WO2000061745A1 - Procede de criblage de ligand de proteine gr et procede d'expression du clonage de la proteine gr - Google Patents

Procede de criblage de ligand de proteine gr et procede d'expression du clonage de la proteine gr Download PDF

Info

Publication number
WO2000061745A1
WO2000061745A1 PCT/JP2000/002416 JP0002416W WO0061745A1 WO 2000061745 A1 WO2000061745 A1 WO 2000061745A1 JP 0002416 W JP0002416 W JP 0002416W WO 0061745 A1 WO0061745 A1 WO 0061745A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gene
substance
sample
receptor
Prior art date
Application number
PCT/JP2000/002416
Other languages
English (en)
Japanese (ja)
Inventor
Takayuki Naito
Yutaka Saito
Mitsuhiro Morita
Original Assignee
Japan Tobacco Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Japan Tobacco Inc. filed Critical Japan Tobacco Inc.
Priority to AU36780/00A priority Critical patent/AU3678000A/en
Publication of WO2000061745A1 publication Critical patent/WO2000061745A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • the present invention provides (1) a method wherein the desired substance is an agonist of a G protein-coupled receptor,
  • the present invention relates to a method for identification by an expression cloning method.
  • the G protein-coupled receptor is a receptor on the cell membrane, has seven transmembrane sites, and acts as a ligand via a GTP (guanosine 5'-triphosphate) binding regulatory protein (G protein). Of information to the effector system.
  • GTP guanosine 5'-triphosphate binding regulatory protein
  • G protein is a trimer consisting of three subunits, G, G, Go, Gq, etc., depending on the type of G subunit, and has receptor specificity (G The types of protein receptors) and effector systems (enzymes and ion channels) are different.
  • glucagon-like receptor 1 and / or 2-adrenergic receptor cooperate with Gs to promote the effector system adenylate cyclase system and increase cyclic AMP (cAMP).
  • the adrenergic receptor also couples with G i to suppress the adenylate cyclase system and reduce cAMP.
  • HI histamine Conjugation with Gq promotes the effector system, phospholipase C system, to increase diacylglycerol and inositol triphosphate, and to increase intracellular Ca 2+ .
  • the main types of effector systems are the adenylate cyclase system, the phospholipase C system, and the cGMP phosphodiesterase system.
  • G protein has GDP (guanosine 5, monophosphate) bound to the subunit and is associated with the? Subunit and the asubunit.
  • GDP guanosine 5, monophosphate
  • the state in which ⁇ , ⁇ ⁇ and GDP are associated is inactive, and when a ligand binds to the receptor, GDP bound to ⁇ is replaced by GTP, and ⁇ -GTP with GTP bound to ⁇ ⁇ subunits. , ⁇ - ⁇ .
  • GTP and / or -G act on the effector system to transmit signals.
  • the GDP leaves the effector system and associates with // and becomes inactive again. By repeating this reaction, information is amplified and transmitted.
  • G protein-coupled receptors The biodistribution of G protein-coupled receptors is often localized in specific organs, but G proteins are widely distributed in living organisms. And, as mentioned above, the G protein triggers a series of intracellular phosphorylation reactions through the G protein-coupled receptor, and regulates a wide range of cell and organ functions, from transcriptional regulation at the gene level to muscle contraction. Has been implemented.
  • 11 adrenergic receptor is localized in the heart, adipose tissue, cerebral cortex, etc., and Gs promotes the adenylate cyclase system, resulting in increased heart rate, increased cardiac contractility, and lipolysis. .
  • the signal transduction system controlled by the G-coupled receptor / G protein is a mechanism essential for the control of the physiological functions of organisms.
  • the signal transduction system is involved in various diseases. It is widely involved in the onset. Therefore, if a G protein-coupled receptor involved in the onset of a certain disease is identified, it is necessary to develop drugs (eg, agonist, angonist, agonist inhibitor) that regulate the physiological function of the receptor. By The drug makes it possible to treat the disease.
  • drugs eg, agonist, angonist, agonist inhibitor
  • G protein-coupled receptor The most important thing to elucidate the physiological function of G protein-coupled receptor is to identify the ligand of the receptor, that is, to identify the agonist of the receptor. It is carried out.
  • Identify ligands of G protein-coupled receptors for which ligands have not been identified ie, orphan G protein-coupled receptors
  • ligands ie, agonists and angonists that interact with the receptor
  • the Atsusei quantitatively detects the presence or absence of an interaction between a test substance and the receptor, and quantitatively detects an increase or a decrease in activation or suppression of a second messenger induced through a G protein to which the receptor is coupled. Therefore, there is a need for an access method that can detect the increase or decrease of the message with high sensitivity.
  • the following method is known as a conventional access method.
  • test sample test substance
  • known agonist and a test sample are allowed to act on cells expressing the desired G protein-coupled receptor, and a second messenger generated by the action of the effector system, such as Gs or Gi-coupled receptor
  • Gs or Gi-coupled receptor a second messenger generated by the action of the effector system, such as Gs or Gi-coupled receptor
  • the amount of cAMP linked to the change in the activity of adenylate cyclase and in the case of the Gq-coupled receptor, the concentration of inositol 3-phosphate ⁇ Ca 2+ linked to the change in the activity of phospholipase C Measurement techniques are widely used.
  • the secondary message induced by coupling of the receptor to Gi is the decrease in cAMP due to suppression of adenylate cyclase.
  • a reagent such as forskolin
  • the amount of cAMP decrease by the test substance with respect to the increase in cAMP which is extremely complicated. Needed operation.
  • an atsey system using a repo overnight gene (Repo overnight at Gene Atsey) has been developed (International Patent Application Publication W092 / 02639, And Tokuyohei 6-502527).
  • an excellent method is to introduce a reporter gene containing a CRE (cAMP response element) as a promoter into a cell and to introduce a reporter gene product that changes when a test substance is brought into contact with the cell.
  • the reporter gene product induced by contacting a test substance with cells was The degree of the increase is about 5 to 10 times that of the case where the test substance is not brought into contact, and it is judged that the test substance interacts with the receptor. Too low to determine.
  • the signal ratio (S / N ratio) detected before and after stimulation with the test substance is as low as about 5 times.
  • Atsushi system using the increase / decrease of intracellular Ca 2+ as an index still has a problem that only the presence or absence of signal transmission via Gq can be measured.
  • a first object of the present invention is to provide an agonist for a G protein-coupled receptor
  • Atsushi system that can detect the change in signal when a nyst or agonist action inhibitor is acted on as a large absolute value, with a high S / N ratio, and with a large signal absolute value.
  • the second objective is to establish an Atssey system that can detect the presence or absence of signal transduction via one of Gs, Gi, and Gq in one type of cell regardless of the type of G protein coupled to the receptor.
  • the third purpose is not only signals that act on Gs or Gq-mediated effector systems but also signals that act on Gi-mediated effector systems (signals that suppress cAMP production). This is the establishment of an Atsushi system that can be detected as signal enhancement.
  • the fourth object is to use the above-mentioned Atsey method to (1) determine whether the desired substance is an agonist, an antagonist, or a substance that inhibits the agonist action of the agonist of the G protein-coupled receptor. And (2) screening for a agonist, an engonist, and / or a substance that inhibits the agonist action of the agonist, which is a ligand of the G protein-coupled receptor, in a rapid and simple manner. It is to be.
  • a fifth object is to provide a method for easily identifying a receptor (for example, a G protein-coupled receptor) that interacts with a certain substance using the above-mentioned Atsey method, using an expression cloning method. is there.
  • a receptor for example, a G protein-coupled receptor
  • the present inventors have enthusiastically described a host cell, a promoter region, and a combination thereof used in a method for identifying a ligand of a G protein receptor by an Atsey method using a repo sequence gene.
  • a host cell a promoter region, and a combination thereof used in a method for identifying a ligand of a G protein receptor by an Atsey method using a repo sequence gene.
  • the expression of the reporter gene product was extremely remarkably observed by addition of agonist.
  • zif268 promoter region hereinafter sometimes simply referred to as zif268
  • signaling of both Gs and Gq can be considered as an increase in the expression of the reporter gene product. It was discovered that detection was possible with the highest sensitivity.
  • the host cell may have any of the following genes:
  • the present invention has led to the invention of an Atsey method capable of quickly and easily identifying an angonist or a substance having an activity of inhibiting the agonist action of the agonist.
  • determining whether a substance is an agonist of a desired G protein-coupled receptor and (2) determining an agonist of a desired G protein-coupled receptor
  • a rapid and simple screening of a large number of test substances to identify a substance having an activity of inhibiting the agonist action of the receptor and / or the agonist action of the agonist (3) expression cleaning Rapid and simple screening of a large number of test proteins (cDNA and cDNA libraries) to identify (cloning) receptors that interact with a substance (eg, G-protein type receptors) , Can achieve.
  • the present invention is a method or a cell as described in the following ⁇ 1> to ⁇ 22>.
  • a method for determining whether or not a substance is an agonist of a desired G protein-coupled receptor comprising the following steps (a) to (c):
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • a method for screening a substance for identifying an agonist of a desired G protein-coupled receptor comprising the following steps ( a ) to (c):
  • step (b) contacting each sample contacted with the substance in step (a) with a detectable signal generated by the repo-all-over-gene expressed in each cell in the sample, and Quantitatively determining each of the detectable signals produced by the repo-gene expressed in each cell of the unsampled sample;
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • a method for screening a substance for identifying an agonist of a desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor comprising: ) Through (c). (a) At least the following exogenous genes (1) and (2):
