁇ .05). The average values from five uninfected WT (black circle) and five uninfected IL-4-deficient mice (open circle) are shown on the Y-axis for each cytokine. These data were reproduced in a separate study.
- EL-13 induces type I collagen synthesis in murine 3T3 fibroblasts.
- Cells were stimulated with media (lane 1), rIL-4 at 1000 Units/ml (lane 2) or rEL- 13 at 20 ng/ml (lanes 3 and 4, from R&D Systems and Genetics Institute, respectively) for 48 h.
- Total cell lysates were separated on 6% SDS-PAGE under reducing conditions, transfe ⁇ ed to nitrocellulose membrane and probed with rabbit IgG anti-mouse type I collagen.
- the top doublet and bottom band (a ⁇ ows) co ⁇ espond to the purified rat collagen type I separated in lane 5 (panel A).
- the bottom figure (panel B) is the densitometric values (arbitrary pixel units).
- EL-13bc polynucleotides encoding the EL-13 binding chain of EL-13R
- SEQ ED NO: 1 provides the nucleotide sequence of a cDNA encoding the murine EL- 13bc.
- SEQ ED NO:2 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-21. The mature murine EL-13bc is believed to have the sequence of amino acids 22-383 of SEQ ED NO:2.
- the mature murine receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 22-334 of SEQ ED NO:2), a transmembrane domain (comprising approximately amino acids 335-356 of SEQ ED NO:2) and an intracellular domain (comprising approximately amino acids 357-383 of SEQ ED NO:2).
- SEQ ED NO:3 provides the nucleotide sequence of a cDNA encoding the human EL- 13bc.
- SEQ ED NO:4 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-25.
- the mature human EL-13bc is believed to have the sequence of amino acids 26-380 of SEQ ID NO:4.
- the mature human receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 26-341 of SEQ ID NO:4), a transmembrane domain (comprising approximately amino acids 342-362 of SEQ ED NO:4) and an intracellular domain (comprising approximately amino acids 363-380 of SEQ ID NO:4).
- the first 81 amino acids of the human EL- 13bc sequence are identical to the translated sequence of an expressed sequence tag (EST) identified as "yg99fl0.rl Homo sapiens cDNA clone 41648 5'" and assigned database accession number R52795.gb_est2. There are no homologies or sequence motifs in this EST sequence which would lead those skilled in the art to identify the encoded protein as a cytokine receptor.
- EST expressed sequence tag
- a cDNA clone co ⁇ esponding to this database entry is publicly-available from the I.M.A.G.E. Consortium. Subsequent to the priority date of the present application, such clone was ordered by applicants and sequenced. The sequence of such clone was determined to be the sequence previously reported by applicants as SEQ ED NO:3 herein.
- Soluble forms of EL- 13bc protein can also be produced.
- Such soluble forms include without limitation proteins comprising amino acids 1-334 or 22-334 of SEQ ED NO:2 or amino acids 1-341 or 26-341 of SEQ ID NO:4.
- the soluble forms of the EL- 13bc are further characterized by being soluble in aqueous solution, preferably at room temperature.
- IL- 13bc proteins comprising only the intracellular domain or a portion thereof may also be produced. Any forms of EL- 13bc of less than full length are encompassed within the present invention and are refe ⁇ ed to herein collectively with full length and mature forms as "EL-13bc" or "EL-13bc proteins .
- EL- 13bc proteins of less than full length may be produced by expressing a co ⁇ esponding fragment of the polynucleotide encoding the full-length EL-13bc protein (SEQ ED NOJ or SEQ ED NO:3). These co ⁇ esponding polynucleotide fragments are also part of the present invention. Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
- a protein has "a biological activity of the EL-13 receptor binding chain” if it possess one or more of the following characteristics: (1) the ability to bind EL-13 or a fragment thereof (preferably a biologically active fragment thereof); and/or (2) the ability to interact with the second non-EL-13-binding chain of IL-13R to produce a signal characteristic of the binding of L- 13 to EL- 13R.
- the biological activity possessed by the protein is the ability to bind EL-13 or a fragment hereof, more preferably with a K D of about OJ to about 100 nM.
- EL-13bc or active fragments thereof may be fused to carrier molecules such as immunoglobulins.
- carrier molecules such as immunoglobulins.
- soluble forms of the EL- 13bc may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
- Other fusions proteins such as those with GST, Lex-A or MBP, may also be used.
- the invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NOJ or SEQ ED NO:3, that is, naturally-occurring alternative forms of the isolated polynucleotide of SEQ ED NO: 1 or SEQ ED NO:3 which also encode EL-13bc proteins, preferably those proteins having a biological activity of IL-13bc. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ED NO: 1 or SEQ ED NO:3 under highly stringent conditions (for example, OJxSSC at 65°C).
- Isolated polynucleotides which encode EL-13bc proteins but which differ from the nucleotide sequence set forth in SEQ ED NOJ or SEQ ED NO:3 by virtue of the degeneracy of the genetic code are also encompassed by the present invention. Variations in the nucleotide sequence as set forth in SEQ ED NO:l or SEQ ED NO:3 which are caused by point mutations or by induced modifications are also included in the invention.
- the present invention also provides polynucleotides encoding homologues of the murine and human EL-13bc from other animal species, particularly other mammalian species.
- Species homologues can be identified and isolated by making probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries constructed from PBMCs, thymus or testis of the relevant species.
- the isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res.19, 4485-4490 (1991), in order to produce the EL-13bc protein recombinantly.
- an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res.19, 4485-4490 (1991)
- Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185.537-566 (1990).
- operably linked means enzymatically or chemically ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the EL-13bc protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
- a number of types of cells may act as suitable host cells for expression of the EL-13bc protein. Any cell type capable of expressing functional IL-13bc protein may be used.
- Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
- monkey COS cells Chinese Hamster Ovary (CHO) cells
- human kidney 293 cells human epidermal A431 cells
- human Colo205 cells human Colo205 cells
- CV-1 cells other transformed primate cell lines
- normal diploid cells cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix
- the IL-13bc protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
- suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
- Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). incorporated herein by reference. Soluble forms of the EL-13bc protein may also be produced in insect cells using appropriate isolated polynucleotides as described above.
- the EL-13bc protein may be produced in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
- yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
- Candida or any yeast strain capable of expressing heterologous proteins.
- Suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins.
- Expression in bacteria may result in formation of inclusion bodies incorporating the recombinant protein. Thus, refolding of the recombinant protein may be required in order to produce active or more active material.
- Several methods for obtaining co ⁇ ectly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaotropic agent.
- the EL-13bc protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the EL-13bc protein.
- the EL- 13bc protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the EL-13bc protein of the invention can be purified from conditioned media.
- Membrane-bound forms of EL-13bc protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
- the IL-13bc protein can be purified using methods known to those skilled in the art.
- the EL-13bc protein of the invention can be concentrated using a commercially available protein concentration filter, for example, an
- the concentrate can be applied to a purification matrix such as a gel filtration medium.
- a purification matrix such as a gel filtration medium.
- an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneimine (PEE) groups.
- the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
- a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups.
- Sulfopropyl groups are prefe ⁇ ed (e.g., S-Sepharose® columns).
- the purification of the EL- 13bc protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin- toyopearl® or Cibacrom blue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography.
- one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP- HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the EL- 13bc protein.
- Affinity columns including IL- 13 or fragments thereof or including antibodies to the EL-13bc protein can also be used in purification in accordance with known methods.
- Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
- the isolated IL-13bc protein is purified so that it is substantially free of other mammalian proteins.
