Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
  • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids

Definitions

• the present invention relates to the use of 1 stabilized oligonucleotides for the preparation of a medicament with anti-tumor action.
• astrocytomas for example, whose treatment is mainly based on surgical excision and local brain irradiation, the median survival is only 4 to 6 months after surgical exeresis and 8 to 10 months with the combination of surgery and radiotherapy. Complementary chemotherapy lengthens survival in patients under 60, but very modestly, on the order of 3 months. Under this triple treatment, the median survival remains less than two years for histological grade III (anaplastic astrocytoma) and less than 1 year for grade IV (glioblastoma). The mortality for these two groups is 100% (Daumas-Duport C. et al. (1988), Cancer 62 (10) pp 2152-65).
• Stimulating the immune system in the treatment of cancer is an old idea and many products have been tested, such as bacterial extracts (Jaeckle KA et al. (1990), J. Clin. Oncol. 8 (8) pp 1408-18), bacterial DNA, in particular that of Mycobacterium bovis (MY-1) (Tokunaga T. et al. (1984), JNCJ 72 pp 955-62). MY-1 is ineffective for increase survival in a mouse glioma model (Nakaichi M. et al. (1995), J. Vet. Med. Sci. 57 (3) pp 583-5). IL2 (Herrlinger U. et al. (1996), J. Neurooncol.
• Oligonucleotides are polymers, formed by the combination of purine or pyrimidine bases and sugars, in particular ribonucleotides or deoxy ribonucleotides. In their natural state, the bonds are phosphoesters bonds sensitive to nucleases in the human organism. Thus, oligonucleotides have a very short half-life (of the order of a minute) when they are injected into humans, which limits their biological effects. Also, several studies have sought to stabilize oligonucleotides by modifying their chemical structure to make them resistant to nucleases.
• oligonucleotides such as, inter alia, phosphorothioates or methylphosphonates, (Crooke RM (1991), Anti-Cancer Drug Design S pp 609-46). The most frequently used are the phosphorothioate oligonucleotides. Certain oligodeoxynucleotides and in particular certain synthetic oligodeoxynucleotides have sometimes their own biological effects, apart from their classic antisense properties.
• oligodeoxynucleotides stimulate, in vi tro and in vivo, the proliferation of B lymphocytes, the activity of NK cells and induce the secretion by these cells of IFN ⁇ , IFN ⁇ , d 'IFN ⁇ , IL6, IL12 or TNF ⁇
• immunostimulatory oligodeoxynucleotides which are not defined as oligonucleotides having an unmethylated CG motif, have been described in Application EP 855,184: they include the binding sequence of eukaryotic transcription factors such as NFKB or the family AP-1 . Among these oligonucleotides, some nevertheless include the unmethylated CG motif.
• the use of the immunostimulatory properties of oligodeoxynucleotides comprising a non-methylated CG type motif is the subject of research in very varied fields:
• Carpentier et al. , Tokunaga et al. and Connell et al. (aforementioned) which respectively use an octameric phosphorothioate oligonucleotide (5 'TGACTGTGAACGTTCGAGATGA3'), a non-stabilized palindromic hexameric oligonucleotide (5 'ACCGAT GACGTCGCCGGTGACGGCACCACGACGACGGCCACGTGCT 3' purine pyrimine type ') and purine oligonucleotide show that said oligonucleotides have anti-tumor activity.
• an octameric phosphorothioate oligonucleotide (5 'TGACTGTGAACGTTCGAGATGA3')
• a non-stabilized palindromic hexameric oligonucleotide (5 'ACCGAT GACGTCGCCGGTGACGGCACCACGACGACGGCCACG
• the Authors show that, depending on the nature of their sequence, the immunostimulatory oligodeoxynucleotides have differential effects on NK activation, the proliferation of B lymphocytes, the secretion of IL12, IL6 and INF ⁇ .
• the immunostimulating oligonucleotides comprising a CG motif from the prior art (palindromic hexameric motif, 5 'purine purine motif CG pyrimidine pyrimidine 3' or octameric motif) which exhibit variable and random antitumor activities and are toxic, do not make it possible to define a set of non-toxic immunostimulatory sequences, effective, for antitumor use.
• the inventors have shown, surprisingly, that certain base pairs 3 ′ of the 5 ′ motif purine purine CG pyrimidine pyrimidine 3 ′ participate, crucially, in optimal anti-tumor activity. Consequently, the inventors have set themselves the goal of providing a set of immunostimulatory oligonucleotide sequences which better meet the needs of the practice in that they:
• the subject of the present invention is the use of stabilized oligonucleotides which comprise at least one octameric motif of the type:
• oligonucleotide means an oligodeoxynucleotide.
• the stabilized oligonucleotides comprise at least one octameric motif selected from the group consisting of: AACGTT-XX j , GACGTT-X ⁇ -, AGCGTT-XiX-, GGCGTT-X X X 2 , AACGTC-X ⁇ , GACGTC-XX 2 , AGCGTC-XX 2 and GGCGTC- X X X 2 , in which XI-X2 is AT, AA, CT or TT.
• the stabilized oligonucleotides preferably comprise at least one of the following octameric units: AACGTT-X 1 X 2 and GACGTC-XX 2.
• At least one of the bases of the octameric motif described above can be modified, in particular at least one of the cytosines can be replaced by a 5-bromocytosine.
• the stabilized oligonucleotide is selected from the group consisting of sequences SEQ ID NO: 8 to 48 According to the invention, the stabilized oligonucleotides are selected in particular from the group consisting of phosphorothioate oligonucleotides, phosphorodithioate oligonucleotides, mixed phosphodiester-phosp orothioate oligonucleotides, methylphosphonate oligonucleotides or oligonucleotides of which at least one end has been stabilized (Crooke RM (1991), AntiCancer Drug Design, 6 pp 609-46).
• the stabilized oligonucleotides used according to the present invention are phosphorothioates.
• the stabilized oligonucleotides can be used in the form of single strand or double strand.
• the stabilized oligonucleotides can be any length greater than 8 bases or 8 base pairs, preferably more than 20 ba- its or 20 base pairs.
• said oligonucleotides comprise between 20 and 100 nucleotides.
• the oligonucleotides can comprise several octameric units as defined above, whether adjacent or not; they can also include other biologically active sequences, such as antisense sequences.
• the octameric sequences can themselves be included in antisense sequences.
• the present invention also relates to the use of stabilized oligonucleotides as defined above, for the preparation of medicaments intended for the treatment of cancers in humans, whatever their nature and their degree of anaplasia, in particular in particular, cancers of the central and peripheral nervous systems, in particular astrocytomas, glioblastomas, medulloblastomas, neuroblastomas, melanomas and carcinomas.
• the stabilized oligonucleotides can advantageously be coupled by covalent, ionic or weak bonds to a molecule capable of increasing tumor affinity, such as for example an antibody specific for tumor tissue.
• the stabilized oligonucleotides are preferably used by the intra-tumor route, but they can also be administered by any other route, possibly by multiple routes, in particular by the intravenous, intraperitoneal, topical, transdermal, subcutaneous, intra-arterial, pulmonary, nasal route.
• -p aromatic or oral in solution, in aqueous or oily suspension, in powder or in any pharmaceutically acceptable form. They can be administered in one or more doses or in continuous release, in particular by means of osmotic micropumps or associated with any physical or chemical means, in particular with encapsulating agents such as colloidal dispersion systems and polymers, in order to have a dose therapeutically effective at the tumor site.
• the effective doses will be determined according to the age, state of health, weight of the patient and the type of cancer to be treated. Typically, the effective doses in humans are such that, in the case of an intra-tumor injection, a dose of oligonucleotide of 10 to 1000 ⁇ g / g of tumor is obtained, at least in part of the tumor. According to the invention, the use of the oligonucleotides can be combined with other therapies, in particular surgery, radiotherapy, chemotherapy, immunotherapy and differentiating therapies.
• said oligonucleotides are associated with cells of the immune system, such as macrophages, lymphocytes or antigen-presenting cells, immunity adjuvants, cytokines, anti-tumor antibodies, tumor extracts, tumor antigens or normal, irradiated or genetically modified tumor cells.
• cells of the immune system such as macrophages, lymphocytes or antigen-presenting cells, immunity adjuvants, cytokines, anti-tumor antibodies, tumor extracts, tumor antigens or normal, irradiated or genetically modified tumor cells.
• FIG. 1 illustrates the results obtained after an intra-tumor injection of the oligodeoxynucleotide phosphorothioate PT1 (SEQ ID No. 2 5'- TGACTGTGAAGTTCGAGATGA-3 '), in the CNS1 glioma model in the brain of rat Lewis ( Kruse CA et al. (1994), J. Neurooncol. 22 pp 191-200), on the survival time of the control animals (-); PT1 50 ⁇ g injected on D1 (-.-.-.), PT1 50 ⁇ g injected on D5 (....) and PT1 50 ⁇ g injected on D9 (), after the injection of the tumor cells.
• the statistical evaluation of the results is carried out by the Kaplan-Meier test.
• FIG. 2 illustrates the effect of an intra-tumor injection on D1 of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), at different doses, in the CNS1 glioma model of the rat Lewis, on the survival time of the control animals (-); PT1 50 ⁇ g (), PT1 10 ⁇ g (-.-.-.) And PT1 1 ⁇ g (.).
• - Figure 3 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No.
• FIG. 4 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide or of the phosphodiester PE1 oligodesoxynucleotide PE1 both having SEQ ID No. 2 (5'- TGACTGTGAACGTTCGAGATGA-3 '), in a model of subcutaneous glial tumors.
• the animals receive subcutaneously, at the tumor site, sodium chloride (control - • * -), or 100 ⁇ g of PE1 (-D-) or 100 ⁇ g of PT1 (- ⁇ -).
• the tumor volume is assessed every two days. The results are expressed as an average ⁇ wk (Anova Test).
• FIG. 5 illustrates the effect of an intra-tumor injection of the phosphorothioate PT1 oligodesoxynucleotide PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), or the phosphorothioate oligodesoxynucleotide IMM (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA-3'), in the model of neuroblastoma neuro2a in A / J mice (Sigal RK et al. (1991), J. Pediatr. Surg. 26 pp 389-96).
• the animals receive, subcutaneously at the tumor site, sodium chloride (control - • * -), 50 ⁇ g of PT1 (-B-), 100 ⁇ g of PT1 (-A-) or 50 ⁇ g of IMM (-D -).
• the tumor volume is evaluated every four days. The results are expressed as an average ⁇ wk (Anova Test).
• FIG. 6 illustrates the effect of an injection by subcutaneous or intraperitoneally of 1 oligodesoxynucleotide phosphorothioate PT1 (SEQ ID N ° 2 5 '-TGACTGTGAACGTTCGAGATGA-3'), at a dose of 50 ⁇ g in the model of neuroblastoma neuro2a in A / J mice (Sigal RK et al. (1991), J. Pediatr. Surg. 26 pp 389-96).
• the animals receive 100 ⁇ l of sodium chloride (control group - • * -) or 50 ⁇ g of PT1 injected by ip route (-B-) or by route sc distant from the tumor (-A-) in 100 ⁇ l of sodium chloride.
• FIG. 7 illustrates the effect of the stabilization of an oligonucleotide (SEQ ID NO: 9 5 '-TGACTGTGAACGTTATAGATGA-3') by a phosphorothioate (PT), phosphodiester (PDE), methylphosphonate (MP) type bond ; phosphodiester stabilized in 3 'by a dideoxycytosine (3') or mixed base: phosphodiester with the first 3 5 'bonds and the last three 3' phosphorothioate type bonds (mixed), on the antitumor activity in a tumor model subcutaneous glials.
• PT phosphorothioate
• PDE phosphodiester
• MP methylphosphonate
• the volume of the tumor is evaluated on D10. The results are expressed as an average ⁇ s.e.m ..
• FIG. 8 illustrates the effect of the 5 '-purine-purine-CG-pyrimidine-pyrimidine-XX- 3' sequences on the modulation of antitumor activity in a model of subcutaneous glial tumors.
• the volume of the tumor is evaluated on D8 (figure 8 to 10) or on D10 (figure 11).
• the results are expressed as an average ⁇ week:
• FIG. 8 illustrates the effect of the sequences of the oligonucleotides on the antitumor efficiency
• FIG. 9 illustrates the effect of the sequence of the 5'-purine-purine-purine-CG-pyrimidine-pyrimidine-3 'hexameric motif and of the adjacent sequences on the antitumor efficacy of the oligonucleotides
• FIG. 10 illustrates the effect of the 2 bases (XiX j ) adjacent to the 3 'sequence of the 5' hexameric motif-purine-purine-CG-pyrimidine-pyrimidine-3 'on the antitumor efficacy of the oligonucleotides
• Example 1 Effect of an Intra-Tumor Injection or an Intraperitoneal Injection of PT1 (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3') on the Survival of Animals in the CNS1 Glioma Model in the Lewis Rat Brain
• CNS1 glioma cells grown in vitro are grafted into the brains of healthy Lewis rats, with 10 5 cells in the right parietal cortex of rats
• the survival of animals treated with PT1 is greatly increased with long-term survival (> 90 days) of 67% (p ⁇ 0.01), 88% (p ⁇ 0.002) and 50% (p ⁇ 0.02 ) for rats treated on D1, D5 and D9 respectively.
• CNS1 glioma cells cultivated in vi tro are grafted into the brain of healthy Lewis rats, in a proportion of 10 5 cells in the right parietal cortex of rats (Kruse CA et al. (1994), J. Neurooncol, 22 pp 191- 200).
• an oligonucleotide without an immunostimulatory sequence does not increase survival, unlike an oligonucleotide with such a sequence (Example 1).
• Example 3 Effect of an intra-tumor injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ') at different doses on the survival of animals in the CNS1 glioma model of the Lewis rat 1. Procedure:
• the rats receive on Jl after the graft carried out under the conditions described in Example 1, an intra-tumor injection of 1 ⁇ g, 10 ⁇ g or 50 ⁇ g of PT1 dissolved in 7 ⁇ l of sodium chloride or the vehicle alone (n ⁇ 5 per group).
• CNS1 glioma cells are placed in culture.
• these PT1 cells are added at concentrations of 0.05 ⁇ M, 0.5 ⁇ M and 5 ⁇ M and at D3 on treats cells with trypsin and measures their viability.
• b) in vivo see the operating mode of 1 example 1. 2. Results: a) in vi tro PT1, at concentrations of 0.05 ⁇ M, 0.5 ⁇ M and 5 ⁇ M has no cytotoxic action direct on CNSl cells after 48 hours of culture. b) in vivo
• Example 5 Effect of an intratumoral injection of PT1, at a tumor site, on the development of a tumor grafted simultaneously, at a distance from this site. 1. Procedure:
• the tumor cells are grafted under the conditions described in Example 1, at two separate sites separated by 4 mm.
• PTl has a remote effect and the immune response induced at the injection site prevents the development of a tumor grafted simultaneously, at a distance from this site.
• Example 6 Study of the immune memory at 3 months in the CNS1 glioma model of the Lewis rat after injection of PT1 (SEQ ID No. 2 5 • -TGACTGTGAACGTTCGAGATGA-3 ')
• Example 7 Effect of an intra-tumor injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ') or of an oligo-deoxynucleotide (IMM) comprising a non-immunostimulatory octanucleotide sequence (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA -3') in a subcutaneous glial tumor model.
• PT1 SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 '
• IMM oligo-deoxynucleotide
• Tumor growth is measured every two days, and the tumor volume is estimated using the formula:
• Example 8 Effect of an intra-tumor injection of PT1 (phosphorothioate oligodesoxynucleotide) or PE1 (non-stabilized oligodesoxynucleotide) in a model of subcutaneous glial tumors; PTl and PE1 both having the same immunostimulatory sequence (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3')
• CNS1 glioma cells cultivated in vi tro are injected subcutaneously into healthy Lewis rats, at the rate of 2 ⁇ 10 6 cells in the right flank, under the conditions described in Example 7.
• Tumor growth is measured every two days, and the tumor volume as described in Example 7.
• the animals are sacrificed on D12 after the injection of the tumor cells.
• J22 is approximately 800 mm 3 in the control group, approximately
• PTl Example 10 Effect of a Subcutaneous or Intraperitoneal Injection of PT1 (SEQ ID No. 2 5'-TGACTGTGAACGTTCGAGATGA-3 ") at a dose of 50 ⁇ g in the model of neuroblastoma neuro2a in mice A / J 1. Procedure:
• the tumor is obtained according to the procedure described in Example 9.
• 50 ⁇ g of PTl in 100 ⁇ l of sodium chloride or 100 ⁇ l of sodium chloride (control group) are injected either by subcutaneous route away from the tumor, or by intraperitoneal route (n ⁇ 6 animals per group).
• Tumor growth is measured every four days and the tumor volume is measured as shown in Example 7.
• D22 is approximately 1000 mm 3 in the control group, approximately 400 mm 3 in the group treated with 50 ⁇ g of PTl injected subcutaneously and approximately 500 mm 3 in the group treated with 50 ⁇ g of PTl injected intraperitoneally.
• EXAMPLE 11 Effect of a repeated subcutaneous injection of PTl (SEQ ID No. 2 5 '-TGACTGTGAACGTTCGAGATGA-3') or of IMM (SEQ ID No. 1 5 '-TGACTGTGAAGGTTAGAGATGA-3') dose of 10 ⁇ g for 15 days in the neuroblastoma neuro2a model in A / J mice
• the tumor is obtained according to the procedure described in Example 9.
• Example 12 Effect of the Stabilization of an Oligonucleotide (SEQ ID N: 9 5 '-TGACTGTGAACGTTATAGATGA-3') on the Antitumor Activity in a Model of Gluceal Subcutaneous Tumors
• the most effective ODNs are, the oligonucleotides of phosphorothioate type, stabilized in 3 ′, or mixed, with a decrease in the tumor volume of respectively 50%, 53% and 34%, compared to the volume of the controls. .
• Example 13 Effect of the 5 ′ -purine-purine-CG-pyriii.idine-pyrimidine-XX - 3 ′ sequences on the modulation of the antitumor activity
• oligonucleotide PT1 SEQ ID No. 2 5 '-TGACTGTG AACGTTCGAGATGA-3'
• oligonucleotide An 2 SEQ ID NO: 8 5 '-TGCCAGTGACGTCATGTGAC-3'
• the difference in efficiency of these two oligonucleotides is linked either to the sequence of the 5'-purine-purine-purine-CG-pyrimidine-pyrimidine-3 'hexameric motif comprising the unmethylated CG motif (underlined sequence) or to the sequences adjacent to this motif .
• Example 2.1 the differences in efficiency observed, in Example 2.1, between the oligonucleotides PT1 and An2 are linked to the nature of the sequences adjacent to the hexameric motif.
• the optimal antitumor sequences are found in the adjacent sequences of the oligonucleotide An2.
• the oligonucleotide An 14 (SEQ ID NO: 3 5'- TGACTGTGAACGTT ⁇ AGATGA-3 ') is less effective than the oligonucleotide An 15 (SEQ ID NO: 9, 5'- TGACTGTGAACGTTATAGATGA-3').
• nucleotides AT 3 ′ of the hexameric motif (An2 (FIG. 8) and An 15 (FIG. 10) make it possible to increase the antitumor efficiency, while the nucleotides CC (An 14, FIG. 10) and CG (PT1, fig. gure 8) have less marked anti-tumor effects.
• CG CG

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Veterinary Medicine (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Epidemiology (AREA)
• Biotechnology (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Steroid Compounds (AREA)
• Saccharide Compounds (AREA)
• Medicinal Preparation (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (9)

Applications Claiming Priority (2)

Related Child Applications (2)

Publications (2)

Family

ID=9543401

Family Applications (1)

Country Status (12)

Cited By (1)

Families Citing this family (29)

Family Cites Families (37)

• 1999
  • 1999-03-19 FR FR9903433A patent/FR2790955B1/fr not_active Expired - Fee Related
• 2000
  • 2000-03-17 DK DK00910993T patent/DK1162982T3/da active
  • 2000-03-17 PT PT00910993T patent/PT1162982E/pt unknown
  • 2000-03-17 ES ES00910993T patent/ES2235839T3/es not_active Expired - Lifetime
  • 2000-03-17 JP JP2000606246A patent/JP2002539265A/ja active Pending
  • 2000-03-17 CA CA002371990A patent/CA2371990A1/fr not_active Abandoned
  • 2000-03-17 DE DE60018050T patent/DE60018050T2/de not_active Expired - Lifetime
  • 2000-03-17 WO PCT/FR2000/000676 patent/WO2000056342A2/fr not_active Ceased
  • 2000-03-17 EP EP00910993A patent/EP1162982B9/fr not_active Expired - Lifetime
  • 2000-03-17 US US09/937,057 patent/US7700569B1/en not_active Expired - Fee Related
  • 2000-03-17 AU AU33006/00A patent/AU3300600A/en not_active Abandoned
  • 2000-03-17 AT AT00910993T patent/ATE288759T1/de active
• 2001
  • 2001-09-28 US US09/967,881 patent/US7108844B2/en not_active Expired - Fee Related

Also Published As

Similar Documents

Legal Events