  • step (b) contacting each sample contacted with the substance in step (a) with a detectable signal generated by the repo-all-over-gene expressed in each cell in the sample, and Quantitatively determining each of the detectable signals generated by said repo overnight gene expressed in each of the vesicles of said unsampled sample;
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • EGR-1 zif268
  • ⁇ 6> The method according to any one of ⁇ 1> to ⁇ 4> above, wherein the overnight promoter region is a zif268 (EGR-1) promoter overnight region.
  • EGR-1 zif268
  • the PC12-derived cell further comprises an exogenous gene of any one of the following (a) to (c): The method described in:
  • a reporter gene operably linked to a promoter overnight region of a gene whose expression is induced by stimulation through a G protein.
  • the promoter region is any one of a zif268 promoter region, a promoter region including an SRE and a CRE, and a C-fos promoter region. A cell as described.
  • ⁇ 11> The cell according to ⁇ 9>, wherein the promoter region is a zif268 promoter region.
  • the PC12-derived cell further has any one of the following exogenous genes (a) to (c): Described cells:
  • a method for identifying a receptor that interacts with a substance comprising: A method characterized by comprising the step of (d) wherein the substance acts as an aco'nist on the receptor.
  • a reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein.
  • step (b) for each sample contacted with the substance in step (a), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals produced by the reporter gene expressed in each cell of the respective sample not contacted;
  • step (c) comparing the amount of signal for each sample determined in step (b) with each other, and selecting one or more samples from the plurality of samples tested in step (a);
  • step (d) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (a) of the cells in the selected sample;
  • a method for identifying a receptor that interacts with a substance comprising the following steps (a) to (g) (where the substance is Acts as an agonist.):
  • step (b) for each sample contacted with the substance in step (a), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Quantitatively determining each of the detectable signals produced by said reporter gene expressed in each cell of said respective sample;
  • step (c) comparing the amount of signal for each sample determined in step (b) with each other and selecting one or more samples from the plurality of samples tested in step (a);
  • step (a) One or more genes encoding the protein described in (1) of step (a), which are exogenous genes of the cells in the sample selected in step (c); and
  • step (e) for each sample contacted with the substance in step (d), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Determining quantitatively each of the detectable signals produced by the repo-gene expressed in each cell of the respective sample;
  • step (f) comparing the amount of signal for each of the samples determined in step (e) with each other; Selecting one or more of said plurality of samples tested in step (d);
  • step (g) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (d) of the cells in the selected sample;
  • the method is characterized in that the method includes one or more times of the same operation consisting of the steps (d) to (f) between the step (f) and the step (g), if desired.
  • ⁇ 15> The method according to ⁇ 15>.
  • ⁇ 18> The method according to any one of ⁇ 14> to ⁇ 16>, wherein the promoter region is a zif268 promoter region.
  • One or more genes encoding the protein are cDNA or cDNA live The method according to any one of ⁇ 14> to ⁇ 20>, wherein the receptor is a G protein-coupled receptor. 21. The method according to any one of the above 21>.
  • the ⁇ PC12-derived cell '' in the present invention is a rat adrenal pheochromocytoma-derived PC12 cell line (ATCC CRL-1721; Pro Natl. Acad. Sci. USA., Vol. 73, p. 2424-2426, 1976; Science, Vol. 229, p. 393-395, 1985; EMBO J., Vol. 2, p. 643-648, 198 3) or any cell line subcloned from the PC12 cell line. You.
  • the subcloned cells have the following properties.
  • a gene encoding a desired G protein-coupled receptor in the cells, (1) a gene encoding a desired G protein-coupled receptor, and (2) a promoter / region of a gene whose expression is induced by stimulation through a G protein described later.
  • the G protein-coupled receptor ligand is brought into contact with a recombinant cell obtained by exogenously introducing an “expressably linked reporter gene”, the reporter gene is induced to be expressed.
  • Preferred examples of the subcloned cells include the PC12h cell line (Brain Research, 222, p.225-233, 1981) and various cells subcloned from the PC12h cell line. .
  • G protein-coupled receptor and “gene encoding G protein-coupled receptor”
  • the “G protein-coupled receptor” in the present invention is a receptor existing on the cell membrane, and is a GTP (guanosine). 5, -trinic acid)
  • GTP guanosine
  • 5 -trinic acid A function to transmit information on ligands interacting with the receptor to a series of effectors via a regulatory protein (G protein) for binding.
  • G protein regulatory protein
  • the G protein-coupled receptor in the present invention is an endogenous receptor naturally expressed in a cell or a receptor expressed in a cell by introducing a gene encoding a desired G protein-coupled receptor into the cell. Mean any of the body.
  • the “G protein-coupled receptor” in the present invention includes both known receptors and unidentified receptors.
  • G protein-coupled receptors examples include those whose structure and function have already been elucidated (for example, para-adrenergic receptor,? -Adrenergic receptor, dopamine receptor, muscarinic acetylcholine receptor, Serotonin receptor, histamine receptor, evening kikinin receptor, glutamate receptor, endothelin receptor, platelet activator (PAF) receptor, thrombin receptor, FSH receptor, etc., and their structures are known.
  • the ligand and / or receptor whose physiological function is unknown for example, various orphan G protein-coupled receptors can be mentioned.
  • G protein-coupled receptor ligand means any agonist that interacts with a G protein-coupled receptor or any agonist of the receptor.
  • the “chimeric G protein G subunit” in the present invention refers to a subunit of a certain G protein subunit (for example, Grq or Gas) obtained by substituting a partial subunit of a different type of G protein. It means a G protein subunit having a structure in which a part of the amino acid sequence of (for example, G subunit i) is substituted.
  • the “chimeric G protein G qi” refers to a protein in which a part of the C-terminal amino acid sequence of Ghi q (a sub-unit of the G q protein) is replaced with a part of the C-terminal amino acid sequence of Ghi i. Means a chimeric G protein subunit having a modified structure.
  • "Chimeric G protein Gsi” is a chimera having a structure in which part of the C-terminal amino acid sequence of Gas (subunit of Gs protein) is replaced with the C-terminal amino acid sequence of Gai. Means G protein subunit.
  • G proteins G shed G protein G shed substituted with ⁇ amino acid C-terminal of the i 2 Tahi q / non i 2 chimeric G protein corresponding to the C-terminal amino acids of q is conjugated with G i coupled receptors G q signaling system activating, arrangement Nihi i 2 subunit C-terminal amino acid sequence # 3 of glycine Rukoto believed to contribute to the conversion of receptor specificity knowledge of (Nature, Vol.363, p.274-276, 1993).
  • the part of the C-terminal amino acid sequence of G-q to be substituted be in a range including the glycine at position 3.
  • the number of amino acids to be substituted is at least about 3 to about 23 amino acids, preferably about 3 to about 11 amino acids, and more preferably about 4 to about 9 amino acids.
  • Ghi q and Ghii each constitute a group of families. These families have different organizational distributions by type.
  • G i family members Hi 2 and Hi 3 are widely distributed in tissues, while Hi and Hi 2 are mainly expressed in brain and nerve tissues, respectively.
  • aq and h11 of the Ghi q family are widely distributed, while h14 is mainly expressed in lung, kidney and liver tissues.
  • the chimeric G protein q / Go: i subunit is preferably a chimeric G protein protein subunit consisting of G aq and Ghi i 2 .
  • Ghs also has at least about 3 to about 23, preferably about 3 to about 11, and more preferably about 3 to about 23 C-terminal amino acid sequences to be substituted. Four to about nine amino acids may be substituted with the corresponding amino acid sequence at the C-terminal of G protein Ghi.
  • the configuration of the chimeric G protein G subunit is not limited to the above.
  • the G protein of the present invention has the ability to couple to any G protein-coupled receptor, and converts the signal received by the receptor by the coupling into a signal transmission pathway through G q, that is, a phosphorivator. It is a G protein that has the ability to transmit further downstream in the form of activation of ZeC.
  • Preferred embodiments include, for example, G15 and G16 (J. Biol. Chem., Vol. 270, p. 16175-16180, 1995), but are not limited thereto.
  • the promoter region of the present invention includes the promoter region of the immediate-early gene (i-throat ediate-early gene). Can be
  • Examples of the promoter of the immediate-early gene used in the present invention include a c-fos promoter motor region and a zif268 promoter overnight region (Pro Natl. Acad. Sci. USA., Vo 1.86, p.377-381, 1989; also referred to as "EGR-1", “NGF1-A”, “Krox24", “Tis8” or “cef5").
  • a particularly preferred embodiment includes the zif268 (EGR-1) promoter region.
  • the promoter used in the present invention also includes a counterpart of any animal species of the promoter.
  • promoter region refers to an arbitrary region containing a minimum nucleotide sequence essential for expressing a promoter activity. For example, part or all of a region of about 500 bp to about 2 kb upstream of the transcription site of the gene can be used.
  • examples of the title promoter region in the present invention include a promoter region having a transcription factor binding sequence SRE (serum response element) and / or CRE (cAMP response element) upstream of the minimal promoter region. 7. "Repo One Night One Gene"
  • the “reporter gene” in the present invention means a gene encoding a reporter protein that emits detectable fluorescence. Specifically, for example, luciferase derived from fireflies or Mississippi or GFP (Green Fluorescence Protein) derived from jellyfish can be mentioned. Further, for example, a gene encoding 5-galactosidase, a gene encoding chloramphenic acid acetyltransferase, and a gene encoding lactamase can be mentioned.
  • Agonist action inhibitory substance / "A substance that inhibits agonist action of agonist”
  • the termed substance in the present invention means a substance which acts directly on agonist to inhibit or lose the activity of agonist. It means antibodies against agonists.
  • reporter gene assay means the following method.