- EL-13bc proteins of the invention may also be used to screen for agents which are capable of binding to EL-13bc or EL-13R or which interfere with the bindmg of EL-13 to the EL-13 or EL-13bc (either the extracellular or intracellular domains) and thus may act as inhibitors of normal binding and cytokine action ("IL- 13R inhibitors").
- Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the EL- 13bc protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
- EL-13bc protein may be immobilized in purified form on a carrier and binding to purified EL-13bc protein may be measured in the presence and in the absence of potential inhibiting agents.
- a suitable binding assay may alternatively employ a soluble form of EL- 13bc of the invention.
- Another example of a system in which inhibitors may be screened is described in Example 2 below.
- a first binding mixture is formed by combining EL-13 or a fragment thereof and EL-13bc protein, and the amount of binding in the first binding mixture (B 0 ) is measured.
- a second binding mixture is also formed by combining EL-13 or a fragment thereof, EL-13bc protein, and the compound or agent to be screened, and the amount of binding in the second binding mixture (B) is measured.
- the amounts of binding in the first and second binding mixtures are compared, for example, by performing a calculation of the ratio B/B 0 .
- a compound or agent is considered to be capable of inhibiting binding if a decrease in binding in the second binding mixture as compared to the first binding mixture is observed.
- the second chain of EL-13R can be added to one or both of the binding mixtures.
- the formulation and optimization of binding mixtures is within the level of skill in the art, such binding mixtures may also contain buffers and salts necessary to enhance or to optimize binding, and additional control assays may be included in the screening assay of the invention.
- Compounds found to reduce the binding activity of IL- 13bc protein to EL- 13 or its fragment to any degree, preferably by at least about 10%, more preferably greater than about 50% or more, may thus be identified and then secondarily screened in other binding assays and in vivo assays. By these means compounds having inhibitory activity for EL- 13bc binding which may be suitable as therapeutic agents may be identified.
- EL-13bc proteins may also be used as diagnostic agents for detecting the expression or presence of IL-13bc, EL-13R, EL- 13 or cells expressing EL-13bc, EL- 13R or IL-13.
- the proteins or polynucleotides may be employed for such purpose in standard procedures for diagnostics assays using these types of materials. Suitable methods are well known to those skilled in the art.
- EL-13R refers to EL-13bc and/or a second EL-13 receptor chain known as "EL-13R ⁇ l” or "NR4" (see: murine receptor chain, Hilton et al., Proc. Natl. Acad. Sci. USA 1996, 93:497-501; human receptor chain, Aman et al., J. Biol. Chem. 1996, 271:29265-70, and Gauchat et al., Eur. J. Immunol. 1997, 27:971-8).
- EL-13bc acts as a mediator of the known biological activities of EL-13.
- EL- 13bc protein particularly, soluble EL- 13bc proteins
- EL- 13R inhibitors i.e., antagonists of interaction of EL-13 with EL-13R (such as, for example, antibodies to EL-13R (including particularly to EL-13bc or to EL-13R0.1) and fragments thereof, antibodies to EL-13 and fragments thereof, soluble EL-13R0.1 proteins, and small molecule and other inhibitors of the interaction of EL-13 with EL- 13R (including with EL- 13bc and/or with EL- 13R ⁇ 1 )) may be useful in treatment or modulation of various medical conditions in which EL-13 is implicated or which are effected by the activity (or lack thereof) of EL-13 (collectively "EL-13-related conditions").
- Mutated forms of EL-4 which bind to EL-13R can also be used as EL- 13 antagonists (see, for example, those disclosed in Shanafelt et al., Proc. Natl. Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993, 178:2213-8; and Grunewald et al., J. Immunol. 1998, 160:4004-9).
- EL- 13-related conditions include without limitation Ig-mediated conditions and diseases, particularly IgE-mediated conditions (including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)); inflammatory conditions of the lungs; immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
- IgE-mediated conditions including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)
- inflammatory conditions of the lungs immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
- pathological states may result from disease, exposure to radiation or drugs, and include, for example, leukopenia, bacterial and viral infections, anemia, B cell or T cell deficiencies such as immune cell or hematopoietic cell deficiency following a bone ma ⁇ ow transplantation.
- leukopenia bacterial and viral infections
- anemia B cell or T cell deficiencies
- immune cell or hematopoietic cell deficiency following a bone ma ⁇ ow transplantation.
- EL- 13bc proteins may also be useful to enhance macrophage activation (i.e., in vaccination, treatment of mycobacterial or intracellular organisms, or parasitic infections).
- EL-13bc proteins may also be used to potentiate the effects of IL-13 in vitro and in vivo.
- an IL-13bc protein can be combined with a protein having IL-13 activity (preferably EL-13) and the resulting combination can be contacted with a cell expressing at least one chain of EL-13R other than EL-13bc (preferably all chains of EL-13R other than EL-13bc, such as EL-13R ⁇ l).
- the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject in vivo.
- the pre- established association of the EL-13 protein with the EL-13bc protein will aid in formation of the complete IL- 13/EL- 13R complex necessary for proper signaling. See for example the methods described by Economides et al., Science 270:1351 (1995).
- EL- 13bc protein and EL- 13R inhibitors purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier may contain, in addition to EL-13bc or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
- pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
- the pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, interleukins (such as, EL-1, EL-2, EL-3, IL-4 . . . EL-24, EL-25), G-CSF, stem cell factor, and erythropoietin.
- the pharmaceutical composition may also include anti- cytokine antibodies.
- the pharmaceutical composition may further contain other anti-inflammatory agents. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with isolated IL- 13bc protein or EL- 13bc inhibitor, or to minimize side effects caused by the isolated IL-13bc or LL-13bc inhibitor.
- isolated IL-13bc or EL-13bc inhibitor may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
- the pharmaceutical composition of the invention may be in the form of a liposome in which isolated EL-13bc protein or EL-13bc inhibitor is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which in aqueous solution.
- Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incorporated herein by reference.
- the term "therapeutically effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
- a meaningful patient benefit e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
- the term refers to that ingredient alone.
- the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
- a therapeutically effective amount of isolated EL-13bc protein or EL-13bc inhibitor is administered to a mammal.
- Isolated EL-13bc protein or EL-13bc inhibitor may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors.
- IL- 13bc protein or EL- 13bc inhibitor When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, IL- 13bc protein or EL- 13bc inhibitor may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering EL-13bc protein or EL-13bc inhibitor in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
- EL-13bc protein or EL-13bc inhibitor used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is prefe ⁇ ed.
- IL- 13bc protein or EL- 13bc inhibitor When a therapeutically effective amount of IL-13bc protein or EL-13bc inhibitor is administered orally, IL- 13bc protein or EL- 13bc inhibitor will be in the form of a tablet, capsule, powder, solution or elixir.
- the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
- the tablet, capsule, and powder contain from about 5 to 95% EL-13bc protein or EL-13bc inhibitor, and preferably from about 25 to 90% EL-13bc protein or EL- 13bc inhibitor.
- a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
- the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
- the pharmaceutical composition When administered in liquid form, contains from about 0.5 to 90% by weight of EL-13bc protein or EL-13bc inhibitor, and preferably from about 1 to 50% EL-13bc protein or EL-13bc inhibitor.
- EL- 13bc protein or EL- 13bc inhibitor When a therapeutically effective amount of IL-13bc protein or EL-13bc inhibitor is administered by intravenous, cutaneous or subcutaneous injection, EL- 13bc protein or EL- 13bc inhibitor will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
- parenterally acceptable protein solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
- a prefe ⁇ ed pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to EL- 13bc protein or EL-13bc inhibitor an isotonic vehicle such as Sodium Chloride Injection,
- the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additive known to those of skill in the art.
