EP1173593A2

EP1173593A2 - Gcn4-derived expression of heterologous coding sequences and different uses thereof

Info

Publication number: EP1173593A2
Application number: EP00906580A
Authority: EP
Inventors: David Engelberg; Avishai Mimram
Original assignee: Yissum Research Development Co of Hebrew University of Jerusalem
Current assignee: Yissum Research Development Co of Hebrew University of Jerusalem
Priority date: 1999-02-28
Filing date: 2000-02-25
Publication date: 2002-01-23
Also published as: IL128757A0; AU2823600A; JP2002537815A; WO2000052181A2; WO2000052181A3

Abstract

The invention provides an expression cassette comprising: a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; b) a heterologous coding sequence downstream to said regulatory element; c) a termination signal operably linked downstream to said heterologous sequence; and d) optionally, an operably linked selectable marker.

Description

GCN4-DERIVED EXPRESSION OF HETEROLOGOUS CODING SEQUENCES

AND DIFFERENT USES THEREOF

FIELD OF THE INVENTION

The present invention relates to an expression cassette comprising a regulatory element, a heterologous coding sequence, a termination signal and optionally a selectable marker as herein after defined, and to the different uses of said expression cassette.

BACKGROUND OF THE INVENTION

Expression of proteins in microorganisms is a powerful tool for basic research as well as for various medical and industrial needs. Most advanced expression systems have been developed in prokaryotes, in particular in the bacterium Eschericia coli [Gold L., Meth. Enzymol. 185:11-14 (190); Mattanovish D. et al, Ann. N. Y. Acad. Sci. USA 782:182-190 (1996)]. In this organism, a foreign protein could be expressed very efficiently, reaching a level of 10% to 30% of the total protein content of the culture [Gold L. (1990) ibid.; Mattanovish D. et al, (1996) ibid.; and Gao B. et al, Gene 176:269-272 (1996)]. However, most types of bacteria, including E. coli, are pathogens and proteins expressed in them must be well purified and assayed in rigorous and expensive quality control systems. Therefore, although powerful, the bacterial systems are disadvantageous in many cases [Walsh G. and Headon D.R., Protein Biotechnology, John Wiley & Sons Ltd., West Sussex England. (1994)].

Methods of expression of heterologous proteins in eukaryotic cells have also been developed. For many reasons expression in eukaryotic cell systems is advantageous over that in prokaryotic cells, since, most proteins (endogenous or heterologous) obtained by such systems undergo accurate post-translational processing which result in the production of biologically active forms of these products [Walsh, G and Headon D R. (1994) ibid.; Romanos M.A. et al. Yeast 8:423-488 (1992)]. However, although expressed, only low levels of protein are obtained in mammalian cell systems. In addition, as indicated, there is a high risk of viral infection when using these expression systems, thus requiring expensive diagnostic tests to ensure the safety in using proteins obtained therefrom.

An attractive alternative for an expression system is of the yeast, and in particular, the baker's yeast Saccharomyces cerevisiae. As with other eukaryotic systems, most foreign proteins expressed in this eukaryote are accurately processed post-translationally and are biologically active. In addition, as a food organism, yeast is highly acceptable for the production of pharmaceutical proteins, thus reducing the cost of manufacturing such proteins. Yet, despite the great potential of yeast as a protein factory, this organism is not widely used. The major reason for this may be the fact that the level of expression obtained in yeast is usually much lower than that obtained in bacteria [Romanos M.A. et al. (1992) ibid.].

To date, only few yeast expression vectors are available. All vectors (similarly to the bacterial and mammalian vectors) contain strong promoters (usually a promoter of glycolitic genes for example, GPD1, ADH1, PGK1). In addition, they contain the 2μ origin of replication which allows several plasmid replications during one round of cell cycle [Schneider J.C. and Guarente L. Meth. Enzymol. 194:373-388 (1991); Schena M. et al. Meth. Enzymol. 194:389-398 (1991); Rose A.B. and Broach J.R., Meth. Enzymol. 185:234-279 (1990)]. As a result, these plasmids are present in 60-100 copies per cell. Some of the vectors also contain an inducible promoter, the most widely used is the GAL1-10 promoter [Schena M. et al. (1991) ibid.].

