WO2000056342A2 - Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale - Google Patents

Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale Download PDF

Info

Publication number
WO2000056342A2
WO2000056342A2 PCT/FR2000/000676 FR0000676W WO0056342A2 WO 2000056342 A2 WO2000056342 A2 WO 2000056342A2 FR 0000676 W FR0000676 W FR 0000676W WO 0056342 A2 WO0056342 A2 WO 0056342A2
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
oligonucleotides
stabilized
group
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FR2000/000676
Other languages
English (en)
French (fr)
Other versions
WO2000056342A3 (fr
Inventor
Antoine Carpentier
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Assistance Publique Hopitaux de Paris APHP
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Assistance Publique Hopitaux de Paris APHP
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AT00910993T priority Critical patent/ATE288759T1/de
Application filed by Assistance Publique Hopitaux de Paris APHP, Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Assistance Publique Hopitaux de Paris APHP
Priority to AU33006/00A priority patent/AU3300600A/en
Priority to DK00910993T priority patent/DK1162982T3/da
Priority to DE60018050T priority patent/DE60018050T2/de
Priority to JP2000606246A priority patent/JP2002539265A/ja
Priority to CA002371990A priority patent/CA2371990A1/fr
Priority to EP00910993A priority patent/EP1162982B9/fr
Priority to US09/937,057 priority patent/US7700569B1/en
Publication of WO2000056342A2 publication Critical patent/WO2000056342A2/fr
Publication of WO2000056342A3 publication Critical patent/WO2000056342A3/fr
Anticipated expiration legal-status Critical
Priority to US09/967,881 priority patent/US7108844B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Definitions