- the amount of EL-13bc protein or EL-13bc inhibitor in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of EL- 13bc protein or EL-13bc inhibitor with which to treat each individual patient. Initially, the attending physician will administer low doses of EL-13bc protein or EL-13bc inhibitor and observe the patient's response. Larger doses of EL-13bc protein or EL-13bc inhibitor may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further.
- compositions used to practice the method of the present invention should contain about 0.1 ⁇ g to about 100 mg (preferably about 20 ⁇ g to about 500 ⁇ g) of EL-13bc protein or EL-13bc inhibitor per kg body weight.
- the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the EL-13bc protein or EL-13bc inhibitor will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
- IL-13bc proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the IL-13bc protein and which may inhibit binding of EL-13 or fragments thereof to the receptor. Such antibodies may be obtained using the entire EL-13bc as an immunogen, or by using fragments of EL- 13bc , such as the soluble mature EL- 13bc .
- the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Additional peptide immunogens may be generated by replacing tyrosine residues with sulfated tyrosine residues. Methods for synthesizing such peptides are known in the art, for example, as in R.P. Me ⁇ ifield, J.Amer.Chem.Soc. 85. 2149-2154 (1963); J.L. Krstenansky, et al., FEBS Lett. 21J, 10 (1987).
- Neutralizing or non-neutralizing antibodies binding to EL-13bc protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutralizing monoclonal antibodies may be capable of blocking EL-13 binding to the EL-13bc.
- Example 1 Isolation of EL-13bc cDNAs Isolation of the murine IL-13 receptor chain.
- RNA 5 ug of polyA+ RNA was prepared from the thymuses of 6-8 week old C3H/HeJ mice.
- Double stranded, hemimethylated cDNA was prepared using Stratagene's cDNA synthesis kit according to manufacturers instructions. Briefly, the first strand was primed with an oligodT-Xho primer, and after second strand synthesis, EcoRI adapters were added, and the cDNA was digested with Xhol, and purified. The cDNA was ligated to the XhoI-EcoRI sites of the Zap Express (Stratagene) lambda vector, and packaged using Gigapak II Gold packaging extracts (Stratagene) according to the manufacturers instructions.
- ZapExpress vector as per manufacturers instruction, and the DNA sequence was determined.
- the DNA sequence encoded a novel member of the hematopoietin receptor family.
- Clone A25 containing the polynucleotide having the sequence of SEQ ED NO: 1 was deposited with ATCC as pA25pBKCMV at accession number 69997 on February 22, 1996.
- a partial fragment of the human homolog of the murine receptor was isolated by PCR using oligonucleotides derived from the murine sequence.
- cDNA was prepared from human testis polyA-i- RNA that was obtained from Clontech.
- a DNA fragment of 274 base pairs was amplified from this cDNA by PCR with the following oligonucleotides: ATAGTTAAACCATTGCCACC (SEQ ED NO:6) and CTCCATTCGCTCCAAATTCC (SEQ ED NO:7) using AmpliTaq polymerase (Promega) in IX Taq buffer containing 1.5 mM MgC12 for 30 cycles of incubation (94°C x 1 minute, 42°C for 1 minute, and 72°C for 1 minute).
- the DNA sequence of this fragment was determined, and two oligonucleotides were prepared from an internal portion of this fragment with the following sequence: AGT CTATCTTACTTTTACTCG (S EQ ID NO : 8 ) and CATCTGAGCAATAAATATTCAC (SEQ ED NO:9). These oligonucleotides were used as probes to screen a human testis cDNA library purchased from CLONTECH (cat #HL1161) . Filters were hybridized at 52°C using standard 5XSSC hybridization conditions and washed in 2X SSC at 52°C . Twenty two clones were isolated that hybridized to both oligonucleotides in a screen of 400,000 clones. DNA sequence was determined from four of the cDNA clones, and all encoded the same novel hematopoietin receptor. The predicted DNA sequence of the full length human receptor chain is shown as SEQ ID NO:3.
- the human clone was deposited with ATCC as phA25#l lpDR2 at accession number 69998 on February 22, 1996.
- EL- 13bc-Ig was produced from DEAE-dextran transfected COS-1 cells and purified via protein A sepharose chromatography (Pharmacia).
- the B9 cell line proliferated in response to EL-13, EL-4 or EL-6. Only responses to EL-13 were inhibited by the soluble EL-13bc-Ig, indicating that this receptor binds EL-13 specifically, but not EL-4 or EL-6.
- the tables show cpm. Two separate experiments are shown. Table I
- a Biacore biosensor was used to measure directly the specific binding of
- EL-13 to purified EL-13bc-Ig (Pharmacia, Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance units (RU) of purified EL-13bcJg , human IgGl or i ⁇ elevant receptor were each covalently immobilized to different flow cells on the sensor chip as recommended by the manufacturer. (RU's are a refelction of the mass of protein bound to the sensor chip surface.) Purified IL-13 was injected across the flow cells at 5 ul min for 10 mins in the presence or absence of excess purified EL-13bc-Ig. Binding was quantified as the difference in RU before and after sample injection.
- Expression vectors for IL-13, EL-4, JL-11 or empty vector were transfected into COS-1 cells in duplicated plates via the DEAE-dextran method. Two days after transfection cells were washed twice in phosphate buffered saline (PBS) and fixed in the culture dish for 10' at 4° C with methanol. Following fixation cells were washed twice with PBS then rinsed once with binding buffer (PBS, 1 % (w/v) bovine serum albumin, )J% (w/v) sodium azide) and incubated for two hours at 4° C in binding buffer with IL- 13bc-Fc at 1.Oug/ml or with relevant anti-cytokine antisera.
- PBS phosphate buffered saline
- binding buffer PBS, 1 % (w/v) bovine serum albumin, )J% (w/v) sodium azide
- Example 5 Other Systems for Determination Biological Activity of EL-13bc Protein
- Other systems can be used to determine whether a specific EL- 13bc protein exhibits a "biological activity" of IL-13bc as defined herein. The following are examples of such systems.
- Binding of EL-13 to the extracellular region of the IL-13bc protein will specifically cause a rapid induction of phosphotyrosine on the receptor protein.
- a EL- 13bc protein (such as, for example, a soluble form of the extracellular domain) is produced and used to detect EL-13 binding.
- a DNA construct is prepared in which the extracellular domain (truncated prior, preferably immediately prior, to the predicted transmembrane domain) is ligated in frame to a cDNA encoding the hinge C H 2 and C H 3 domains of a human immunoglobulin (Ig) ⁇ 1.
- This construct is generated in an appropriate expression vector for COS cells, such as pED ⁇ C or pMT2.
- the plasmid is transiently transfected into COS cells.
- the secreted EL-13bc-Ig fusion protein is collected in the conditioned medium and purified by protein A chromatography.
- the purified EL- 13bc-Ig fusion protein is used to demonstrate EL- 13 binding in a number of applications.
- EL-13 can be coated onto the surface of an enzyme- linked immunosorbent assay (ELISA) plate, and then additional binding sites blocked with bovine serum albumin or casein using standard ELISA buffers.
- the EL-13bc-Ig fusion protein is then bound to the solid-phase EL-13, and binding is detected with a secondary goat anti-human Ig conjugated to horseradish peroxidase.
- the activity of specifically bound enzyme can be measured with a colorimetric substrate, such as tetramethyl benzidine and absorbance readings.
- EL-13 may also be expressed on the surface of cells, for example by providing a transmembrane domain or glucosyl phosphatidyl inositol (GPI) linkage.