The strategy used with yeast vectors in order to increase expression is a combination of high transcription rate with the presence of many copies of the vector per cell. Cells harboring those vectors must be grown on synthetic media under selective conditions to maintain the plasmids in the cell. These conditions are usually not optimal. When grown in laboratory flasks these cultures enter stationary phase at low concentrations and the quantities of proteins obtained are usually low. When grown in industrial fermentors, high cell concentrations could be obtained via special treatments and long and expensive incubation time.

The present invention aims at the development of an expression vector utilizing the promoter region of the GCN4 gene for regulating foreign coding sequence expression. GCN4 encodes a transcription activator, which induces transcription of coding sequences of biosynthetic enzymes [Hinnebusch A.G., Microbiol. Rev. 52:248-273 (1988); Hinnebusch A.G. In Broach J.R. et al, Eds. The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. Cold Spring Harbor Laboratory. NY pp 319-414 (1992); Hinnebusch A.G., J. Biol. Chem. 272:21661-21664 (1997)]. Under optimal growth conditions on media supplemented with amino acids and pyrimidine and purine bases, GCN4 is not expressed. When cells are starved for amino acids, Gcn4 expression is dramatically induced, and consequently, transcription of biosynthetic genes commences. Expression of GCN4 is regulated mainly at the translational level. The mRNA levels of GCN4 are high under most growth conditions, but under optimal growth conditions, translation rate of this mRNA is extremely low and GCN4 protein is barely detectable. This minimal translation rate is maintained by 4 short open reading frames located in the 5' non-coding leader of the message (4uORF) [Hinnebusch, A.G. (1997) ibid.; Dever, T.E. et al. Cell 68:585-596 (1992)]. Ribosomes recognize the most upstream ORF and begin translation. Yet, they dissociate from the mRNA at the stop codon and re-initiate translation at another short ORF. In most cases ribosomes do not reach the 5th ORF which is the GCN4 coding sequence [Hinnebusch A.G. (1997) ibid.]. This prevention of GCN4 translation depends on the high rate of re-initiation. Under starvation for amino acids the rate of re-initiation is reduced to a minimum because the activity of initiation factor 2 (eIF2α) is inhibited. Inhibition of eIF2α is obtained through its phosphorylation, catalyzed by the Gcn2 kinase. This inhibition halts most translation activity in the cell, an obvious cellular protecting response to amino acid starvation. Although translation in the cell is generally ceased under these conditions, the GCN4 mRNA is preferably translated. This seems to be a logical response since the Gcn4 protein is required for induction of amino acids biosynthesis. In the laboratory, amino acid starvation could be easily mimicked by treatment of yeast cells with inhibitors of biosynthetic enzymes. The most widely used compound is 3-amino-l,2,4-triazole (3-AT), a competitive inhibitor of His3. Cells combat the competitive inhibition effect simply by producing more His3. Indeed, the rate of GCN4 translation (leading to HIS 3 transcription) dramatically increases in response to 3-AT treatment [Hinnebusch A.G. (1988) ibid. ; Hill D.E. et al. Science 234:451-457]. The sequence which resides upstream to the GCN4 coding sequence (including the 5'UTR and the promoter) was shown to govern transcription and translation of GCN4/β-galactosidase (β-GAL) chimeric gene [Hinnebusch A.G. PNAS USA 81:6442-6446 (1984); Thireos G. et al, PNAS USA 81:5096-5100 (1984); Hinnebusch A.G. Mol. Cell. Biol. 5:2349-2360 (1985)]. As translation of GCN4 (and of the GCN4/β-GAL chimeric gene) increases when eIF2α is phosphorylated and its activity decreases, it was recently suggested to use the GNC4/β-GAL gene as a marker which monitors the level of eIF2α phosphorylation and activity [Dever T.E. Methods 11:403-417 (1997)]. However, hitherto it was unknown whether the GCN4 upstream sequences (with no coding sequences) are capable of controlling transcription and translation of an heterologous gene at the translational level.