  • the present invention relates to the use of 1 stabilized oligonucleotides for the preparation of a medicament with anti-tumor action.
  • astrocytomas for example, whose treatment is mainly based on surgical excision and local brain irradiation, the median survival is only 4 to 6 months after surgical exeresis and 8 to 10 months with the combination of surgery and radiotherapy. Complementary chemotherapy lengthens survival in patients under 60, but very modestly, on the order of 3 months. Under this triple treatment, the median survival remains less than two years for histological grade III (anaplastic astrocytoma) and less than 1 year for grade IV (glioblastoma). The mortality for these two groups is 100% (Daumas-Duport C. et al. (1988), Cancer 62 (10) pp 2152-65).
  • Stimulating the immune system in the treatment of cancer is an old idea and many products have been tested, such as bacterial extracts (Jaeckle KA et al. (1990), J. Clin. Oncol. 8 (8) pp 1408-18), bacterial DNA, in particular that of Mycobacterium bovis (MY-1) (Tokunaga T. et al. (1984), JNCJ 72 pp 955-62). MY-1 is ineffective for increase survival in a mouse glioma model (Nakaichi M. et al. (1995), J. Vet. Med. Sci. 57 (3) pp 583-5). IL2 (Herrlinger U. et al. (1996), J. Neurooncol.
  • Oligonucleotides are polymers, formed by the combination of purine or pyrimidine bases and sugars, in particular ribonucleotides or deoxy ribonucleotides. In their natural state, the bonds are phosphoesters bonds sensitive to nucleases in the human organism. Thus, oligonucleotides have a very short half-life (of the order of a minute) when they are injected into humans, which limits their biological effects. Also, several studies have sought to stabilize oligonucleotides by modifying their chemical structure to make them resistant to nucleases.
  • oligonucleotides such as, inter alia, phosphorothioates or methylphosphonates, (Crooke RM (1991), Anti-Cancer Drug Design S pp 609-46). The most frequently used are the phosphorothioate oligonucleotides. Certain oligodeoxynucleotides and in particular certain synthetic oligodeoxynucleotides have sometimes their own biological effects, apart from their classic antisense properties.
  • oligodeoxynucleotides stimulate, in vi tro and in vivo, the proliferation of B lymphocytes, the activity of NK cells and induce the secretion by these cells of IFN ⁇ , IFN ⁇ , d 'IFN ⁇ , IL6, IL12 or TNF ⁇
  • immunostimulatory oligodeoxynucleotides which are not defined as oligonucleotides having an unmethylated CG motif, have been described in Application EP 855,184: they include the binding sequence of eukaryotic transcription factors such as NFKB or the family AP-1 . Among these oligonucleotides, some nevertheless include the unmethylated CG motif.
  • the use of the immunostimulatory properties of oligodeoxynucleotides comprising a non-methylated CG type motif is the subject of research in very varied fields:
  • Carpentier et al. , Tokunaga et al. and Connell et al. (aforementioned) which respectively use an octameric phosphorothioate oligonucleotide (5 'TGACTGTGAACGTTCGAGATGA3'), a non-stabilized palindromic hexameric oligonucleotide (5 'ACCGAT GACGTCGCCGGTGACGGCACCACGACGACGGCCACGTGCT 3' purine pyrimine type ') and purine oligonucleotide show that said oligonucleotides have anti-tumor activity.
  • an octameric phosphorothioate oligonucleotide (5 'TGACTGTGAACGTTCGAGATGA3')
  • a non-stabilized palindromic hexameric oligonucleotide (5 'ACCGAT GACGTCGCCGGTGACGGCACCACGACGACGGCCACG
  • the Authors show that, depending on the nature of their sequence, the immunostimulatory oligodeoxynucleotides have differential effects on NK activation, the proliferation of B lymphocytes, the secretion of IL12, IL6 and INF ⁇ .
  • the immunostimulating oligonucleotides comprising a CG motif from the prior art (palindromic hexameric motif, 5 'purine purine motif CG pyrimidine pyrimidine 3' or octameric motif) which exhibit variable and random antitumor activities and are toxic, do not make it possible to define a set of non-toxic immunostimulatory sequences, effective, for antitumor use.
  • the inventors have shown, surprisingly, that certain base pairs 3 ′ of the 5 ′ motif purine purine CG pyrimidine pyrimidine 3 ′ participate, crucially, in optimal anti-tumor activity. Consequently, the inventors have set themselves the goal of providing a set of immunostimulatory oligonucleotide sequences which better meet the needs of the practice in that they:
  • the subject of the present invention is the use of stabilized oligonucleotides which comprise at least one octameric motif of the type:
  • oligonucleotide means an oligodeoxynucleotide.
  • the stabilized oligonucleotides comprise at least one octameric motif selected from the group consisting of: AACGTT-XX j , GACGTT-X ⁇ -, AGCGTT-XiX-, GGCGTT-X X X 2 , AACGTC-X ⁇ , GACGTC-XX 2 , AGCGTC-XX 2 and GGCGTC- X X X 2 , in which XI-X2 is AT, AA, CT or TT.
  • the stabilized oligonucleotides preferably comprise at least one of the following octameric units: AACGTT-X 1 X 2 and GACGTC-XX 2.
  • At least one of the bases of the octameric motif described above can be modified, in particular at least one of the cytosines can be replaced by a 5-bromocytosine.
  • the stabilized oligonucleotide is selected from the group consisting of sequences SEQ ID NO: 8 to 48 According to the invention, the stabilized oligonucleotides are selected in particular from the group consisting of phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, mixed phosphodiester-phosp orothioate oligonucleotides, methylphosphonate oligonucleotides or oligonucleotides of which at least one end has been stabilized (Crooke RM (1991), AntiCancer Drug Design, 6 pp 609-46).
  • the stabilized oligonucleotides used according to the present invention are phosphorothioates.
  • the stabilized oligonucleotides can be used in the form of single strand or double strand.
  • the stabilized oligonucleotides can be any length greater than 8 bases or 8 base pairs, preferably more than 20 ba- its or 20 base pairs.
  • said oligonucleotides comprise between 20 and 100 nucleotides.
  • the oligonucleotides can comprise several octameric units as defined above, whether adjacent or not; they can also include other biologically active sequences, such as antisense sequences.
  • the octameric sequences can themselves be included in antisense sequences.