  • test substance is brought into contact with the cells according to ⁇ 9> to ⁇ 13>, which are a part of the present invention, and the amount of repo overnight protein expressed depending on the action of the compound is determined.
  • the presence or absence of interaction of the test substance with a G protein-coupled receptor is analyzed by indirectly measuring the amount of emitted fluorescence (for example, see US Pat. No. 5,436, No. 128 and U.S. Pat. No. 5,401,629).
  • a “substance” identified or screened by the method of the present invention refers to existing natural substances (proteins, antibodies, peptides, natural compounds, etc.) or any artificially prepared substances.
  • any “compound” chemically synthesized can be mentioned.
  • the type and molecular weight of the compound are not particularly limited. It has a molecular weight of from about 100 to about 2000, and more typically from about 100 to about 1000.
  • the substance when the substance is a protein, antibody or peptide, it also includes those isolated from living tissue cells and those prepared by genetic recombination or chemical synthesis. Furthermore, those chemical modifications are also included.
  • Examples of the peptide include a peptide consisting of about 3 to about 500 amino acids, preferably about 3 to about 300 amino acids, and more preferably about 3 to about 200 amino acids.
  • genes used in the present invention can be obtained by any method. There may be.
  • known nucleotide sequence information can be used, or a completely new cloning can be performed.
  • cDNA complementary DNA
  • genomic DNA DNA prepared from genomic DNA
  • DNA obtained by chemical synthesis DNA obtained by amplifying the RNA or DNA by PCR as a Combining methods appropriately It also encompasses all of the DNAs that have been constructed.
  • the DNA encoding a protein used in the present invention can be obtained by a method of cloning cDNA from mRNA encoding the protein according to a conventional method, a method of isolating genomic DNA and splicing it, and a method of chemical synthesis. Etc.
  • the following method is exemplified as a method for cloning cDNA from mRNA encoding the protein.
  • mRNA encoding the protein is prepared from the above-mentioned tissues or cells that express and produce the desired protein.
  • total RNA prepared by a known method such as the guanidine thiosocyanate method (Chirgwin et al., Biochemistry, Vol. 18, p. 5294, 1979), the hot phenol method or the AGP C method is oligo- d T) It can be carried out by affinity chromatography with cellulose or poly-U-Sepharose.
  • the obtained mRNA is used as type ⁇ , and a known method such as, for example, using reverse transcriptase, for example, the method of Okayama et al. (Mol. Cell. Biol., Vol. 2, p. 161, 1982; Mol. Ce 11 Biol., Vol. 3, p. 280, 1983) and the method of Hoffman et al. (Gene, Vol. 25, p. 263, 1983) synthesize cDNA strands and convert them into double-stranded cDNAs. Is converted.
  • a known method such as, for example, using reverse transcriptase, for example, the method of Okayama et al. (Mol. Cell. Biol., Vol. 2, p. 161, 1982; Mol. Ce 11 Biol., Vol. 3, p. 280, 1983) and the method of Hoffman et al. (Gene, Vol. 25, p. 263, 1983) synthesize cDNA strands and convert them into double-stranded cDNAs
  • This cDNA is incorporated into a plasmid vector, phage vector or cosmid vector, and transformed into Escherichia coli, or after in vitro packaging, transfected into Escherichia coli to produce a cDNA library.
  • the plasmid vector used here is not particularly limited as long as it can be replicated and maintained in the host, and any phage vector used can be used as long as it can be propagated in the host.
  • Examples of a cloning vector used in a conventional manner include pUC19, human gtlO, and human gtll.
  • a promoter capable of expressing the gene encoding the protein in the host is used. It is preferable that the vector is a one-time vector.
  • Examples of a method for incorporating cDNA into a plasmid include the method described in Maniatis et al. (Molecular Cloning, A Laooratory Manual, second edition, Cold Spring Harbor Laboratory, p. 1.53, 1989).
  • a method of incorporating cDNA into a phage vector the method of Hyunh et al. (DNA Cloning, a practical approach, Vol. 1, p. 49, 1985) and the like can be mentioned.
  • a commercially available closing kit for example, Takara Shuzo
  • the recombinant plasmid vector obtained in this manner is introduced into a suitable host such as a prokaryotic cell (for example, E. coli: HB101, DH5 or MC1061 / P3).
  • a prokaryotic cell for example, E. coli: HB101, DH5 or MC1061 / P3
  • Methods for introducing a plasmid into a host include a calcium chloride method, a calcium chloride / rubidium chloride method, and a Lipofi method described in (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, Vol. 1.74, 1989). Examples include the extrusion method and the elect opening method. Examples of a method for introducing the phage vector into a host include a method in which phage DNA is packaged in vitro and then introduced into a grown host. In vitro packaging can be easily performed by using a commercially available in vitro packaging kit (eg, manufactured by Stratagene, Amersham, etc.).
  • cDNA gene encoding a protein whose expression is enhanced in response to a certain kind of stimulus (for example, stimulus by a cytokine)
  • mRNA derived from the cell to which the stimulus is given is used.
  • a cDNA library tester cDNA library
  • a cDNA library dri ver cDNA library
  • mRNA from unstimulated cells for example, the inhibitory PCR effect Suc. (Supression subtract hybridization (S SH)) using the Subtraction Subtraction Neutralization Method (Nucleic Acids Res., Vol. 23, p. 1087-1088, 1995) (Proc. Natl. Acad.
  • a commercially available kit for example, a PCR-Select Subtraction Kit (manufactured by CL0NTECH, catalog number: K1804-1) can be used.
  • the experimental operation can be performed according to the experimental operation manual attached to the kit.
  • RNA was prepared in the same manner as previously reported (Nucleic Acids Res., Vol. 26, No. 4, p. 911-918, 1998). I do.
  • cDNA is prepared from each polyANA sample using a reverse transcriptase according to a conventional method.
  • CDNA prepared from stimulated cells is used as tester cDNA, and cMA from unstimulated cells is used as driver cDNA.
  • the driver cDNA is added to the test DNA to perform subtraction. The efficiency of the subtraction is monitored by adding a small amount of appropriate exogenous DNA to the cDNA as a control.
  • the exogenous DNA is concentrated.
  • the subtracted cDNA is cloned into an appropriate plasmid expression vector according to a conventional method to prepare a plasmid library.
  • a large number of colonies of the library are screened by the differential hybridization method (Nucleic Acids Res., Vo 1.26, No. 4, p. 911-918, 1998; Clinical Immunity, Vol. 29). , No. Suppl. 17, p. 451-459, 1997).
  • the hybridization probe those obtained by radioactively labeling each of the above-mentioned TES cDNA and driver cDNA can be used.
  • the clone containing the target DNA and the clone containing the exogenous DNA can be distinguished by hybridizing the exogenous DNA with a replicant filter.
  • a radiolabeled driver A clone that produces a stronger signal with a radiolabeled tester cDNA probe than with a cDNA probe can be identified, and the desired cDNA or cDNA fragment can be obtained.
  • the cDNA encoding any protein of the present invention can be isolated by using other general cDNA screening methods.
  • a commercially available or known cDNA or cDNA fragment Amino acid sequence and nucleotide sequence also encodes its own isolated protein based, or separately oligonucleotides corresponding to the chemically synthesized amino acid sequence of the protein 32 Labeled with P and used as a probe, the well-known colony hybridization method (Crunstein et al., Proc. Natl. Acid. Sci. USA, Vol. 72, p. 3961, 1975) or plaque hybridization. It can be obtained by screening a commercially available or originally prepared cDNA library by the Chillon method (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, p. 2.108, 1989). .
  • a pair of PCR primers is prepared based on the nucleotide sequence of the cDNA or cDNA fragment encoding the protein, and a cDNA encoding the protein is obtained by PCR using the full-length cDNA library as a type III primer and the primers.
  • a method for amplifying MA can be mentioned.
  • a target clone When a cDNA library prepared using an expression vector capable of expressing cDNA is used, a target clone may be selected by utilizing an antigen-antibody reaction using an antibody reactive with the protein. it can. When a large number of clones are processed, it is preferable to use a screening method using the PCR method.
  • the gene encoding any protein in the present invention can be obtained by cutting out all or a part of the clone obtained as described above using restriction enzymes or the like. it can.
  • examples of a method for preparing a gene encoding a desired protein by isolating it from a genomic DNA derived from a cell that expresses the protein include the following methods.
  • the cells are preferably lysed using SDS or proteinase K or the like, and the DNA is deproteinized by repeating extraction with phenol.
  • the RNA is digested, preferably by ribonuclease.
  • the obtained DNA is partially digested with an appropriate restriction enzyme, and the obtained DNA fragment is amplified with an appropriate phage or cosmid to prepare a library.
  • a clone having the target sequence is detected by, for example, a method using a radiolabeled DNA probe, and all or a part of the gene encoding the protein is cut out from the clone with a restriction enzyme or the like and obtained.
  • Kosumi Dry Slurry into which human genomic DNA (chromosomal DNA) has been introduced is also prepared ("Labo Manual Human Genome Matching", edited by Masaaki Hori and Yusuke Nakamura, Maruzen)
  • a positive clone containing the DNA of the coding region of the target protein is obtained.
  • the cDNA library described above is used. It can also be prepared by screening rallies.
  • Examples of the vector used in cloning of the gene encoding any of the above-mentioned proteins and / or the expression vector for expressing the gene encoding the protein include various prokaryotic and / or eukaryotic host cells. There is no particular limitation as long as it can maintain replication or self-reproduce in it, and includes plasmid vector and phage vector. However, in the above-mentioned embodiments ⁇ 1> to ⁇ 22>, the gene encoding the protein is limited to a vector that can be expressed in the “PC12-derived cell” as defined above.
  • the recombinant vector can be simply prepared by ligating the DNA encoding the protein to a recombinant vector (plasmid DNA and bacterial phage DNA) available in the art in a conventional manner. it can.
  • telomeres derived from Escherichia coli such as pBR322, pBR325, pUC12, pUC13 and pUC19, and plasmids derived from yeast such as pSH19 and pSH15, and plasmids derived from Bacillus subtilis.
  • pUB110, pTP5, and PC194 are exemplified.