- Cells expressing the membrane bound EL-13 can be identified using the EL-13bc-Ig fusion protein.
- the soluble IL-13bc-Ig fusion is bound to the surface of these cells and detected with goat anti-human Ig conjugated to a fluorochrome, such as fluorescein isothiocyanate and flow cytometry.
- a yeast genetic selection method the "interaction trap” [Gyuris et al, Cell 75:791-803, 1993] can be used to determine whether a JJ -13bc protein has a biological activity of IL-13bc as defined herein.
- the expression of reporter genes from both Lex Aop-Leu2 and LexAop-LacZ relies on the interaction between the bait protein, for example in this case a species which interacts with human EL-13bc, and the prey, for example in this case the human IL-13bc protein.
- the prey for example in this case the human IL-13bc protein.
- Leu2 or LacZ expression The most simple method is to measure the activity of the LacZ encoded protein, ⁇ -galactosidase.
- This activity can be judged by the degree of blueness on the X-Gal containing medium or filter.
- standard assays can be found in "Methods in Yeast Genetics" Cold Spring Harbor, New York, 1990 (by Rose, M.D., Winston, F., and Hieter, P.).
- a particular species such as, for example, a cytosolic protein which binds to the intracellular domain of the EL-13bc in vivo
- that species can be used as the "bait" in the interaction trap with the EL-13bc protein to be tested serving as the "prey”, or vice versa.
- Such conditions include, without limitation, fibrositis, formation of fibromas (fibromatosis), fibrogenesis (including pulmonary fibrogenesis), fibroelastosis (including endocardial fibroelastosis), formation of fibromyomas, fibrous ankylosis, formation of fibroids, formation of fibroadenomas, formation of fibromyxomas, and fibrocystotitis (including cystic fibrosis).
- the EL-13 receptor complex is composed of at least three distinct components, including the IL-4 receptor, the low-affinity binding IL-13R ⁇ l chain, and the high affinity binding chain, EL-13R ⁇ 2 35,42-44 Recently, a soluble EL- 13R ⁇ 2-Fc fusion protein was prepared and has been used successfully to neutralize EL-13 both in vitro 35 and j n v ivo 30,39-41 Since the fusion protein binds EL-13 with high affinity, but fails to neutralize EL-4, the protein provided an excellent tool to determine the specific roles of EL-13.
- mice showed no significant change in granuloma size as a result of EL- 13 blockade (Fig. 2A).
- control-Fc-treated IL-4-deficient mice also failed to show a reduced granulomatous response, and in fact, granulomas were significantly larger in these mice.
- the EL-4-deficient mice displayed a markedly reduced granulomatous response when EL-13 was inhibited (Fig. 2A, far right).
- mice displayed on average a 40 to 50% reduction in granuloma volume when compared with either control or sEL-13R ⁇ 2-Fc-treated WT animals, and more than a 75% reduction when compared with control-Fc-treated EL-4-deficient mice.
- Th2-type cytokine production is reduced in IL-4-deficient mice but unaffected by IL-13 inhibition.
- EL-4 is the primary cytokine driving CD4 + Th2 cell development 21,22
- me ro ⁇ e 0 f IL-13 in the generation and maintenance of Th2-type responses has been controversial and may be influenced by both host genetics and the infectious disease model under study 30,34,38 Therefore, to determine whether the sEL-13R ⁇ 2-Fc-induced changes in liver pathology were generated by alterations in the Thl/Th2 cytokine balance, we isolated mesenteric lymph nodes and spleens from infected mice, prepared single cell suspensions, and restimulated the cultures in vitro with parasite antigens.
- IL-13 blockade had no significant effect on the pattern of cytokine mRNA expression in either WT or EL-4-deficient mice.
- Collagen I and collagen HI mRNA levels are reduced in the livers of sIL-13R 2-Fc-treated mice but unaffected by IL-4-deficiency.
- IL-13 stimulates collagen production in mouse 3T3 fibroblasts. Having shown that EL-13 blockade in vivo significantly reduced Col I and
- Col HI mRNA expression in the liver of infected WT and IL-4-deficient mice we wanted to determine whether EL-13 would directly stimulate collagen synthesis in fibroblasts.
- a CD4 + Th2-type cytokine pattern dominates the immune response in mice infected with S. mansoni 12,13.
- Previous EL-4 depletion studies and experiments with EL-4-deficient mice failed to show an indispensable role for this cytokine in the pathogenesis of schistosomiasis 15,23,24 indeed, while a partial reduction in fibrosis was observed in some studies 1 , egg-induced granuloma formation could proceed in the complete absence of EL-423,24 j ⁇ contrast to these observations, granuloma formation and the development of hepatic fibrosis was severely impaired in Stat ⁇ -deficient mice 16, which display a major defect in the production of several Th2-associated cytokines 46.
- T JL-4 and EL-13 both signal through Stat6, therefore the apparent differences in pathology observed between infected EL-4-deficient and Stat ⁇ -deficient mice may be explained by EL-13. Nevertheless, the distinct contributions of EL-4 and EL-13 in disease progression can not be discerned from studies in Stat ⁇ or EL-4-deficient mice alone. In this study, we used a potent inhibitor of EL-13 in infected WT and EL-4-deficient mice and demonstrate that IL-13 and IL-4 exhibit redundant, as well as unique roles in the pathogenesis of schistosomiasis.
- Th2-type cytokine responses can develop in vivo in the absence of EL-4 or the EL-4 receptor 26,39, which is consistent with our findings since reduced but significant IL-13, IL-10, and EL-5 expression was detected in the mesenteric lymph nodes (Fig.4) and livers (Fig. 5) of infected EL-4- deficient mice. Their production was also highly dependent on a CD4 + T cell response (Fig. 4), further indicating that a conventional Th2-type response was established.
- IL-13 appears to partially support the reduced but significant egg-induced tissue eosinophilia in IL-4-deficient mice since eosinophils were reduced to below 10% in the IL-4-deficient/sIL-13R ⁇ 2-Fc-treated animals. Nevertheless, these data indicate that IL-4 is the dominant cytokine responsible for the development of eosinophil and mast cell populations within granulomas.
- EL-13 had no significant effect on the production of EFN- ⁇ , EL-4, EL-5, EL- 10, or EL- 13 by mesenteric lymph node (Fig. 4) or spleen cells in vitro and there was also no change in cytokine mRNA expression in vivo, at the site of lesion formation (Fig. 5).
- EL-4-deficient mice displayed an increased J-FN- ⁇ response in the draining lymph nodes (Fig.4) and decreased EL-5 and EL-13 expression in both the lymph nodes (Fig. 4) and liver (Fig. 5).
- the slight reduction in fibrosis detected in EL-4-deficient mice by hydroxyproline analysis Fig.
- EL-13 was also recently shown to be important for resistance against intestinal nematodes 27,37-39
- IL- 13 also plays a central role in murine asthma models.
- EL-13 was found to be necessary and sufficient for the expression of allergic asthma 40,41
- Subepithelial fibrosis and airway smooth muscle hypertrophy are common features of chronic severe asthma 5 and chronic pulmonary fibrosis is associated with the production of type EH and type I collagen in the early and late stages of the disease, respectively.
- the link between EL-13 and fibrosis revealed in our study elucidates the etiology of several important human diseases and provides more effective modes of treatment of fibrotic diseases in general.
- IL-12 is less capable of modulating established Th2- type responses 53, which likely explains the failure to modulate pathology in the latter study .
- sIL- 13R ⁇ 2-Fc was extremely effective at reducing hepatic fibrosis, even though administered only during the later stages of infection.