  • the present invention also relates to the use of stabilized oligonucleotides as defined above, for the preparation of medicaments intended for the treatment of cancers in humans, whatever their nature and their degree of anaplasia, in particular in particular, cancers of the central and peripheral nervous systems, in particular astrocytomas, glioblastomas, medulloblastomas, neuroblastomas, melanomas and carcinomas.
  • the stabilized oligonucleotides can advantageously be coupled by covalent, ionic or weak bonds to a molecule capable of increasing tumor affinity, such as for example an antibody specific for tumor tissue.
  • the stabilized oligonucleotides are preferably used by the intra-tumor route, but they can also be administered by any other route, possibly by multiple routes, in particular by the intravenous, intraperitoneal, topical, transdermal, subcutaneous, intra-arterial, pulmonary, nasal route.
  • -p aromatic or oral in solution, in aqueous or oily suspension, in powder or in any pharmaceutically acceptable form. They can be administered in one or more doses or in continuous release, in particular by means of osmotic micropumps or associated with any physical or chemical means, in particular with encapsulating agents such as colloidal dispersion systems and polymers, in order to have a dose therapeutically effective at the tumor site.
  • the effective doses will be determined according to the age, state of health, weight of the patient and the type of cancer to be treated. Typically, the effective doses in humans are such that, in the case of an intra-tumor injection, a dose of oligonucleotide of 10 to 1000 ⁇ g / g of tumor is obtained, at least in part of the tumor. According to the invention, the use of the oligonucleotides can be combined with other therapies, in particular surgery, radiotherapy, chemotherapy, immunotherapy and differentiating therapies.
  • said oligonucleotides are associated with cells of the immune system, such as macrophages, lymphocytes or antigen-presenting cells, immunity adjuvants, cytokines, anti-tumor antibodies, tumor extracts, tumor antigens or normal, irradiated or genetically modified tumor cells.
  • cells of the immune system such as macrophages, lymphocytes or antigen-presenting cells, immunity adjuvants, cytokines, anti-tumor antibodies, tumor extracts, tumor antigens or normal, irradiated or genetically modified tumor cells.
  • FIG. 1 illustrates the results obtained after an intra-tumor injection of the oligodeoxynucleotide phosphorothioate PT1 (SEQ ID No. 2 5'- TGACTGTGAAGTTCGAGATGA-3 '), in the CNS1 glioma model in the brain of rat Lewis ( Kruse CA et al. (1994), J. Neurooncol. 22 pp 191-200), on the survival time of the control animals (-); PT1 50 ⁇ g injected on D1 (-.-.-.), PT1 50 ⁇ g injected on D5 (....) and PT1 50 ⁇ g injected on D9 (), after the injection of the tumor cells.
  • the statistical evaluation of the results is carried out by the Kaplan-Meier test.
  • FIG. 2 illustrates the effect of an intra-tumor injection on D1 of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), at different doses, in the CNS1 glioma model of the rat Lewis, on the survival time of the control animals (-); PT1 50 ⁇ g (), PT1 10 ⁇ g (-.-.-.) And PT1 1 ⁇ g (.).
  • - Figure 3 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No.
  • FIG. 4 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide or of the phosphodiester PE1 oligodesoxynucleotide PE1 both having SEQ ID No. 2 (5'- TGACTGTGAACGTTCGAGATGA-3 '), in a model of subcutaneous glial tumors.
  • the animals receive subcutaneously, at the tumor site, sodium chloride (control - • * -), or 100 ⁇ g of PE1 (-D-) or 100 ⁇ g of PT1 (- ⁇ -).
  • the tumor volume is assessed every two days. The results are expressed as an average ⁇ wk (Anova Test).
  • FIG. 5 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), or the phosphorothioate oligodesoxynucleotide IMM (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA-3'), in the model of neuroblastoma neuro2a in A / J mice (Sigal RK et al. (1991), J. Pediatr. Surg. 26 pp 389-96).
  • the animals receive, subcutaneously at the tumor site, sodium chloride (control - • * -), 50 ⁇ g of PT1 (-B-), 100 ⁇ g of PT1 (-A-) or 50 ⁇ g of IMM (-D -).
  • the tumor volume is evaluated every four days. The results are expressed as an average ⁇ wk (Anova Test).
  • FIG. 6 illustrates the effect of an injection by subcutaneous or intraperitoneally of 1 oligodesoxynucleotide phosphorothioate PT1 (SEQ ID N ° 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), at a dose of 50 ⁇ g in the model of neuroblastoma neuro2a in A / J mice (Sigal RK et al. (1991), J. Pediatr. Surg. 26 pp 389-96).
  • the animals receive 100 ⁇ l of sodium chloride (control group - • * -) or 50 ⁇ g of PT1 injected by ip route (-B-) or by route sc distant from the tumor (-A-) in 100 ⁇ l of sodium chloride.
  • FIG. 7 illustrates the effect of the stabilization of an oligonucleotide (SEQ ID NO: 9 5 '-TGACTGTGAACGTTATAGATGA-3') by a phosphorothioate (PT), phosphodiester (PDE), methylphosphonate (MP) type bond ; phosphodiester stabilized in 3 'by a dideoxycytosine (3') or mixed base: phosphodiester with the first 3 5 'bonds and the last three 3' phosphorothioate type bonds (mixed), on the antitumor activity in a tumor model subcutaneous glials.
  • PT phosphorothioate
  • PDE phosphodiester
  • MP methylphosphonate
  • the volume of the tumor is evaluated on D10. The results are expressed as an average ⁇ s.e.m ..
  • FIG. 8 illustrates the effect of the 5 '-purine-purine-CG-pyrimidine-pyrimidine-XX- 3' sequences on the modulation of antitumor activity in a model of subcutaneous glial tumors.
  • the volume of the tumor is evaluated on D8 (figure 8 to 10) or on D10 (figure 11).
  • the results are expressed as an average ⁇ week:
  • FIG. 8 illustrates the effect of the sequences of the oligonucleotides on the antitumor efficiency
  • FIG. 9 illustrates the effect of the sequence of the 5'-purine-purine-purine-CG-pyrimidine-pyrimidine-3 'hexameric motif and of the adjacent sequences on the antitumor efficacy of the oligonucleotides
  • FIG. 10 illustrates the effect of the 2 bases (XiX j ) adjacent to the 3 'sequence of the 5' hexameric motif-purine-purine-CG-pyrimidine-pyrimidine-3 'on the antitumor efficacy of the oligonucleotides