  • the phage include pacteriophage such as input phage, and animal and insect viruses (pVL1393, manufactured by Invitrogen) such as retrovirus, puccinia virus, and nucleopolyhedrovirus.
  • Expression vectors are useful for the purpose of expressing DNA encoding the protein in “PC12-derived cells” as defined above.
  • the expression vector is not particularly limited as long as it has a function of expressing the gene in the cell.
  • pMAL C2 pEF-BOS (Nucleic Acid Research) ⁇ 18 Volume, p. 532, p. 1992, etc.) or pME18S (Experimental Medicine separate volume, “Genetic Engineering Handbook”, p. 1992, etc.).
  • the expression vector preferably contains at least a promoter, an initiation codon, DNA encoding the protein of interest, and a stop codon.
  • DNA encoding a signal peptide, enhancer sequence, untranslated regions at the 5 and 3 sides of the gene encoding the protein, splicing junction, polyadenylation site, selective binding region, or replicable unit Etc. may be included. Further, it may contain a gene amplification gene (maichmatichi) usually used depending on the purpose.
  • Suitable initiation codons include methionine codon (ATG).
  • stop codon examples include commonly used stop codons (eg, TAG, TGA, TAA).
  • the evening / mine / night area is usually used natural or synthetic evening / mine One can be used.
  • a replicable unit is DNA that has the ability to replicate its entire DNA sequence in a host cell, and is composed of natural plasmids, artificially modified plasmids (prepared from natural plasmids). DNA fragments) and synthetic plasmids.
  • plasmid pBR322 or an artificially modified product thereof is used in E. coli
  • plasmid pRSVneo is used in mammalian cells. ATCC 37198, plasmid pSV2dhfr ATCC 37145, plasmid pdBPV-MMMTneo ATCC 37224, and plasmid pSV2neo ATCC 37149.
  • polyadenylation site and slicing junction site those commonly used by those skilled in the art can be used.
  • selection marker a commonly used marker can be used by a conventional method. Examples thereof include antibiotic resistance genes such as neomycin, tetracycline, ambicillin, hygromycin, and kanamycin.
  • Gene amplification genes include dihydrofolate reductase (DHFR) gene, thymidine kinase gene, neomycin resistance gene, glutamate synthase gene, adenosine deminase gene, ordinine decarboxylase gene, hygromycin B — A phosphotransferase gene, an aspartalate transcarbamylase gene, and the like.
  • DHFR dihydrofolate reductase
  • thymidine kinase gene thymidine kinase gene
  • neomycin resistance gene glutamate synthase gene
  • adenosine deminase gene amino acid deminase gene
  • ordinine decarboxylase gene ordinine decarboxylase gene
  • hygromycin B A phosphotransferase gene, an aspartalate transcarbamylase gene, and the like.
  • the expression vector used in the present invention can appropriately and continuously replicate at least the above-mentioned promoter, start codon, DNA encoding the desired protein, stop codon, and overnight-mine area. It can be prepared by linking to units. At this time, if necessary, an appropriate DNA fragment (for example, a linker, another restriction enzyme cleavage site, etc.) can be used by a conventional method such as digestion with a restriction enzyme or ligation using T4 DNA ligase.
  • an appropriate DNA fragment for example, a linker, another restriction enzyme cleavage site, etc.
  • the transformed cell prepared in the present invention is prepared by transforming the above-described expression vector into a host cell (immediately). That is, it can be prepared by introduction into the “PC12-derived cell” defined above.
  • the cells (including wild-type cells, cell lines, non-transformed cells, and transformed cells) used in the present invention can survive, maintain, and / or proliferate by culturing in a nutrient medium.
  • the nutrient medium preferably contains a carbon source, an inorganic nitrogen source or an organic nitrogen source necessary for the growth of the host cell (transformant).
  • the carbon source include glucose, dextran, soluble starch, and sucrose
  • examples of the inorganic or organic nitrogen source include ammonium salts, nitrates, amino acids, corn chips, peptone, casein, and meat extract. , Soybean meal, potato extract and the like.
  • other nutrients eg, inorganic salts (eg, calcium chloride, sodium dihydrogen phosphate, magnesium chloride), bimins, antibiotics (eg, tetracycline, neomycin, ambibicin, kanamycin, etc.), etc.) May be included.
  • the culturing is performed by a method known in the art. Culture conditions, such as temperature, pH of the medium, and culture time are appropriately selected.
  • a MEM medium containing about 5 to 20% fetal bovine serum (Science, Vol. 122, p. 501, 1952), a DMEM medium (Virology, Vol. 8, p. 396, 1959), RPMI1640 medium (J. Am. Med. Assoc., Vol. 199, p. 519, 1967), 199 medium (proc. Soc. Exp. Biol. Med., Vol. 73, p. L) , 1950)
  • the pH of the medium can be set to about 6 to 8, and the culture is usually performed at about 30 to 40 ° C, and if necessary, aeration and stirring can be performed.
  • the chimeric G protein subunit used in the present invention for example, a gene encoding Ghi qi consisting of Ghi i and G aq or a gene encoding G asi consisting of G hi i and G his is
  • the base sequence of mMA encoding each of aq and G Can be prepared by PCR using the following pair of primers.
  • Fourth primer A primer having a nucleotide sequence complementary to the nucleotide sequence encoding the N-terminal amino acid sequence of each of Gq and Gs.
  • Reverse primer A nucleotide sequence complementary to the nucleotide sequence encoding the C-terminal amino acid sequence of Gi downstream of the nucleotide sequence complementary to the nucleotide sequence encoding a part of the amino acid at the C-terminal side of each of Gq and Gs A primer having
  • the various reporter genes used in the present invention as defined above can be cloned using the existing gene cloning method as described above. However, commercially available expression vectors into which the gene has been inserted can be used. It is convenient to use a cutter.
  • Transformation of host cells by various gene expression vectors in the present invention is performed by the above-described general method (eg, lipofection method or electroporation method). Can be performed.
  • the transformants used in the present invention include c- transformants, which include both transient transformants and stable transformants, as described above.
  • Host cells are transformed with various marker genes (for example, a drug resistance gene such as a neomycin resistance gene), and the cells are then cultured in the presence of the drug to obtain clones resistant to the drug. it can.
  • the invention ⁇ 1> is as follows.
  • a method for determining whether or not a substance is an agonist of a desired G protein-coupled receptor comprising the following steps (a) to (c): ) At least the following exogenous genes (1) and (2): (1) a gene encoding the desired G protein-coupled receptor; and
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • the present invention can be implemented, for example, as follows.
  • PC12-derived cells eg, PC12h cell line
  • PC12h cell line are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (iii) have been inserted so that they can be expressed in host cells.
  • a transformed cell preferably a stable transformed cell into which all the genes have been introduced is obtained.
  • a gene (preferably cDNA) encoding a desired G protein-coupled receptor.
  • a promoter overnight region of a gene whose expression is induced by a signal mediated by a G protein preferably, a promoter region containing a zif268 (EGR-1) promoter region, a c-fos promoter region, or an SRE and / or a CRE.
  • EGR-1 zif268
  • c-fos promoter region preferably a promoter region containing a zif268 (EGR-1) promoter region, a c-fos promoter region, or an SRE and / or a CRE.
  • the amino acid sequence at the C-terminal side of the Gq subunit from about 3 to about 23 (preferably 9) consecutive amino acid sequences including glycine at position 3 is converted to the C-subunit of the Gi subunit.
  • a gene (preferably cDNA) encoding a chimeric G protein subunit obtained by substitution with the corresponding amino acid sequence at the terminal side.
  • the number of the obtained transformed cells (for example, l to lx l0 lfl , lxlO ⁇ lxlO 9 pieces, lxl0 2 ⁇ lxl0 8 pieces, lxl0 3 ⁇ lxl0 7 atoms, lxl0 4 ⁇ lxl0 7 amino, 1 xl0 4 ⁇ lxl0 6 pieces, Ixl0 4 ⁇ 5xl0 5 pieces) capable desired cell culture
  • a desired nutrient medium eg, D-MEM medium
  • the desired reagents eg, serum, antibiotics, etc.
  • instruments eg, petri dishes, microplates with multiple wells, microtubes, etc.
  • At least one of the samples contains the desired concentration of the substance (eg, compound) to be tested (eg, about ⁇ . ⁇ to about 1.0 ⁇ , and in the following order of preference, about ⁇ . ⁇ to about 100 mM, Add about ⁇ to about 10 mM, about ⁇ . ⁇ to about 1.0 mM, about ⁇ to about 500 M, about ⁇ to about 500 / M), and add the desired time at about 37 ° C (for example, about 1 to 24 hours). ) Incubate.
  • the desired concentration of the substance (eg, compound) to be tested eg, about ⁇ . ⁇ to about 1.0 ⁇ , and in the following order of preference, about ⁇ . ⁇ to about 100 mM, Add about ⁇ to about 10 mM, about ⁇ . ⁇ to about 1.0 mM, about ⁇ to about 500 M, about ⁇ to about 500 / M), and add the desired time at about 37 ° C (for example, about 1 to 24 hours). ) Incubate.
  • the cells contained in the cell sample cultured in the presence of the substance are lysed with a desired cell lysis reagent, and the amount of luciferase contained in a certain amount of the cell lysate of the sample is determined by using commercially available luciferase. Determine quantitatively using an I-lase activity measuring device to obtain the measured value [A].
  • cells contained in the cell sample of the above (2) cultured without adding the substance are also lysed in the same manner, and the amount of luciferase contained in a certain amount of the cell lysate is determined by using commercially available luciferase. Quantitatively, using an activity measuring device to obtain the measured value [B].
  • the measured value [A] is compared with the measured value [B], and based on the degree of the difference, whether or not the substance is an agonist of the G protein-coupled receptor (interaction with the receptor) Is determined).
  • the invention 2 is as follows.
  • step (b) for each sample contacted with the substance in step (a), the detectable signal produced by the reporter gene expressed in each cell in the sample; and Quantitatively determining each of the detectable signals produced by the repo overnight gene expressed in each cell of the sample;
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • the present invention can be implemented, for example, as follows.
  • PC12-derived cells eg, PC12h cell line
  • PC12h cell line are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (ii) have been inserted so that they can be expressed in host cells.
  • a transformed cell preferably a stable transformed cell into which all the genes have been introduced is obtained.
  • a gene (preferably cDNA) encoding a desired G protein-coupled receptor.