- EL-13 inhibitors such as the sEL-13R ⁇ 2-Fc, are of general therapeutic benefit in preventing fibrosis associated with chronic infectious disease and demonstrate the important and non-redundant role of EL-13 in the pathogenesis of schistosomiasis.
- mice Animals, Parasites and Ag preparations 6-8 week old female C57BL/6 and EL-4-deficient mice (C57BL/6 background, 10 th backcross) were obtained from Taconic Farms, Inc. (Germantown, NY). All mice were housed in a NEH American Association for the Accreditation of Laboratory Animal Care-approved animal facility in sterile filter-top cages and maintained on sterile water. Cercariae of a Puerto Rican strain o ⁇ Schistosoma mansoni (NMRI) were obtained from infected Biomphalaria glabrata snails (Biomedical Research Institute, Rockville, MD). Soluble egg antigen (SEA) was purified from homogenized eggs, as previously described 15.
- the soluble EL-13 receptor cc2-Fc fusion protein (sEL-13R ⁇ 2-Fc) was prepared as previously described 5 and provided by Genetics Institute, Cambridge MA. Endotoxin contamination was ⁇ 2 EU/mg, as determined with the Cape Cod
- mice were infected by percutaneous challenge of tail skin for 40 min in water containing between 20 and 25 cercariae. Animals were treated with either a human control-Fc or with the sIL- 13R ⁇ 2-Fc by i.p. injection in 0.5 ml PBS, every other day after the onset of egg production (week 5). The optimal concentration for in vivo use (200 ⁇ g/mouse/day) was chosen based on kinetic assays and on dose response experiments in sensitized/i.v. egg-injected mice 30. Sera were collected from mice on the day of sacrifice. All animals were sacrificed by i.p. administration of sodium pentobarbital (18 mg/mouse, Sigma, St. Louis, MO) on week 8 and perfused with citrated saline to assess worm burdens 15. No mortality was observed among any of the treated groups.
- Histopathology and fibrosis measurement For measurement of granulomas, approximately half of the liver was fixed with Bouin-Hollander fixative and processed as previously described 15. The size of hepatic granulomas was determined in histological sections stained by Wright's Giemsa stain (Histopath of America, Clinton, MD). The diameters of each granuloma containing a single viable egg were measured with an ocular micrometer and the volume of each granuloma calculated assuming a spherical shape. The mean of the longest diameter and the diameter perpendicular to that was used. The percentage of eosinophils, mast cells and other cell types were evaluated in the same sections.
- Parenchymal necrosis was scored on a scale of 0-4, with 0 being the least and 4 being the most extensive necrosis.
- the frequency of mast cells was also assigned on a similar scale, using a range from 0-4.
- Fibrosis was also scored histologically using sections stained with picrosirius red. The picrosirius reagent stains collagen specifically and when sections are viewed under polarizing light, the bright areas where collagen is deposited are illuminated.
- RNA-STAT 60 Two portions of the liver from each animal were combined and placed in 1 ml of RNA-STAT 60 (Tel-Test), frozen on dry ice and kept at -70"C until use. Tissues were homogenized using a tissue polytron (Omni International Inc., Waterbury, CT) and total RNA was extracted following the recommendations of the manufacturer. The RNA was resuspended in DEPC-treated water and quantitated spectrophotometrically.
- RT-PCR procedure was used to determine relative quantities of mRNA for EL-4, EL-5, EL-10, EL-13, EFN- ⁇ , collagen I, collagen ELI, TGF ⁇ l, TGF ⁇ 2, and HPRT (hypoxanthine-guanine phosphoribosyl transferase).
- the cDNA was obtained after reverse transcription of 1 ⁇ g of RNA as described 14.
- the primers and probes for all genes were previously published 14,19,54 j e PCR cycles used for each cytokine were as follows: EL-4 (33), EL-5 (31 ), EFN- ⁇ (29), collagen I (26), collagen ELI (22), TGF ⁇ l (34), TGF ⁇ 2 (34), and HPRT (23).
- the amplified DNA was analyzed by electrophoresis, S outhern blotting and hybridization with non-radioactive cytokine-specif ⁇ c probes as previously described 1 .
- the PCR products were detected using a ECL detection system (Amersham).
- the chemiluminescent signals were quantified using a flat-bed scanner (Microtek model 600 ZS, To ⁇ ance, CA).
- the amount of PCR product was determined by comparing the ratio of cytokine-specific signal density to that of HPRT-specific signal density for individual samples. Arbitrary densitometric units for individual samples were subsequently multiplied by a factor of 100.
- MNN Mesenteric lymph node
- spleens were extracted from the mice and single cell suspensions were prepared.
- Red blood cells were lysed by osmotic treatment with ACK lysing buffer (Biofluids, Inc., Rockville, MD).
- Cells were placed in RPMI 1640 medium supplemented with 10% FCS , 2mM glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 25 mM HEPES, lmM sodium pyruvate, 0J mM nonessential amino acids, and 50 ⁇ M 2-ME at 37°C in 5% CO 2 .
- EL-4, EL- 5, EL-10, EL-13 and EFN- ⁇ were plated in 24- well plates (3 x 10 6 /ml, 1ml) and stimulated with SEA (20 ⁇ g/ml) and supematants were collected after 72 h to measure the levels of EL-4, EL- 5, EL-10, EL-13 and EFN- ⁇ . Additional SEA-stimulated cultures were also treated with 50 ⁇ g ml of anti-CD4 mAb (GK1.5). Cultures treated with anti-CD4 mAb alone showed no change in cytokine expression when compared with that observed in medium control cultures (data not shown). EL-5, EL-10, and EFN- ⁇ were measured using specific sandwich ELISA 5.
- EL-13 levels were measured using murine EL- 13 ELISA kits (R&D Systems, Minneapolis, MN). Cytokine levels were calculated from curves prepared with recombinant cytokines. EL-4 was measured using the EL-4 sensitive cell line CT.4S. Proliferation of these cells was quantified by ( 3 H)TdR incorporation, and the amount of cytokine was determined by comparison with known amounts of recombinant EL-4.
- the bands were visualized using a western blot chemiluminescence reagent (NEN Life Science Products, Boston, MA). To confirm identity of the collagen bands, cell lysates were treated with 0.5 mg/ml of collagenase (Boehringer Mannheim, Indianapolis, EN) in PBS, supplemented with 1 mM CaCl 2 and 1% FCS, for 1 h at 37°C. A purified rat collagen I preparation was also used as a control.
- Schistosome worm and egg numbers, changes in cytokine mRNA, and values for secreted cytokine proteins were compared using Student's two-tailed t test. Hepatic fibrosis was compared by analysis of covariance, using the log of total liver eggs as the covariate and the log of hydroxyproline per egg. p ⁇ 0.05 was considered significant.
- Th2 cytokines while decreasing egg-induced hepatic fibrosis. J.Immunol. 153, 753-754 (1994).
- Tumour necrosis factor alpha restores granulomas and induces parasite egg-laying in schistosome-infected SCTD mice. Nature 356, 604-607 (1992).
- Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248-250 (1993).
- Endogenous interleukin 12 regulates granuloma formation induced by eggs o ⁇ Schistosoma mansoni and exogenous IL-12 both inhibits and prophylactically immunizes against egg pathology. J.Exp.Med. 179, 1551- 1561 (1994).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Cell Biology (AREA)
- Endocrinology (AREA)
- Physical Education & Sports Medicine (AREA)
- Reproductive Health (AREA)
- Neurology (AREA)
- Diabetes (AREA)
- Biomedical Technology (AREA)
- Heart & Thoracic Surgery (AREA)
- Pulmonology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Dermatology (AREA)
- Obesity (AREA)
- Pregnancy & Childbirth (AREA)
- Hematology (AREA)
- Gynecology & Obstetrics (AREA)
- Cardiology (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| NZ515464A NZ515464A (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains |
| HU0200862A HU230582B1 (hu) | 1999-04-28 | 2000-04-28 | IL-13 és IL-13-receptorláncok antagonizmusának alkalmazása fibrózis kezelésére |
| IL14608200A IL146082A0 (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| DK00928591.7T DK1173484T3 (da) | 1999-04-28 | 2000-04-28 | Behandling af fibrose ved antagonisme mellem IL-13 og IL-13-receptorkæder |
| JP2000614293A JP4988988B2 (ja) | 1999-04-28 | 2000-04-28 | Il−13およびil−13レセプター鎖の拮抗による線維症の処置 |
| EP00928591A EP1173484B1 (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| AU46805/00A AU780991B2 (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains |
| BR0010061-7A BR0010061A (pt) | 1999-04-28 | 2000-04-28 | Tratamento de fibrose por antagonista de il-13 e cadeias de receptor il-13 |
| CA2370306A CA2370306C (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| MXPA01011023A MXPA01011023A (es) | 1999-04-28 | 2000-04-28 | Tratamiento de la fibrosis por antagonismo de il-13 y de cadenas receptoras de il-13. |
| AT00928591T ATE515513T1 (de) | 1999-04-28 | 2000-04-28 | Behandlung von fibrose durch antagonismus zwischen il-13 und il-13-rezeptorketten |
| IL146082A IL146082A (en) | 1999-04-28 | 2001-10-21 | Use of il-13 antagonist - for the production of a drug to treat tissue loosening |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US09/301,808 US6664227B1 (en) | 1996-03-01 | 1999-04-28 | Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains |
| US09/301,808 | 1999-04-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2000064944A1 true WO2000064944A1 (en) | 2000-11-02 |
Family
ID=23164976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2000/011612 Ceased WO2000064944A1 (en) | 1999-04-28 | 2000-04-28 | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
Country Status (16)
| Country | Link |
|---|---|
| US (2) | US6664227B1 (https=) |
| EP (2) | EP1173484B1 (https=) |
| JP (3) | JP4988988B2 (https=) |
| KR (1) | KR100862931B1 (https=) |
| CN (1) | CN1348465A (https=) |
| AT (1) | ATE515513T1 (https=) |
| AU (1) | AU780991B2 (https=) |
| BR (1) | BR0010061A (https=) |
| CA (1) | CA2370306C (https=) |
| DK (1) | DK1173484T3 (https=) |
| HU (1) | HU230582B1 (https=) |
| IL (2) | IL146082A0 (https=) |
| MX (1) | MXPA01011023A (https=) |
| NZ (1) | NZ515464A (https=) |
| PT (1) | PT1173484E (https=) |
| WO (1) | WO2000064944A1 (https=) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005079755A3 (en) * | 2004-02-12 | 2006-04-06 | Nektar Therapeutics | Interleukin-13 antagonist powders, spray-dried particles, and methods |
| EP1552462A4 (en) * | 2002-06-14 | 2006-09-20 | Us Gov Health & Human Serv | PROCESS FOR TREATING AND PREVENTING COLITIS INVOLVING IL-13 AND NK-T CELLS |
| WO2007047791A3 (en) * | 2005-10-19 | 2007-12-06 | Regeneron Pharma | Monomeric self-associating fusion polypeptides and therapeutic uses thereof |
| WO2008017894A1 (en) * | 2006-08-10 | 2008-02-14 | University Of Southampton | Peptide for treatment of asthma |
| US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
| US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
| US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
| US7585500B2 (en) | 2004-11-17 | 2009-09-08 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
| US7829090B2 (en) | 2003-07-15 | 2010-11-09 | Medimmune Limited | Human antibody molecules for IL-13 |
| US8092804B2 (en) * | 2007-12-21 | 2012-01-10 | Medimmune Limited | Binding members for interleukin-4 receptor alpha (IL-4Rα)-173 |
| US8388965B2 (en) | 2007-10-15 | 2013-03-05 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| US8691233B2 (en) | 2009-03-11 | 2014-04-08 | Ucb Pharma S.A. | Antibody molecules having binding specificity for human IL-13 |
| CN105052892A (zh) * | 2015-07-20 | 2015-11-18 | 山东省齐鲁干细胞工程有限公司 | 一种无dmso的冷冻保护剂与冷冻保存卵巢的方法 |
| WO2017162604A1 (en) | 2016-03-21 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for diagnosis and treatment of solar lentigo |
| US10245298B2 (en) | 2014-09-18 | 2019-04-02 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
| WO2019228405A1 (zh) | 2018-05-29 | 2019-12-05 | 康诺亚生物医药科技(成都)有限公司 | 一种自免疫抑制剂及其应用 |
| US11008389B2 (en) | 2011-03-16 | 2021-05-18 | Sanofi | Uses of a dual V region antibody-like protein |
Families Citing this family (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0105360D0 (en) * | 2001-03-03 | 2001-04-18 | Glaxo Group Ltd | Chimaeric immunogens |
| US7541040B2 (en) * | 2001-12-04 | 2009-06-02 | The United States Of America As Represented By The Department Of Health And Human Serivces | Chimeric molecule for the treatment of th2-like cytokine mediated disorders |
| AU2003223497A1 (en) * | 2002-04-05 | 2003-10-27 | Centocor, Inc. | Asthma-related anti-il-13 immunoglobulin derived proteins, compositions, methods and uses |
| US20070104710A1 (en) * | 2002-06-28 | 2007-05-10 | Domants Limited | Ligand that has binding specificity for IL-4 and/or IL-13 |
| US20110223168A1 (en) * | 2002-12-27 | 2011-09-15 | Greg Winter | Ligand that has binding specificity for il-4 and/or il-13 |
| EP1444989A1 (en) * | 2003-02-07 | 2004-08-11 | Giorgio Dr. Stassi | Sensitizing cells for apoptosis by selectively blocking cytokines |
| PL3718564T3 (pl) * | 2003-12-23 | 2024-03-18 | Genentech, Inc. | Nowe przeciwciała anty-IL 13 i ich zastosowania |
| EP1734970B1 (en) | 2004-03-12 | 2014-12-31 | Intercept Pharmaceuticals, Inc. | Treatment of fibrosis using fxr ligands |
| MXPA06014091A (es) * | 2004-06-04 | 2007-01-31 | Wyeth Corp | Inhibidores de proteinas regiii como substancias terapeuticas para el asma. |
| US20090098142A1 (en) * | 2004-06-09 | 2009-04-16 | Kasaian Marion T | Methods and compositions for treating and monitoring treatment of IL-13-associated disorders |
| JP4465469B2 (ja) * | 2005-02-21 | 2010-05-19 | 国立大学法人佐賀大学 | 循環器病マーカーとしてのインターロイキン13 |
| WO2006124451A2 (en) * | 2005-05-11 | 2006-11-23 | Centocor, Inc. | Anti-il-13 antibodies, compositions, methods and uses |
| WO2007045477A2 (en) | 2005-10-21 | 2007-04-26 | Novartis Ag | Human antibodies against il-13 and therapeutic uses |