  • Example 1 Effect of an Intra-Tumor Injection or an Intraperitoneal Injection of PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3') on the Survival of Animals in the CNS1 Glioma Model in the Lewis Rat Brain
  • CNS1 glioma cells grown in vitro are grafted into the brains of healthy Lewis rats, with 10 5 cells in the right parietal cortex of rats
  • the survival of animals treated with PT1 is greatly increased with long-term survival (> 90 days) of 67% (p ⁇ 0.01), 88% (p ⁇ 0.002) and 50% (p ⁇ 0.02 ) for rats treated on D1, D5 and D9 respectively.
  • CNS1 glioma cells cultivated in vi tro are grafted into the brain of healthy Lewis rats, in a proportion of 10 5 cells in the right parietal cortex of rats (Kruse CA et al. (1994), J. Neurooncol, 22 pp 191- 200).
  • an oligonucleotide without an immunostimulatory sequence does not increase survival, unlike an oligonucleotide with such a sequence (Example 1).
  • Example 3 Effect of an intra-tumor injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ') at different doses on the survival of animals in the CNS1 glioma model of the Lewis rat 1. Procedure:
  • the rats receive on Jl after the graft carried out under the conditions described in Example 1, an intra-tumor injection of 1 ⁇ g, 10 ⁇ g or 50 ⁇ g of PT1 dissolved in 7 ⁇ l of sodium chloride or the vehicle alone (n ⁇ 5 per group).
  • CNS1 glioma cells are placed in culture.
  • these PT1 cells are added at concentrations of 0.05 ⁇ M, 0.5 ⁇ M and 5 ⁇ M and at D3 on treats cells with trypsin and measures their viability.
  • b) in vivo see the operating mode of 1 example 1. 2. Results: a) in vi tro PT1, at concentrations of 0.05 ⁇ M, 0.5 ⁇ M and 5 ⁇ M has no cytotoxic action direct on CNSl cells after 48 hours of culture. b) in vivo
  • Example 5 Effect of an intratumoral injection of PT1, at a tumor site, on the development of a tumor grafted simultaneously, at a distance from this site. 1. Procedure:
  • the tumor cells are grafted under the conditions described in Example 1, at two separate sites separated by 4 mm.
  • PTl has a remote effect and the immune response induced at the injection site prevents the development of a tumor grafted simultaneously, at a distance from this site.
  • Example 6 Study of the immune memory at 3 months in the CNS1 glioma model of the Lewis rat after injection of PT1 (SEQ ID No. 2 5 • -TGACTGTGAACGTTCGAGATGA-3 ')
  • Example 7 Effect of an intra-tumor injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ') or of an oligo-deoxynucleotide (IMM) comprising a non-immunostimulatory octanucleotide sequence (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA -3') in a subcutaneous glial tumor model.
  • PT1 SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 '
  • IMM oligo-deoxynucleotide
  • Tumor growth is measured every two days, and the tumor volume is estimated using the formula:
  • Example 8 Effect of an intra-tumor injection of PT1 (phosphorothioate oligodesoxynucleotide) or PE1 (non-stabilized oligodesoxynucleotide) in a model of subcutaneous glial tumors; PTl and PE1 both having the same immunostimulatory sequence (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3')
  • CNS1 glioma cells cultivated in vi tro are injected subcutaneously into healthy Lewis rats, at the rate of 2 ⁇ 10 6 cells in the right flank, under the conditions described in Example 7.
  • Tumor growth is measured every two days, and the tumor volume as described in Example 7.
  • the animals are sacrificed on D12 after the injection of the tumor cells.
  • J22 is approximately 800 mm 3 in the control group, approximately
  • PTl Example 10 Effect of a Subcutaneous or Intraperitoneal Injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ") at a dose of 50 ⁇ g in the model of neuroblastoma neuro2a in mice A / J 1. Procedure:
  • the tumor is obtained according to the procedure described in Example 9.
  • 50 ⁇ g of PTl in 100 ⁇ l of sodium chloride or 100 ⁇ l of sodium chloride (control group) are injected either by subcutaneous route away from the tumor, or by intraperitoneal route (n ⁇ 6 animals per group).
  • Tumor growth is measured every four days and the tumor volume is measured as shown in Example 7.
  • D22 is approximately 1000 mm 3 in the control group, approximately 400 mm 3 in the group treated with 50 ⁇ g of PTl injected subcutaneously and approximately 500 mm 3 in the group treated with 50 ⁇ g of PTl injected intraperitoneally.
  • EXAMPLE 11 Effect of a repeated subcutaneous injection of PTl (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3') or of IMM (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA-3') dose of 10 ⁇ g for 15 days in the neuroblastoma neuro2a model in A / J mice
  • the tumor is obtained according to the procedure described in Example 9.
  • Example 12 Effect of the Stabilization of an Oligonucleotide (SEQ ID N: 9 5 '-TGACTGTGAACGTTATAGATGA-3') on the Antitumor Activity in a Model of Gluceal Subcutaneous Tumors
  • the most effective ODNs are, the oligonucleotides of phosphorothioate type, stabilized in 3 ′, or mixed, with a decrease in the tumor volume of respectively 50%, 53% and 34%, compared to the volume of the controls. .
  • Example 13 Effect of the 5 ′ -purine-purine-CG-pyriii.idine-pyrimidine-XX - 3 ′ sequences on the modulation of the antitumor activity
  • oligonucleotide PT1 SEQ ID No. 2 5 '-TGACTGTG AACGTTCGAGATGA-3'
  • oligonucleotide An 2 SEQ ID NO: 8 5 '-TGCCAGTGACGTCATGTGAC-3'
  • the difference in efficiency of these two oligonucleotides is linked either to the sequence of the 5'-purine-purine-purine-CG-pyrimidine-pyrimidine-3 'hexameric motif comprising the unmethylated CG motif (underlined sequence) or to the sequences adjacent to this motif .
  • Example 2.1 the differences in efficiency observed, in Example 2.1, between the oligonucleotides PT1 and An2 are linked to the nature of the sequences adjacent to the hexameric motif.
  • the optimal antitumor sequences are found in the adjacent sequences of the oligonucleotide An2.
  • the oligonucleotide An 14 (SEQ ID NO: 3 5'- TGACTGTGAACGTT ⁇ AGATGA-3 ') is less effective than the oligonucleotide An 15 (SEQ ID NO: 9, 5'- TGACTGTGAACGTTATAGATGA-3').
  • nucleotides AT 3 ′ of the hexameric motif (An2 (FIG. 8) and An 15 (FIG. 10) make it possible to increase the antitumor efficiency, while the nucleotides CC (An 14, FIG. 10) and CG (PT1, fig. gure 8) have less marked anti-tumor effects.
  • CG CG