  • Promoter region of a gene whose expression is induced by a signal mediated by a G protein preferably, zif268 (EGR-1) Promoter region, c-fos Promoter region, or SRE and / or CRE Repro overnight gene (preferably, luciferase derived from fireflies or mimics, GFP (Green Fluorescence Protein) derived from jellyfish, CDNA encoding zeolites).
  • the amino acid sequence at the C-terminal side of Gq Encodes a chimeric G protein subunit obtained by replacing about 3 to about 23 (preferably 9) contiguous amino acid sequences with the corresponding amino acid sequence at the C-terminal side of Gi subunit. (Preferably cDNA).
  • the resulting constants of the transformed cell e.g., L ⁇ lxl0 1 () number, in order of preference below nine lxlO ⁇ lxlO, 1 10 2 ⁇ 1 10 8 pieces, 1 10 3 to 1 10 7, Lxl0 4 ⁇ lxl0 7 amino, 1 xl0 4 ⁇ lxl0 6 pieces, Ixl0 4 to ⁇ 5Xl0 5 pieces), a number of Ueru (e.g., 24 holes, 48 holes, 96 holes, each of the microplates with 364 like holes) Ueru
  • the cells are cultured in a desired nutrient medium (eg, D-MEM medium) containing the desired reagents (eg, serum, antibiotics, etc.).
  • a desired nutrient medium eg, D-MEM medium
  • the desired reagents eg, serum, antibiotics, etc.
  • Each of a plurality of samples set in each well of the microplate has a desired concentration (for example, about 1.0 pM to about 1.0 M) of a different substance to be tested (for example, a compound).
  • a desired concentration for example, about 1.0 pM to about 1.0 M
  • a different substance to be tested for example, a compound.
  • a desired cell lysis reagent is added to each sample cultured in the presence of a different test substance to lyse the cells, and the luciferase contained in a fixed amount of the cell lysate of each sample is determined.
  • the amount was quantitatively determined using a commercially available luciferase activity measuring instrument, and multiple measured values [A], [B], [C], [D], [E] ⁇ ⁇ -[X ].
  • cells contained in the cell sample of the above (2) cultured without adding the substance are also lysed in the same manner, and the amount of luciferase contained in a certain amount of the cell lysate is measured using a commercially available luciferase activity assay. Determine quantitatively using the instrument and obtain one or more measured values [Control].
  • the invention of 3> is as follows.
  • a method for determining whether or not a substance is an antagonist of the desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor A method characterized by including the following steps (a) to (c):
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • the present invention can be implemented, for example, as follows.
  • a PC12-derived cell for example, a PC12h cell line
  • a PC12-derived cell is transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (iii) have been inserted so that they can be expressed in host cells.
  • a transformed cell preferably a stable transformed cell into which all the genes have been introduced is obtained.
  • a gene (preferably cDNA) encoding a desired G protein-coupled receptor.
  • Promoting genes whose expression is induced by G protein-mediated signals A repo overnight gene (preferably a zif268 (EGR-l) promoter overnight region, a c-fos promoter overnight region, or a promoter region containing SRE and / or CRE) Are luciferases derived from fireflies or mimic, GFP (Green Fluorescence Protein) derived from jellyfish, and cDNA encoding laccase.
  • EGR-l zif268
  • CRE Green Fluorescence Protein
  • the resulting constants of the transformed cell e.g., L ⁇ lxl0 1Q pieces, in order of preference below, lxlO 'lxlO 9 pieces, lxl0 2 ⁇ lxl0 8 fli, Ixl0 3 ⁇ lxl0 7 atoms, 1 10 4 to 1 10 7 pieces, 1 xl0 4 ⁇ lxl0 6 pieces, Ixl0 4 ⁇ 5xl0 5 pieces
  • the desired cell culture instrument e.g., a petri dish, a microplate having many Ueru, etc. microtube
  • the desired reagents used For example, culture in a desired nutrient medium (eg, D-MEM medium) containing serum, antibiotics, etc.).
  • a desired nutrient medium eg, D-MEM medium
  • a desired concentration of a known agonist of the G protein-coupled receptor e.g., about l.Op M to about 1.0 M, preferably in the order of about ⁇ ⁇ ⁇ ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, About 1.OnM to about 1.0mM, about ⁇ to about 500M, about ⁇ to about 500 ⁇ M).
  • the desired concentration of the substance to be tested for example, a compound (for example, about ⁇ . ⁇ to about 1.0 M, and in the preferred order, about ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, about 1.0 nM About 1.0 mM, about 10 nM to about 500 ⁇ M, about ⁇ to about 500 / M).
  • a desired concentration of the known agonist of the G protein-coupled receptor for example, about l. Op M to about 1.0 M, and in the following order of preference, about ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, About 1. OnM to about 1.0 mM, about ⁇ to about 500 ⁇ M, about ⁇ to about 500 ⁇ M).
  • the cells contained in the cell sample cultured in the absence of any of the agonist and the test substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed.
  • the amount is quantitatively determined using a commercially available luciferase activity measuring instrument, and the measured value [C] is obtained.
  • the measured values [A], [B] and [C] are compared, and based on the degree of the difference, whether or not the substance is an agonite of the G protein-coupled receptor, or Is a substance having an activity of inhibiting the agonist action of the agonist.
  • the invention of 4> is as follows.
  • a method for screening a substance for identifying an agonist of the desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor comprising the following (a) And (c): (a) at least the following exogenous genes (1) and (2):
  • a plurality of samples consisting of a constant of PC12-derived cells having Contacting a substance different from the agonist of the G protein receptor;
  • step (b) contacting each sample contacted with the substance in step (a) with a detectable signal generated by the repo-all-over-gene expressed in each cell in the sample, and Quantitatively determining each of the detectable signals produced by the repo-gene expressed in each cell of the unsampled sample;
  • step (c) comparing the amounts of the respective signals determined in step (b).
  • the present invention can be implemented, for example, as follows.
  • PC12-derived cells eg, PC12h cell line
  • PC12h cell line are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (ii) have been inserted so that they can be expressed in host cells.
  • a transformed cell preferably a stable transformed cell into which all the genes have been introduced is obtained.
  • a gene (preferably cDNA) encoding a desired G protein-coupled receptor.
  • a promoter region of a gene whose expression is induced by a signal mediated by a G protein preferably, a zif268 (EGR-1) promoter region, a c-fos promoter overnight region, or a promoter region containing SRE and / or CRE.
  • a G protein preferably, a zif268 (EGR-1) promoter region, a c-fos promoter overnight region, or a promoter region containing SRE and / or CRE.
  • luciferase preferably luciferase derived from fireflies or escherichia
  • GFP Green Fluorescence Protein
  • the amino acid sequence at the C-terminal side of the Gq subunit from about 3 to about 23 (preferably 9) consecutive amino acid sequences including glycine at position 3 is converted to the C-terminal of the Gi subunit.
  • a gene (preferably C DNA) encoding a chimeric G protein subunit obtained by substituting the corresponding amino acid sequence on the side.
  • the resulting constants of the transformed cell e.g., L ⁇ lxl0 1Q pieces, in order of preference below nine lxlO ⁇ lxlO, lxl0 2 ⁇ lxl0 8 pieces, lxl0 3 ⁇ lxl0 7 atoms, lxl0 4 ⁇ lxl0 7 carbon atoms, 1 xl0 4 ⁇ lxl0 6 pieces, the lxl0 4 ⁇ 5xl0 5 pieces), a number of Ueru (e.g., 24-well, 48-well, 96-well, microplate of 1 or more (preferably a plurality) having a 364 like holes)
  • the cells are plated on each of the cells, and the cells are cultured in a desired nutrient medium (eg, D-MEM medium) containing a desired reagent (eg, serum, antibiotic, etc.).
  • a desired reagent eg, serum, antibiotic, etc.
  • a desired concentration of a known agonist of the G protein-coupled receptor e.g., about l.Op M to about 1.0 M, preferably in the order of about ⁇ ⁇ ⁇ ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, About 1.OnM to about 1.0mM, about ⁇ to about 500 ⁇ M, about ⁇ to about 500 / M).
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound
  • the desired concentration of the substance to be tested for example, a compound which is different from each other (for example, about ⁇ . ⁇ to about 1.0 ⁇ , and in the following order of preference, about ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, about ⁇ . ⁇ to about 1.0 mM, about ⁇ to about 500 M, about ⁇ to about 500 ⁇ M).
  • a desired concentration of a known agonist of the G protein-coupled receptor e.g., about l.Op M to about 1.0 M, and in a preferred order, about ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, about 1. OnM to about 1.0 mM, about ⁇ to about 500 ⁇ M, about ⁇ to about 500 ⁇ M).
  • cells contained in the cell sample cultured in the absence of any of the agonist and the test substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed.
  • the amount is quantitatively determined using a commercially available luciferase activity measuring device to obtain one or more measured values [Control].
  • 6Plural measured values [A], [B], [C], [D], ⁇ E ⁇ ⁇ [X] are converted to measured values [], [B,], [C,], [ D,], [ ⁇ ,] ⁇ ⁇ ⁇ ⁇ [ ⁇ ,], and the measured value [Control], and based on the degree of the difference, a substance that is an angoneist of the G protein-coupled receptor; Alternatively, a substance having an activity of inhibiting the agonist action of the agonist is selected and identified. (10) Methods for identifying receptors that interact with a substance (eg, G protein-coupled receptors)
  • a method for identifying a receptor that interacts with a substance comprising the following steps (a) to (d) (where the substance is an agonist for the receptor: Acts as :):
  • Preparing a plurality of samples comprising PC12-derived cells having the following steps: contacting each of the samples with the substance (wherein the cells in each of the samples are different from each other for each sample). Has the following genes :);
  • step (b) for each sample that has been contacted with the substance in step (a), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Quantitatively determine each of the detectable signals produced by the repo gene expressed in each cell of the respective sample About;
  • step (c) comparing the amount of signal for each sample determined in step (b) with each other, and selecting one or more samples from the plurality of samples tested in step (a);
  • step (d) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (a) of the cells in the selected sample;
  • the invention of ⁇ 15> is as follows.
  • a method for identifying a receptor that interacts with a substance comprising the following steps (a) to (f) (wherein the substance is an agonist for the receptor: Acts as :):
