WO2000061745A1

WO2000061745A1 - Method for screening g protein-coupled receptor ligand and method for expression cloning g protein-coupled receptor

Info

Publication number: WO2000061745A1
Application number: PCT/JP2000/002416
Authority: WO
Inventors: Takayuki Naito; Yutaka Saito; Mitsuhiro Morita
Original assignee: Japan Tobacco Inc.
Priority date: 1999-04-13
Filing date: 2000-04-13
Publication date: 2000-10-19
Also published as: AU3678000A

Abstract

A method for screening a G protein-coupled receptor ligand characterized by comprising treating with a test sample PC12h cells having a gene encoding a foreign G protein-coupled receptor and a reporter gene bonded in an expressible manner to the promoter of a gene capable of undergoing expression by a stimulus mediated by G protein of the cells, and comparing the expression dose of the reporter gene product with a level in the absence of the test sample.

Description

Details Ϊ

Screening method of G protein-coupled receptor ligand and expression cloning method of G protein-coupled receptor

The present invention provides (1) a method wherein the desired substance is an agonist of a G protein-coupled receptor,

(2) a G protein-coupled receptor ligand such as agonist, and gonist, and / or an agonist of the agonist. (3) PC12-derived cells used in any of the methods, and (4) a receptor (eg, a G protein-coupled receptor) that interacts with a substance. The present invention relates to a method for identification by an expression cloning method. Background art

The G protein-coupled receptor is a receptor on the cell membrane, has seven transmembrane sites, and acts as a ligand via a GTP (guanosine 5'-triphosphate) binding regulatory protein (G protein). Of information to the effector system.

G protein is a trimer consisting of three subunits, G, G, Go, Gq, etc., depending on the type of G subunit, and has receptor specificity (G The types of protein receptors) and effector systems (enzymes and ion channels) are different.

For example, glucagon-like receptor 1 and / or 2-adrenergic receptor cooperate with Gs to promote the effector system adenylate cyclase system and increase cyclic AMP (cAMP). The adrenergic receptor also couples with G i to suppress the adenylate cyclase system and reduce cAMP. HI histamine Conjugation with Gq promotes the effector system, phospholipase C system, to increase diacylglycerol and inositol triphosphate, and to increase intracellular Ca ²⁺ . The main types of effector systems are the adenylate cyclase system, the phospholipase C system, and the cGMP phosphodiesterase system.

G protein has GDP (guanosine 5, monophosphate) bound to the subunit and is associated with the? Subunit and the asubunit. The state in which 、, 及び and GDP are associated is inactive, and when a ligand binds to the receptor, GDP bound to に is replaced by GTP, and ひ -GTP with GTP bound to サブ subunits. , Β-乖. GTP and / or -G act on the effector system to transmit signals. During this time, when GTP is decomposed into GDP by the GTPase activity of the subunit, the GDP leaves the effector system and associates with // and becomes inactive again. By repeating this reaction, information is amplified and transmitted.

The biodistribution of G protein-coupled receptors is often localized in specific organs, but G proteins are widely distributed in living organisms. And, as mentioned above, the G protein triggers a series of intracellular phosphorylation reactions through the G protein-coupled receptor, and regulates a wide range of cell and organ functions, from transcriptional regulation at the gene level to muscle contraction. Has been implemented.

For example, 11 adrenergic receptor is localized in the heart, adipose tissue, cerebral cortex, etc., and Gs promotes the adenylate cyclase system, resulting in increased heart rate, increased cardiac contractility, and lipolysis. .

Thus, the signal transduction system controlled by the G-coupled receptor / G protein is a mechanism essential for the control of the physiological functions of organisms. In other words, the signal transduction system is involved in various diseases. It is widely involved in the onset. Therefore, if a G protein-coupled receptor involved in the onset of a certain disease is identified, it is necessary to develop drugs (eg, agonist, angonist, agonist inhibitor) that regulate the physiological function of the receptor. By The drug makes it possible to treat the disease.

On the other hand, recently, a large number of novel G protein-coupled receptors (orphan G protein-coupled receptors) have been isolated (for example, see JP-A-9-12688 and JP-A-9-151717). 95, etc.). However, most of them do not have a ligand that interacts with the receptor, that is, the receptor for the protein G protein. As described above, since the G protein-coupled receptor is deeply involved in the control of the physiological functions of living organisms and the onset of various diseases, clarifying the physiological functions of the receptors is important for the onset of various diseases. It is extremely important in elucidating the cause.

The most important thing to elucidate the physiological function of G protein-coupled receptor is to identify the ligand of the receptor, that is, to identify the agonist of the receptor. It is carried out.

Identify ligands of G protein-coupled receptors for which ligands have not been identified (ie, orphan G protein-coupled receptors) (ie, agonists and angonists that interact with the receptor) To do so, it is necessary to screen a large number of tens of thousands of candidate substances by tests, and an Atsey system capable of performing the screening rapidly is required.

In addition, the Atsusei quantitatively detects the presence or absence of an interaction between a test substance and the receptor, and quantitatively detects an increase or a decrease in activation or suppression of a second messenger induced through a G protein to which the receptor is coupled. Therefore, there is a need for an access method that can detect the increase or decrease of the message with high sensitivity.

The following method is known as a conventional access method.

That is, a test sample (test substance) or a known agonist and a test sample are allowed to act on cells expressing the desired G protein-coupled receptor, and a second messenger generated by the action of the effector system, such as Gs or Gi-coupled receptor In the case of the body, the amount of cAMP linked to the change in the activity of adenylate cyclase, and in the case of the Gq-coupled receptor, the concentration of inositol 3-phosphate ゃ Ca ²⁺ linked to the change in the activity of phospholipase C Measurement techniques are widely used.

However, these measurement methods require extremely complicated operations, and it is extremely difficult to quickly evaluate a large amount of test substances. In addition, these methods require that the second messenger to be measured be selected depending on the type of G protein to which the target receptor is coupled. Therefore, when the G protein coupled to the receptor is unknown, it is necessary to perform a plurality of types of assays in each assay system capable of measuring a message via each of Gs, Gi, and Gq.

Furthermore, for the receptor that is coupled to Gi, the secondary message induced by coupling of the receptor to Gi is the decrease in cAMP due to suppression of adenylate cyclase. In order to capture cAMP, it is necessary to increase the amount of cAMP in advance with a reagent (such as forskolin) that activates Gs and increase cAMP, and to evaluate the amount of cAMP decrease by the test substance with respect to the increase in cAMP, which is extremely complicated. Needed operation.

Recently, as a method for rapidly testing a large number of test substances, an atsey system using a repo overnight gene (Repo overnight at Gene Atsey) has been developed (International Patent Application Publication W092 / 02639, And Tokuyohei 6-502527). Among them, an excellent method is to introduce a reporter gene containing a CRE (cAMP response element) as a promoter into a cell and to introduce a reporter gene product that changes when a test substance is brought into contact with the cell. Quantification of Gs or Gi signal transduction, or the use of a reporter gene containing SRE (serum response element) as a promoter all at once. There is a method of detecting the presence or absence.

Although this method has made it possible to process relatively large amounts of samples, for example, in a conventional Gq-based signal transduction evaluation system using SRE, the reporter gene product induced by contacting a test substance with cells was The degree of the increase is about 5 to 10 times that of the case where the test substance is not brought into contact, and it is judged that the test substance interacts with the receptor. Too low to determine.

In addition, as a method for measuring the increase or decrease of intracellular Ca ²⁺ concentration, which is one of the second messengers, a method capable of measuring a large amount of a test substance in a short time has recently been developed. However, also in this method, the signal ratio (S / N ratio) detected before and after stimulation with the test substance is as low as about 5 times.

In order to miniaturize an Atssey system that can clearly determine the presence or absence of an interaction of a test substance with a receptor and rapidly screen a large number of test substances, a larger signal per cell must be induced, It is necessary to develop an Atssey system that can obtain signal induction at a high S / N ratio.

In addition, the Atsushi system using the increase / decrease of intracellular Ca ²⁺ as an index still has a problem that only the presence or absence of signal transmission via Gq can be measured.

Similarly, also in the reporter gene atsey system described above, it is necessary to select a repo all at once according to the type of G protein to which the target receptor is coupled, and also, it is necessary to select a receptor coupled to Gi. In the search for ligand, the presence or absence of interaction between the test substance and the receptor must be evaluated using the degree of suppression of cAMP increase relative to cAMP increase caused by Gs-mediated signal transmission as an index. None of the problems remained.

Therefore, in order to identify the ligand of the desired G protein-coupled receptor (the substance that interacts with the receptor), the secondary signal induced by the signal transmitted by the interaction between the test substance and the receptor is used. The development of an assay method that can detect a message as a large absolute value and with high sensitivity (high S / N ratio) and rapidly screen a large number of test substances is eagerly desired. Furthermore, there is a need for the establishment of an Atssey system that can simultaneously detect the presence or absence of signal transmission via any of Gs, Gi, and Gq in one type of Atssey system. Open invention A first object of the present invention is to provide an agonist for a G protein-coupled receptor,

It is the establishment of an Atsushi system that can detect the change in signal when a nyst or agonist action inhibitor is acted on as a large absolute value, with a high S / N ratio, and with a large signal absolute value.

The second objective is to establish an Atssey system that can detect the presence or absence of signal transduction via one of Gs, Gi, and Gq in one type of cell regardless of the type of G protein coupled to the receptor.

The third purpose is not only signals that act on Gs or Gq-mediated effector systems but also signals that act on Gi-mediated effector systems (signals that suppress cAMP production). This is the establishment of an Atsushi system that can be detected as signal enhancement.

The fourth object is to use the above-mentioned Atsey method to (1) determine whether the desired substance is an agonist, an antagonist, or a substance that inhibits the agonist action of the agonist of the G protein-coupled receptor. And (2) screening for a agonist, an engonist, and / or a substance that inhibits the agonist action of the agonist, which is a ligand of the G protein-coupled receptor, in a rapid and simple manner. It is to be.

A fifth object is to provide a method for easily identifying a receptor (for example, a G protein-coupled receptor) that interacts with a certain substance using the above-mentioned Atsey method, using an expression cloning method. is there.

In order to achieve the above object, the present inventors have enthusiastically described a host cell, a promoter region, and a combination thereof used in a method for identifying a ligand of a G protein receptor by an Atsey method using a repo sequence gene. As a result of the investigation, it was found that when PC12h cells were used as host cells expressing the desired G protein-coupled receptor, the expression of the reporter gene product was extremely remarkably observed by addition of agonist. In addition, by using the zif268 promoter region (hereinafter sometimes simply referred to as zif268) as the promoter region for controlling the expression of the reporter gene, signaling of both Gs and Gq can be considered as an increase in the expression of the reporter gene product. It was discovered that detection was possible with the highest sensitivity.

Furthermore, when PC12-derived cells (particularly, PC12h cells) are used as host cells and zif268 promoter region is used as a repo overnight-regulatory promoter, gene signaling of both Gs and Gq is extremely sensitive. It was found that it could be detected by.

In addition, the host cell may have any of the following genes:

(a) a gene encoding a chimeric G protein Ga subunit in which a part of the C-terminal amino acid sequence of Ghiq is replaced by a part of the C-terminal amino acid sequence of Ghii;

(b) a gene encoding a chimeric G protein G subunit obtained by substituting a part of the C terminal amino acid sequence of G column with a part of the C terminal amino acid sequence of G column; or

(c) A gene encoding a G protein that couples to a receptor without receptor specificity and transduces a signal by activating phospholipase C. It has been found that, by introducing, the signal transduction through Gi can be detected with extremely high sensitivity using an increase in the expression of the repo overnight gene as an index.

Based on the above-mentioned novel findings, it is possible to detect signal transmission via any G protein of Gs, Gi and Gq with high sensitivity, and to interact with a desired G protein-coupled receptor (agonist). The present invention has led to the invention of an Atsey method capable of quickly and easily identifying an angonist or a substance having an activity of inhibiting the agonist action of the agonist.

Using the Atsey method of the present invention, (1) determining whether a substance is an agonist of a desired G protein-coupled receptor, and (2) determining an agonist of a desired G protein-coupled receptor A rapid and simple screening of a large number of test substances to identify a substance having an activity of inhibiting the agonist action of the receptor and / or the agonist action of the agonist, (3) expression cleaning Rapid and simple screening of a large number of test proteins (cDNA and cDNA libraries) to identify (cloning) receptors that interact with a substance (eg, G-protein type receptors) , Can achieve.

That is, the present invention is a method or a cell as described in the following <1> to <22>. <1> A method for determining whether or not a substance is an agonist of a desired G protein-coupled receptor, comprising the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a reporter gene operably linked to one region of a promoter of a gene whose expression is induced by stimulation through a G protein;

Contacting the substance with a sample consisting of a constant number of PC12-derived cells having

(b) a detectable signal produced by the repo gene expressed in each cell in the sample that has been contacted with the substance, and the repo gene expressed in each cell of the sample that has not been contacted with the substance. Quantitatively determining each of the detectable signals produced by the gene;

(c) comparing the amounts of the respective signals determined in step (b).