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Steroid Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Saccharide Compounds (AREA)
PCT/FR2000/000676 1999-03-19 2000-03-17 Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale Ceased WO2000056342A2 (fr)

Priority Applications (9)

Application Number Priority Date Filing Date Title
US09/937,057 US7700569B1 (en) 1999-03-19 2000-03-17 Use of stabilised oligonucleotides for preparing a medicine with antitumor activity
AU33006/00A AU3300600A (en) 1999-03-19 2000-03-17 Use of stabilised oligonucleotides for preparing a medicine with antitumour activity
DK00910993T DK1162982T3 (da) 1999-03-19 2000-03-17 Anvendelse af stabiliserede oligonucleotider til fremstilling af et lægemiddel med antitumoral virkning
DE60018050T DE60018050T2 (de) 1999-03-19 2000-03-17 VERWENDUNG VON STABILISIERTEn OLIGONUCLEOTIDEn ZUR HERSTELLUNG VON ANTITUMORALen ARZNEIMITTELn
JP2000606246A JP2002539265A (ja) 1999-03-19 2000-03-17 抗腫瘍活性を有する薬剤を製造するための安定化オリゴヌクレオチドの使用
AT00910993T ATE288759T1 (de) 1999-03-19 2000-03-17 Verwendung von stabilisierten oligonucleotiden zur herstellung von antitumoralen arzneimitteln
EP00910993A EP1162982B9 (fr) 1999-03-19 2000-03-17 Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale
CA002371990A CA2371990A1 (fr) 1999-03-19 2000-03-17 Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale
US09/967,881 US7108844B2 (en) 1999-03-19 2001-09-28 Use of stabilized oligonucleotides for preparing a medicament with antitumor activity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR99/03433 1999-03-19
FR9903433A FR2790955B1 (fr) 1999-03-19 1999-03-19 Utilisation d'oligonucleotides stabilises comme principe actif antitumoral