  • Preparing a plurality of samples consisting of PC12-derived cells having the following steps: contacting each of the samples with the substance (wherein the cells in each of the samples are different from each other for each sample) (1) Has the following genes :);
  • step (b) for each sample contacted with the substance in step (a), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals generated by said repo-all-night gene expressed in each cell of said respective sample not contacted;
  • step (c) comparing the amount of signal for each sample determined in step (b) with each other and selecting one or more samples from the plurality of samples tested in step (a);
  • step (d) At least the following exogenous genes (1) and (2): (1) one or more genes encoding the protein described in (1) of step (a), which are exogenous genes of the vesicles in the sample selected in step (c); and
  • Providing a plurality of samples comprising PC12-derived cells having the following steps: contacting each of the samples with the substance (where the cells in each of the samples are different from each other for each sample; Gene));
  • step (e) for each sample contacted with the substance in step (d), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals produced by the reporter gene expressed in each cell of the respective sample not contacted;
  • step (f) comparing the amount of signal for each of the samples determined in step (e) with each other, and selecting one or more samples from the plurality of samples tested in step (d);
  • step (g) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (d) of the cells in the selected sample;
  • the invention of the above item 16> is as follows.
  • the method comprises, if desired, between the step (f) and the step (g), one or more times of the same operation comprising the steps (d) to (f). 15>.
  • the present invention can be implemented, for example, as follows.
  • PC12-derived cells eg, PC12h cell line
  • PC12h cell line are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (ii) have been inserted so that they can be expressed in host cells.
  • a transformed cell preferably inexpensive into which all the genes have been introduced
  • a plurality of types of transformed cells having the following gene (i) are prepared for each transformed cell.
  • genes encoding any protein.
  • a cDNA or cDNA group consisting of one or more kinds in a cDNA library consisting of various kinds of cDNAs encoding the full-length amino acid sequences of various human-derived proteins.
  • Promoter region of a gene whose expression is induced by a signal mediated by a G protein preferably, a promoter region of zif268 (EGR-l), a c-fos promoter region, or a promoter region containing SRE and / or CRE.
  • CDNA encoding a reporter gene preferably luciferase from fireflies or peaches, GFP (Green Fluorescence Protein) from jellyfish, or luciferase) ).
  • the C-terminal amino acid sequence of the C-terminal of the G subunit comprising about 3 to about 23 (preferably 9) contiguous amino acid sequences including glycine at position 3;
  • a gene preferably cDNA
  • a chimeric G protein subunit obtained by substitution with the corresponding amino acid sequence on the side.
  • each of the constants of the transformed cell e.g., L ⁇ lxl0 1Q pieces, in order of preference below nine lxlO ⁇ lxlO, 1 10 2 ⁇ 1 10 8 pieces, lxl0 3 ⁇ lxl0 7 carbon atoms, 1 xl0 4 ⁇ lxl0 7 atoms, lxl0 4 ⁇ lxl0 6 pieces, the lxl0 4 ⁇ 5xl0 5 pieces), if e numerous Ueru (e.g., 24 holes, 48 holes, 96 holes, each of the microplates having 364 such holes)
  • a desired nutrient medium e.g, D-MEM medium
  • a desired reagent eg, serum, antibiotic, etc.
  • the desired concentration (for example, about ⁇ . ⁇ ⁇ to about 1. 1.) of the desired substance to be tested is added to each of a plurality of samples set in each microplate of the microplate.
  • 0M in the following order of preference, about ⁇ . ⁇ to about 100 mM, about ⁇ to about 10 mM, about ⁇ . ⁇ to about 1.OmM, about ⁇ to about 500 / M, about ⁇ to about 500 / M), and Incubate at about 37 ° C for the desired time (eg, about 1 to 24 hours).
  • a desired cell lysis reagent is added to each sample cultured in the presence of the test substance to lyse the cells, and the amount of luciferase contained in a fixed amount of the cell lysate of each sample is determined. Quantitatively determined using a commercially available luciferase activity measuring device, and multiple measurements [A], [B], [C], [D], [E]... ' ]. Also, if desired, the cells contained in each cell sample of the above (1) cultured without adding the substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed. The amount is quantitatively determined using a commercially available luciferase activity measuring device to obtain one or more measured values [Control].
  • the gene of (i) of (2) introduced into the cells contained in each sample is used for each sample.
  • the nucleotide sequence is determined, and the gene (i) interacting with the substance can be identified based on the nucleotide sequence.
  • Selected sample 1 Genes introduced into cells in (i) above: Genes A, B,
  • FIG. 1 is a diagram showing the responsiveness of PC12h cells transfected with a zif-luciferase gene and a histamine H1 receptor gene to histamine at various concentrations.
  • FIG. 2 shows the responsiveness of PC12h cells transfected with zif-luciferase gene and GLP1 receptor gene to GLP at various concentrations.
  • FIG. 3 is a diagram showing the responsiveness of PC12h cells, into which zif-luciferase gene and adrenaline A2 receptor gene have been introduced, to forskolin and / or UK14304.
  • Figure 4 shows (1) responsiveness to histamine of PC12h cells transfected with genes encoding zif-luciferase gene, histamine H1 receptor gene and Gqi chimeric molecule, (2) zif-luciferase gene, GLP1 Responsiveness to GLP of PC12h cells transfected with the gene encoding the receptor gene and Gqi chimera molecule, and (3) transfection of zif-luciferase gene, adrenergic A2 receptor gene, and genes encoding Gqi chimera molecule The figure which shows each response of UK12304 of the obtained PC12h cell.
  • H1 histamine receptor pME-H1R
  • pME-H1R H1 histamine receptor
  • PCR PCR was performed using ⁇ brain-derived cDNA (Bovine QUICK-Clone cDNA; manufactured by CLONTECH) as type ⁇ with primer F 3 (5, -GCGAATTCCAATGACCTGTCCCAACTCC-3 ') and primer R 3 (5'-GCGCGGCCGCAGGCTTCCTCCTTCACTTCC-3 ').
  • primer F 3 5, -GCGAATTCCAATGACCTGTCCCAACTCC-3 '
  • primer R 3 5'-GCGCGGCCGCAGGCTTCCTCCTTCACTTCC-3 '
  • GLP1 receptor pEF-GLPR
  • An expression vector for the adrenaline 2A receptor (pME-AR2AR) was constructed as follows.
  • the adrenaline 2A receptor gene was obtained from ATCC (American Type Culture Collection), and its coding region was incorporated into the pME18S expression vector according to the following procedure. That is, the upstream (5 ,;) side of the coding region of human 2A was digested with restriction enzymes PvuII and Sacl, and this DNA fragment was cloned into the pBluescript II Smal-Sacl site (pBlue- Hi 2A5,).
  • the downstream (3 ') side of the 2A coding region was digested with the restriction enzyme Accl to obtain a DNA fragment that partially overlaps the upstream side described above, and this was placed on the Accl site of pBluescript II. It was cloned (pBlue-H2A3,).
  • pBlue-hi 2A5 was digested with the restriction enzymes EcoRI (restriction enzyme site on vector) and Fspl (restriction enzyme site on ⁇ 2A coding), and the upstream (5) The DNA fragment on the ') side was obtained.
  • pBlue-hi 2A3 was digested with the restriction enzymes Fspl (restriction enzyme site at the same position on the 2A coding of pBlue-hi 2A5) and Notl (restriction enzyme site on the vector).
  • a DNA fragment downstream (3 ') of the coding region of was obtained.
  • the DNA fragments upstream and downstream of the coding region of human 2A thus obtained were ligated at the Fspl site and cloned into the EcoRI-Notl site of pMel8S.
  • the zif268 (EGR-l) promoter overnight luciferase reporter plasmid (pGL2-zif, hereinafter sometimes referred to as zif-luciferase) was prepared by the following procedure.
  • the rat genomic DNA was designated as type II, and the primers F1 (5, AGAGAGGGTACCAGCCTCAGCTCTACGCGCCT-3 ') and R-1 (5,-
  • the amplified DNA fragment was digested with the restriction enzyme SacII, blunt-ended, and then digested with the restriction enzyme Kpnl to obtain a fragment of -526 to +97.
  • SacII restriction enzyme
  • Kpnl restriction enzyme
  • the zif268 promoter fragment was cloned upstream of the luciferase gene in pGL2-basic vector.
  • c-fos Promo overnight Luciferase repo overnight plasmid (pGL2-fos, hereinafter sometimes referred to as fos promo overnight Lucifera zelepo overnight) was constructed as follows.
  • primer F2 (5'-TCTCTCGGTACCGCAGGAACAGTGCTAGTATT-3 ') and primer R2 (5, -TCTCTCGAGATCTTGAAGCAGAGCTGGGTAGGA-3') were used.
  • primer R2 5, -TCTCTCGAGATCTTGAAGCAGAGCTGGGTAGGA-3'
  • the amplified DNA fragment was digested with restriction enzymes Bglll and Kpnl.
  • the expression vector pGL2-basic vector (PR0MEGA) was digested with restriction enzymes Bgl11 and Kpnl, and the above DNA fragment was cloned into pGL2-basic vector.
  • PR0MEGA restriction enzymes Bgl11 and Kpnl
  • the pure mouth mycin resistance vector (pCMV-Pur) used in the following examples was prepared as follows.
  • pPUR plasmid (manufactured by CLONTECH) was digested with restriction enzymes HindI II and Xbal to obtain a DNA fragment containing a buromycin resistance structural gene. This DNA fragment is The clone was cloned into Hindl l-Xbal site of Kuta-pIRESIhyg (manufactured by CLONTECH).
  • Activation of the reporter gene by a ligand / receptor that activates the Gq signaling system activation of zif-luciferase through HI histamine receptor (H 1 R) by histamine.
  • PC12h cells were seeded on a collagen-coated 24-well plate (manufactured by IWAKI) at a concentration of 1 ⁇ 10 5 cells / ⁇ l.
  • the medium used was D-MEM (10% horse serum, 5% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 // g / ml).
  • D-MEM 10% horse serum, 5% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 // g / ml.
  • a receptor expression vector pME-HIR; 200 ng / Pell
  • a repo-plasmid plasmid were prepared using a ribofectamine reagent (manufactured by GIBCO BRL) according to the manufacturer's instructions.
  • pME-HIR a receptor expression vector
  • a repo-plasmid plasmid were prepared using a ribofectamine reagent (manufactured by
  • the transfection solution is discarded, and low serum D-MEM medium (0.5% horse serum, 0.25% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 g / ml) is added per ml to each well. added.
  • low serum D-MEM medium (0.5% horse serum, 0.25% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 g / ml
  • histamine was added to a final concentration of 10 nM to ImM.
  • discard the medium wash the cells twice with phosphate buffered saline, add cell lysis buffer (reporter lysis buffer; manufactured by PR0MEGA), add lOOAd per gel, and lyse the cells.
  • Luciferase activity was measured using Lucifer-Zeatsy System (PR0MEGA) as a substrate and LUMINOUS CT-9000D (DIA-IATR0N) as a measuring instrument.
  • PR0MEGA Lucifer-Zeatsy System
  • LUMINOUS CT-9000D DIA-IATR0N
  • GLP Glucagon-like peptide