Further, as gene expression is a complex multi-step process and problems can arise at numerous stages, from transcription through to protein stability, it is clear that the insertion of a foreign gene into an expression vector does not guarantee a high level or properly regulated expression of that foreign protein.

Yet, as will be demonstrated in the following detailed description and Examples, the inventors have now surprisingly found that GCN4 upstream sequences could be utilized for efficient and regulated expression of foreign protein by the expression cassette ofthe invention.

SUMMARY OF THE INVENTION

The present invention relates to an expression cassette comprising:- (a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (b) a heterologous coding sequence downstream to said regulatory element; (c) a termination signal operably linked downstream to said heterologous sequence; and (d) optionally, an operably linked selectable marker.

The GCN4 transcription factor within the expression cassette ofthe present invention is preferably of the yeast's Saccharomyces cerevisiae, and more preferably comprises the nucleotides -1067 to -1 upstream to the GCN4 coding sequence. The heterologous coding sequence/s within the expression cassette of the invention encode amino acid sequence/s, particularly those having a therapeutic utility.

In a second aspect, the invention relates to an expression vector comprising the expression cassette ofthe invention.

Yet, the invention also relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- (a) providing eukaryotic cells; (b) transforming said cells provided in (a) with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter, preferably that of the yeast S. cerevisiae, or a functional derivative or fragment thereof; (ii) a heterologous coding sequence downstream to said regulatory element; (iii) a termination signal operably linked to said heterologous sequence; and (iv) optionally, an operably linked selectable marker; the method further comprising the steps of:- (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and (e) optionally, isolating said functionally active protein or peptide obtained in step (c) from said cells.

Evidently, for efficient expression of the heterologous coding sequence, when necessary, the expression vector of the invention may further comprise at least one replication element.

In a further aspect, the invention relates to a therapeutic protein or peptide produced by the method of the invention and to eukaryotic cells transformed with the expression cassette or vector of the invention, said cells being capable of expressing a heterologous coding sequence comprised therein, to obtain said therapeutic protein or peptide.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 Schematic description of the GCN4 gene and the primers used for promoter cloning. Open reading frames are shown as boxes and primers as arrows. Figure 2A-2C The basic pGES vector family containing the HSA cDNA. Fig. 2A show the integrative vector pGES306-HSA, Fig. 2B shows the centromeric vector pGES316-HSA and Fig. 2C shows the multicopy vector ρGES426-HSA.

Figure 3 Induction and expression of HSA by pGES vectors containing either the long regulatory element (Long) or the middle sized regulatory element (Mid.), both containing the GCN4 promoter. Western blot analysis using anti-HSA antibodies was performed on protein extracts prepared from cultures (BJ2168 cells) harboring either pGES306-L-HSA (Long) or pGES306-M-HSA (Mid.), 8 and 10 hours after addition of 3-AT.

Figure 4A-4B Time course and dose response analysis of induction of HSA expression. Fig. 4A shows a culture of BJ2168 cells harboring pGES426-L-HSA grown to logarithmic phase and than supplemented with 3-AT (20 mM). Samples were removed at indicated time points and subjected to western blot analysis. Fig. 4B shows a similar culture grown to logarithmic phase and then divided to six fractions, each fraction supplemented with the indicated concentrations of 3-AT. Cultures were further grown for 7 hours before collection and analysis by western blotting. Purified HSA (10 and 50 ng) were loaded on the right lane of each gel.

Figure 5A-5C Expression of HSA from pGES vectors is induced at the translational level. A culture harboring the oGES306-L-HSA vector and culture harboring the control plasmid pRS306-S were grown to logarithmic phase when 3-AT was added. At the indicated time points samples were removed. Protein extracts and RNAs were prepared from each sample and analyzed by western blot and primer extension respectively. Fig 5A shows the western blot analysis. Fig. 5B shows the primer extension analysis using GCN4 primer. Fig. 5C shows the primer extension analysis using HSA primer. Figure 6 pGES system is inducible in highly concentrated cultures a culture harboring the pGES306-L-HSA was grown on YPD to OD600=3.3 when the media was replaced with SD(-HIS) supplemented with 40mM 3-AT. Samples were removed and analyzed by western blot as the indicated time points after induction. Purified HSA (50 Ng) was loaded on the right lane ofthe gel.

DETAILED DESCRIPTION OF THE INVENTION

The present invention describes the development of a new family of yeast expression vectors, which are based on the promoter region of GCN4 as the regulatory element. Expression from these vectors is tightly controlled and is induced under amino acid starvation conditions.

Biosynthesis of proteins (transcription and translation) in living organisms is similar. Therefore, in principal, any cell type may be used as a host for the expression of a foreign gene. Nevertheless, for practical reasons, to date only few cell systems have been employed as "factories" for proteins. These practical reasons include, inter alia, the cost of growing the host cell, the efficiency in which the foreign protein is expressed, the cell's stability which may alter as a result of the expression of unrecognized proteins, the desire to obtain biologically functional proteins and the cost and efficacy of producing a purified protein.

The use of yeast for the expression of foreign proteins provides numerous advantages. While yeast are edible organisms and thus safe to use as a "factory" for pharmaceuticals. Prokaryotes, such as Escherichia coli, have toxic cell wall pyrogens, while mammalian cells may contain oncogenic or viral DNA, so that the products from these organisms must be tested more extensively. Further, yeast can be grown rapidly on simple media and to high cell density, their genetics are advanced, and they can be manipulated almost as readily as E.coli [Romanos M.A. et al. Yeast 8:423-488 (1992)]. Therefore, the use of yeast cells for the production of proteins reduces cost and is less time consuming. In addition, since yeast cells are eukaryotic cells, many of the post-translational processes necessary for the production of a biologically functional product are correctly performed. As will be demonstrated by the following Examples, the system ofthe present invention differs from currently available expression vectors since it is controlled at the translational level, allowing rapid induction. Under non-inducible conditions, expression from these vectors is quite well suppressed. Further, this system allows fine control on the level of expression, since this level is directly proportional to the concentration of the inducer. Yet further, an integrated version of the cassette is almost as efficient as a multicopy version. Therefore, the pGES expression system could be used under various growing conditions, including in rich, non-selective media, which is clearly an advantage.

The present invention thus relates to an expression cassette comprising: -(a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (b) a heterologous coding sequence downstream to said regulatory element; (c) a termination signal operably linked downstream to said heterologous sequence; and (d) optionally, an operably linked selectable marker. It should be noted that as an alternative for the heterologous coding sequence, the expression cassette may comprise a genomic or cDNA library, which may be used for many different purposes, as known to the man skilled in the art, e.g. for screening.

By the term 'heterologous coding sequence' is meant any sequence which encodes a therapeutic protein or peptide. The coding sequence may be a naturally occurring sequence or a derivative thereof, and is not of yeast origin.

The term 'derivatives' used herein in connection with nucleic acids, either in a coding or in a non-coding sequence, means any modification thereof including, insertions, deletions, mutations and substitutions.

The expression cassette of the invention may further comprise operably linked thereto a replication element, to provide an expression vehicle which will be substantially independent from the host cell replication elements.

When a replication element is required for the efficient expression of the coding sequence within the expression cassette of the invention, it may be any suitable replication element, for example, the 2μ element, which supports maintenance of many copies of the gene in the cell [Rose A.B. and Broach J.R. Meth. Enzymol. 185:234-279 (1990)] or a centromeric element (CEN) which replicates together with the endogenous DNA and is maintained therefore as a single copy per cell. CEN based vectors are combined in many cases with auto-replicating sequences (ARS). The CEN-ARS based vectors, which may also be employed, are maintained in few copies (usually 1-2).

However, as indicated hereinbefore, the expression cassettes of the invention may also be employed as an integrative single copy fragment, which does not require growing the cells on a selective medium.

Within the expression cassette ofthe invention, the said GCN4 transcription factor is of the yeast Saccharomyces cerevisiae. In particular, the regulatory element employed in the expression cassette of the invention, comprises at least the nucleotides -904 to -1, upstream to the GCN4 coding sequence.

Preferably, the expression cassette of the invention comprises nucleotides -1067 to -1 upstream to the GCN4 coding sequence and more preferably, it has the nucleotides -1067 to -1 of said sequence upstream to the GCN4 coding sequence.

In a preferred embodiment, the expression cassette according to the invention comprises a coding sequence which encodes a naturally occurring amino acid sequence or a derivative thereof. In particular, the amino acid sequence corresponds to a natural protein, polypeptide or peptide, or to a functional derivative of said natural protein or peptide, to an essential fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments.

The term 'functional derivative' used herein means any modification of the naturally occurring sequence, including insertions, deletions or substitutions of nucleic or amino acids residues therein, or any other suitable modification which does not damage the biological function of the nucleic or amino acid sequence. The functional derivatives according to the invention may also be any dimeric or multimeric form of said amino acid according to the invention.

Functional proteins or peptides within the scope of the invention, encompass any protein or peptide having a therapeutic value. Such proteins or peptides may be selected from the group consisting of enzymes, antibodies, cytokines, hormones, receptors, transcription factors or any chimera of said therapeutic products with a different protein or peptide.

The term "therapeutic" as used herein means any protein, polypeptide or peptide having an industrial application. Thus it may refer to any pharmaceutical, agricultural, veterinary or diagnostic product.

In one particular embodiment according to the invention, the expression cassette comprises a heterologous coding sequence which encodes the human serum albumin (HSA) protein.

The termination signal according to the invention may be any suitable terminator which is capable of terminating the transcription of coding sequence and of adding polyadenylated ribonucleotides to the 3" end of the primary transcript obtained therefrom. The termination signal thus may be selected from the group consisting ofthe yeast alcohol dehydronease gene (ADH1), TRP1, glyceralkehyde-3 -phosphate dehydrogenase (GAP, GAPDH), MF1, phosphate regulated terminator (e.g. of PH05), phosphoglycerate kinase (PGK), CYC1 or the GCN4 terminator.

The expression vector of the invention may include, in addition to the expression cassette, any other element required for the efficient and regulated expression of the product encoded by the coding sequence, such as an ORI sequence. Further, the vector may include an appropriate polyA signal, and/or an intron splicing signal, e.g. of the SV40 virus.

Evidently, the vector may include other elements such as sequences which encode peptides facilitating the secretion of the protein expressed by the heterologous coding sequence incorporated in the expression cassette into the growing media (secretion elements). Further, it may contain sequences which encode peptides capable of eliciting production of antibodies thereagainst, or even those encoding tagging proteins, which bind to specific columns during affinity purification (e.g. polyHis that binds to to agarose-nickel beads, gluthatione S-transferase (GST) that binds to gluthatione beads, cellulose binding domain (CBD) which binds to cellulose). In one preferred embodiment, the expression vector according to the invention is the integrative plasmid substantially as shown in Figure 2A. Alternatively, according to a second preferred embodiment ofthe invention, the expression vector of the invention is the centromeric plasmid substantially as shown in Figure 2B. Yet, the expression vector ofthe invention may be the multicopy plasmid substantially as shown in Figure 2C.

In a third aspect, the invention relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- (a) providing eukaryotic cells; (b) transforming said cells provided in (a) with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; (ii) a heterologous coding sequence downstream to said regulatory element; (iii) a termination signal operably linked to said heterologous sequence; and (iv) optionally, an operably linked selectable marker; the method further comprising the steps of (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and (e) optionally, isolating said functionally active protein or peptide obtained in step (c) from said cells or from the cell's medium.

According to the method of the invention, when necessary for efficient expression, the expression cassette further comprises a replication element.

The cells provided for the expression ofthe coding sequence may be any eukaryotic cell capable of efficiently and sufficiently expressing said coding sequence, thus producing an active product. Particularly, the eukaryotic cell may be of a mammalian type.

Alternatively, the eukaryotic cells employed by the method of the invention may be yeast cells. Evidently, the yeast cells will be those capable of expressing said coding sequence and may include, ter alia, the yeast S. cerevisiae, Schizosaccharomyces pombe or Pichia pastor is. In a preferred embodiment, the yeast cells are of the S. cerevisiae type, in particular, those of the strains SPl, W303, C13ABYS86, BJ2407, BJ2168, H625, H628, and H640 and is preferably ofthe BJ2168 strain.

According to the method ofthe invention, the upstream sequence of GCN4 transcription factor (including the promoter sequence and the 5'UTR) is ofthe yeast S. cerevisiae and comprises at least the nucleotides from -904 to -1 (upstream to the GCN4 coding sequence). Nevertheless, the said sequence may comprise the nucleotides from -1067 to -1 upstream to the GCN4 transcription factor. Moreover, the sequence employed by the method ofthe invention is that having the nucleotides from -1067 to -1, upstream to the GCN4 coding sequence.

By the method of the invention, any heterologous coding sequence which encodes an amino acid sequence, may be utilized. The amino acid sequence may comprise naturally occurring amino acids and/or derivatives ofthe same, as defined hereinbefore.

The amino acid sequences produced by utilizing the expression cassette ofthe invention will preferably correspond to a natural protein or peptide having an industrial purpose or to a functional derivative thereof, to a fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments thereof.

Accordingly, the protein or peptide product may be an enzyme, an antibody, a cytokine, a hormone, a receptor, a transcription factor or a functional derivative thereof or any other protein or peptide having a biological and/or therapeutic function.

In a preferred embodiment, the human serum albumin protein is obtained by the method ofthe invention.

One substantial advantage ofthe method of the invention is the possibility to obtain the expressed protein in a controlled manner and with high yield. As will be shown in the following Examples, under conditions which mimic amino acid starvation, HSA is obtained in high quantities.

Starvation conditions may be mimicked by specific drugs which inhibit amino acid biosynthesis, such as 3-aminotriazole (3-AT), allowing stringent control and easy induction of expression of the foreign gene. Other examples for drugs capable of mimicking amino acid starvation may include 5-fluorotryptophan. In the method according to the invention, the termination signal may be any suitable termination signal, however, is preferably selected from yeast, for example, the termination signal of ADHl, TRPl, GAP (GAPDH), MFl, PH05, PGK, CYCl or of GCN4.

In a particular embodiment, the cells are transformed by the method of the invention with the expression vector which is the integrative plasmid substantially as shown in Figure 2A. As an alternative, the cells may be transformed by the method of the invention with the centromeric expression vector substantially as shown in Figure 2B. Yet, according to a further particular embodiment, the cells may be transformed by the method of the invention with the multicopy expression vector substantially as shown in Figure 2C.

As will be shown in the following Examples, the intracellular level of protein expression (per cell) obtained with the pGES vectors is similar to that of currently available vectors. Yet, as it could be used as an integrated vector and is still inducible in dense cultures (Fig. 5), these vectors may give rise to improved protein production (in quantity and quality). An improved transcription rate could also be obtained through a combination of a strong constitutive promoter (from another gene) with the 5'UTR of GCN4. Such chimera may be more efficient than pGES and still be regulated at the translational level.

In a further aspect, the invention concerns with eukaryotic cells transformed with the expression cassette or expression vector of the invention which cells are capable of expressing the heterologous coding sequence comprised therein. Eukaryotic cells transformed with the system of the invention may be mammalian cells, yeast cells, fungi, insect cells, avian cells or any other eukaryotic cell capable of efficiently producing the desired therapeutic protein or peptide.