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09/937,057 A-371-Of-International US7700569B1 (en) 1999-03-19 2000-03-17 Use of stabilised oligonucleotides for preparing a medicine with antitumor activity
US09/967,881 Continuation-In-Part US7108844B2 (en) 1999-03-19 2001-09-28 Use of stabilized oligonucleotides for preparing a medicament with antitumor activity

Publications (2)

Publication Number Publication Date
WO2000056342A2 true WO2000056342A2 (fr) 2000-09-28
WO2000056342A3 WO2000056342A3 (fr) 2001-07-26

Family

ID=9543401

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2000/000676 Ceased WO2000056342A2 (fr) 1999-03-19 2000-03-17 Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale

Country Status (12)

Country Link
US (2) US7700569B1 (https=)
EP (1) EP1162982B9 (https=)
JP (1) JP2002539265A (https=)
AT (1) ATE288759T1 (https=)
AU (1) AU3300600A (https=)
CA (1) CA2371990A1 (https=)
DE (1) DE60018050T2 (https=)
DK (1) DK1162982T3 (https=)
ES (1) ES2235839T3 (https=)
FR (1) FR2790955B1 (https=)
PT (1) PT1162982E (https=)
WO (1) WO2000056342A2 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005034979A3 (en) * 2003-10-11 2005-06-02 Inex Pharmaceuticals Corp Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2711670B1 (fr) * 1993-10-22 1996-01-12 Pasteur Institut Vecteur nucléotidique, composition le contenant et vaccin pour l'immunisation à l'encontre d'une hépatite.
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
PT1077722E (pt) 1998-05-22 2006-12-29 Coley Pharm Group Inc Produtos e composições para utilização na indução da imunidade mucosal
US20030022854A1 (en) 1998-06-25 2003-01-30 Dow Steven W. Vaccines using nucleic acid-lipid complexes
WO2000048630A1 (en) 1999-02-17 2000-08-24 Csl Limited Immunogenic complexes and methods relating thereto
FR2790955B1 (fr) * 1999-03-19 2003-01-17 Assist Publ Hopitaux De Paris Utilisation d'oligonucleotides stabilises comme principe actif antitumoral
IL160157A0 (en) 2001-08-17 2004-07-25 Coley Pharm Group Inc Combination motif immune stimulation oligonucleotides with improved activity
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) * 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
PT2241325E (pt) 2002-10-29 2012-04-12 Coley Pharm Gmbh Utilização de oligonucleótidos cpg no tratamento de infecção com vírus da hepatite c
US10100316B2 (en) * 2002-11-21 2018-10-16 Archemix Llc Aptamers comprising CPG motifs
EP1578954A4 (en) 2002-12-11 2010-08-11 Coley Pharm Group Inc 5'-CPG NUCLEIC ACIDS AND USE METHOD
WO2006010838A2 (fr) * 2004-06-25 2006-02-02 Institut Gustave Roussy Produits contenant au moins un principe actif anticancereux peu diffusible et un principe actif immunostimulant
EP1649859A1 (fr) * 2004-10-22 2006-04-26 Institut Gustave Roussy Produits pharmaceutiques contenant au moins un principe actif anticancereux peu diffusible et un principe actif immunostimulant sous forme d'oligodésoxynucléotide
MY159370A (en) * 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
AU2006220835B2 (en) 2005-03-04 2012-01-19 Dynavax Technologies Corporation Vaccines comprising oligonucleotides having immunostimulatory sequences (ISS) wherein the ISS are conjugated to antigens and stabilized by buffer conditions and further excipients
CA2723672C (en) * 2007-05-11 2019-09-03 Adynxx, Inc. Gene expression and pain
FR2975600B1 (fr) 2011-05-24 2013-07-05 Assist Publ Hopitaux De Paris Agents pour le traitement de tumeurs
US20130210896A1 (en) * 2011-11-09 2013-08-15 City Of Hope Immunotheraphy of Brain Tumors Using a Nanoparticle CpG Delivery System
EP3511022A1 (en) 2012-05-10 2019-07-17 Adynxx, Inc. Formulations for the delivery of active ingredients
JP6705807B2 (ja) 2014-08-15 2020-06-03 エーダイニクス インコーポレイテッド 疼痛を治療するためのオリゴヌクレオチドデコイ
CA3023022A1 (en) 2016-05-04 2017-11-09 Transgene Sa Combination therapy with cpg tlr9 ligand
KR20240113607A (ko) 2017-06-21 2024-07-22 트랜스진 개인 맞춤형 백신
JP2021516957A (ja) 2018-03-07 2021-07-15 トランジェーヌTransgene パラポックスウイルスベクター
JP7625521B2 (ja) 2018-12-28 2025-02-03 トランスジーン m2欠陥ポックスウイルス
WO2022148736A1 (en) 2021-01-05 2022-07-14 Transgene Vectorization of muc1 t cell engager