  • Example 7 Other conditions were the same as in Example 7, except that the receptor expression vector used (pEF-GLPI and ligand were different) GLP (7-37, manufactured by WAK0) stimulation was performed at 1 pM to: LOnM. As shown in Fig. 2, the luciferase activity was increased in a GLP concentration-dependent manner, for example, the luciferase activity was increased 12-fold in ⁇ and 50-fold in ⁇ .
  • the receptor expression vector used pEF-GLPI and ligand were different
  • GLP (7-37, manufactured by WAK0) stimulation was performed at 1 pM to: LOnM.
  • the luciferase activity was increased in a GLP concentration-dependent manner, for example, the luciferase activity was increased 12-fold in ⁇ and 50-fold in ⁇ .
  • UK14304 one of the ligands for the adrenergic ⁇ 2 ⁇ receptor, is known to activate the Gi signal transduction system at about ⁇ . It is also known that the Gs signaling system activated by forskolin, which is an activator of the Gs signaling system adenylate cyclase, is suppressed by about ⁇ of UK14304. An example in which this phenomenon is evaluated using the Atsushi system of the present invention is shown below.
  • Example 7 The procedure was performed under the same conditions as in Example 7, except that the drug stimulation conditions and the adrenaline 2A receptor expression vector (pME-hi2AR) were used as the receptor expression vector.
  • Drug stimulation Phonorescholine (RBI Research Biochemicals International; ⁇ ) Performed at 37 ° C for 10 minutes with certain t ⁇ (or forskolin (10 ⁇ M) and UK14304 (RBI Research Biochemicals International; ⁇ ). After changing to -MEM medium (0.5% equine serum, 0.25% fetal calf serum, penicillin 50 units / ml, streptomycin 50 / g / ml), culture at 37 ° C for about 6 hours, and luciferase Activity was measured.
  • -MEM medium 0.5% equine serum, 0.25% fetal calf serum, penicillin 50 units / ml, streptomycin 50 / g / ml
  • luciferase activity was increased about 10-fold by stimulation of forskolin, an adenylate cyclase activator, and Gn inhibition (Gi activation) by 10 nM UK14304 was luciferase activity. It was shown to be reduced by about 40%.
  • the Gqi chimera G protein expression vector pME-Gqi was constructed as follows.
  • CDNA was synthesized from RNA prepared from mouse brain using oligo dT primer. Using this cDNA as a ⁇ type, PCR was performed using primer F5 (5'-GGACTAGTGAGGCACTTCGGAAGAATGACTCTGGA-3 ') and primer R5 (5, -GGACTAGTTAGAACAGACCGCAATCCTTCAGGTTATTCTGCAGG-3' :) and amplified. The widened DNA fragment was digested with a restriction enzyme Spel.
  • the complementary strand sequence of a part of the primer R5 (GAACAGACCGCAATCCTTCAGGTTATT) encodes the C-terminal amino acid sequence of G i, and the complementary strand sequence of the other part of the nucleotide sequence (CTGCAGG-3 ′) is Gq Encodes an amino acid sequence of
  • the expression vector PME18S was digested with the restriction enzyme Xhol, and an expression vector containing no Xhol fragment (stuffer fragment) was prepared by a self-ligation reaction. So Thereafter, the expression vector was digested with the restriction enzyme Spel, and the DNA fragment amplified by the above PCR was cloned into the Spel site of PME18S.
  • Xhol restriction enzyme
  • Spel restriction enzyme
  • Receptor / repo / Irichi / Gqi chimera Activation of the repo / original gene via Gs, Gq, Gi coupled receptors by combining G proteins.
  • Gs and Gq information transmission can be obtained with high sensitivity in the form of an increase in luciferase activity, and G i information transmission using G Combined with activation of the signal transduction system, it can be captured in the form of suppression of luciferase activity.
  • Gqi chimeric G protein
  • Gs and Gq are obtained by forcibly expressing in a cell a chimeric G protein of Gqi in which the C-terminal 9 residues of the Gq protein subunit are replaced with the G protein subunit.
  • the following is an example in which not only signal transduction through a receptor coupled to any of Gi but also in the form of increased luciferase activity is shown below.
  • a receptor expression vector 100 ng
  • a reporter plasmid pGL2-zif; 20 ng
  • a Gqi expression vector pME-Gqi; 30 mg
  • luciferase activity was enhanced about 18-fold by UK14304 stimulation of ⁇ , which activates the Gi signaling system, indicating that the Gi signaling system can be perceived as an increase in luciferase activity with high sensitivity.
  • HI receptor expression vector Gq signal transduction system
  • GLP receptor expression vector Gs signal transduction system
  • GIBC0 BRL repo overnight plasmid
  • pGL2-zif or pGL2-fos repo overnight plasmid
  • 6 zg repo overnight plasmid
  • pBK-CMV drug-resistant plasmid
  • STRATAGENE neomycin resistance gene
  • pCMV-pur puro Co-transformation with mycin resistance gene
  • D-MEM medium (10% horse serum, 5% fetal calf serum, penicillin 50 units / ml, streptomycin 50 g / ml) was added at 10 ml per petri dish. After culturing at 37 ° C for 2 days, the cells were diluted to 1/3, and a selective drug (G418; GIBC0 BRL or puromycin; SIGMA) was added. After one to two weeks, the colonies formed in the petri dish were picked up on a collagen-coated 24-well plate (manufactured by IWAKI).
  • each clone is seeded on a 24-well plate in the same manner as in Example 7, and transfected. : No cushion operation was performed, NGF stimulation was performed 2 days later, and luciferase activity was measured 6 hours later. Then, a clone showing low luciferase activity without stimulation and showing high response to NGF stimulation was selected. With respect to the selected clones, the cells were cloned again by the limiting dilution method to establish stable transformants of the repo overnight gene.
  • a colony was picked up in the same manner as above, and the responsiveness to histamine was measured for each clone of the obtained H1 histamine receptor / zif268-repo overnight gene stable transformant. Clones were selected.
  • the responsiveness of the repo-gene to the signal was determined using various host cells (PC12h Cells, PC12 cells, CH0 cells or COS cells) and various promoter / reporter genes (zif-lucifera-zelepo overnight / fOS-luciferase reporter gene).
  • fos fos luciferase plasmid, that is, zi f-lucifera-zelepo overnight shows highest response in PC12h cells, but also ligand-specific response in other cells, and fos-lucifera.
  • Each and every single zelepo showed ligand-specific responsiveness in various cells including PC12h cells, indicating that any combination of these multiple species can be used for ligand assay.
  • MAP kinase mitogen activated protein kinase activation
  • PathDetect Elkltrans Reporting System including pFR Luc plasmid; repo overnight plasmid; pFA2 Elkl plasmid; and Fusion Transactivator overnight plasmid; manufactured by STRATAGENE.
  • PC12h cells, CH0 cells, CV1 cells, and HEK293 cells 0.5 to 2 x 10 5 cells / ⁇ l are spread on a collagen-coated 24-well plate (manufactured by IWAKI) and pFR Luc (40 to 200 ng / ⁇ l) is applied to each cell.
  • PFA2 Elkl (10-300 ng / ⁇ ⁇ ) and receptor expression vector (pME-HIR; 200-400 ng / ⁇ ) were transfected and luciferase activation in response to histamine stimulation was measured.
  • Cotransfection was carried out using a SuperFect transfection reagent (1.5 to 5/1 / L; manufactured by QUAGEN, # 301307) according to the manufacturer's instructions. The number of cells, the amount of various plasmids, and the amount of the transfusion reagent used in the test were set to optimal conditions for each cell examined in advance.
  • the MAP kinase activity was measured using STR ATAGENE's patDetectElktltrans-ReportIngsSystem.
  • the zif268 (EGR-l) promoter contains four SREs (serum response elements) every night.
  • SREs serum response elements
  • the SRE-luciferase-zelepo overnight gene when used, it responds to signal transmission in the histamine / H1 histamine receptor-expressing cell line, but to a lesser extent the zif-luciferase reporter.
  • the ratio was about 1/2 compared with the case where the gene was used, and the response to signal transduction in cells expressing the GLP / GLP1 receptor was low.
  • the zif268 (EGR-l) promoter contains important elements other than SRE involved in responsiveness, and zif268 cannot be substituted with SRe It was shown that.
  • the promoter used in the present invention is preferably the zif268 (EGR-1) promoter, and it is a promoter other than zif268, and This does not mean that a portal containing a CRE cannot be used in the present invention. It goes without saying that a promotion including an SRE and / or a CRE is also an embodiment of the present invention.
  • a promoter region of a gene whose expression is induced by a signal through a G protein preferably, a promoter region of zif268 (EGR-1) promoter is used as a promoter for controlling the expression of the reporter gene.
  • a PC12 cell or a cell subcloned therefrom eg, a PC12h cell and a cell subcloned from the PC12h cell
  • activation of the G protein-mediated signal transduction system repo The level of the signal, which is detected by an increase in the expression of a gene every night, can be detected with extremely high sensitivity. .
  • the absolute value of the value of the signal detected by contacting the ligand for the receptor with the G protein-coupled receptor-expressing PC12-derived cell used in the assay of the present invention becomes extremely large.
  • the ratio to the signal detected when not contacted with the ligand ie, the S / N ratio
  • a gene encoding a chimeric G protein G hysubunit consisting of each of Gq or Gs and a giant subunit or (2) By activating phospholipase C by coupling to receptor without receptor specificity like G15 and G16 By introducing a gene that encodes a G protein that transduces a signal, Gi-mediated signal transduction can be detected with extremely high sensitivity using an increase in the expression of a repo overnight gene as an index. became.
  • the presence or absence of signal transduction through any G protein can be determined by using one type of cell, without being restricted by the coupled G protein. Can be detected with extremely high sensitivity.
  • the following (1) to (4) can be carried out extremely easily and quickly by using the Atsey method of the present invention and the cells having the above-mentioned characteristics used in the Atsey.
  • G protein-coupled receptors such as histamine receptor, adrenergic receptor, and serotonin receptor are closely related to various diseases, and such G protein-coupled receptors are Many drugs have been developed and marketed to control the function of the receptor.
  • the implementation of the above (1) to (4) is a method for identifying and screening a drug targeting any G protein-coupled receptor, and is an essential step in drug development. That is, the method and cell of the present invention are essential and extremely useful in drug development.
  • the atsie method of the present invention and the above-mentioned features used in the atsee are provided.
  • the following (5) can be performed extremely simply and quickly.
  • G protein-coupled receptors are closely related to the onset of various diseases, the possibility of the above (5) will enable the development of pharmaceuticals for the treatment of various diseases.
  • the receptor as a target can be easily identified.