Examples for insect cell lines which may be transformed with the system of the invention, but not limited thereto, are Spodeoptera frugiperda (e.g. sf9 cell linej, Trichoplusia ni (Tn), Mamestra brassicae, Estigmene acrea, Anopheles gambiae, Aedes albopictus and Aedes aegypti Mos20. Examples for mammailan cells which may be transformed with the system of the present invention, but not limited thereto, are CV-1, COS, C127, NIH3T3, FR3T3 or the CHO cell lines.

Regulation of GCN4 translation is well studied and mutants are available in which GCN4 translation rate is constitutively high and not regulated (gcd mutants are described by Hinnebusch et al. [Hinnebusch A.G., Microbiol. Rev. 52:248-273 (1988); Hinnebusch A.G. In Broach J.R. Jones et al Ed.: The Molecular and Cellular Biology of the Yeast Saccharomyces: Gene Expression. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY pp 319-414; and Harashima S. and Hinnebush A.G., Mol. Cell Biol. 6:3990-3998 (1986)]). Also GCN4 translation is induced by the yeast Ras/cAMP cascade and is therefore high in RAS^vaI119 and bcyl strains [Engelberg D. et al, Cell 77:381-390 (1994)]. pGES plasmid could be used in gcd strains and in RAS^vain9 and bcyl strains as constitutive vectors to obtain large quantities of proteins for research and industry.

It is clear therefore, that any protein or peptide, particularly therapeutic ones, produced by such cells, encompass part of the invention. One example for such a protein is the HSA protein.

Finally, the invention relates to the use of the expression cassette of the invention, wherein the heterologous coding sequence encodes a therapeutic protein or peptide, in the production of a therapeutic protein or peptide.

Further, the invention relates to the use of the expression cassette of the invention, wherein the heterologous coding sequence encodes a therapeutic protein or peptide, in the preparation of a pharmaceutical composition containing said protein or peptide.

Nevertheless, the expression cassette ofthe invention may be utilized for the expression of libraries, for example, for cloning via functional complementations of mutants, for screening genes which allow growth under certain conditions (e.g. toxic conditions, under extreme conditions or in the presence of drugs), for the detection of protein-protein interactions (through the expression of a sequence encoding a chimeric peptide), as with the two hybrid system. In the latter case, the nucleotide sequence of GAL4-DNA binding domain fused to a cDNA library, or alternatively, the sequence of GAL4 activation domain fused to a library, will be expressed using the expression cassette of the invention. The expression cassette may also be utilized in the Sos recruitment system (SRS) or in the Ras recruitment system (RRS) system, in which the membrane localized cDNA library, the SOS-cDNA library or the RAS-cDNA library, may be expressed using the system ofthe invention.

The invention will now be described in an illustrative manner and it is to be understood that the terminology, which will be used is intended to be in the nature of the words of description rather than of limitation.

Obviously, many modifications and variations of the present invention are possible in light of the above teaching. It is therefore, to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.

EXAMPLES

Example 1 - Materials and methods Yeast strains and growth conditions

The SPl strain (MATa, his3, leu2, ura3, trpl, ade8 and can [Kataoka T. et al., Cell 37:437-445 (1984)] was obtained form Wigler M.) was used as a source of genomic DNA from which the GCN4 upstream sequences were cloned by PCR. The BJ2168 strain (MATa, prcl-407, prbl-1122, pep4-3, leu2, trpl, and ura3-52 [Zubenko, G.S. et al, Genetics 96:137-146 (1980)] was used as a host for all expression plasmids and was obtained from the yeast genetic stock center at UC Berkley. Yeast cells were grown on either YPD (1% yeast extract, 2% bactopeptone, 2% glucose) or on SD media (0.17% yeast nitrogen base w/o amino acids and ammonium sulfate (Difco), 0.5% NFL^SO^, 2% glucose and the required amino acids and uracil (40 mg/liter)). Strains harboring plasmids were grown on SD (-uracil). For expression experiments cultures were grown to logarithmic phase (unless otherwise indicated) on wither SD (-uracil), or YPD (for integrated vectors), collected and re-suspended in SD (-uracil, -histidine) (or in SD (-his) for integrated vectors), supplemented with 3-AT (mostly at 40 mM, unless otherwise indicated). PCR cloning of GCN4 fragments and plasmid construction