<2> A method for screening a substance for identifying an agonist of a desired G protein-coupled receptor, the method comprising the following steps ( _a ) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein; Preparing a plurality of samples consisting of a constant number of PC12-derived cells having: and contacting each of the samples with a different substance;

(b) contacting each sample contacted with the substance in step (a) with a detectable signal generated by the repo-all-over-gene expressed in each cell in the sample, and Quantitatively determining each of the detectable signals produced by the repo-gene expressed in each cell of the unsampled sample; and

(c) comparing the amounts of the respective signals determined in step (b).

<3> Whether the substance is an agonist of the desired G protein-coupled receptor or whether it is an inhibitor of the agonist action of the agonist of the G protein-coupled receptor A method for determining, characterized by including the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a sample consisting of a constant number of PC12-derived cells having a repo overnight gene operably linked to a promoter overnight region of a gene whose expression is induced by stimulation through a G protein; Contacting the body agonist and the substance;

(c) comparing the amounts of the respective signals determined in step (b).

4> A method for screening a substance for identifying an agonist of a desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor, the method comprising: ) Through (c). (a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a promoter of a gene whose expression is induced by stimulation through a G protein; a reporter gene operably linked to a region of interest; a plurality of samples consisting of a constant number of PC12-derived cells having: Contacting each with a substance different from the agonist of the G protein receptor;

(b) contacting each sample contacted with the substance in step (a) with a detectable signal generated by the repo-all-over-gene expressed in each cell in the sample, and Quantitatively determining each of the detectable signals generated by said repo overnight gene expressed in each of the vesicles of said unsampled sample; and

(c) comparing the amounts of the respective signals determined in step (b).

Ku 5> the promoter evening one region, characterized in that it is either a promoter evening one region or _c -f _os promoter Isseki a region including the zif268 (EGR-1) promoter region, SRE and CRE said <1> The method according to any one of <2>.

<6> The method according to any one of <1> to <4> above, wherein the overnight promoter region is a zif268 (EGR-1) promoter overnight region.

<7> The PC12-derived cell further comprises an exogenous gene of any one of the following (a) to (c): The method described in:

(a) a gene encoding a chimeric G protein G subunit in which a portion of the C-terminal amino acid sequence of Ghi q is substituted with a portion of the C-terminal amino acid sequence of Ghi;

(b) a gene encoding a chimeric G protein G subunit in which a part of the C terminal amino acid sequence of Gs is replaced by a part of the C terminal amino acid sequence of Go: i; or

(c) Activate phospholipase C by conjugated to the receptor without receptor specificity A gene _c encoding a G protein that transmits a signal upon sexualization <8> The method according to the above 7>, wherein the G protein according to the above (c) is G16 or G15.

<9> PC12-derived cells having at least the following exogenous genes (1) and (2):

(1) a gene encoding a desired G protein-coupled receptor; and

(2) A reporter gene operably linked to a promoter overnight region of a gene whose expression is induced by stimulation through a G protein.

The promoter region is any one of a zif268 promoter region, a promoter region including an SRE and a CRE, and a C-fos promoter region. A cell as described.

<11> The cell according to <9>, wherein the promoter region is a zif268 promoter region.

<12> The PC12-derived cell further has any one of the following exogenous genes (a) to (c): Described cells:

(a) a gene encoding a chimeric G protein G subunit in which a part of the C-terminal amino acid sequence of G aq is replaced with a part of the C-terminal amino acid sequence of G o: i;

(b) a gene encoding a chimeric G protein G subunit obtained by substituting a part of the C terminal amino acid sequence of G subunit with a part of the C terminal amino acid sequence of G subunit; or

(c) a gene encoding a G protein that couples to a receptor without receptor specificity and that transmits a signal by activating phospholipase C c> 13> the above-mentioned (c) The cell according to <12>, wherein the G protein is G16 or G15.

<14> A method for identifying a receptor that interacts with a substance, comprising: A method characterized by comprising the step of (d) wherein the substance acts as an aco'nist on the receptor.

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and

(2) A reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein. Contacting the substance (where the cells in each of the samples have the gene of (1) different from each other for each sample);

(b) for each sample contacted with the substance in step (a), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals produced by the reporter gene expressed in each cell of the respective sample not contacted;

(c) comparing the amount of signal for each sample determined in step (b) with each other, and selecting one or more samples from the plurality of samples tested in step (a); and

(d) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (a) of the cells in the selected sample;

15> A method for identifying a receptor that interacts with a substance, comprising the following steps (a) to (g) (where the substance is Acts as an agonist.):

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and

(2) a repo overnight gene operably linked to a promoter overnight region of a gene whose expression is induced by stimulation through a G protein; Providing a plurality of samples comprising PC12-derived cells having the following steps: contacting each of the samples with the substance (where the cells in each of the samples are different from each other for each sample; Gene));

(b) for each sample contacted with the substance in step (a), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Quantitatively determining each of the detectable signals produced by said reporter gene expressed in each cell of said respective sample;

(c) comparing the amount of signal for each sample determined in step (b) with each other and selecting one or more samples from the plurality of samples tested in step (a);

(d) At least the following exogenous genes (1) and (2):

(1) One or more genes encoding the protein described in (1) of step (a), which are exogenous genes of the cells in the sample selected in step (c); and

(2) preparing a plurality of samples consisting of PC12-derived cells having a repo overnight gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein; Contacting the substance with each of the above (where the cells in each of the samples have the gene of (1) different from each other for each sample);

(e) for each sample contacted with the substance in step (d), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Determining quantitatively each of the detectable signals produced by the repo-gene expressed in each cell of the respective sample;

(f) comparing the amount of signal for each of the samples determined in step (e) with each other; Selecting one or more of said plurality of samples tested in step (d); and

(g) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (d) of the cells in the selected sample;

16> The method is characterized in that the method includes one or more times of the same operation consisting of the steps (d) to (f) between the step (f) and the step (g), if desired. <15> The method according to <15>.

Ku 17> the promoter region, _Z if268 (EGR-1) promoter region, rather the which is characterized in that either a promoter evening one region or c- f _os promoter evening one region including the SRE and CRE 14 > The method according to any one of <16>.

<18> The method according to any one of <14> to <16>, wherein the promoter region is a zif268 promoter region.

19> wherein the (12) -derived cell further has an exogenous gene of any one of the following (a) to (c): Described method:

(a) a gene encoding a chimeric G protein G subunit obtained by substituting a part of the C-terminal amino acid sequence of G subunit Q with a part of the C-terminal amino acid sequence of G subunit;

(b) a gene encoding a chimeric G protein G subunit obtained by substituting a part of the C-terminal amino acid sequence of G subunit with a part of the C-terminal amino acid sequence of G subunit; or

(c) a gene encoding a G protein that couples to a receptor without receptor specificity and transduces a signal by activating phospholipase C. The method according to <19>, wherein the G protein is G15 or G16.

21> One or more genes encoding the protein are cDNA or cDNA live The method according to any one of <14> to <20>, wherein the receptor is a G protein-coupled receptor. 21. The method according to any one of the above 21>.

Hereinafter, the present invention will be described in more detail by clarifying the meanings of phrases used in the present invention and specific embodiments of the present invention.

1. "PC12-derived cells"

The `` PC12-derived cell '' in the present invention is a rat adrenal pheochromocytoma-derived PC12 cell line (ATCC CRL-1721; Pro Natl. Acad. Sci. USA., Vol. 73, p. 2424-2426, 1976; Science, Vol. 229, p. 393-395, 1985; EMBO J., Vol. 2, p. 643-648, 198 3) or any cell line subcloned from the PC12 cell line. You.

Preferably, the subcloned cells have the following properties.

That is, in the cells, (1) a gene encoding a desired G protein-coupled receptor, and (2) a promoter / region of a gene whose expression is induced by stimulation through a G protein described later. When the G protein-coupled receptor ligand is brought into contact with a recombinant cell obtained by exogenously introducing an “expressably linked reporter gene”, the reporter gene is induced to be expressed. This is a cell in which the amount of the product is higher than the amount of the reporter detected using the PC12 cell line as a host cell.

Preferred examples of the subcloned cells include the PC12h cell line (Brain Research, 222, p.225-233, 1981) and various cells subcloned from the PC12h cell line. .

2. “G protein-coupled receptor” and “gene encoding G protein-coupled receptor” The “G protein-coupled receptor” in the present invention is a receptor existing on the cell membrane, and is a GTP (guanosine). 5, -trinic acid) A function to transmit information on ligands interacting with the receptor to a series of effectors via a regulatory protein (G protein) for binding. Means a protein having Most G protein-coupled receptors identified so far have a structure that penetrates the cell membrane seven times.

The G protein-coupled receptor in the present invention is an endogenous receptor naturally expressed in a cell or a receptor expressed in a cell by introducing a gene encoding a desired G protein-coupled receptor into the cell. Mean any of the body.

The “G protein-coupled receptor” in the present invention includes both known receptors and unidentified receptors.

Examples of known G protein-coupled receptors include those whose structure and function have already been elucidated (for example, para-adrenergic receptor,? -Adrenergic receptor, dopamine receptor, muscarinic acetylcholine receptor, Serotonin receptor, histamine receptor, evening kikinin receptor, glutamate receptor, endothelin receptor, platelet activator (PAF) receptor, thrombin receptor, FSH receptor, etc., and their structures are known The ligand and / or receptor whose physiological function is unknown (for example, various orphan G protein-coupled receptors) can be mentioned.

3. "G protein coupled receptor ligand"

As used herein, "G protein-coupled receptor ligand" means any agonist that interacts with a G protein-coupled receptor or any agonist of the receptor.

4. "Chimeric G Protein G Subunit"

The “chimeric G protein G subunit” in the present invention refers to a subunit of a certain G protein subunit (for example, Grq or Gas) obtained by substituting a partial subunit of a different type of G protein. It means a G protein subunit having a structure in which a part of the amino acid sequence of (for example, G subunit i) is substituted.

In the present invention, the “chimeric G protein G qi” refers to a protein in which a part of the C-terminal amino acid sequence of Ghi q (a sub-unit of the G q protein) is replaced with a part of the C-terminal amino acid sequence of Ghi i. Means a chimeric G protein subunit having a modified structure. Also, "Chimeric G protein Gsi" is a chimera having a structure in which part of the C-terminal amino acid sequence of Gas (subunit of Gs protein) is replaced with the C-terminal amino acid sequence of Gai. Means G protein subunit.

G proteins G shed G protein G shed substituted with § amino acid C-terminal of the i ₂ Tahi q / non i ₂ chimeric G protein corresponding to the C-terminal amino acids of q is conjugated with G i coupled receptors G q signaling system activating, arrangement Nihi i ₂ subunit C-terminal amino acid sequence # 3 of glycine Rukoto believed to contribute to the conversion of receptor specificity knowledge of (Nature, Vol.363, p.274-276, 1993).

Therefore, it is particularly desirable that the part of the C-terminal amino acid sequence of G-q to be substituted be in a range including the glycine at position 3. The number of amino acids to be substituted is at least about 3 to about 23 amino acids, preferably about 3 to about 11 amino acids, and more preferably about 4 to about 9 amino acids.

Ghi q and Ghii each constitute a group of families. These families have different organizational distributions by type.

For example, G i family members Hi _{2 and} Hi ₃ are widely distributed in tissues, while Hi and Hi ₂ are mainly expressed in brain and nerve tissues, respectively. On the other hand, aq and h11 of the Ghi q family are widely distributed, while h14 is mainly expressed in lung, kidney and liver tissues. As Ghi q and Ghi i constituting the above-mentioned “chimeric G protein G hysubunit”, any Ghi q and Ghi i belonging to each family may be used, and the tissue in which the receptor is expressed Can be selected according to Preferably, it is widely distributed to tissues. In the present invention, the chimeric G protein q / Go: i subunit is preferably a chimeric G protein protein subunit consisting of G aq and Ghi i ₂ .

As in the case of Ghq described above, Ghs also has at least about 3 to about 23, preferably about 3 to about 11, and more preferably about 3 to about 23 C-terminal amino acid sequences to be substituted. Four to about nine amino acids may be substituted with the corresponding amino acid sequence at the C-terminal of G protein Ghi. The configuration of the chimeric G protein G subunit is not limited to the above.

5. "A G protein that couples to a receptor without receptor specificity and transduces a signal by activating phospholipase C"

The G protein of the present invention has the ability to couple to any G protein-coupled receptor, and converts the signal received by the receptor by the coupling into a signal transmission pathway through G q, that is, a phosphorivator. It is a G protein that has the ability to transmit further downstream in the form of activation of ZeC.

Preferred embodiments include, for example, G15 and G16 (J. Biol. Chem., Vol. 270, p. 16175-16180, 1995), but are not limited thereto.

6. “Promoter region of gene whose expression is induced by stimulation through G protein” The promoter region of the present invention includes the promoter region of the immediate-early gene (i-throat ediate-early gene). Can be

Examples of the promoter of the immediate-early gene used in the present invention include a c-fos promoter motor region and a zif268 promoter overnight region (Pro Natl. Acad. Sci. USA., Vo 1.86, p.377-381, 1989; also referred to as "EGR-1", "NGF1-A", "Krox24", "Tis8" or "cef5"). A particularly preferred embodiment includes the zif268 (EGR-1) promoter region. The promoter used in the present invention also includes a counterpart of any animal species of the promoter.

As used herein, the term "promoter region" refers to an arbitrary region containing a minimum nucleotide sequence essential for expressing a promoter activity. For example, part or all of a region of about 500 bp to about 2 kb upstream of the transcription site of the gene can be used.

Further, examples of the title promoter region in the present invention include a promoter region having a transcription factor binding sequence SRE (serum response element) and / or CRE (cAMP response element) upstream of the minimal promoter region. 7. "Repo One Night One Gene"

The “reporter gene” in the present invention means a gene encoding a reporter protein that emits detectable fluorescence. Specifically, for example, luciferase derived from fireflies or Mississippi or GFP (Green Fluorescence Protein) derived from jellyfish can be mentioned. Further, for example, a gene encoding 5-galactosidase, a gene encoding chloramphenic acid acetyltransferase, and a gene encoding lactamase can be mentioned.

8. "Agonist action inhibitory substance" / "A substance that inhibits agonist action of agonist" The termed substance in the present invention means a substance which acts directly on agonist to inhibit or lose the activity of agonist. It means antibodies against agonists.

9. "Repo One Night One Gene Atsushi"

In the invention, "reporter gene assay" means the following method.

A test substance is brought into contact with the cells according to <9> to <13>, which are a part of the present invention, and the amount of repo overnight protein expressed depending on the action of the compound is determined. In this method, the presence or absence of interaction of the test substance with a G protein-coupled receptor is analyzed by indirectly measuring the amount of emitted fluorescence (for example, see US Pat. No. 5,436, No. 128 and U.S. Pat. No. 5,401,629).

In addition, the repo overnight can be performed manually, but what is called High Throughput Screening (Tissue Culture Engineering, Vol. 23, No. .13, p.521-524; U.S. Pat. No. 5,670,113) can be carried out more quickly and conveniently.

10. "Material"

A “substance” identified or screened by the method of the present invention It refers to existing natural substances (proteins, antibodies, peptides, natural compounds, etc.) or any artificially prepared substances.

Specifically, for example, any “compound” chemically synthesized can be mentioned. The type and molecular weight of the compound are not particularly limited. It has a molecular weight of from about 100 to about 2000, and more typically from about 100 to about 1000.

When the substance is a protein, antibody or peptide, it also includes those isolated from living tissue cells and those prepared by genetic recombination or chemical synthesis. Furthermore, those chemical modifications are also included.

Examples of the peptide include a peptide consisting of about 3 to about 500 amino acids, preferably about 3 to about 300 amino acids, and more preferably about 3 to about 200 amino acids.

Hereinafter, the meaning of various experimental tools used in the present invention and / or general methods for their preparation will be exemplified. However, it goes without saying that the tools used in the present invention are not limited to those prepared by the methods exemplified below.

(1) Cloning and isolation of various genes

Various genes (eg, a gene encoding a desired G protein-coupled receptor, a gene encoding a desired protein, a reporter gene, a promoter region, etc.) used in the present invention can be obtained by any method. There may be. In addition, in the acquisition, known nucleotide sequence information can be used, or a completely new cloning can be performed.

For example, complementary DNA (cDNA) prepared from mRNA, DNA prepared from genomic DNA, DNA obtained by chemical synthesis, DNA obtained by amplifying the RNA or DNA by PCR as a Combining methods appropriately It also encompasses all of the DNAs that have been constructed.

The DNA encoding a protein used in the present invention can be obtained by a method of cloning cDNA from mRNA encoding the protein according to a conventional method, a method of isolating genomic DNA and splicing it, and a method of chemical synthesis. Etc.

For example, the following method is exemplified as a method for cloning cDNA from mRNA encoding the protein.

First, mRNA encoding the protein is prepared from the above-mentioned tissues or cells that express and produce the desired protein. For preparation of mRNA, total RNA prepared by a known method such as the guanidine thiosocyanate method (Chirgwin et al., Biochemistry, Vol. 18, p. 5294, 1979), the hot phenol method or the AGP C method is oligo- d T) It can be carried out by affinity chromatography with cellulose or poly-U-Sepharose.

Then, the obtained mRNA is used as type 、, and a known method such as, for example, using reverse transcriptase, for example, the method of Okayama et al. (Mol. Cell. Biol., Vol. 2, p. 161, 1982; Mol. Ce 11 Biol., Vol. 3, p. 280, 1983) and the method of Hoffman et al. (Gene, Vol. 25, p. 263, 1983) synthesize cDNA strands and convert them into double-stranded cDNAs. Is converted. This cDNA is incorporated into a plasmid vector, phage vector or cosmid vector, and transformed into Escherichia coli, or after in vitro packaging, transfected into Escherichia coli to produce a cDNA library.

The plasmid vector used here is not particularly limited as long as it can be replicated and maintained in the host, and any phage vector used can be used as long as it can be propagated in the host. Examples of a cloning vector used in a conventional manner include pUC19, human gtlO, and human gtll. However, when subjected to immunological screening described below, a promoter capable of expressing the gene encoding the protein in the host is used. It is preferable that the vector is a one-time vector.

Examples of a method for incorporating cDNA into a plasmid include the method described in Maniatis et al. (Molecular Cloning, A Laooratory Manual, second edition, Cold Spring Harbor Laboratory, p. 1.53, 1989). As a method of incorporating cDNA into a phage vector, the method of Hyunh et al. (DNA Cloning, a practical approach, Vol. 1, p. 49, 1985) and the like can be mentioned. For convenience, a commercially available closing kit (for example, Takara Shuzo) can be used. The recombinant plasmid vector obtained in this manner is introduced into a suitable host such as a prokaryotic cell (for example, E. coli: HB101, DH5 or MC1061 / P3).

Methods for introducing a plasmid into a host include a calcium chloride method, a calcium chloride / rubidium chloride method, and a Lipofi method described in (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, Vol. 1.74, 1989). Examples include the extrusion method and the elect opening method. Examples of a method for introducing the phage vector into a host include a method in which phage DNA is packaged in vitro and then introduced into a grown host. In vitro packaging can be easily performed by using a commercially available in vitro packaging kit (eg, manufactured by Stratagene, Amersham, etc.).

On the other hand, for example, when obtaining a gene (cDNA) encoding a protein whose expression is enhanced in response to a certain kind of stimulus (for example, stimulus by a cytokine), mRNA derived from the cell to which the stimulus is given is used. Using two cDNA libraries, a cDNA library (tester cDNA library) based on DNA and a cDNA library (dri ver cDNA library) based on mRNA from unstimulated cells, for example, the inhibitory PCR effect Suc. (Supression subtract hybridization (S SH)) using the Subtraction Subtraction Neutralization Method (Nucleic Acids Res., Vol. 23, p. 1087-1088, 1995) (Proc. Natl. Acad. Sci. USA, Vol. 93, p. 6025-6030, 1996; Anal. Biochem., Vol. 240, p. 90-97, 1996). For preparing a cDNA library required for subtraction cloning, a commercially available kit, for example, a PCR-Select Subtraction Kit (manufactured by CL0NTECH, catalog number: K1804-1) can be used. The experimental operation can be performed according to the experimental operation manual attached to the kit.

An example of a specific experimental operation is outlined below.

From each of cells stimulated with an appropriate stimulant and unstimulated cells, polyA + RNA was prepared in the same manner as previously reported (Nucleic Acids Res., Vol. 26, No. 4, p. 911-918, 1998). I do. Next, cDNA is prepared from each polyANA sample using a reverse transcriptase according to a conventional method. CDNA prepared from stimulated cells is used as tester cDNA, and cMA from unstimulated cells is used as driver cDNA. According to the experimental report described in the above-mentioned report and the commercially available kit, the driver cDNA is added to the test DNA to perform subtraction. The efficiency of the subtraction is monitored by adding a small amount of appropriate exogenous DNA to the cDNA as a control. After the subtraction, the exogenous DNA is concentrated. The subtracted cDNA is cloned into an appropriate plasmid expression vector according to a conventional method to prepare a plasmid library. As described previously, a large number of colonies of the library are screened by the differential hybridization method (Nucleic Acids Res., Vo 1.26, No. 4, p. 911-918, 1998; Clinical Immunity, Vol. 29). , No. Suppl. 17, p. 451-459, 1997). Here, as the hybridization probe, those obtained by radioactively labeling each of the above-mentioned TES cDNA and driver cDNA can be used. The clone containing the target DNA and the clone containing the exogenous DNA can be distinguished by hybridizing the exogenous DNA with a replicant filter. A radiolabeled driver—A clone that produces a stronger signal with a radiolabeled tester cDNA probe than with a cDNA probe can be identified, and the desired cDNA or cDNA fragment can be obtained. In addition, the cDNA encoding any protein of the present invention can be isolated by using other general cDNA screening methods.

For example, a commercially available or known cDNA or cDNA fragment Amino acid sequence and nucleotide sequence also encodes its own isolated protein based, or separately oligonucleotides corresponding to the chemically synthesized amino acid sequence of the protein ³² Labeled with P and used as a probe, the well-known colony hybridization method (Crunstein et al., Proc. Natl. Acid. Sci. USA, Vol. 72, p. 3961, 1975) or plaque hybridization. It can be obtained by screening a commercially available or originally prepared cDNA library by the Chillon method (Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, p. 2.108, 1989). . Furthermore, a pair of PCR primers is prepared based on the nucleotide sequence of the cDNA or cDNA fragment encoding the protein, and a cDNA encoding the protein is obtained by PCR using the full-length cDNA library as a type III primer and the primers. A method for amplifying MA can be mentioned.

When a cDNA library prepared using an expression vector capable of expressing cDNA is used, a target clone may be selected by utilizing an antigen-antibody reaction using an antibody reactive with the protein. it can. When a large number of clones are processed, it is preferable to use a screening method using the PCR method.

The DNA sequence obtained in this manner is based on the Maxam-Gilbert method (Maxam

Natl. Acad. Sci. USA., Vol. 74, p. 560, 1977) or a method of terminating dideoxynucleotide synthesis using F13 M13 (Sanger et al., Proc.

Natl. Acad. Sci. USA., Vol. 74, p. 5463-5467, 1977). When a commercially available DNA sequencer is used, the nucleotide sequence can be easily determined.

The gene encoding any protein in the present invention can be obtained by cutting out all or a part of the clone obtained as described above using restriction enzymes or the like. it can.

In addition, examples of a method for preparing a gene encoding a desired protein by isolating it from a genomic DNA derived from a cell that expresses the protein include the following methods.

The cells are preferably lysed using SDS or proteinase K or the like, and the DNA is deproteinized by repeating extraction with phenol. The RNA is digested, preferably by ribonuclease. The obtained DNA is partially digested with an appropriate restriction enzyme, and the obtained DNA fragment is amplified with an appropriate phage or cosmid to prepare a library. Then, a clone having the target sequence is detected by, for example, a method using a radiolabeled DNA probe, and all or a part of the gene encoding the protein is cut out from the clone with a restriction enzyme or the like and obtained.

For example, when obtaining cDNAs encoding human-derived proteins, Kosumi Dry Slurry into which human genomic DNA (chromosomal DNA) has been introduced is also prepared ("Labo Manual Human Genome Matching", edited by Masaaki Hori and Yusuke Nakamura, Maruzen) Then, by screening the cosmid library, a positive clone containing the DNA of the coding region of the target protein is obtained. Using the coding DNA cut out from the positive clone as a probe, the cDNA library described above is used. It can also be prepared by screening rallies.

(2) Preparation of expression vector and transformation of cells with the vector

Examples of the vector used in cloning of the gene encoding any of the above-mentioned proteins and / or the expression vector for expressing the gene encoding the protein include various prokaryotic and / or eukaryotic host cells. There is no particular limitation as long as it can maintain replication or self-reproduce in it, and includes plasmid vector and phage vector. However, in the above-mentioned embodiments <1> to <22>, the gene encoding the protein is limited to a vector that can be expressed in the “PC12-derived cell” as defined above. The recombinant vector can be simply prepared by ligating the DNA encoding the protein to a recombinant vector (plasmid DNA and bacterial phage DNA) available in the art in a conventional manner. it can.

Specific examples of the recombination vector used include plasmids derived from Escherichia coli such as pBR322, pBR325, pUC12, pUC13 and pUC19, and plasmids derived from yeast such as pSH19 and pSH15, and plasmids derived from Bacillus subtilis. For example, pUB110, pTP5, and PC194 are exemplified. Examples of the phage include pacteriophage such as input phage, and animal and insect viruses (pVL1393, manufactured by Invitrogen) such as retrovirus, puccinia virus, and nucleopolyhedrovirus. Expression vectors are useful for the purpose of expressing DNA encoding the protein in “PC12-derived cells” as defined above. The expression vector is not particularly limited as long as it has a function of expressing the gene in the cell. For example, pMAL C2, pEF-BOS (Nucleic Acid Research) ^ 18 Volume, p. 532, p. 1992, etc.) or pME18S (Experimental Medicine separate volume, “Genetic Engineering Handbook”, p. 1992, etc.).

When an animal cell is used as a host, the expression vector preferably contains at least a promoter, an initiation codon, DNA encoding the protein of interest, and a stop codon. DNA encoding a signal peptide, enhancer sequence, untranslated regions at the 5 and 3 sides of the gene encoding the protein, splicing junction, polyadenylation site, selective binding region, or replicable unit Etc. may be included. Further, it may contain a gene amplification gene (maichiriichi) usually used depending on the purpose.

Suitable initiation codons include methionine codon (ATG).

Examples of the stop codon include commonly used stop codons (eg, TAG, TGA, TAA).

The evening / mine / night area is usually used natural or synthetic evening / mine One can be used.

A replicable unit is DNA that has the ability to replicate its entire DNA sequence in a host cell, and is composed of natural plasmids, artificially modified plasmids (prepared from natural plasmids). DNA fragments) and synthetic plasmids. For example, plasmid pBR322 or an artificially modified product thereof (a DNA fragment obtained by treating PBR322 with an appropriate restriction enzyme) is used in E. coli, and plasmid pRSVneo is used in mammalian cells. ATCC 37198, plasmid pSV2dhfr ATCC 37145, plasmid pdBPV-MMMTneo ATCC 37224, and plasmid pSV2neo ATCC 37149.

As the enhancer sequence, polyadenylation site and slicing junction site, those commonly used by those skilled in the art can be used.

As the selection marker, a commonly used marker can be used by a conventional method. Examples thereof include antibiotic resistance genes such as neomycin, tetracycline, ambicillin, hygromycin, and kanamycin.

Gene amplification genes include dihydrofolate reductase (DHFR) gene, thymidine kinase gene, neomycin resistance gene, glutamate synthase gene, adenosine deminase gene, ordinine decarboxylase gene, hygromycin B — A phosphotransferase gene, an aspartalate transcarbamylase gene, and the like.

The expression vector used in the present invention can appropriately and continuously replicate at least the above-mentioned promoter, start codon, DNA encoding the desired protein, stop codon, and overnight-mine area. It can be prepared by linking to units. At this time, if necessary, an appropriate DNA fragment (for example, a linker, another restriction enzyme cleavage site, etc.) can be used by a conventional method such as digestion with a restriction enzyme or ligation using T4 DNA ligase.

The transformed cell prepared in the present invention is prepared by transforming the above-described expression vector into a host cell (immediately). That is, it can be prepared by introduction into the “PC12-derived cell” defined above.

The cells (including wild-type cells, cell lines, non-transformed cells, and transformed cells) used in the present invention can survive, maintain, and / or proliferate by culturing in a nutrient medium.

The nutrient medium preferably contains a carbon source, an inorganic nitrogen source or an organic nitrogen source necessary for the growth of the host cell (transformant). Examples of the carbon source include glucose, dextran, soluble starch, and sucrose, and examples of the inorganic or organic nitrogen source include ammonium salts, nitrates, amino acids, corn chips, peptone, casein, and meat extract. , Soybean meal, potato extract and the like. If desired, other nutrients (eg, inorganic salts (eg, calcium chloride, sodium dihydrogen phosphate, magnesium chloride), bimins, antibiotics (eg, tetracycline, neomycin, ambibicin, kanamycin, etc.), etc.) May be included.

The culturing is performed by a method known in the art. Culture conditions, such as temperature, pH of the medium, and culture time are appropriately selected.

When the host is an animal cell, for example, a MEM medium containing about 5 to 20% fetal bovine serum (Science, Vol. 122, p. 501, 1952), a DMEM medium (Virology, Vol. 8, p. 396, 1959), RPMI1640 medium (J. Am. Med. Assoc., Vol. 199, p. 519, 1967), 199 medium (proc. Soc. Exp. Biol. Med., Vol. 73, p. L) , 1950) can be used. The pH of the medium can be set to about 6 to 8, and the culture is usually performed at about 30 to 40 ° C, and if necessary, aeration and stirring can be performed.

(3) Construction of chimeric gene and construction of expression vector

The chimeric G protein subunit used in the present invention, for example, a gene encoding Ghi qi consisting of Ghi i and G aq or a gene encoding G asi consisting of G hi i and G his is The base sequence of mMA encoding each of aq and G Can be prepared by PCR using the following pair of primers.

Fourth primer: A primer having a nucleotide sequence complementary to the nucleotide sequence encoding the N-terminal amino acid sequence of each of Gq and Gs.

Reverse primer: A nucleotide sequence complementary to the nucleotide sequence encoding the C-terminal amino acid sequence of Gi downstream of the nucleotide sequence complementary to the nucleotide sequence encoding a part of the amino acid at the C-terminal side of each of Gq and Gs A primer having

(4) Reporter gene expression vector

The various reporter genes used in the present invention as defined above can be cloned using the existing gene cloning method as described above. However, commercially available expression vectors into which the gene has been inserted can be used. It is convenient to use a cutter.

(5) Cell transformation

Transformation of host cells (eg, “PC12-derived cells” as defined above) by various gene expression vectors in the present invention is performed by the above-described general method (eg, lipofection method or electroporation method). Can be performed. The transformants used in the present invention include _c- transformants, which include both transient transformants and stable transformants, as described above. Host cells are transformed with various marker genes (for example, a drug resistance gene such as a neomycin resistance gene), and the cells are then cultured in the presence of the drug to obtain clones resistant to the drug. it can.

(6) Method for identifying agonist of G protein-coupled receptor

An example of an embodiment of the following invention (1) as one of the present invention will be described.

The invention <1> is as follows.

"A method for determining whether or not a substance is an agonist of a desired G protein-coupled receptor, comprising the following steps (a) to (c): ) At least the following exogenous genes (1) and (2): (1) a gene encoding the desired G protein-coupled receptor; and

(2) a reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein;

Contacting the substance with a sample consisting of a constant number of PC12-derived cells having:

(b) a detectable signal produced by the repo gene expressed in each cell in the sample contacted with the substance, and the repo gene expressed in each cell of the sample not contacted with the substance Quantitatively determining each of the detectable signals produced by the gene;

(c) comparing the amounts of the respective signals determined in step (b). The present invention can be implemented, for example, as follows.

(1) PC12-derived cells (eg, PC12h cell line) are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (iii) have been inserted so that they can be expressed in host cells. A transformed cell (preferably a stable transformed cell) into which all the genes have been introduced is obtained.

i) A gene (preferably cDNA) encoding a desired G protein-coupled receptor. ii) A promoter overnight region of a gene whose expression is induced by a signal mediated by a G protein (preferably, a promoter region containing a zif268 (EGR-1) promoter region, a c-fos promoter region, or an SRE and / or a CRE. Encoding a repo overnight gene (preferably luciferase derived from fireflies or P. mushrooms), GFP (Green Fluorescence Protein) derived from jellyfish, CDNA).

iii) The amino acid sequence at the C-terminal side of the Gq subunit, from about 3 to about 23 (preferably 9) consecutive amino acid sequences including glycine at position 3 is converted to the C-subunit of the Gi subunit. A gene (preferably cDNA) encoding a chimeric G protein subunit obtained by substitution with the corresponding amino acid sequence at the terminal side.

② The number of the obtained transformed cells (for example, l to ^lx l0 ^lfl , lxlO ^ lxlO ⁹ pieces, lxl0 ² ~lxl0 ⁸ pieces, lxl0 ³ ~lxl0 ⁷ atoms, lxl0 ⁴ ~ lxl0 ⁷ amino, 1 xl0 ⁴ ~lxl0 ⁶ pieces, Ixl0 ⁴ ~5xl0 ⁵ pieces) capable desired cell culture In a desired nutrient medium (eg, D-MEM medium) containing the desired reagents (eg, serum, antibiotics, etc.) using instruments (eg, petri dishes, microplates with multiple wells, microtubes, etc.) Incubate with Prepare at least two sets of samples consisting of cells with this constant.

③ At least one of the samples contains the desired concentration of the substance (eg, compound) to be tested (eg, about Ι.ΟρΜ to about 1.0 ·, and in the following order of preference, about ΙΟ.ΟρΜ to about 100 mM, Add about ΙΟΟρΜ to about 10 mM, about Ι.ΟηΜ to about 1.0 mM, about ΙΟηΜ to about 500 M, about ΙΟΟηΜ to about 500 / M), and add the desired time at about 37 ° C (for example, about 1 to 24 hours). ) Incubate.

細胞 The cells contained in the cell sample cultured in the presence of the substance are lysed with a desired cell lysis reagent, and the amount of luciferase contained in a certain amount of the cell lysate of the sample is determined by using commercially available luciferase. Determine quantitatively using an I-lase activity measuring device to obtain the measured value [A].

In addition, cells contained in the cell sample of the above (2) cultured without adding the substance are also lysed in the same manner, and the amount of luciferase contained in a certain amount of the cell lysate is determined by using commercially available luciferase. Quantitatively, using an activity measuring device to obtain the measured value [B].

⑤ The measured value [A] is compared with the measured value [B], and based on the degree of the difference, whether or not the substance is an agonist of the G protein-coupled receptor (interaction with the receptor) Is determined).

(7) Screening substances to identify agonists of G protein-coupled receptors

An example of an embodiment of the following invention (as described above 2), which is one of the present invention, will be described.

The invention 2) is as follows.

"Screening substances to identify agonists of the desired G protein-coupled receptor A method comprising the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a repo overnight gene operably linked to a promoter overnight region of a gene whose expression is induced by stimulation through a G protein;

Preparing a plurality of samples consisting of a constant number of PC12-derived cells having: and contacting each of the samples with a different substance;

(b) for each sample contacted with the substance in step (a), the detectable signal produced by the reporter gene expressed in each cell in the sample; and Quantitatively determining each of the detectable signals produced by the repo overnight gene expressed in each cell of the sample; and

① PC12-derived cells (eg, PC12h cell line) are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (ii) have been inserted so that they can be expressed in host cells. A transformed cell (preferably a stable transformed cell) into which all the genes have been introduced is obtained.

i) A gene (preferably cDNA) encoding a desired G protein-coupled receptor. ii) Promoter region of a gene whose expression is induced by a signal mediated by a G protein (preferably, zif268 (EGR-1) Promoter region, c-fos Promoter region, or SRE and / or CRE Repro overnight gene (preferably, luciferase derived from fireflies or mimics, GFP (Green Fluorescence Protein) derived from jellyfish, CDNA encoding zeolites).

iii) The amino acid sequence at the C-terminal side of Gq Encodes a chimeric G protein subunit obtained by replacing about 3 to about 23 (preferably 9) contiguous amino acid sequences with the corresponding amino acid sequence at the C-terminal side of Gi subunit. (Preferably cDNA).

② The resulting constants of the transformed cell (e.g., L～lxl0 ^{1 ()} number, in order of preference below ^nine ^{lxlO ^ lxlO, 1 10 2 ~1} 10 8 pieces, 1 10 ³ to 1 10 ^7, Lxl0 ⁴ ~ ^lxl0 ⁷ amino, 1 xl0 ⁴ ~lxl0 ⁶ pieces, Ixl0 ⁴ to ～5Xl0 ⁵ pieces), a number of Ueru (e.g., 24 holes, 48 holes, 96 holes, each of the microplates with 364 like holes) Ueru And the cells are cultured in a desired nutrient medium (eg, D-MEM medium) containing the desired reagents (eg, serum, antibiotics, etc.). (Hereinafter, a fixed group of cells set in each well is referred to as a sample.)

③ Each of a plurality of samples set in each well of the microplate has a desired concentration (for example, about 1.0 pM to about 1.0 M) of a different substance to be tested (for example, a compound). About ΙΟ.ΟρΙΟ to about 100 mM, about ΙΟΟρΜ to about 10 mM, about Ι.ΟηΜ to about 1.0 mM, about ΙΟηΜ to about 500 M, about ΙΟΟηΜ to about 500 // M) and about 37 ° C. Incubate for about 1 to 24 hours.

Next, a desired cell lysis reagent is added to each sample cultured in the presence of a different test substance to lyse the cells, and the luciferase contained in a fixed amount of the cell lysate of each sample is determined. The amount was quantitatively determined using a commercially available luciferase activity measuring instrument, and multiple measured values [A], [B], [C], [D], [E] · ·-[X ]. In addition, cells contained in the cell sample of the above (2) cultured without adding the substance are also lysed in the same manner, and the amount of luciferase contained in a certain amount of the cell lysate is measured using a commercially available luciferase activity assay. Determine quantitatively using the instrument and obtain one or more measured values [Control].

⑤Compares each of the measured values [A], [B], [C], [D], [E] · [X] with the measured value [Control], and based on the degree of difference Then, a substance that is an agonist of the G protein-coupled receptor (interacts with the receptor) is selected and identified. (8) Method for identifying an agonist or agonist inhibitor of G protein-coupled receptor

An example of an embodiment of the following invention (as described above 3), which is one of the present invention, will be described.

The invention of 3> is as follows.

`` A method for determining whether or not a substance is an antagonist of the desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor. A method characterized by including the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

Contacting the G protein receptor agonist and the substance with a sample consisting of a constant number of PC12-derived cells having:

(b) a detectable signal produced by the reporter gene expressed in each cell in the sample contacted with the substance, and the reporter gene expressed in each cell of the sample not contacted with the substance Quantitatively determining each of the detectable signals resulting from;

(1) A PC12-derived cell (for example, a PC12h cell line) is transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (iii) have been inserted so that they can be expressed in host cells. A transformed cell (preferably a stable transformed cell) into which all the genes have been introduced is obtained.

i) A gene (preferably cDNA) encoding a desired G protein-coupled receptor. ii) Promoting genes whose expression is induced by G protein-mediated signals A repo overnight gene (preferably a zif268 (EGR-l) promoter overnight region, a c-fos promoter overnight region, or a promoter region containing SRE and / or CRE) Are luciferases derived from fireflies or mimic, GFP (Green Fluorescence Protein) derived from jellyfish, and cDNA encoding laccase.

iii) The amino acid sequence at the C-terminal side of the Gq subunit, from about 3 to about 23 (preferably 9) consecutive amino acid sequences including glycine at position 3 is substituted with the C sequence of the Gi subunit. A gene (preferably _C DNA) encoding a chimeric G protein subunit obtained by substituting the corresponding amino acid sequence at the terminal side.

② The resulting constants of the transformed cell (e.g., L～lxl0 ^1Q pieces, in order of preference below, lxlO 'lxlO ⁹ ^{^{pieces, lxl0 2 ~lxl0 8 fli, Ixl0}} 3 ~lxl0 7 atoms, 1 10 ⁴ to 1 10 ⁷ pieces, 1 xl0 ⁴ ~lxl0 ⁶ pieces, Ixl0 ⁴ ~5xl0 ⁵ pieces) and capable of the desired cell culture instrument (e.g., a petri dish, a microplate having many Ueru, etc. microtube) the desired reagents used ( For example, culture in a desired nutrient medium (eg, D-MEM medium) containing serum, antibiotics, etc.). Prepare at least two or more sets of samples consisting of cells of this constant.

(3) Add at least one of the samples (1) and (2) below, and incubate at about 37 ° C for a desired time (eg, about 1 to 24 hours).

i) a desired concentration of a known agonist of the G protein-coupled receptor (e.g., about l.Op M to about 1.0 M, preferably in the order of about 好ましい .ΟρΜ to about 100 mM, about ΙΟΟρΙΟΟ to about 10 mM, About 1.OnM to about 1.0mM, about ΙΟηΙΟ to about 500M, about ΙΟΟηΜ to about 500〃M).

ii) The desired concentration of the substance to be tested (for example, a compound) (for example, about Ι.ΟρΜ to about 1.0 M, and in the preferred order, about ΙΟ.ΟρΜ to about 100 mM, about ΙΟΟρΜ to about 10 mM, about 1.0 nM About 1.0 mM, about 10 nM to about 500 〃M, about ΜηΜ to about 500 / M).

(4) Add at least one of the samples (1) below and incubate at about 37 ° C for a desired time (for example, about 1 to 24 hours). i) a desired concentration of the known agonist of the G protein-coupled receptor (for example, about l. Op M to about 1.0 M, and in the following order of preference, about ΙΟ. ΜρΜ to about 100 mM, about ΙΟΟρΜ to about 10 mM, About 1. OnM to about 1.0 mM, about ΙΟηΜ to about 500 〃M, about ΙΟΟηΜ to about 500 〃M).

し In each sample cultured in ③ and 試薬 above, lyse the cells with the desired cell lysis reagent, and determine the amount of luciferase contained in a certain amount of cell lysate of each sample. Determine quantitatively using a measuring device. Obtain the measured value [A] for the sample (3) and obtain the measured value [B] for the sample (2).

Further, the cells contained in the cell sample cultured in the absence of any of the agonist and the test substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed. The amount is quantitatively determined using a commercially available luciferase activity measuring instrument, and the measured value [C] is obtained.

⑥ The measured values [A], [B] and [C] are compared, and based on the degree of the difference, whether or not the substance is an agonite of the G protein-coupled receptor, or Is a substance having an activity of inhibiting the agonist action of the agonist.

(9) A method of screening a G protein-coupled receptor for identification of an agonist or agonist inhibitor

An example of an embodiment of the following invention (4>) as one of the present invention will be described.

The invention of 4> is as follows.

"A method for screening a substance for identifying an agonist of the desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor, comprising the following (a) And (c): (a) at least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

A plurality of samples consisting of a constant of PC12-derived cells having Contacting a substance different from the agonist of the G protein receptor;

i) A gene (preferably cDNA) encoding a desired G protein-coupled receptor. ii) A promoter region of a gene whose expression is induced by a signal mediated by a G protein (preferably, a zif268 (EGR-1) promoter region, a c-fos promoter overnight region, or a promoter region containing SRE and / or CRE. One region) luciferase (preferably luciferase derived from fireflies or escherichia), GFP (Green Fluorescence Protein) derived from jellyfish, CDNA encoding).

iii) The amino acid sequence at the C-terminal side of the Gq subunit, from about 3 to about 23 (preferably 9) consecutive amino acid sequences including glycine at position 3 is converted to the C-terminal of the Gi subunit. A gene (preferably _C DNA) encoding a chimeric G protein subunit obtained by substituting the corresponding amino acid sequence on the side.

② The resulting constants of the transformed cell (e.g., L～lxl0 ^1Q pieces, in order of preference below ^nine lxlO ^ lxlO, lxl0 ² ~lxl0 ⁸ pieces, lxl0 ³ ~lxl0 ⁷ atoms, lxl0 ⁴ ~lxl0 ⁷ carbon atoms, 1 xl0 ⁴ ~lxl0 ⁶ pieces, the lxl0 ⁴ ~5xl0 ⁵ pieces), a number of Ueru (e.g., 24-well, 48-well, 96-well, microplate of 1 or more (preferably a plurality) having a 364 like holes) The cells are plated on each of the cells, and the cells are cultured in a desired nutrient medium (eg, D-MEM medium) containing a desired reagent (eg, serum, antibiotic, etc.). (Hereinafter, a fixed group of cells set in each well is referred to as a sample.)

③ Add the following (i) and (ii) to each or all of the multiple samples set in each well of the microplate, and add them at about 37 ° C for a desired time (for example, 2 4 hours) Incubate.

i) a desired concentration of a known agonist of the G protein-coupled receptor (e.g., about l.Op M to about 1.0 M, preferably in the order of about 好ましい .ΟρΜ to about 100 mM, about ΙΟΟρΙΟΟ to about 10 mM, About 1.OnM to about 1.0mM, about ΙΟηΜ to about 500〃M, about ΙΟΟηΜ to about 500 / M).

ii) For each sample, the desired concentration of the substance to be tested (for example, a compound) which is different from each other (for example, about Ι.ΟρΜ to about 1.0 ·, and in the following order of preference, about ΙΟ.ΟρΜ to about 100 mM, about ΙΟΟρΜ to about 10 mM, about Ι.ΟηΜ to about 1.0 mM, about ΙΟηΜ to about 500 M, about ΙΟΟη to about 500 〃M).

試料 Each sample set in each micro-well of the microplate of the above ② different from the microplate used in the test of ③ above, or the sample set in the microplate of ③ above and the test of ③ above Each of the samples set in the remaining wells that were not used in the above-mentioned steps was added to each of the plurality of samples set in the above, and the following (i) was added. , About 1-24 hours).

i) a desired concentration of a known agonist of the G protein-coupled receptor (e.g., about l.Op M to about 1.0 M, and in a preferred order, about ΙΟ.ΟρΜ to about 100 mM, about ΙΟΟρΜ to about 10 mM, about 1. OnM to about 1.0 mM, about ΙΟηΜ to about 500 〃M, about ΙΟΟηΜ to about 500 〃M).

(4) Lyse cells in each of the samples cultured in (3) and (4) above using the desired cell lysis reagent, and determine the amount of luciferase contained in a fixed amount of the cell lysate of each sample by measuring the luciferase activity on the market It is determined quantitatively using an apparatus. The measured values [A], [B], [C], [D], [E] · · · '[X] were obtained for the sample of (3), and the measured values [A,], [ B,], [C,], [D,], [Ε,] · · · '[Χ'] are obtained. Further, cells contained in the cell sample cultured in the absence of any of the agonist and the test substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed. The amount is quantitatively determined using a commercially available luciferase activity measuring device to obtain one or more measured values [Control].

⑥Plural measured values [A], [B], [C], [D], 〖E レ · [X] are converted to measured values [], [B,], [C,], [ D,], [Ε,] · · · · [Χ,], and the measured value [Control], and based on the degree of the difference, a substance that is an angoneist of the G protein-coupled receptor; Alternatively, a substance having an activity of inhibiting the agonist action of the agonist is selected and identified. (10) Methods for identifying receptors that interact with a substance (eg, G protein-coupled receptors)

An example of an embodiment of the following invention (14> to 16>) which is one of the present invention will be described. The invention of the above item 14> is as follows.

"A method for identifying a receptor that interacts with a substance, comprising the following steps (a) to (d) (where the substance is an agonist for the receptor: Acts as :):

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and

Preparing a plurality of samples comprising PC12-derived cells having the following steps: contacting each of the samples with the substance (wherein the cells in each of the samples are different from each other for each sample). Has the following genes :);

(b) for each sample that has been contacted with the substance in step (a), contacting the detectable signal produced by the reporter gene expressed in each cell in the sample with the substance, if desired; Quantitatively determine each of the detectable signals produced by the repo gene expressed in each cell of the respective sample About;

(d) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (a) of the cells in the selected sample; "

The invention of <15> is as follows.

"A method for identifying a receptor that interacts with a substance, comprising the following steps (a) to (f) (wherein the substance is an agonist for the receptor: Acts as :):

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and

Preparing a plurality of samples consisting of PC12-derived cells having the following steps: contacting each of the samples with the substance (wherein the cells in each of the samples are different from each other for each sample) (1) Has the following genes :);

(b) for each sample contacted with the substance in step (a), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals generated by said repo-all-night gene expressed in each cell of said respective sample not contacted;

(d) At least the following exogenous genes (1) and (2): (1) one or more genes encoding the protein described in (1) of step (a), which are exogenous genes of the vesicles in the sample selected in step (c); and

Providing a plurality of samples comprising PC12-derived cells having the following steps: contacting each of the samples with the substance (where the cells in each of the samples are different from each other for each sample; Gene));

(e) for each sample contacted with the substance in step (d), providing a detectable signal produced by the repo overnight gene expressed in each cell in the sample, and, if desired, Quantitatively determining each of the detectable signals produced by the reporter gene expressed in each cell of the respective sample not contacted;

(f) comparing the amount of signal for each of the samples determined in step (e) with each other, and selecting one or more samples from the plurality of samples tested in step (d);

(g) the step of determining the nucleotide sequence of the gene encoding the protein according to (1) in step (d) of the cells in the selected sample; "

The invention of the above item 16> is as follows.

"The method comprises, if desired, between the step (f) and the step (g), one or more times of the same operation comprising the steps (d) to (f). 15>. "

The present invention can be implemented, for example, as follows.

① PC12-derived cells (eg, PC12h cell line) are transformed into one or more expression vectors in which the following genes (i) and (ii) or (i) to (ii) have been inserted so that they can be expressed in host cells. A transformed cell (preferably inexpensive) into which all the genes have been introduced Wherein a plurality of types of transformed cells having the following gene (i) are prepared for each transformed cell.

i) One or more genes (preferably cDNA) encoding any protein. Specifically, for example, a cDNA or cDNA group consisting of one or more kinds in a cDNA library consisting of various kinds of cDNAs encoding the full-length amino acid sequences of various human-derived proteins.

ii) Promoter region of a gene whose expression is induced by a signal mediated by a G protein (preferably, a promoter region of zif268 (EGR-l), a c-fos promoter region, or a promoter region containing SRE and / or CRE. CDNA encoding a reporter gene (preferably luciferase from fireflies or peaches, GFP (Green Fluorescence Protein) from jellyfish, or luciferase) ).

iii) the C-terminal amino acid sequence of the C-terminal of the G subunit, comprising about 3 to about 23 (preferably 9) contiguous amino acid sequences including glycine at position 3; A gene (preferably cDNA) encoding a chimeric G protein subunit obtained by substitution with the corresponding amino acid sequence on the side.