Abstract

La présente invention concerne un procédé de criblage du ligand de la protéine GR caractérisé en ce qu'il consiste à traiter à l'aide d'un échantillon pour essai des cellules PC12h présentant un gène codant pour une protéine GR étrangère et un gène rapporteur lié de manière exprimable au promoteur d'un gène apte à être soumis à une expression par un stimulus assisté d'une protéine G des cellules, et à comparer la dose d'expression du produit du gène rapporteur à un certain niveau en l'absence de l'échantillon pour essai.
PCT/JP2000/002416 1999-04-13 2000-04-13 Procede de criblage de ligand de proteine gr et procede d'expression du clonage de la proteine gr WO2000061745A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU36780/00A AU3678000A (en) 1999-04-13 2000-04-13 Method for screening g protein-coupled receptor ligand and method for expressioncloning g protein-coupled receptor

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP10563199 1999-04-13
JP11/105631 1999-04-13

Publications (1)

Publication Number Publication Date
WO2000061745A1 true WO2000061745A1 (fr) 2000-10-19

Family

ID=14412829

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2000/002416 WO2000061745A1 (fr) 1999-04-13 2000-04-13 Procede de criblage de ligand de proteine gr et procede d'expression du clonage de la proteine gr

Country Status (2)

Country Link
AU (1) AU3678000A (fr)
WO (1) WO2000061745A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112760342A (zh) * 2019-11-05 2021-05-07 珠海联邦制药股份有限公司 一种用于glp-1及其类似物活性测定的慢病毒载体及细胞株

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0542830A1 (fr) * 1990-08-07 1993-05-26 Sibia Neurosciences, Inc. Techniques et compositions de detection et d'evaluation de la transduction intracellulaire d'un signal extracellulaire
US5783402A (en) * 1991-10-01 1998-07-21 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of identifying ligands and anatgonists of G-protein coupled receptor

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0542830A1 (fr) * 1990-08-07 1993-05-26 Sibia Neurosciences, Inc. Techniques et compositions de detection et d'evaluation de la transduction intracellulaire d'un signal extracellulaire
US5783402A (en) * 1991-10-01 1998-07-21 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of identifying ligands and anatgonists of G-protein coupled receptor

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MURAYAMA, T. ET. AL.: "Pertussis toxin-insensitive effects of mastoparan, a wasp venom peptide, in PC12 cells", JOURNAL OF CELLULAR PHYSIOLOGY, vol. 169, no. 3, 1996, pages 448 - 454, XP002929574 *
SATO, M. ET. AL.: "Factors determining sepecificity of signal transduction by G-protein-coupled receptors", J. BIOL. CHEM., vol. 270, no. 25, 1995, pages 15269 - 15276, XP002929622 *
STABLES, J. ET. AL.: "Development of a dual glow-signal firely and Renilla luciferase assay reagent for the analysis of G-protein coupled receptor signalling", J. OF RECEPTOR & SIGNAL TRANSDUCTION RESEARCH, vol. 19, no. 1-4, January 1999 (1999-01-01), pages 395 - 410, XP002929573 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112760342A (zh) * 2019-11-05 2021-05-07 珠海联邦制药股份有限公司 一种用于glp-1及其类似物活性测定的慢病毒载体及细胞株
CN112760342B (zh) * 2019-11-05 2023-03-28 珠海联邦制药股份有限公司 一种用于glp-1及其类似物活性测定的慢病毒载体及细胞株

Also Published As

Publication number Publication date
AU3678000A (en) 2000-11-14

Similar Documents

Publication Publication Date Title
US5217867A (en) Receptors: their identification, characterization, preparation and use
JP4734498B2 (ja) タンパク質−タンパク質相互作用を解析する方法
US5262300A (en) Receptors: their identification, characterization, preparation and use
CN112210017B (zh) 一组焦亡执行者融合蛋白和基于荧光素酶片段互补分析技术的焦亡活性检测方法
Nguyen et al. Establishment of a NanoBiT-based cytosolic Ca2+ sensor by optimizing calmodulin-binding motif and protein expression levels
CA2627022A1 (fr) Detection de complexes enzymatiques intracellulaires
US6383761B2 (en) Methods and compositions for identifying modulators of G-protein-coupled receptors
EP2823044B1 (fr) Protéine de fusion span-kinase de membrane et utilisations associées
JP3643288B2 (ja) Ｇ蛋白質共役型受容体リガンドのスクリーニング法並びにｇ蛋白質共役型受容体のエクスプレッションクローニング法
EP2483696B1 (fr) Peptide naturel et ses dérivés en tant que modulateurs du GPCR GPR1 et leurs utilisations
WO2000061745A1 (fr) Procede de criblage de ligand de proteine gr et procede d'expression du clonage de la proteine gr
WO2007032793A1 (fr) Reseau multiplex utile pour le dosage d'interaction proteine-proteine
US20210340526A1 (en) Novel method for transducing protein-protein interactions
Jain et al. The Adenosine A1 and A2A receptor C-Termini are necessary for activation but not the specificity of downstream signaling
JP2005118050A (ja) Ｇ蛋白質共役型受容体リガンドのスクリーニング法並びにｇ蛋白質共役型受容体のエクスプレッションクローニング法
Lu et al. Quantitative analysis of G-protein-coupled receptor internalization using DnaE intein-based assay
AU778648B2 (en) Cells and assays
JP4768946B2 (ja) ヒトｇタンパク質共役型受容体の内因性および非内因性型
JP2002045188A (ja) ダイオキシンレセプター遺伝子およびその利用
EP1544307A1 (fr) Recepteur chimerique LAC9 et ses utilisations
JP2011147461A (ja) ヒトｇタンパク質共役型受容体の内因性および非内因性型
US20030148390A1 (en) Dose response-based methods for identifying receptors having alterations in signaling
JP2003525018A6 (ja) 非内在性の構成的に活性化されるヒトｇタンパク質共役型受容体
JP2004121254A (ja) 抗血小板剤スクリーニング方法

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase