WO2000052181A2 - Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees - Google Patents

Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees Download PDF

Info

Publication number
WO2000052181A2
WO2000052181A2 PCT/IL2000/000118 IL0000118W WO0052181A2 WO 2000052181 A2 WO2000052181 A2 WO 2000052181A2 IL 0000118 W IL0000118 W IL 0000118W WO 0052181 A2 WO0052181 A2 WO 0052181A2
Authority
WO
WIPO (PCT)
Prior art keywords
protein
coding sequence
peptide
cells
expression
Prior art date
Application number
PCT/IL2000/000118
Other languages
English (en)
Other versions
WO2000052181A3 (fr
Inventor
David Engelberg
Avishai Mimran
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem
Priority to AU28236/00A priority Critical patent/AU2823600A/en
Priority to EP00906580A priority patent/EP1173593A2/fr
Priority to JP2000602791A priority patent/JP2002537815A/ja
Publication of WO2000052181A2 publication Critical patent/WO2000052181A2/fr
Publication of WO2000052181A3 publication Critical patent/WO2000052181A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA

Definitions

  • the present invention relates to an expression cassette comprising a regulatory element, a heterologous coding sequence, a termination signal and optionally a selectable marker as herein after defined, and to the different uses of said expression cassette.
  • yeast An attractive alternative for an expression system is of the yeast, and in particular, the baker's yeast Saccharomyces cerevisiae. As with other eukaryotic systems, most foreign proteins expressed in this eukaryote are accurately processed post-translationally and are biologically active. In addition, as a food organism, yeast is highly acceptable for the production of pharmaceutical proteins, thus reducing the cost of manufacturing such proteins. Yet, despite the great potential of yeast as a protein factory, this organism is not widely used. The major reason for this may be the fact that the level of expression obtained in yeast is usually much lower than that obtained in bacteria [Romanos M.A. et al. (1992) ibid.].
  • yeast expression vectors are available. All vectors (similarly to the bacterial and mammalian vectors) contain strong promoters (usually a promoter of glycolitic genes for example, GPD1, ADH1, PGK1). In addition, they contain the 2 ⁇ origin of replication which allows several plasmid replications during one round of cell cycle [Schneider J.C. and Guarente L. Meth. Enzymol. 194:373-388 (1991); Schena M. et al. Meth. Enzymol. 194:389-398 (1991); Rose A.B. and Broach J.R., Meth. Enzymol. 185:234-279 (1990)].
  • these plasmids are present in 60-100 copies per cell.
  • Some of the vectors also contain an inducible promoter, the most widely used is the GAL1-10 promoter [Schena M. et al. (1991) ibid.].
  • the strategy used with yeast vectors in order to increase expression is a combination of high transcription rate with the presence of many copies of the vector per cell.
  • Cells harboring those vectors must be grown on synthetic media under selective conditions to maintain the plasmids in the cell. These conditions are usually not optimal. When grown in laboratory flasks these cultures enter stationary phase at low concentrations and the quantities of proteins obtained are usually low. When grown in industrial fermentors, high cell concentrations could be obtained via special treatments and long and expensive incubation time.
  • the present invention aims at the development of an expression vector utilizing the promoter region of the GCN4 gene for regulating foreign coding sequence expression.
  • GCN4 encodes a transcription activator, which induces transcription of coding sequences of biosynthetic enzymes [Hinnebusch A.G., Microbiol. Rev. 52:248-273 (1988); Hinnebusch A.G. In Broach J.R. et al, Eds. The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. Cold Spring Harbor Laboratory. NY pp 319-414 (1992); Hinnebusch A.G., J. Biol. Chem. 272:21661-21664 (1997)].
  • GCN4 Under optimal growth conditions on media supplemented with amino acids and pyrimidine and purine bases, GCN4 is not expressed. When cells are starved for amino acids, Gcn4 expression is dramatically induced, and consequently, transcription of biosynthetic genes commences. Expression of GCN4 is regulated mainly at the translational level. The mRNA levels of GCN4 are high under most growth conditions, but under optimal growth conditions, translation rate of this mRNA is extremely low and GCN4 protein is barely detectable. This minimal translation rate is maintained by 4 short open reading frames located in the 5' non-coding leader of the message (4uORF) [Hinnebusch, A.G. (1997) ibid.; Dever, T.E. et al. Cell 68:585-596 (1992)].
  • Ribosomes recognize the most upstream ORF and begin translation. Yet, they dissociate from the mRNA at the stop codon and re-initiate translation at another short ORF. In most cases ribosomes do not reach the 5th ORF which is the GCN4 coding sequence [Hinnebusch A.G. (1997) ibid.]. This prevention of GCN4 translation depends on the high rate of re-initiation. Under starvation for amino acids the rate of re-initiation is reduced to a minimum because the activity of initiation factor 2 (eIF2 ⁇ ) is inhibited. Inhibition of eIF2 ⁇ is obtained through its phosphorylation, catalyzed by the Gcn2 kinase.
  • eIF2 ⁇ initiation factor 2
  • GCN4 As translation of GCN4 (and of the GCN4/ ⁇ -GAL chimeric gene) increases when eIF2 ⁇ is phosphorylated and its activity decreases, it was recently suggested to use the GNC4/ ⁇ -GAL gene as a marker which monitors the level of eIF2 ⁇ phosphorylation and activity [Dever T.E. Methods 11:403-417 (1997)]. However, hitherto it was unknown whether the GCN4 upstream sequences (with no coding sequences) are capable of controlling transcription and translation of an heterologous gene at the translational level.
  • GCN4 upstream sequences could be utilized for efficient and regulated expression of foreign protein by the expression cassette ofthe invention.
  • the present invention relates to an expression cassette comprising:- (a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (b) a heterologous coding sequence downstream to said regulatory element; (c) a termination signal operably linked downstream to said heterologous sequence; and (d) optionally, an operably linked selectable marker.
  • the GCN4 transcription factor within the expression cassette ofthe present invention is preferably of the yeast's Saccharomyces cerevisiae, and more preferably comprises the nucleotides -1067 to -1 upstream to the GCN4 coding sequence.
  • the heterologous coding sequence/s within the expression cassette of the invention encode amino acid sequence/s, particularly those having a therapeutic utility.
  • the invention in a second aspect, relates to an expression vector comprising the expression cassette ofthe invention.
  • the invention also relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- (a) providing eukaryotic cells; (b) transforming said cells provided in (a) with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter, preferably that of the yeast S.
  • the method further comprising the steps of:- (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and (e) optionally, isolating said functionally active protein or peptide obtained in step (c) from said cells.
  • the expression vector of the invention may further comprise at least one replication element.
  • the invention relates to a therapeutic protein or peptide produced by the method of the invention and to eukaryotic cells transformed with the expression cassette or vector of the invention, said cells being capable of expressing a heterologous coding sequence comprised therein, to obtain said therapeutic protein or peptide.
  • FIG. 1 Schematic description of the GCN4 gene and the primers used for promoter cloning. Open reading frames are shown as boxes and primers as arrows.
  • Figure 2A-2C The basic pGES vector family containing the HSA cDNA. Fig. 2A show the integrative vector pGES306-HSA, Fig. 2B shows the centromeric vector pGES316-HSA and Fig. 2C shows the multicopy vector ⁇ GES426-HSA.
  • FIG. 3 Induction and expression of HSA by pGES vectors containing either the long regulatory element (Long) or the middle sized regulatory element (Mid.), both containing the GCN4 promoter.
  • Western blot analysis using anti-HSA antibodies was performed on protein extracts prepared from cultures (BJ2168 cells) harboring either pGES306-L-HSA (Long) or pGES306-M-HSA (Mid.), 8 and 10 hours after addition of 3-AT.
  • FIG. 4A-4B Time course and dose response analysis of induction of HSA expression.
  • Fig. 4A shows a culture of BJ2168 cells harboring pGES426-L-HSA grown to logarithmic phase and than supplemented with 3-AT (20 mM). Samples were removed at indicated time points and subjected to western blot analysis.
  • Fig. 4B shows a similar culture grown to logarithmic phase and then divided to six fractions, each fraction supplemented with the indicated concentrations of 3-AT. Cultures were further grown for 7 hours before collection and analysis by western blotting. Purified HSA (10 and 50 ng) were loaded on the right lane of each gel.
  • Figure 5A-5C Expression of HSA from pGES vectors is induced at the translational level.
  • a culture harboring the oGES306-L-HSA vector and culture harboring the control plasmid pRS306-S were grown to logarithmic phase when 3-AT was added. At the indicated time points samples were removed.
  • Protein extracts and RNAs were prepared from each sample and analyzed by western blot and primer extension respectively.
  • Fig 5A shows the western blot analysis.
  • Fig. 5B shows the primer extension analysis using GCN4 primer.
  • Fig. 5C shows the primer extension analysis using HSA primer.
  • the present invention describes the development of a new family of yeast expression vectors, which are based on the promoter region of GCN4 as the regulatory element. Expression from these vectors is tightly controlled and is induced under amino acid starvation conditions.
  • Biosynthesis of proteins (transcription and translation) in living organisms is similar. Therefore, in principal, any cell type may be used as a host for the expression of a foreign gene. Nevertheless, for practical reasons, to date only few cell systems have been employed as "factories" for proteins. These practical reasons include, inter alia, the cost of growing the host cell, the efficiency in which the foreign protein is expressed, the cell's stability which may alter as a result of the expression of unrecognized proteins, the desire to obtain biologically functional proteins and the cost and efficacy of producing a purified protein.
  • yeast for the expression of foreign proteins provides numerous advantages. While yeast are edible organisms and thus safe to use as a "factory" for pharmaceuticals. Prokaryotes, such as Escherichia coli, have toxic cell wall pyrogens, while mammalian cells may contain oncogenic or viral DNA, so that the products from these organisms must be tested more extensively. Further, yeast can be grown rapidly on simple media and to high cell density, their genetics are advanced, and they can be manipulated almost as readily as E.coli [Romanos M.A. et al. Yeast 8:423-488 (1992)]. Therefore, the use of yeast cells for the production of proteins reduces cost and is less time consuming.
  • yeast cells are eukaryotic cells, many of the post-translational processes necessary for the production of a biologically functional product are correctly performed.
  • the system ofthe present invention differs from currently available expression vectors since it is controlled at the translational level, allowing rapid induction. Under non-inducible conditions, expression from these vectors is quite well suppressed. Further, this system allows fine control on the level of expression, since this level is directly proportional to the concentration of the inducer. Yet further, an integrated version of the cassette is almost as efficient as a multicopy version. Therefore, the pGES expression system could be used under various growing conditions, including in rich, non-selective media, which is clearly an advantage.
  • the present invention thus relates to an expression cassette comprising: -(a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (b) a heterologous coding sequence downstream to said regulatory element; (c) a termination signal operably linked downstream to said heterologous sequence; and (d) optionally, an operably linked selectable marker.
  • the expression cassette may comprise a genomic or cDNA library, which may be used for many different purposes, as known to the man skilled in the art, e.g. for screening.
  • heterologous coding sequence is meant any sequence which encodes a therapeutic protein or peptide.
  • the coding sequence may be a naturally occurring sequence or a derivative thereof, and is not of yeast origin.
  • nucleic acids in a coding or in a non-coding sequence, means any modification thereof including, insertions, deletions, mutations and substitutions.
  • the expression cassette of the invention may further comprise operably linked thereto a replication element, to provide an expression vehicle which will be substantially independent from the host cell replication elements.
  • a replication element When a replication element is required for the efficient expression of the coding sequence within the expression cassette of the invention, it may be any suitable replication element, for example, the 2 ⁇ element, which supports maintenance of many copies of the gene in the cell [Rose A.B. and Broach J.R. Meth. Enzymol. 185:234-279 (1990)] or a centromeric element (CEN) which replicates together with the endogenous DNA and is maintained therefore as a single copy per cell.
  • CEN based vectors are combined in many cases with auto-replicating sequences (ARS).
  • ARS auto-replicating sequences
  • the CEN-ARS based vectors which may also be employed, are maintained in few copies (usually 1-2).
  • the expression cassettes of the invention may also be employed as an integrative single copy fragment, which does not require growing the cells on a selective medium.
  • the said GCN4 transcription factor is of the yeast Saccharomyces cerevisiae.
  • the regulatory element employed in the expression cassette of the invention comprises at least the nucleotides -904 to -1, upstream to the GCN4 coding sequence.
  • the expression cassette of the invention comprises nucleotides -1067 to -1 upstream to the GCN4 coding sequence and more preferably, it has the nucleotides -1067 to -1 of said sequence upstream to the GCN4 coding sequence.
  • the expression cassette according to the invention comprises a coding sequence which encodes a naturally occurring amino acid sequence or a derivative thereof.
  • the amino acid sequence corresponds to a natural protein, polypeptide or peptide, or to a functional derivative of said natural protein or peptide, to an essential fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments.
  • the term 'functional derivative' used herein means any modification of the naturally occurring sequence, including insertions, deletions or substitutions of nucleic or amino acids residues therein, or any other suitable modification which does not damage the biological function of the nucleic or amino acid sequence.
  • the functional derivatives according to the invention may also be any dimeric or multimeric form of said amino acid according to the invention.