| WO2007147600A2 (en) * | 2006-06-21 | 2007-12-27 | Apogenix Gmbh | Differential il-4 and/or il-10 cytokine expression in human cancer |
| US20100086515A1 (en) * | 2006-07-06 | 2010-04-08 | Apogenix Gmbh | Human il-4 muteins in cancer therapy |
| JP2010502224A (ja) * | 2006-09-08 | 2010-01-28 | アボット・ラボラトリーズ | インターロイキン13結合タンパク質 |
| EA200970588A1 (ru) * | 2006-12-15 | 2009-12-30 | Сентокор Орто Байотек Инк. | Способы и композиции для лечения патологий, связанных с опосредуемым il-4 или il-13 фиброзом |
| AR066240A1 (es) * | 2007-04-23 | 2009-08-05 | Wyeth Corp | Metodos y composiciones para tratar y monitorear el tratamiento de trastornos asociados con il-13 |
| CN101318013B (zh) * | 2008-07-17 | 2013-04-10 | 四川大学 | Il-4在制备治疗慢性肝纤维化的药物组合物中的用途 |
| EA201170357A1 (ru) | 2008-08-20 | 2012-05-30 | Сентокор Орто Байотек Инк. | Инженерные антитела к il-13: композиции, способы и применение |
| PT2953948T (pt) | 2013-02-07 | 2017-12-12 | Scifluor Life Sciences Inc | Antagonistas de integrina fluorada |
| RU2016107435A (ru) | 2013-09-13 | 2017-10-18 | Дженентек, Инк. | Композиции и способы обнаружения и количественного определения белка клеток-хозяев в клеточных линиях и рекомбинантные полипептидные продукты |
| CN120904322A (zh) | 2013-09-13 | 2025-11-07 | 豪夫迈·罗氏有限公司 | 包含纯化的重组多肽的方法和组合物 |
| TW201628647A (zh) * | 2014-06-27 | 2016-08-16 | 賽諾菲公司 | 抗-il4-il13雙特異性抗體 |
| AU2015346150B2 (en) * | 2014-11-14 | 2021-08-19 | Regeneron Pharmaceuticals, Inc. | Methods for treating chronic sinusitis with nasal polyps by administering an IL-4R antagonist |
| US9790222B2 (en) | 2015-02-19 | 2017-10-17 | Scifluor Life Sciences, Inc. | Fluorinated tetrahydronaphthyridinyl nonanoic acid derivatives and uses thereof |
| BR112017023432A2 (pt) | 2015-04-30 | 2018-07-24 | Scifluor Life Sciences Inc | Derivados de ácido propiônico tetra- hidronaftiridinila e usos do mesmo |
| US10118929B2 (en) | 2016-04-27 | 2018-11-06 | Scifluor Life Sciences, Inc. | Nonanoic and decanoic acid derivatives and uses thereof |
| WO2021249555A1 (en) * | 2020-06-12 | 2021-12-16 | Beijing Vdjbio Co., Ltd. | Fusion polypeptide |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997033913A1 (en) * | 1996-03-13 | 1997-09-18 | Zymogenetics, Inc. | Cytokine-receptor expressed in testis cells |
| EP0812913A2 (en) * | 1996-06-12 | 1997-12-17 | Smithkline Beecham Corporation | HR-1 receptor, a receptor of the cytokine receptors family |
| WO1997047741A1 (en) * | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| WO1997047742A1 (en) * | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4235871A (en) | 1978-02-24 | 1980-11-25 | Papahadjopoulos Demetrios P | Method of encapsulating biologically active materials in lipid vesicles |
| US4501728A (en) | 1983-01-06 | 1985-02-26 | Technology Unlimited, Inc. | Masking of liposomes from RES recognition |
| US4737323A (en) | 1986-02-13 | 1988-04-12 | Liposome Technology, Inc. | Liposome extrusion method |
| US4837028A (en) | 1986-12-24 | 1989-06-06 | Liposome Technology, Inc. | Liposomes with enhanced circulation time |
| GB8927546D0 (en) | 1989-12-06 | 1990-02-07 | Ciba Geigy | Process for the production of biologically active tgf-beta |
| WO1994004680A1 (en) | 1992-08-21 | 1994-03-03 | Schering Corporation | Human interleukin-13 |
| HUT76369A (en) | 1994-07-29 | 1997-08-28 | Smithkline Beecham Corp | Novel soluble protein compounds |
| US5710023A (en) | 1996-03-01 | 1998-01-20 | Genetics Institute, Inc. | IL-13 cytokine receptor chain |
-
1999
- 1999-04-28 US US09/301,808 patent/US6664227B1/en not_active Expired - Lifetime
-
2000
- 2000-04-28 BR BR0010061-7A patent/BR0010061A/pt not_active Application Discontinuation
- 2000-04-28 CA CA2370306A patent/CA2370306C/en not_active Expired - Lifetime
- 2000-04-28 KR KR1020017013820A patent/KR100862931B1/ko not_active Expired - Fee Related
- 2000-04-28 MX MXPA01011023A patent/MXPA01011023A/es active IP Right Grant
- 2000-04-28 EP EP00928591A patent/EP1173484B1/en not_active Revoked
- 2000-04-28 AT AT00928591T patent/ATE515513T1/de active
- 2000-04-28 IL IL14608200A patent/IL146082A0/xx unknown
- 2000-04-28 CN CN00806772A patent/CN1348465A/zh active Pending
- 2000-04-28 WO PCT/US2000/011612 patent/WO2000064944A1/en not_active Ceased
- 2000-04-28 NZ NZ515464A patent/NZ515464A/xx not_active IP Right Cessation
- 2000-04-28 HU HU0200862A patent/HU230582B1/hu unknown
- 2000-04-28 EP EP09169462A patent/EP2123674A1/en not_active Ceased
- 2000-04-28 PT PT00928591T patent/PT1173484E/pt unknown
- 2000-04-28 AU AU46805/00A patent/AU780991B2/en not_active Expired
- 2000-04-28 DK DK00928591.7T patent/DK1173484T3/da active
- 2000-04-28 JP JP2000614293A patent/JP4988988B2/ja not_active Expired - Lifetime
-
2001
- 2001-10-21 IL IL146082A patent/IL146082A/en not_active IP Right Cessation
-
2003
- 2003-09-25 US US10/671,034 patent/US7282206B2/en not_active Expired - Lifetime
-
2011
- 2011-01-07 JP JP2011002569A patent/JP2011078432A/ja not_active Withdrawn
-
2013
- 2013-11-11 JP JP2013232738A patent/JP2014087345A/ja not_active Withdrawn
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997033913A1 (en) * | 1996-03-13 | 1997-09-18 | Zymogenetics, Inc. | Cytokine-receptor expressed in testis cells |
| EP0812913A2 (en) * | 1996-06-12 | 1997-12-17 | Smithkline Beecham Corporation | HR-1 receptor, a receptor of the cytokine receptors family |
| WO1997047741A1 (en) * | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| WO1997047742A1 (en) * | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| WO1998010638A1 (en) * | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
Cited By (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
| US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
| EP2273419A1 (en) * | 2002-06-14 | 2011-01-12 | GOVERNMENT OF THE UNITED STATES OF AMERICA, as represented by THE SECRETARY, DEPARTMENT OF HEALTH AND HUMAN SERVICES | Methods of treating and preventing colitis involving IL-13 and NK-T cells |
| EP1552462A4 (en) * | 2002-06-14 | 2006-09-20 | Us Gov Health & Human Serv | PROCESS FOR TREATING AND PREVENTING COLITIS INVOLVING IL-13 AND NK-T CELLS |
| US8173123B2 (en) | 2002-06-14 | 2012-05-08 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Methods of treating colitis involving IL-13 and NK-T cells |
| US7666411B2 (en) | 2002-06-14 | 2010-02-23 | The United States Of America As Represented By The Department Of Health And Human Services | Methods of treating and preventing colitis involving IL-13 and NK-T cells |
| US9315575B2 (en) | 2003-07-15 | 2016-04-19 | Medimmune Limited | Methods of treatment using human antibody molecules for IL-13 |
| US9856317B2 (en) | 2003-07-15 | 2018-01-02 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7947273B2 (en) | 2003-07-15 | 2011-05-24 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7935343B2 (en) | 2003-07-15 | 2011-05-03 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7829090B2 (en) | 2003-07-15 | 2010-11-09 | Medimmune Limited | Human antibody molecules for IL-13 |
| WO2005079755A3 (en) * | 2004-02-12 | 2006-04-06 | Nektar Therapeutics | Interleukin-13 antagonist powders, spray-dried particles, and methods |
| US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
| US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
| US7585500B2 (en) | 2004-11-17 | 2009-09-08 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US7994302B2 (en) | 2004-11-17 | 2011-08-09 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US7666622B2 (en) | 2005-10-19 | 2010-02-23 | Regeneron Pharmaceuticals, Inc. | Monomeric self-associating fusion polypeptides and therapeutic uses thereof |
| WO2007047791A3 (en) * | 2005-10-19 | 2007-12-06 | Regeneron Pharma | Monomeric self-associating fusion polypeptides and therapeutic uses thereof |
| WO2008017894A1 (en) * | 2006-08-10 | 2008-02-14 | University Of Southampton | Peptide for treatment of asthma |
| EP2573121A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
| US9732162B2 (en) | 2007-10-15 | 2017-08-15 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP2573118A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP2573115A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP2573116A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP2574630A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
| EP2574629A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
| EP2574626A1 (en) | 2007-10-15 | 2013-04-03 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| US11453727B2 (en) | 2007-10-15 | 2022-09-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| US10759871B2 (en) | 2007-10-15 | 2020-09-01 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP3686220A1 (en) | 2007-10-15 | 2020-07-29 | Sanofi | Antibodies that bind il-4 and/or il-13 and their uses |
| US8388965B2 (en) | 2007-10-15 | 2013-03-05 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| US9738728B2 (en) | 2007-10-15 | 2017-08-22 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| EP2573119A1 (en) | 2007-10-15 | 2013-03-27 | Sanofi | Antibodies that bind IL-4 and/or IL-13 and their uses |
| US8092804B2 (en) * | 2007-12-21 | 2012-01-10 | Medimmune Limited | Binding members for interleukin-4 receptor alpha (IL-4Rα)-173 |
| US8877189B2 (en) | 2007-12-21 | 2014-11-04 | Medimmune Limited | Binding members for interleukin-4 receptor alpha (IL-4Rα) - 173 |
| US8691233B2 (en) | 2009-03-11 | 2014-04-08 | Ucb Pharma S.A. | Antibody molecules having binding specificity for human IL-13 |
| US9957320B2 (en) | 2009-03-11 | 2018-05-01 | Ucb Biopharma Sprl | Isolated DNA sequences encoding, and methods for making, antibody molecules having binding specificity for human IL-13 |
| US9394361B2 (en) | 2009-03-11 | 2016-07-19 | Ucb Biopharma Sprl | Isolated DNA sequences encoding, and methods for making, antibody molecules having binding specificity for human IL-13 |
| US11008389B2 (en) | 2011-03-16 | 2021-05-18 | Sanofi | Uses of a dual V region antibody-like protein |
| US10245298B2 (en) | 2014-09-18 | 2019-04-02 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
| US11547738B2 (en) | 2014-09-18 | 2023-01-10 | Cedars-Sinai Medical Center | Compositions and methods for treating fibrosis |
| CN105052892A (zh) * | 2015-07-20 | 2015-11-18 | 山东省齐鲁干细胞工程有限公司 | 一种无dmso的冷冻保护剂与冷冻保存卵巢的方法 |
| WO2017162604A1 (en) | 2016-03-21 | 2017-09-28 | INSERM (Institut National de la Santé et de la Recherche Médicale) | Methods for diagnosis and treatment of solar lentigo |
| WO2019228405A1 (zh) | 2018-05-29 | 2019-12-05 | 康诺亚生物医药科技(成都)有限公司 | 一种自免疫抑制剂及其应用 |
| US11725057B2 (en) | 2018-05-29 | 2023-08-15 | Keymed Biosciences Co., Ltd. | Autoimmune suppressor and application thereof |
| US12503514B2 (en) | 2018-05-29 | 2025-12-23 | Keymed Biosciences Co., Ltd. | Autoimmune suppressor and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| HUP0200862A3 (en) | 2004-11-29 |
| HU230582B1 (hu) | 2017-01-30 |
| JP2003527311A (ja) | 2003-09-16 |
| NZ515464A (en) | 2004-02-27 |
| HUP0200862A2 (hu) | 2002-07-29 |
| EP2123674A1 (en) | 2009-11-25 |
| BR0010061A (pt) | 2003-02-25 |
| JP2011078432A (ja) | 2011-04-21 |
| AU780991B2 (en) | 2005-04-28 |
| EP1173484B1 (en) | 2011-07-06 |
| DK1173484T3 (da) | 2011-10-03 |
| MXPA01011023A (es) | 2002-05-06 |
| IL146082A0 (en) | 2002-07-25 |
| PT1173484E (pt) | 2011-09-29 |
| KR20020026426A (ko) | 2002-04-10 |
| US7282206B2 (en) | 2007-10-16 |
| CN1348465A (zh) | 2002-05-08 |
| AU4680500A (en) | 2000-11-10 |
| KR100862931B1 (ko) | 2008-10-13 |
| CA2370306C (en) | 2014-06-17 |
| CA2370306A1 (en) | 2000-11-02 |
| IL146082A (en) | 2014-08-31 |
| JP2014087345A (ja) | 2014-05-15 |
| JP4988988B2 (ja) | 2012-08-01 |
| US6664227B1 (en) | 2003-12-16 |
| EP1173484A1 (en) | 2002-01-23 |
| ATE515513T1 (de) | 2011-07-15 |
| US20050096268A1 (en) | 2005-05-05 |
| EP1173484A4 (en) | 2003-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1173484B1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
| ES2367352T3 (es) | Tratamiento de la fibrosis meidante el antagonismo de la il-3 y de las cadenas del receptor del il-3. | |
| US6214559B1 (en) | Methods of identifying inhibitors of binding of IL-13 to the IL-13 receptor chain | |
| US6197525B1 (en) | Assay kits for detection and methods of inhibiting IL-17 binding | |
| EP0797664B1 (en) | Use of a human interleukin-11 receptor | |
| AU780031B2 (en) | Cytokine receptor chain | |
| WO2000078336A1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
| US7078494B1 (en) | Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding | |
| US6680057B1 (en) | Methods of treating autoimmune disease by administering interleukin-17 receptor | |
| HK1138294A (en) | Treatment of fibrosis by antagonism of il-13 and/or il-13 receptor | |
| US20020082233A1 (en) | Human interleukin-11 receptor | |
| MXPA97004618A (en) | Receiver of the interleucine-11 hum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 00806772.4 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| ENP | Entry into the national phase |
Ref document number: 2370306 Country of ref document: CA Ref document number: 2370306 Country of ref document: CA Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2000 614293 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020017013820 Country of ref document: KR Ref document number: PA/a/2001/011023 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 515464 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 46805/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2000928591 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2000928591 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020017013820 Country of ref document: KR |
|
| WWG | Wipo information: grant in national office |
Ref document number: 46805/00 Country of ref document: AU |