② The resulting plurality of types of each of the constants of the transformed cell (e.g., L～lxl0 ^1Q pieces, in order of preference below ^nine ^{lxlO ^ lxlO, 1 10 2 ~1} 10 8 pieces, lxl0 ³ ~lxl0 ⁷ carbon atoms, 1 xl0 ⁴ ~lxl0 ⁷ atoms, lxl0 ⁴ ~lxl0 ⁶ pieces, the lxl0 ⁴ ~5xl0 ⁵ pieces), if e numerous Ueru (e.g., 24 holes, 48 holes, 96 holes, each of the microplates having 364 such holes) Then, the cells are cultured in a desired nutrient medium (eg, D-MEM medium) containing a desired reagent (eg, serum, antibiotic, etc.). That is, cells having different genes (i) are set in each well. (Hereafter, the cell group of a constant set in each well is referred to as a sample.)

③ The desired concentration (for example, about Ι.Ορ 試 to about 1. 1.) of the desired substance to be tested (for example, compound) is added to each of a plurality of samples set in each microplate of the microplate. 0M, in the following order of preference, about ΙΟ.ΟρΜ to about 100 mM, about ΙΟΟρΜ to about 10 mM, about Ι.ΟηΜ to about 1.OmM, about ΙΟηΜ to about 500 / M, about ΙΟΟηΜ to about 500 / M), and Incubate at about 37 ° C for the desired time (eg, about 1 to 24 hours).

Next, a desired cell lysis reagent is added to each sample cultured in the presence of the test substance to lyse the cells, and the amount of luciferase contained in a fixed amount of the cell lysate of each sample is determined. Quantitatively determined using a commercially available luciferase activity measuring device, and multiple measurements [A], [B], [C], [D], [E]... ' ]. Also, if desired, the cells contained in each cell sample of the above (1) cultured without adding the substance are similarly lysed, and the luciferase contained in a certain amount of the cell lysate is similarly lysed. The amount is quantitatively determined using a commercially available luciferase activity measuring device to obtain one or more measured values [Control].

⑤Compare each of the measured values [A], [B], [C], [D], [E] · · · [X] with each other. Select and identify samples that are deemed to work. In this selection and identification, the plurality of measured values [A],

The knowledge obtained by comparing each of [B], [C], [D], [E] · · · · [X] with the measured value [Control] can also be referred to.

(1) When the sample selected in (1) is one or several types, for each sample, the gene of (i) of (2) introduced into the cells contained in each sample is used. The nucleotide sequence is determined, and the gene (i) interacting with the substance can be identified based on the nucleotide sequence.

場合 When there are many types of samples selected in the above ⑤, for each of the selected samples, information on the type of the gene of (i) of ① introduced into the cells in the samples Based on the above, by repeating the same operation as in the above ① to ⑤ and then performing the above operation 遺伝子, the gene of (i) interacting with the substance can be identified.

That is, for example, the following operation can be performed, for example, in the case where the following 10 types of samples are identified in the above ①. (1) Selected sample 1: Genes introduced into cells in (i) above: Genes A, B,

C

(2) Selected sample 2: Genes introduced into cells in (i) above: Genes A, D,

E

(3) Sample 3 selected: Genes introduced into cells in (i) above: Genes A, F,

G

(4) Sample 4 selected: Genes introduced into cells in (i) above: Genes A, H,

I

(5) Sample 5 selected: Genes introduced into cells in (i) above: Genes A, J,

K

(6) Sample 6 selected: Genes introduced into the cells in (i) above: Genes A, L,

M

(7) Selected sample 7: Genes introduced into the cells in (i) above: Genes A, N,

0

(8) Sample 8 selected: Genes introduced into cells in (i) above: Genes A, P,

Q

(9) Selected sample 9: Genes introduced into cells in (i) above: Genes A and R.

S

(10) Selected sample 10: Genes introduced into cells in (i) above: Genes A, T, U

In the above case, the gene of (i) above is replaced with the genes A, B, C, D, E, F, G, H, I, J, K, L, M, N, 0, P , Q, R, S, T, and U. Next, one or more selected from these genes are introduced into PC12-derived cells in the same manner as in (1) above. Hereinafter, the same operations as the above ① to ⑤ are repeated. BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a diagram showing the responsiveness of PC12h cells transfected with a zif-luciferase gene and a histamine H1 receptor gene to histamine at various concentrations.

FIG. 2 shows the responsiveness of PC12h cells transfected with zif-luciferase gene and GLP1 receptor gene to GLP at various concentrations.

FIG. 3 is a diagram showing the responsiveness of PC12h cells, into which zif-luciferase gene and adrenaline A2 receptor gene have been introduced, to forskolin and / or UK14304. Figure 4 shows (1) responsiveness to histamine of PC12h cells transfected with genes encoding zif-luciferase gene, histamine H1 receptor gene and Gqi chimeric molecule, (2) zif-luciferase gene, GLP1 Responsiveness to GLP of PC12h cells transfected with the gene encoding the receptor gene and Gqi chimera molecule, and (3) transfection of zif-luciferase gene, adrenergic A2 receptor gene, and genes encoding Gqi chimera molecule The figure which shows each response of UK12304 of the obtained PC12h cell. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in more detail with reference to Examples. However, it goes without saying that the present invention is not limited to only the embodiments described in the Examples. Example 1

Construction of H1 Hismin Receptor Expression Vector

An expression vector for the H1 histamine receptor (pME-H1R) was constructed as follows. C Note that the “receptor” may be hereinafter referred to as a receptor.

PCR PCR was performed using 脳 brain-derived cDNA (Bovine QUICK-Clone cDNA; manufactured by CLONTECH) as type を with primer F 3 (5, -GCGAATTCCAATGACCTGTCCCAACTCC-3 ') and primer R 3 (5'-GCGCGGCCGCAGGCTTCCTCCTTCACTTCC-3 '). To amplify the DNA fragment containing the coding region of the HI histamine receptor, and restrict the resulting DNA fragment. It was digested with enzymes EcoRI and Notl. The expression vector pME18S (Mol. Cell. Biol., Vol. 8, p. 466, 1988) was digested with restriction enzymes EcoRi and Notl, and the above DNA fragment was cloned into pME18S.

In this experiment and all subsequent experiments, the sequence was confirmed after cloning the PCR fragment into the vector. Example 2

Construction of glucagon-like peptide receptor expression vector

A glucagon-like peptide (GLP1) receptor (pEF-GLPR) expression vector was constructed as follows.

Using human pancreas-derived cDNA (Human Pancreas QUICK-Clone cDNA; manufactured by CLONTECH) as type III, primer F4 (5, -GCGAATTCCCAGTCCTGAACTCC-3,) and primer R4 (5'-CGCTCGAGTCTCAGCTGCAGGAGG-3 ') were used. Then, the amplified DNA fragment was digested with restriction enzymes EcoRI and Xhol to obtain a DNA fragment containing the coding region of the GLP1 receptor. The obtained DNA fragment was cloned (ρΙΤΙΟΙ) into the EcoRI-XhoI site of pCRI I (TA Cloning Kit; manufactured by Invitrogen). Then, ρΙΤΙΟΙ was digested with Spel and Xbal (both restriction enzyme sites were derived from pCRI I), and the obtained DNA fragment was cloned into the Xbal-Xbal site of pEF-BOS (Japanese Patent Laid-Open No. 2-242687). . Example 3

Construction of Adrenaline 2A Receptor Expression Vector

An expression vector for the adrenaline 2A receptor (pME-AR2AR) was constructed as follows.

The adrenaline 2A receptor gene was obtained from ATCC (American Type Culture Collection), and its coding region was incorporated into the pME18S expression vector according to the following procedure. That is, the upstream (5 ,;) side of the coding region of human 2A was digested with restriction enzymes PvuII and Sacl, and this DNA fragment was cloned into the pBluescript II Smal-Sacl site (pBlue- Hi 2A5,).

The downstream (3 ') side of the 2A coding region was digested with the restriction enzyme Accl to obtain a DNA fragment that partially overlaps the upstream side described above, and this was placed on the Accl site of pBluescript II. It was cloned (pBlue-H2A3,).

Then, pBlue-hi 2A5 'was digested with the restriction enzymes EcoRI (restriction enzyme site on vector) and Fspl (restriction enzyme site on α2A coding), and the upstream (5) The DNA fragment on the ') side was obtained. On the other hand, pBlue-hi 2A3 'was digested with the restriction enzymes Fspl (restriction enzyme site at the same position on the 2A coding of pBlue-hi 2A5) and Notl (restriction enzyme site on the vector). A DNA fragment downstream (3 ') of the coding region of was obtained. The DNA fragments upstream and downstream of the coding region of human 2A thus obtained were ligated at the Fspl site and cloned into the EcoRI-Notl site of pMel8S. Example 4

Construction of zif268 Promo One-One Lucifera-Zelepo-One-One Plasmid.

The zif268 (EGR-l) promoter overnight luciferase reporter plasmid (pGL2-zif, hereinafter sometimes referred to as zif-luciferase) was prepared by the following procedure. The rat genomic DNA was designated as type II, and the primers F1 (5, AGAGAGGGTACCAGCCTCAGCTCTACGCGCCT-3 ') and R-1 (5,-

PCR using AGAGAGAAGCTTGAAGCTACTGAGGGCACACT-3 ') and the promoter region of the zif268 gene (-526 to +227 relative to the transcription start site (Proc. Natl. Acad. Sci.

USA., Vol. 86, p. 377-381, 1989)]. The amplified DNA fragment was digested with the restriction enzyme SacII, blunt-ended, and then digested with the restriction enzyme Kpnl to obtain a fragment of -526 to +97. After digestion of the expression vector pGL2-basic vector-1 (PR0MEGA) without the promoter and enhancer sequences of eukaryotic cells with the restriction enzyme Hindl I, blunt-end treatment was performed, followed by restriction enzyme Kpnl The zif268 promoter fragment (-526 to +97) was cloned upstream of the luciferase gene in pGL2-basic vector. Example 5

c-fos Promoter-Construction of luciferase repo overnight plasmid

c-fos Promo overnight—Luciferase repo overnight plasmid (pGL2-fos, hereinafter sometimes referred to as fos promo overnight Lucifera zelepo overnight) was constructed as follows.

Using human genomic DNA as type I, primer F2 (5'-TCTCTCGGTACCGCAGGAACAGTGCTAGTATT-3 ') and primer R2 (5, -TCTCTCGAGATCTTGAAGCAGAGCTGGGTAGGA-3') were used. To amplify the c-fos gene promoter region [-733 to +98 relative to the transcription start site (Endocrinology, Vol.136, p.4505-4516, 1995); GenBank Accession No.M16287)] did. The amplified DNA fragment was digested with restriction enzymes Bglll and Kpnl.

The expression vector pGL2-basic vector (PR0MEGA) was digested with restriction enzymes Bgl11 and Kpnl, and the above DNA fragment was cloned into pGL2-basic vector. Example 6

Construction of drug resistance vector

The pure mouth mycin resistance vector (pCMV-Pur) used in the following examples was prepared as follows.

pPUR plasmid (manufactured by CLONTECH) was digested with restriction enzymes HindI II and Xbal to obtain a DNA fragment containing a buromycin resistance structural gene. This DNA fragment is The clone was cloned into Hindl l-Xbal site of Kuta-pIRESIhyg (manufactured by CLONTECH). Example 7

Activation of the reporter gene by a ligand / receptor that activates the Gq signaling system (activation of zif-luciferase through HI histamine receptor (H 1 R) by histamine).

Examples of the activation of the histamine / H1 histamine receptor, which activates the Gq signal transduction system, of the repo overnight gene in the assay system of the present invention are shown below.

PC12h cells were seeded on a collagen-coated 24-well plate (manufactured by IWAKI) at a concentration of 1 × 10 ⁵ cells / μl. The medium used was D-MEM (10% horse serum, 5% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 // g / ml). After culturing the cells at 37 ° C. for 1 day, a receptor expression vector (pME-HIR; 200 ng / Pell) and a repo-plasmid plasmid were prepared using a ribofectamine reagent (manufactured by GIBCO BRL) according to the manufacturer's instructions. Was co-transfected (pGL2-zif; 20 ng / well).

After about 6 hours, the transfection solution is discarded, and low serum D-MEM medium (0.5% horse serum, 0.25% fetal bovine serum, penicillin 50 units / ml, streptomycin 50 g / ml) is added per ml to each well. added. After culturing at 37 ° C for 2 days, histamine was added to a final concentration of 10 nM to ImM. After culturing at 37 ° C for 6 hours, discard the medium, wash the cells twice with phosphate buffered saline, add cell lysis buffer (reporter lysis buffer; manufactured by PR0MEGA), add lOOAd per gel, and lyse the cells. A portion (10 // 1) of was subjected to luciferase activity measurement. Luciferase activity was measured using Lucifer-Zeatsy System (PR0MEGA) as a substrate and LUMINOUS CT-9000D (DIA-IATR0N) as a measuring instrument.

As shown in Figure 1, the activity of luciferase, a repo overnight gene product, increases depending on the concentration of the ligand, histamine. An increase of 32 fold was observed in the case of adding no min, and a 123 fold increase was observed at 100 zM, indicating that the Atsushi system exhibited a much higher response than the conventional technology.