  • Functional proteins or peptides within the scope of the invention encompass any protein or peptide having a therapeutic value.
  • Such proteins or peptides may be selected from the group consisting of enzymes, antibodies, cytokines, hormones, receptors, transcription factors or any chimera of said therapeutic products with a different protein or peptide.
  • therapeutic means any protein, polypeptide or peptide having an industrial application. Thus it may refer to any pharmaceutical, agricultural, veterinary or diagnostic product.
  • the expression cassette comprises a heterologous coding sequence which encodes the human serum albumin (HSA) protein.
  • HSA human serum albumin
  • the termination signal according to the invention may be any suitable terminator which is capable of terminating the transcription of coding sequence and of adding polyadenylated ribonucleotides to the 3" end of the primary transcript obtained therefrom.
  • the termination signal thus may be selected from the group consisting ofthe yeast alcohol dehydronease gene (ADH1), TRP1, glyceralkehyde-3 -phosphate dehydrogenase (GAP, GAPDH), MF1, phosphate regulated terminator (e.g. of PH05), phosphoglycerate kinase (PGK), CYC1 or the GCN4 terminator.
  • the invention in a second aspect, relates to an expression vector comprising the expression cassette ofthe invention.
  • the expression vector of the invention may include, in addition to the expression cassette, any other element required for the efficient and regulated expression of the product encoded by the coding sequence, such as an ORI sequence. Further, the vector may include an appropriate polyA signal, and/or an intron splicing signal, e.g. of the SV40 virus.
  • the vector may include other elements such as sequences which encode peptides facilitating the secretion of the protein expressed by the heterologous coding sequence incorporated in the expression cassette into the growing media (secretion elements). Further, it may contain sequences which encode peptides capable of eliciting production of antibodies thereagainst, or even those encoding tagging proteins, which bind to specific columns during affinity purification (e.g. polyHis that binds to to agarose-nickel beads, gluthatione S-transferase (GST) that binds to gluthatione beads, cellulose binding domain (CBD) which binds to cellulose).
  • GST gluthatione S-transferase
  • CBD cellulose binding domain
  • the expression vector according to the invention is the integrative plasmid substantially as shown in Figure 2A.
  • the expression vector of the invention is the centromeric plasmid substantially as shown in Figure 2B.
  • the expression vector ofthe invention may be the multicopy plasmid substantially as shown in Figure 2C.
  • the invention relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- (a) providing eukaryotic cells; (b) transforming said cells provided in (a) with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (ii) a heterologous coding sequence downstream to said regulatory element; (iii) a termination signal operably linked to said heterologous sequence; and (iv) optionally, an operably linked selectable marker; the method further comprising the steps of (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and (e
  • the expression cassette when necessary for efficient expression, further comprises a replication element.
  • the cells provided for the expression ofthe coding sequence may be any eukaryotic cell capable of efficiently and sufficiently expressing said coding sequence, thus producing an active product.
  • the eukaryotic cell may be of a mammalian type.
  • the eukaryotic cells employed by the method of the invention may be yeast cells.
  • the yeast cells will be those capable of expressing said coding sequence and may include, ter alia, the yeast S. cerevisiae, Schizosaccharomyces pombe or Pichia pastor is.
  • the yeast cells are of the S. cerevisiae type, in particular, those of the strains SPl, W303, C13ABYS86, BJ2407, BJ2168, H625, H628, and H640 and is preferably ofthe BJ2168 strain.
  • the upstream sequence of GCN4 transcription factor (including the promoter sequence and the 5'UTR) is ofthe yeast S. cerevisiae and comprises at least the nucleotides from -904 to -1 (upstream to the GCN4 coding sequence). Nevertheless, the said sequence may comprise the nucleotides from -1067 to -1 upstream to the GCN4 transcription factor. Moreover, the sequence employed by the method ofthe invention is that having the nucleotides from -1067 to -1, upstream to the GCN4 coding sequence.
  • any heterologous coding sequence which encodes an amino acid sequence may be utilized.
  • the amino acid sequence may comprise naturally occurring amino acids and/or derivatives ofthe same, as defined hereinbefore.
  • amino acid sequences produced by utilizing the expression cassette ofthe invention will preferably correspond to a natural protein or peptide having an industrial purpose or to a functional derivative thereof, to a fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments thereof.
  • the protein or peptide product may be an enzyme, an antibody, a cytokine, a hormone, a receptor, a transcription factor or a functional derivative thereof or any other protein or peptide having a biological and/or therapeutic function.
  • the human serum albumin protein is obtained by the method ofthe invention.
  • One substantial advantage ofthe method of the invention is the possibility to obtain the expressed protein in a controlled manner and with high yield. As will be shown in the following Examples, under conditions which mimic amino acid starvation, HSA is obtained in high quantities.
  • the termination signal may be any suitable termination signal, however, is preferably selected from yeast, for example, the termination signal of ADHl, TRPl, GAP (GAPDH), MFl, PH05, PGK, CYCl or of GCN4.
  • the cells are transformed by the method of the invention with the expression vector which is the integrative plasmid substantially as shown in Figure 2A.
  • the cells may be transformed by the method of the invention with the centromeric expression vector substantially as shown in Figure 2B.
  • the cells may be transformed by the method of the invention with the multicopy expression vector substantially as shown in Figure 2C.
  • the intracellular level of protein expression (per cell) obtained with the pGES vectors is similar to that of currently available vectors. Yet, as it could be used as an integrated vector and is still inducible in dense cultures (Fig. 5), these vectors may give rise to improved protein production (in quantity and quality). An improved transcription rate could also be obtained through a combination of a strong constitutive promoter (from another gene) with the 5'UTR of GCN4. Such chimera may be more efficient than pGES and still be regulated at the translational level.
  • the invention concerns with eukaryotic cells transformed with the expression cassette or expression vector of the invention which cells are capable of expressing the heterologous coding sequence comprised therein.
  • Eukaryotic cells transformed with the system of the invention may be mammalian cells, yeast cells, fungi, insect cells, avian cells or any other eukaryotic cell capable of efficiently producing the desired therapeutic protein or peptide.
  • insect cell lines which may be transformed with the system of the invention, but not limited thereto, are Spodeoptera frugiperda (e.g. sf9 cell linej, Trichoplusia ni (Tn), Mamestra brassicae, Estigmene acrea, Anopheles gambiae, Aedes albopictus and Aedes aegypti Mos20.
  • Spodeoptera frugiperda e.g. sf9 cell linej, Trichoplusia ni (Tn)
  • Mamestra brassicae e.g. sf9 cell linej, Trichoplusia ni (Tn)
  • Mamestra brassicae e.g. sf9 cell linej
  • Estigmene acrea e.g. sf9 cell linej
  • Mamestra brassicae e.g. sf9 cell linej
  • Mamestra brassicae e.g. sf9 cell linej,
  • GCN4 translation rate is constitutively high and not regulated (gcd mutants are described by Hinnebusch et al. [Hinnebusch A.G., Microbiol. Rev. 52:248-273 (1988); Hinnebusch A.G. In Broach J.R. Jones et al Ed.: The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY pp 319-414; and Harashima S. and Hinnebush A.G., Mol. Cell Biol. 6:3990-3998 (1986)]).
  • GCN4 translation is induced by the yeast Ras/cAMP cascade and is therefore high in RAS vaI119 and bcyl strains [Engelberg D. et al, Cell 77:381-390 (1994)].
  • pGES plasmid could be used in gcd strains and in RAS vain9 and bcyl strains as constitutive vectors to obtain large quantities of proteins for research and industry.
  • any protein or peptide, particularly therapeutic ones, produced by such cells encompass part of the invention.
  • One example for such a protein is the HSA protein.
  • the invention relates to the use of the expression cassette of the invention, wherein the heterologous coding sequence encodes a therapeutic protein or peptide, in the production of a therapeutic protein or peptide.
  • the invention relates to the use of the expression cassette of the invention, wherein the heterologous coding sequence encodes a therapeutic protein or peptide, in the preparation of a pharmaceutical composition containing said protein or peptide.
  • the expression cassette ofthe invention may be utilized for the expression of libraries, for example, for cloning via functional complementations of mutants, for screening genes which allow growth under certain conditions (e.g. toxic conditions, under extreme conditions or in the presence of drugs), for the detection of protein-protein interactions (through the expression of a sequence encoding a chimeric peptide), as with the two hybrid system.
  • the nucleotide sequence of GAL4-DNA binding domain fused to a cDNA library or alternatively, the sequence of GAL4 activation domain fused to a library, will be expressed using the expression cassette of the invention.
  • the expression cassette may also be utilized in the Sos recruitment system (SRS) or in the Ras recruitment system (RRS) system, in which the membrane localized cDNA library, the SOS-cDNA library or the RAS-cDNA library, may be expressed using the system ofthe invention.
  • SRS Sos recruitment system
  • RRS Ras recruitment system
  • Example 1 Materials and methods Yeast strains and growth conditions
  • the SPl strain (MATa, his3, leu2, ura3, trpl, ade8 and can [Kataoka T. et al., Cell 37:437-445 (1984)] was obtained form Wigler M.) was used as a source of genomic DNA from which the GCN4 upstream sequences were cloned by PCR.
  • the BJ2168 strain (MATa, prcl-407, prbl-1122, pep4-3, leu2, trpl, and ura3-52 [Zubenko, G.S. et al, Genetics 96:137-146 (1980)] was used as a host for all expression plasmids and was obtained from the yeast genetic stock center at UC Berkley.
  • Yeast cells were grown on either YPD (1% yeast extract, 2% bactopeptone, 2% glucose) or on SD media (0.17% yeast nitrogen base w/o amino acids and ammonium sulfate (Difco), 0.5% NFL ⁇ SO ⁇ , 2% glucose and the required amino acids and uracil (40 mg/liter)).
  • YPD 1% yeast extract, 2% bactopeptone, 2% glucose
  • SD media 0.17% yeast nitrogen base w/o amino acids and ammonium sulfate (Difco), 0.5% NFL ⁇ SO ⁇ , 2% glucose and the required amino acids and uracil (40 mg/liter)).
  • SD media 0.17% yeast nitrogen base w/o amino acids and ammonium sulfate (Difco), 0.5% NFL ⁇ SO ⁇ , 2% glucose and the required amino acids and uracil (40 mg/liter)
  • Strains harboring plasmids were grown on SD (-uracil).
  • Primer 3 ' - 5 'GCGCCGGATCCTTTATTTGTATTTAATTTATTTTCTTGAGC-3 ' This primer contains the BamHI site and was used in all PCR reactions (Fig. 1).
  • Short promoter - 5 ' GCGCCGACTAGTCGGAAGATAAATACTCCAAC-3 ' .
  • This primer was used in combination with primer 3' to clone the shorter promoter by amplifying the sequence from nucleotide number -706 to nucleotide -1.
  • PCR products were digested with Spel and BamHI and ligated to pBluescript to obtain the plasmids pBSG-Short (pBSG-S), pBSG-Mid (pBSG-M) and pBSG-Long (pBSG-L).
  • the cloned DNAs were sequenced and found identical to the sequence of this region as appears in the Saccharomyces genome database.
  • HSA human serum albumin
  • the cDNA of HSA was cloned as a BamHI-EcoRI fragment to pBSG-S, pBSG-M and pBSG-L.
  • These chimeric genes contained about 70 bp of the 5'UTR sequences of HSA which were found to reduce expression levels (data not shown).
  • a 885 bp BamHI-NcoI fragment containing the entire 5'UTR and 815 bp of the HSA coding, was replaced with a 815 bp PCR product containing only the first 815 bp of the HSA coding sequence.
  • Primers used for this PCR reaction were as follows:- HSA-ATG - 5'GCGCGCGGATCCATGAAGTGGGTAACCTTTATTTCCC-3'.
  • HSA-900 5'GCAGATCTCCATGGCAGCATTCC-3'.
  • the plasmids obtained were named pBSG-S-HSA, pBSG-M-HSA and pBSG-L-HSA.
  • the GCS4-HSA moiety of each of these plasmids was removed as a Spel-EcoRI fragment and inserted into pRS316 (a centromeric yeast plasmid [Sikorski R.S. and Hieter P., Genetics 122:19-27 (1989)], pRS306 [Sikorski R.S. and Hieter P. (1989) ibid.] and pRS426 (a 2 ⁇ based vector [Chritianson T.W. et. al, Gene 110: 119-122 (1992)].
  • the terminator of ADHl (0.6 Kb EcoRI fragment) was ligated to the EcoRI site of wach of the 9 plasmids obtained.
  • the final constructs were named as follows:- (a) pGES306-S-HSA, for the GCN4 based expression system, being derived from the pRS306 plasmid and containing the short GCN4 regulatory element and the HSA cDNA; (b) pGES306-M-HSA, which is similar to pGES-S-HSA however containing the medium sized GCN4-derived regulatory element; (c) pGES-L-HSA containing the long GCN4 regulatory element; (d) pGES316-S-HSA; (e) pgES316-M-HSA; (f) pGES315-L-HSA; pGES426-S-HSA; (g) pGES426-M-HSA and
  • Protein extracts were prepared as previously described [Gross E. et al, Mol. Cell. Biol. 12:2653-2661 (1992)]. All SDS-PAGE gels contained 10% acrylamide. Protein blotting was performed with a LKB semi-dry blotter for two hours under constant current (mA-0.8xgel area in cm 2 ). Polyclonal anti HSA antibodies (RAHu/albumin) (from Nordic Immunology) were used in a dilution of 1 :50,000. Peroxidase conjugated Goat anti rabbit antibodies (from Jackson Immunological) were used in a dilution of 1 :25,000. Purified HSA (from SIGMA) was used as a standard positive control. RNA preparation and primer extension analysis
  • RNA preparation and primer extension analysis were performed as previously described [Engelberg D. et al, Mol. Cell. Biol. 14:4929-4937 (1994)] using the following primers :-
  • GCN4-extension 5'ATAATTCGCTAGTGAAACTGATGGGC 3'
  • Primer extension products were separated on 6% acrylamide 7 M urea gel.
  • heterologous coding sequence requires a fragment of at least 904 bp upstream to the GCN4 coding sequence
  • the cDNA encoding HSA was ligated downstream to the cloned 706 bp fragment.
  • This GCN4-S-HSA cassette was inserted into a multicopy yeast plasmid as well as into centromeric and integrated plasmids (Fig. 2).
  • the terminator of the ADHl gene was inserted downstream to GCN4-S-HSA.
  • the resulting plasmids were introduced into yeast and HSA expression was monitored by western blot analysis. Expression was tested under various growth conditions, including amino acid starvation and 3-AT treatment. In all cases, using the short regulatory element, expression of HSA was not detectable (data not shown).
  • the inventors have cloned two longer fragments of GCN4 upstream sequences, one containing the sequences from -904 to -1 and a longer one containing the sequence from -1067 to -1 (Materials & Methods, Figs. 1 and 2).
  • HSA gene was ligated to these fragments to obtain plasmids pGES-M-HSA and pGES-L-HS A and introduced to yeast, high expression level of HSA was detected (Fig. 3).
  • HSA expression was barely detectable prior to induction with 3-AT, performed as described hereinafter.
  • Expression level from constructs containing the Long regulatory element was usually higher than that obtained with the middle sized element (Mid.), as depicted from the levels of expression after 10 hours of induction (Fig. 3).
  • yeast cells harboring pGES426-L-HSA were grown to logarithmic phase on SD(-URA). Then, cells were collected and re-suspended in SD(-URA,-HIS) medium supplemented with 20 mM 3-AT. Samples were removed from the culture at indicated time points ( Figure 4A) and expression of HSA was measured (Fig. 4A). Already 2 hrs after addition of 3-AT, expression of HSA could be easily detected. As may be seen from the figures, expression reached its maximum level between 6 to 8 hours after induction.
  • HSA mRNA and protein levels were measured (Fig. 5).
  • Protein extracts were tested by Western blot analysis using anti HSA antibodies (Fig. 5A), whereas RNA preparations were subjected to primer extension analysis (Figs. 5B and 5C). It is evident from the results presented herein that the mRNA encoding HSA is expressed at a similar level before and after the 3-AT induction. In addition, as may be seen from a compression between Fig. 5B and Fig.
  • this construct was then integrated into the yeast genome and the resulting clones were grown on rich, non-selective media to high protein concentration (to about 5xl0 8 cells/ml) prior to the addition of 3-AT. Under these conditions expression of HSA was still efficiently induced (Fig. 6). In fact, the level of HSA obtained per cell was just slightly less than that obtained using the multicopy pGES426-L-HSA vector. As the culture grown on YPD reached higher cell concentration, the quantity of intracellular HSA protein obtained was about two times more with the integrated vector (about 0.5 mg/liter).
  • the cDNA encoding HSA was ligated downstream to the ADHl promoter.
  • vector pAD4 ⁇ Bacillus subtilis
  • cultures harboring either pADH-HSA, or pGES426-L-HSA were grown in parallel.
  • the expression of HSA was compared.
  • the levels of HSA expression obtained from both plasmids was similar.
  • the amount of intracellular HSA was determined to be 250 ⁇ g/liter, being about half of the amount obtained using the integrative version, pGES306-L-HSA, on rich medium. It was therefore concluded that the pGES system could be more efficient than currently available yeast expression vectors.
  • heterologous coding sequence in cells other than yeast cells pGES expression systems ofthe invention, which will include, ter alia, a heterologous coding sequence, for example the HSA coding sequence, and as a selectable marker neomycin or hygromycin resistance gene (suitable for selection either in mammalian cells, insect cells, plant cells or avian cells) will be prepared as described hereinabove.
  • the plasmid obtained will be transferred into mammalian cells using electroporation or calcium phosphate precipitation.
  • the cells will then be grown on a suitable medium to a concentration of about 2xl07cells/ml and then transformed with the pGES based vectors described hereinbefore.
  • the cells may be co-transfected with a second plasmid carrying the selectable marker.
  • the transfected cells will be selected by culturing the population of cells obtained after transfection, in the presence of the relevant agent, such as an antibiotics (e.g. G418, hygromycin). The selected cells will then be exposed to amino acid starvation conditions mimicked by the addition of 3-AT, to induce expression of the HSA coding sequence.
  • the relevant agent such as an antibiotics (e.g. G418, hygromycin).
  • the selected cells will then be exposed to amino acid starvation conditions mimicked by the addition of 3-AT, to induce expression of the HSA coding sequence.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne une cassette d'expression comprenant : a) un élément régulateur comprenant la séquence nucléotidique du promoteur du facteur de transcription GCN4 ou un dérivé fonctionnel ou un fragment de cette dernière ; b) une séquence de codage hétérologue située en aval dudit élément régulateur ; c) un signal de terminaison lié en aval de manière fonctionnelle à ladite séquence hétérologue ; et d) facultativement un marqueur sélectionnable lié de manière fonctionnelle.
PCT/IL2000/000118 1999-02-28 2000-02-25 Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees WO2000052181A2 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
AU28236/00A AU2823600A (en) 1999-02-28 2000-02-25 Gcn4-derived expression of heterologous coding sequences and different uses thereof
EP00906580A EP1173593A2 (fr) 1999-02-28 2000-02-25 Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees
JP2000602791A JP2002537815A (ja) 1999-02-28 2000-02-25 異種起源コード配列のｇｃｎ４誘導発現及びその種々の用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IL12875799A IL128757A0 (en) 1999-02-28 1999-02-28 GCN4-derived expression of heterologous coding sequences and different uses thereof
IL128757 1999-02-28