Family Cites Families (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5734033A (en) * 1988-12-22 1998-03-31 The Trustees Of The University Of Pennsylvania Antisense oligonucleotides inhibiting human bcl-2 gene expression
US6153737A (en) 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
JPH04352724A (ja) * 1990-07-27 1992-12-07 Mitsui Toatsu Chem Inc 免疫調節型治療剤
EP0468520A3 (en) * 1990-07-27 1992-07-01 Mitsui Toatsu Chemicals, Inc. Immunostimulatory remedies containing palindromic dna sequences
AU2580892A (en) 1991-09-05 1993-04-05 Isis Pharmaceuticals, Inc. Determination of oligonucleotides for therapeutics, diagnostics and research reagents
ATE235549T1 (de) 1993-04-30 2003-04-15 Biognostik Ges Antisense oligonukleotide zur behandlung von immunsuppressiven wirkungen von tgf-beta2
EP0708829B8 (en) * 1993-07-10 2004-07-21 BIOGNOSTIK GESELLSCHAFT FÜR BIOMOLEKULARE DIAGNOSTIK mbH A pharmaceutical composition comprising antisense-nucleic acid for prevention and/or treatment of neuronal injury, degeneration and cell death and for the treatment of neoplasms
US6001982A (en) 1993-07-29 1999-12-14 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
EP1584682B1 (en) * 1993-09-20 2009-07-15 The Trustees Of The University Of Pennsylvania Regulation of bcl-2 gene expression
WO1995026204A1 (en) 1994-03-25 1995-10-05 Isis Pharmaceuticals, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US5563255A (en) * 1994-05-31 1996-10-08 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of raf gene expression
US6207646B1 (en) * 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6429199B1 (en) * 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
ATE509102T1 (de) * 1994-07-15 2011-05-15 Univ Iowa Res Found Immunomodulatorische oligonukleotide
US6160109A (en) 1995-10-20 2000-12-12 Isis Pharmaceuticals, Inc. Preparation of phosphorothioate and boranophosphate oligomers
US6280978B1 (en) * 1995-12-15 2001-08-28 Intronn Holdings, Llc Methods and compositions for use in spliceosome mediated RNA trans-splicing
EP0914324B1 (en) * 1996-05-22 2001-12-05 McGILL UNIVERSITY Specific inhibitors of dna methyltransferase enzyme
EP0855184A1 (en) * 1997-01-23 1998-07-29 Grayson B. Dr. Lipford Pharmaceutical composition comprising a polynucleotide and an antigen especially for vaccination
US5965420A (en) * 1997-03-05 1999-10-12 Smithkline Beecham Corporation Human protein kinases hYAK3
WO1998055495A2 (en) * 1997-06-06 1998-12-10 Dynavax Technologies Corporation Immunostimulatory oligonucleotides, compositions thereof and methods of use thereof
ATE294388T1 (de) * 1997-08-29 2005-05-15 Univ California Modulatoren der cytosin-5-methyl-transferase und verfahren zu ihrer verwendung
DK1009413T3 (da) * 1997-09-05 2007-06-11 Univ California Anvendelse af immunstimulerende oligonukleotider til forebyggelse eller behandling af astma
US5874416A (en) * 1997-11-07 1999-02-23 Sheikhnejad; Gholamreza RAS antisense inhibition
US6060310A (en) 1997-11-24 2000-05-09 The United States Of America As Represented By The Department Of Health And Human Services Transcription factor decoy and tumor growth inhibitor
US6020475A (en) 1998-02-10 2000-02-01 Isis Pharmeuticals, Inc. Process for the synthesis of oligomeric compounds
ATE356630T1 (de) 1998-04-03 2007-04-15 Univ Iowa Res Found Verfahren und produkte zur stimulierung des immunsystems mittels immunotherapeutischer oligonukleotide und zytokine
US6562798B1 (en) * 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
US6166239A (en) 1998-09-04 2000-12-26 Isis Pharmaceuticals, Inc. Oligonucleotide protecting groups
WO2000016804A1 (en) 1998-09-18 2000-03-30 Dynavax Technologies Corporation METHODS OF TREATING IgE-ASSOCIATED DISORDERS AND COMPOSITIONS FOR USE THEREIN
US6069243A (en) 1998-10-06 2000-05-30 Isis Pharmaceuticals, Inc. Process for oligonucleotide synthesis
EP1117433A1 (en) 1998-10-09 2001-07-25 Dynavax Technologies Corporation Anti hiv compositions comprising immunostimulatory polynucleotides and hiv antigens
US6169177B1 (en) 1998-11-06 2001-01-02 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligomeric compounds
US6121437A (en) 1999-03-16 2000-09-19 Isis Pharmaceuticals, Inc. Phosphate and thiophosphate protecting groups
FR2790955B1 (fr) * 1999-03-19 2003-01-17 Assist Publ Hopitaux De Paris Utilisation d'oligonucleotides stabilises comme principe actif antitumoral
AU4237300A (en) 1999-04-19 2000-11-02 Engelhard Corporation Catalyst composition comprising ceria and a platinum group metal
WO2001051061A1 (en) * 2000-01-14 2001-07-19 Intrabiotics Pharmaceuticals, Inc. Derivatives of polyene macrolides and preparation and use thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005034979A3 (en) * 2003-10-11 2005-06-02 Inex Pharmaceuticals Corp Methods and compositions for enhancing innate immunity and antibody dependent cellular cytotoxicity