When PC12h cells were transformed with pME18S vector plasmid instead of the histamine receptor expression vector, histamine did not activate the repo overnight gene. It has also been confirmed that it is specific for the forcedly expressed H1 receptor. Example 8

Activation of reporter gene by ligand / receptor that activates Gs signaling system.

Examples of the activation of the reporter gene of the Glucagon-like peptide (GLP) / GLP1 receptor that activates the Gs signal transduction system in the Atsushi system of the present invention are shown below.

Other conditions were the same as in Example 7, except that the receptor expression vector used (pEF-GLPI and ligand were different) GLP (7-37, manufactured by WAK0) stimulation was performed at 1 pM to: LOnM. As shown in Fig. 2, the luciferase activity was increased in a GLP concentration-dependent manner, for example, the luciferase activity was increased 12-fold in ΜρΜ and 50-fold in ΙΟηΜ.

Changes in reporter gene activation by ligands / receptors that activate the Gi signaling system.

UK14304, one of the ligands for the adrenergic α2Α receptor, is known to activate the Gi signal transduction system at about {η}. It is also known that the Gs signaling system activated by forskolin, which is an activator of the Gs signaling system adenylate cyclase, is suppressed by about {η} of UK14304. An example in which this phenomenon is evaluated using the Atsushi system of the present invention is shown below.

The procedure was performed under the same conditions as in Example 7, except that the drug stimulation conditions and the adrenaline 2A receptor expression vector (pME-hi2AR) were used as the receptor expression vector. Drug stimulation Phonorescholine (RBI Research Biochemicals International; ΙΟχζΜ) Performed at 37 ° C for 10 minutes with certain t ヽ (or forskolin (10〃M) and UK14304 (RBI Research Biochemicals International; ΜηΜ). After changing to -MEM medium (0.5% equine serum, 0.25% fetal calf serum, penicillin 50 units / ml, streptomycin 50 / g / ml), culture at 37 ° C for about 6 hours, and luciferase Activity was measured.

As shown in Fig. 3, luciferase activity was increased about 10-fold by stimulation of forskolin, an adenylate cyclase activator, and Gn inhibition (Gi activation) by 10 nM UK14304 was luciferase activity. It was shown to be reduced by about 40%. Example 10

Construction of Gqi chimera G protein expression vector

The Gqi chimera G protein expression vector pME-Gqi was constructed as follows.

A chimera G protein expression vector in which the 9 carboxy terminal amino acid residues of G protein Gq are replaced with the 9 carboxy terminal amino acid residues of G protein Gi subunit as follows: Prepared.

CDNA was synthesized from RNA prepared from mouse brain using oligo dT primer. Using this cDNA as a 鎵 type, PCR was performed using primer F5 (5'-GGACTAGTGAGGCACTTCGGAAGAATGACTCTGGA-3 ') and primer R5 (5, -GGACTAGTTAGAACAGACCGCAATCCTTCAGGTTATTCTGCAGG-3' :) and amplified. The widened DNA fragment was digested with a restriction enzyme Spel. The complementary strand sequence of a part of the primer R5 (GAACAGACCGCAATCCTTCAGGTTATT) encodes the C-terminal amino acid sequence of G i, and the complementary strand sequence of the other part of the nucleotide sequence (CTGCAGG-3 ′) is Gq Encodes an amino acid sequence of

The expression vector PME18S was digested with the restriction enzyme Xhol, and an expression vector containing no Xhol fragment (stuffer fragment) was prepared by a self-ligation reaction. So Thereafter, the expression vector was digested with the restriction enzyme Spel, and the DNA fragment amplified by the above PCR was cloned into the Spel site of PME18S. Example 1 1

Receptor / repo / Irichi / Gqi chimera Activation of the repo / original gene via Gs, Gq, Gi coupled receptors by combining G proteins.

As shown in Examples 7 to 9, in the present Atsushi system, Gs and Gq information transmission can be obtained with high sensitivity in the form of an increase in luciferase activity, and G i information transmission using G Combined with activation of the signal transduction system, it can be captured in the form of suppression of luciferase activity.

On the other hand, a chimeric G protein (Gqi), in which about 4 to 9 residues at the C-terminal side of the Gq protein subunit are replaced with a G protein subunit, binds to a Gi-coupled receptor and transmits Gq signaling. Activating the system has already been reported (Nature, Vol. 363, p. 274-276, 1993; Molecular Pharmacology, Vol. 50, p. 923-930, 1996).

In the Atsushi system of the present invention, Gs and Gq are obtained by forcibly expressing in a cell a chimeric G protein of Gqi in which the C-terminal 9 residues of the Gq protein subunit are replaced with the G protein subunit. The following is an example in which not only signal transduction through a receptor coupled to any of Gi but also in the form of increased luciferase activity is shown below.

For transfection, a receptor expression vector (100 ng), a reporter plasmid (pGL2-zif; 20 ng), and a Gqi expression vector (pME-Gqi; 30 mg) were used per well. For the purpose of adjusting the final plasmid amount to 200 ng per well, 50 ng of PME18S vector-plasmid was added. Other conditions were the same as in Example 7.

As shown in Fig. 4, luciferase activity was enhanced about 18-fold by UK14304 stimulation of ΙΟηΜ, which activates the Gi signaling system, indicating that the Gi signaling system can be perceived as an increase in luciferase activity with high sensitivity. Was. In addition, HI receptor expression vector (Gq signal transduction system) or GLP receptor expression vector (Gs signal transduction system) were transformed into cells by Gqi expression vector and reporter plasmid. It was shown that when stimulated with GLP, each activation of the signal transduction system can be regarded as about 160-fold and 9-fold increase in luciferase activity, respectively.

That is, by co-transfecting PC12h cells with a receptor expression vector, a repo overnight plasmid, and a Gqi expression vector, information via any of Gq, Gs, and Gi can be obtained. It was shown that all the activations of the transduction system can be detected with high sensitivity as an increase in luciferase activity. Example 1 2

Preparation of stable transformant of receptor gene / report gene and response of stable transformant to ligand.

Wrap 3 x 10 ⁶ PC12h cells in a collagen-coated Petri dish (10 cm ID; manufactured by IWAKI), incubate for 1 day, and then follow the manufacturer's instructions for Ribofectamine reagent

(GIBC0 BRL), repo overnight plasmid (pGL2-zif or pGL2-fos; 6 zg) and drug-resistant plasmid (pBK-CMV; neomycin resistance gene (STRATAGENE) or pCMV-pur; puro Co-transformation with mycin resistance gene (0.6 g)

(co-transfection). After about 6 hours, the transfection solution was discarded, and D-MEM medium (10% horse serum, 5% fetal calf serum, penicillin 50 units / ml, streptomycin 50 g / ml) was added at 10 ml per petri dish. After culturing at 37 ° C for 2 days, the cells were diluted to 1/3, and a selective drug (G418; GIBC0 BRL or puromycin; SIGMA) was added. After one to two weeks, the colonies formed in the petri dish were picked up on a collagen-coated 24-well plate (manufactured by IWAKI). When culturing was continued and each clone (cell) was sufficiently grown, the repo overnight activity of each clone was measured by the following method. That is, PC12h cells are stimulated with NGF (Nerve Growth Factor). By utilizing the property of activating the reporter gene (pGL2-zif or pGL2-fos) used in the Atsushi system of the present invention, each clone is seeded on a 24-well plate in the same manner as in Example 7, and transfected. : No cushion operation was performed, NGF stimulation was performed 2 days later, and luciferase activity was measured 6 hours later. Then, a clone showing low luciferase activity without stimulation and showing high response to NGF stimulation was selected. With respect to the selected clones, the cells were cloned again by the limiting dilution method to establish stable transformants of the repo overnight gene.

Next, one clone of the neomycin resistance gene and a stable transformant of the zif268 reporter gene, z / n36-2, was transformed with the H1 histamine receptor expression vector (pME-HIR; 6 jug) and the drug resistance plasmid ( Cotransformation was carried out with pBS-pur; buromycin resistance; 0.6 g).

A colony was picked up in the same manner as above, and the responsiveness to histamine was measured for each clone of the obtained H1 histamine receptor / zif268-repo overnight gene stable transformant. Clones were selected.

In a similar manner, stable transformants expressing the adrenergic α2Α receptor / zif268-repo overnight gene and the GLP1 receptor / zif268-repo overnight gene were established.

As shown in Table 1, all of these stable transformants were shown to have high responsiveness to the ligand corresponding to the receptor.

table 1

Receptor Reporter (zif luciferase) Reactivity of stable transformants to various ligands

Receptor pig clone name ligand luciferase activity

(Stimulation) (Stimulation unstimulated)

H 1 R Z / H 1-36-7 Histamine (100 // M) 1 13

GL P 1 R Z / g 29- 1 GL P (10 nM) 70

2 AR Z / a 36-9 FSK (10 ^ M) 14

F S K + UK (10 nM) 6.5

(54% inhibition)

Example 13

Comparison of responsiveness of reporter genes to various combinations of host cells and reporter gene expression regulatory promoters

In the detection of signal transduction induced by the interaction between the histamine / H1 histamine receptor by repo-gene, the responsiveness of the repo-gene to the signal was determined using various host cells (PC12h Cells, PC12 cells, CH0 cells or COS cells) and various promoter / reporter genes (zif-lucifera-zelepo overnight / fOS-luciferase reporter gene).

Transfect PC12h cells, PC12 cells, CH0 cells, COS cells, repo overnight plasmid (pGL2-zif or pGL2-fos) and receptor expression vector (pME-HIR), and histamine Luciferase activation in response to stimuli was measured. A series of operations and conditions from transfusion to luciferase activity measurement are as follows: According to Example 7.

As shown in Table 2, the combination of PC12h cells / zif-luciferase showed the highest ligand responsiveness (130-fold activation). On the other hand, although the response was reduced in other combinations, activation of the reporter gene by the ligand (histamine) was observed in all combinations.

Table 2

Cell line promoter Receptor Yuichi Luciferase activation

(Stimulation no stimulation)

PC 1 2 h z i f H 1 3 0

P C 1 2h f o s H 1 65

PC 1 2 z i f H 1 3 3

P C 1 2 f o s H 1 2 0

CHO z i f H 1 5.3

CHO f o s H 1 6.6

COS z i f H 1 2.4

COS f o s H 12.2

All stimulations were with histamine (100 / iM).

zif; zif luciferase plasmid

fos; fos luciferase plasmid, that is, zi f-lucifera-zelepo overnight shows highest response in PC12h cells, but also ligand-specific response in other cells, and fos-lucifera. Each and every single zelepo showed ligand-specific responsiveness in various cells including PC12h cells, indicating that any combination of these multiple species can be used for ligand assay. Example 14

Comparison of detection of signal transduction using MAP kinase activation as an index and signal transduction using repo overnight gene expression as an index

Signaling induced by the interaction between the Hismin / H1 receptor was analyzed using MAP kinase (mitogen activated protein kinase) activation as an index. PC12h cells, CH0 cells, CV1 cells, and HEK293 cells were used as host cells for producing the HI receptor-expressing cells, and the degree of MAP kinase activation in various cells was compared.

For the MAP kinase activation measurement, use PathDetect Elkltrans Reporting System (including pFR Luc plasmid; repo overnight plasmid; pFA2 Elkl plasmid; and Fusion Transactivator overnight plasmid; manufactured by STRATAGENE). Was. PC12h cells, CH0 cells, CV1 cells, and HEK293 cells (0.5 to 2 x 10 ⁵ cells / μl) are spread on a collagen-coated 24-well plate (manufactured by IWAKI) and pFR Luc (40 to 200 ng / μl) is applied to each cell. ), PFA2 Elkl (10-300 ng / ゥヱ) and receptor expression vector (pME-HIR; 200-400 ng / ゥ) were transfected and luciferase activation in response to histamine stimulation was measured. Cotransfection was carried out using a SuperFect transfection reagent (1.5 to 5/1 / L; manufactured by QUAGEN, # 301307) according to the manufacturer's instructions. The number of cells, the amount of various plasmids, and the amount of the transfusion reagent used in the test were set to optimal conditions for each cell examined in advance.

A series of operations from histamine stimulation to luciferase activity measurement was performed according to Example 7.

As shown in Table 3, when the presence or absence of signal transmission induced by the interaction between the ligand and the receptor was detected using MAP kinase activation as an index, the sensitivity of the detection was as shown in the above Examples. -It was shown to be much lower than when Luciferase was used for repo overnight. However, even in the detection of a signal using MAP kinase activation as an index, the host cell expressing the receptor can be used for signal transduction in the repo overnight gene access using zif-luciferase described in the above example. Similarly, it was shown that signal transduction was most sensitive when PC12h cells were used.

Table 3 MAP kinase activation responsiveness to H1RZ histamine stimulation in various cells Cell line MAP kinase activation

(No stimulation, no stimulation)

CHO 10

CV 1 16

HEK 293 3.1

All stimuli were given with histamine (100 ^ M).

The MAP kinase activity was measured using STR ATAGENE's patDetectElktltrans-ReportIngsSystem.