Publications (2)

Publication Number Publication Date
WO2000052181A2 true WO2000052181A2 (fr) 2000-09-08
WO2000052181A3 WO2000052181A3 (fr) 2000-12-28

Family

ID=11072543

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2000/000118 WO2000052181A2 (fr) 1999-02-28 2000-02-25 Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees

Country Status (5)

Country Link
EP (1) EP1173593A2 (fr)
JP (1) JP2002537815A (fr)
AU (1) AU2823600A (fr)
IL (1) IL128757A0 (fr)
WO (1) WO2000052181A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002020789A1 (fr) * 2000-09-07 2002-03-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres
EP1678301A1 (fr) * 2003-09-08 2006-07-12 The University of Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0655503A1 (fr) * 1993-11-26 1995-05-31 The Green Cross Corporation Procédé de production du sérum albumine humaine
EP0771871A2 (fr) * 1988-04-25 1997-05-07 Research Corporation Technologies, Inc Expression de l'albumine du sérum humain dans des levures méthylotrophiques

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0771871A2 (fr) * 1988-04-25 1997-05-07 Research Corporation Technologies, Inc Expression de l'albumine du sérum humain dans des levures méthylotrophiques
EP0655503A1 (fr) * 1993-11-26 1995-05-31 The Green Cross Corporation Procédé de production du sérum albumine humaine

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DEVER TE: "Using GCN4 as a reporter of eIF2alpha phosphorylation and transcriptional regulation in yeast" METHODS: A COMPANION TO METHODS IN ENZYMOLOGY, vol. 11, no. 4, April 1997 (1997-04), pages 403-417, XP000939011 ISSN:1046-2023 cited in the application *
MIMRAN A ET AL: "GCN4-based expression system (pGES): translationally regulated yeast expression vectors" BIOTECHNIQUES, vol. 28, no. 3, March 2000 (2000-03), pages 552-560, XP000939054 NATICK US *
See also references of EP1173593A2 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002020789A1 (fr) * 2000-09-07 2002-03-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres
EP1678301A1 (fr) * 2003-09-08 2006-07-12 The University of Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle
EP1678301A4 (fr) * 2003-09-08 2008-03-05 Univ Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle

Also Published As

Publication number Publication date
JP2002537815A (ja) 2002-11-12
EP1173593A2 (fr) 2002-01-23
WO2000052181A3 (fr) 2000-12-28
IL128757A0 (en) 2000-01-31
AU2823600A (en) 2000-09-21

Similar Documents

Publication Publication Date Title
US5773245A (en) Methods for increasing secretion of overexpressed proteins
US20100297738A1 (en) Expression system
Schultz et al. Regulated overproduction of the GAL4 gene product greatly increases expression from galactose-inducible promoters on multi-copy expression vectors in yeast
JP2018522565A (ja) プロモーター変異体
KR20140015137A (ko) 분비 효율이 개선된 재조합 단백질의 생산 방법
CN102648286A (zh) 在巴斯德毕赤氏酵母中生产缺乏与针对宿主细胞抗原的抗体的可检测交叉结合活性的蛋白质的方法
EP1951877B1 (fr) Promoteur de facteur d'elongation translationnelle issu de pichia pastoris et procede pour produire une proteine recombinee grace a celui-ci
KR20210032972A (ko) 전사인자를 사용하여 단백질 발현을 증가시키는 수단 및 방법
DE69738158T2 (de) Alpha-Amylase Transkriptionsfaktor
EP1002095B1 (fr) Souches ameliorees pour l'expression de proteines
EP0631627A1 (fr) Procede de production de proteines dans la levure
CN103764837A (zh) 用于生产具有修饰的o-糖基化的蛋白的酵母菌株
JP5997140B2 (ja) 生産細胞株
WO2000052181A2 (fr) Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees
US20030040047A1 (en) Method for producing a recombinant protein
WO2002020789A1 (fr) Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres
US20070077642A1 (en) Steroid receptor modulation of gene expression
US6613547B1 (en) Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 1 promoter and terminator
Lin-Cereghino et al. Expression of protein in Pichia pastoris
EP0590721A1 (fr) Procédé d'expression de récepteurs du système nerveux humain ches la levure schizosacchoromyces pombe
US6440720B1 (en) Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 2 promoter and terminator
KR0185980B1 (ko) 알부민 유전자-함유 플라스미드, 이를 함유하는 형질전환체, 이러한 형질전환체의 생산방법 및 알부민의 생산방법
JP2003509024A (ja) ピチア・メタノリカグリセルアルデヒド−３−リン酸デヒドロゲナーゼ２プロモーター及びターミネーター

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 602791

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000906580

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09913916

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 2000906580

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000906580

Country of ref document: EP