Also Published As

Publication number Publication date
ES2235839T3 (es) 2005-07-16
US7108844B2 (en) 2006-09-19
ATE288759T1 (de) 2005-02-15
FR2790955A1 (fr) 2000-09-22
WO2000056342A3 (fr) 2001-07-26
FR2790955B1 (fr) 2003-01-17
EP1162982B1 (fr) 2005-02-09
JP2002539265A (ja) 2002-11-19
CA2371990A1 (fr) 2000-09-28
DE60018050D1 (de) 2005-03-17
US20020192184A1 (en) 2002-12-19
DE60018050T2 (de) 2006-02-23
EP1162982B9 (fr) 2005-07-06
AU3300600A (en) 2000-10-09
PT1162982E (pt) 2005-05-31
US7700569B1 (en) 2010-04-20
DK1162982T3 (da) 2005-06-13
EP1162982A2 (fr) 2001-12-19

Similar Documents

Publication Publication Date Title
WO2000056342A2 (fr) Utilisation d'oligonucleotides stabilises pour la preparation d'un medicament a action antitumorale
Carpentier et al. CpG-oligonucleotides for cancer immunotherapy: review of the literature and potential applications in malignant glioma
US8466116B2 (en) Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US7851454B2 (en) Short immunomodulatory oligonucleotides
US7208478B2 (en) Immunostimulatory polynucleotide/immunomodulatory molecule conjugates
EP1326636B1 (fr) Composition vaccinale
US8030285B2 (en) Oligodeoxynucleotide and its use to induce an immune response
AU2009302468A1 (en) Use of inhibitors of toll-like receptors in the prevention and treatment of hypercholesterolemia and hyperlipidemia and diseases related thereto
US20080124366A1 (en) Methods and Compositions for Treating Tumors
EP1750707A1 (fr) Composition immunostimulante comprenant au moins un agoniste des recepteurs toll-like 7 ou du recepteur toll-like 8 et un agoniste du recepteur toll-like 4
AU2013252785B2 (en) Use of CpG oligonucleotides co-formulated with an antibiotic to accelarate wound healing
US20170202977A1 (en) Polyketal particles including a cpg oligodeoxynucleotide for the treatment of lung cancer
US20070093439A1 (en) Short immunomodulatory oligonucleotides
JPH11512426A (ja) 免疫刺激応答を低減させて遺伝子発現を調節するためのシクロデキストリンの使用
WO2020247724A1 (en) Dna nanostructure-based vaccines
WO2006010838A2 (fr) Produits contenant au moins un principe actif anticancereux peu diffusible et un principe actif immunostimulant
ES2303441B1 (es) Uso del acido valproico o de una sal farmaceuticamente aceptable del mismo para la prevencion y/o el tratamiento de la adenoleucodistrofia ligada a x.
EP1649859A1 (fr) Produits pharmaceutiques contenant au moins un principe actif anticancereux peu diffusible et un principe actif immunostimulant sous forme d'oligodésoxynucléotide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AU CA JP US

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

ENP Entry into the national phase

Ref document number: 2371990

Country of ref document: CA

Ref country code: JP

Ref document number: 2000 606246

Kind code of ref document: A

Format of ref document f/p: F

Ref country code: CA

Ref document number: 2371990

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000910993

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000910993

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 09937057

Country of ref document: US

WWG Wipo information: grant in national office

Ref document number: 2000910993

Country of ref document: EP