Example 15

Comparison of responsiveness between reporter gene having SRE in promoter and zif268-reporter gene

The zif268 (EGR-l) promoter contains four SREs (serum response elements) every night. Thus, the following is an example in which the responsiveness of a reporter gene having an SRE promoter as a promoter and the responsiveness of a zif repo allele gene were compared and examined for histamine / HI histamine receptor expressing cells and GLP / GLP1 receptor expressing cells.

In PC12h cells, repo overnight plasmid (pGL2-zif or pSRE-Luc [Luciferase reporter plasmid with SRE in the mouth motor; STRATAGENE; Log number: # 219080]) and a receptor expression vector (pME-H1R or pEF-GLPR) were transfected, and luciferase activation in response to ligand stimulation was measured. A series of operations and conditions from transfusion to luciferase activity measurement were the same as in Example 7.

As shown in Table 4, when the zif-lucifera-zelepo overnight gene was used, signal transduction was detected in both histamine / H1 histamine receptor-expressing cells and GLP / GLP1 receptor-expressing cells. It showed high responsiveness.

On the other hand, when the SRE-luciferase-zelepo overnight gene is used, it responds to signal transmission in the histamine / H1 histamine receptor-expressing cell line, but to a lesser extent the zif-luciferase reporter. The ratio was about 1/2 compared with the case where the gene was used, and the response to signal transduction in cells expressing the GLP / GLP1 receptor was low.

Table 4 Ligand responsiveness of zif norsiferase and SREZ luciferase reporter Receptor Promoter Ligand luciferase activation

(Stimulated / unstimulated)

H 1 R z i f Histamine (100 / M) 98

H 1 R SRE Histamine (100 M) 56

GL PR z i f GL P (10 nM) 52

GL PR SRE GLP (10 nM) 3.0 zif; zif luciferase plasmid

SRE; SRE-luciferase plasmid As mentioned above, the zif268 (EGR-l) promoter contains important elements other than SRE involved in responsiveness, and zif268 cannot be substituted with SRe It was shown that. However, this test result merely shows that the promoter used in the present invention is preferably the zif268 (EGR-1) promoter, and it is a promoter other than zif268, and This does not mean that a portal containing a CRE cannot be used in the present invention. It goes without saying that a promotion including an SRE and / or a CRE is also an embodiment of the present invention. Industrial applicability

Using the cell-based repo overnight gene assay (cell l-based reporter gene assay), the degree of activation of the G protein-mediated signal transduction system induced by the interaction between a G protein-coupled receptor and a ligand was determined. In the analysis method, a promoter region of a gene whose expression is induced by a signal through a G protein (preferably, a promoter region of zif268 (EGR-1) promoter) is used as a promoter for controlling the expression of the reporter gene. In addition, by using a PC12 cell or a cell subcloned therefrom (eg, a PC12h cell and a cell subcloned from the PC12h cell) as a host cell, activation of the G protein-mediated signal transduction system (repo The level of the signal, which is detected by an increase in the expression of a gene every night, can be detected with extremely high sensitivity. .

Specifically, the absolute value of the value of the signal detected by contacting the ligand for the receptor with the G protein-coupled receptor-expressing PC12-derived cell used in the assay of the present invention becomes extremely large. The ratio to the signal detected when not contacted with the ligand (ie, the S / N ratio) is as high as at least about 20 to 30 times or more.

Further, in the host cell used for the reporter gene assay, (l) a gene encoding a chimeric G protein G hysubunit consisting of each of Gq or Gs and a giant subunit, or (2) By activating phospholipase C by coupling to receptor without receptor specificity like G15 and G16 By introducing a gene that encodes a G protein that transduces a signal, Gi-mediated signal transduction can be detected with extremely high sensitivity using an increase in the expression of a repo overnight gene as an index. became.

That is, by using this method, the presence or absence of signal transduction through any G protein (for example, Gq, Gs, and Gi) can be determined by using one type of cell, without being restricted by the coupled G protein. Can be detected with extremely high sensitivity.

Therefore, the following (1) to (4) can be carried out extremely easily and quickly by using the Atsey method of the present invention and the cells having the above-mentioned characteristics used in the Atsey.

(1) Determine whether the desired substance is an agonist of a G protein-coupled receptor.

(2) Determination of whether the desired substance is a substance having an activity of inhibiting the agonist action of an agonist of a G protein-coupled receptor or an agonist of the receptor.

(3) Screening of a large number of substances to identify ligands (eg, agonists) of desired G protein-coupled receptors.

(4) Screening of a number of substances for identifying a substance that inhibits the agonist action of a desired G protein-coupled receptor agonist or a known agonist of the receptor.

For example, many G protein-coupled receptors such as histamine receptor, adrenergic receptor, and serotonin receptor are closely related to various diseases, and such G protein-coupled receptors are Many drugs have been developed and marketed to control the function of the receptor.

Therefore, the implementation of the above (1) to (4) is a method for identifying and screening a drug targeting any G protein-coupled receptor, and is an essential step in drug development. That is, the method and cell of the present invention are essential and extremely useful in drug development.

In addition, the atsie method of the present invention and the above-mentioned features used in the atsee are provided. By using cells having the above, the following (5) can be performed extremely simply and quickly.

(5) Identification of a receptor that interacts with a substance (for example, a G protein-coupled receptor) using an expression cloning method.

As described above, since G protein-coupled receptors are closely related to the onset of various diseases, the possibility of the above (5) will enable the development of pharmaceuticals for the treatment of various diseases. The receptor as a target can be easily identified.

Claims

The scope of the claims

1. A method for determining whether a substance is an agonist of a desired G protein-coupled receptor, comprising the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a repo overnight gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein;

(b) a detectable signal generated by the reporter gene expressed in each cell in the sample contacted with the substance, and the reporter signal expressed in each cell of the sample not contacted with the substance. Quantitatively determining each of the detectable signals produced by the gene;

(c) comparing the amounts of the respective signals determined in step (b).

2. A method for screening a substance for identifying an agonist of a desired G protein-coupled receptor, comprising the following steps ( _a ) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) preparing a plurality of samples comprising a constant number of PC12-derived cells having a reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein; Contacting each with a different substance;

(b) for each sample that has been contacted with the substance in step (a), the detectable signal produced by the repo-only gene expressed in each cell in the sample, and any of the substances The reporter expressed in each cell of the sample not contacted Quantitatively determining each of the detectable signals produced by the gene; and (c) comparing the amount of each of the signals determined in step (b).

3. A method for determining whether a substance is an agonist of a desired G protein-coupled receptor, or whether it is an inhibitor of the agonist action of an agonist of the G protein-coupled receptor And comprising the following steps (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a sample comprising a constant number of PC12-derived cells having a repo overnight gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein; Contacting the agonist and the substance;

(b) a detectable signal produced by the reporter gene expressed in each cell in the sample contacted with the substance, and the reporter signal expressed in each cell of the sample not contacted with the substance. Quantitatively determining each of the detectable signals produced by the gene;

(c) comparing the amounts of the respective signals determined in step (b).

4. A method for screening a substance for identifying an agonist of a desired G protein-coupled receptor or an inhibitor of the agonist action of an agonist of the G protein-coupled receptor, the method comprising: a) A method comprising the steps of (a) to (c):

(a) At least the following exogenous genes (1) and (2):

(1) a gene encoding the desired G protein-coupled receptor; and

(2) a promoter of a gene whose expression is induced by stimulation through a G protein; a reporter gene operably linked to one of the gene expression regions;

Prepare a plurality of samples consisting of a constant of PC12-derived cells having Contacting a substance different from the agonist of the G protein receptor;

(b) for each sample contacted with the substance in step (a), contacting a detectable signal produced by the reporter gene expressed in each cell in the sample with any substance; Quantitatively determining each of the detectable signals produced by the repo overnight gene expressed in each of the cells of the sample; and

(c) comparing the amounts of the respective signals determined in step (b).

5. The promoter evening one region is, zif268 (EGR-1) promoter region, claims 1 to 4, characterized in that any one of SRE and promoter region or _c -f _0S promoter region which includes a CRE The method according to any of the above.

6. The method according to any one of claims 1 to 4, wherein the promoter region is a zif268 (EGR-1) promoter region.

7. The method according to any one of claims 1 to 6, wherein the PC12-derived cell further has an exogenous gene of any one of the following (a) to (c):

(a) a gene encoding a chimeric G protein G subunit in which a part of the C-terminal amino acid sequence of G subunit is replaced by a part of the C-terminal amino acid sequence of G subunit;

(b) a gene encoding a chimeric G protein G subunit in which a part of the C-terminal amino acid sequence of Gas is replaced with a part of the C-terminal amino acid sequence of Go: i; or

(c) A gene that encodes a G protein that couples to a receptor without receptor specificity and transmits a signal by activating phospholipase C.

8. The method according to claim 7, wherein the G protein according to (c) is G16 or G15.

9. PC12-derived cells having at least the following exogenous genes (1) and (2): (1) a gene encoding a desired G protein-coupled receptor; and

(2) A reporter gene that is operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein.

10. The promoter region, zif268 promoter Isseki one region, SRE and cell of claim 9, characterized in that either a promoter region or c_ _fos promoter Isseki one region and a CRE.

11. The cell according to claim 9, wherein the promoter region is a zif268 promoter region.

12. The cell according to any one of claims 9 to 11, wherein the PC12-derived cell further has an exogenous gene of any one of the following (a) to (c):

(a) a gene encoding a chimeric G protein G subunit in which a part of the C-terminal amino acid sequence of Ghi q is substituted with a part of the C-terminal amino acid sequence of Go: i;

(b) a gene encoding a chimeric G protein G subunit in which a part of the C terminal amino acid sequence of G sub is replaced with a part of the C terminal amino acid sequence of G sub;

(c) A gene encoding a G protein that couples to a receptor without receptor specificity and transmits a signal by activating phospholipase C.

13. The cell according to claim 12, wherein the G protein according to (c) is G16 or G15.

14. A method for identifying a receptor that interacts with a substance, comprising the following steps (a) to (d) (where the substance is a Acts as an agonist.):

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and (2) a reporter gene operably linked to a promoter region of a gene whose expression is induced by stimulation through a G protein;

(b) for each sample contacted with the substance in step (a), the detectable signal produced by the reporter gene expressed in each cell in the sample, and, if desired, the substance Quantitatively determining each of the detectable signals produced by said reporter gene expressed in each cell of said respective sample not contacted with;

(c) comparing the amount of signal for each of the samples determined in step (b) with each other and selecting one or more samples from the plurality of samples tested in step (a); and

15. A method for identifying a receptor that interacts with a substance, comprising the following steps (a) to (g) (where the substance is a Acts as an agonist.):

(a) At least the following exogenous genes (1) and (2):

(1) one or more genes encoding a protein; and

(2) a plurality of samples consisting of PC12-derived cells having a promoter of a gene whose expression is induced by stimulation through a G protein—a repo overnight gene operably linked to a region; Contacting the substance with each of the above (where the cells in each of the samples have the gene of (1) different from each other for each sample);

(b) for each sample contacted with the substance in step (a), the detectable signal produced by the reporter gene expressed in each cell in the sample, and Optionally quantitatively determining each of the detectable signals produced by said reporter gene expressed in each cell of said respective sample not contacted with said substance;

(c) comparing the amount of signal for each of the samples determined in step (b) with each other and selecting one or more samples from the plurality of samples tested in step (a);

(d) At least the following exogenous genes (1) and (2):

(e) for each sample that has been contacted with the substance in step (d), the detectable signal produced by the repo-only gene expressed in each cell in the sample, and, if desired, the signal. Quantitatively determining each of the detectable signals produced by said reporter gene expressed in each cell of said respective sample not contacted with a substance;

(f) comparing the amount of signal for each of the samples determined in step (e) with each other and selecting one or more samples from the plurality of samples tested in step (d); and

16. The method, as desired, comprises between step (f) and step (g) one or more of the same steps comprising steps (d) through (f). Item 15. The method according to Item 15.

17. The promoter overnight region is a zif268 (EGR-1) promoter region, a promoter region containing SRE and CRE, or a c-fos promoter region. The method according to any of the above.

18. The method according to any one of claims 14 to 16, wherein the overnight promo area is a zif268 overnight promo area.

19. The PC12-derived cell according to any one of claims 14 to 18, wherein the PC12-derived cell further has an exogenous gene of any one of the following (a) to (c): Method:

(a) a gene encoding a chimeric G protein G subunit obtained by substituting a part of the C-terminal amino acid sequence of G sub-q with a part of the C-terminal amino acid sequence of G sub-unit;

(b) a gene encoding a chimeric G protein Ga subunit obtained by substituting a part of the C-terminal amino acid sequence of Ghis with a part of the C-terminal amino acid sequence of Ghii;

20. The method according to claim 19, wherein the G protein according to (c) is G15 or G16.

21. The method according to any one of claims 14 to 20, wherein the one or more genes encoding the protein are cDNA or cDNA library.

22. The method according to any one of claims 14 to 22, wherein the receptor is a G protein-coupled receptor.