PCR reaction was performed using genomic DNA of yeast strain SPl as a template and the following primers :-

Primer 3 ' - 5 'GCGCCGGATCCTTTATTTGTATTTAATTTATTTTCTTGAGC-3 ' . This primer contains the BamHI site and was used in all PCR reactions (Fig. 1).

Long promoter - 5 'GCGCCGACTAGTTTGCCACGTACATGACATTA-3 ' . This primer was used in combination with primer 3' to clone the long promoter by amplifying the sequence from nucleotide number -1067 to nucleotide -1.

Mid promoter - 5'GCGCCGATAGTGCCGAACACCACCGGCATCTTG-3'. This primer was used in combination with the primer 3 ' to clone the middle length promoter by amplifying the sequence from nucleotide number -904 to nucleotide -1.

Short promoter - 5 ' GCGCCGACTAGTCGGAAGATAAATACTCCAAC-3 ' . This primer was used in combination with primer 3' to clone the shorter promoter by amplifying the sequence from nucleotide number -706 to nucleotide -1.

These long, mid and short primers contain Spel sites and were used at the 5' side ofthe GCN4 promoter (see Fig. 1). PCR products were digested with Spel and BamHI and ligated to pBluescript to obtain the plasmids pBSG-Short (pBSG-S), pBSG-Mid (pBSG-M) and pBSG-Long (pBSG-L). The cloned DNAs were sequenced and found identical to the sequence of this region as appears in the Saccharomyces genome database.

For the ligation ofthe coding sequence of human serum albumin (HSA) downstream to the GCN4 sequences, the cDNA of HSA was cloned as a BamHI-EcoRI fragment to pBSG-S, pBSG-M and pBSG-L. These chimeric genes contained about 70 bp of the 5'UTR sequences of HSA which were found to reduce expression levels (data not shown). To remove this sequence from each of the three plasmids, a 885 bp BamHI-NcoI fragment, containing the entire 5'UTR and 815 bp of the HSA coding, was replaced with a 815 bp PCR product containing only the first 815 bp of the HSA coding sequence. Primers used for this PCR reaction were as follows:- HSA-ATG - 5'GCGCGCGGATCCATGAAGTGGGTAACCTTTATTTCCC-3'.

HSA-900 - 5'GCAGATCTCCATGGCAGCATTCC-3'.

The plasmids obtained were named pBSG-S-HSA, pBSG-M-HSA and pBSG-L-HSA. The GCS4-HSA moiety of each of these plasmids was removed as a Spel-EcoRI fragment and inserted into pRS316 (a centromeric yeast plasmid [Sikorski R.S. and Hieter P., Genetics 122:19-27 (1989)], pRS306 [Sikorski R.S. and Hieter P. (1989) ibid.] and pRS426 (a 2μ based vector [Chritianson T.W. et. al, Gene 110: 119-122 (1992)]. The terminator of ADHl (0.6 Kb EcoRI fragment) was ligated to the EcoRI site of wach of the 9 plasmids obtained. The final constructs were named as follows:- (a) pGES306-S-HSA, for the GCN4 based expression system, being derived from the pRS306 plasmid and containing the short GCN4 regulatory element and the HSA cDNA; (b) pGES306-M-HSA, which is similar to pGES-S-HSA however containing the medium sized GCN4-derived regulatory element; (c) pGES-L-HSA containing the long GCN4 regulatory element; (d) pGES316-S-HSA; (e) pgES316-M-HSA; (f) pGES315-L-HSA; pGES426-S-HSA; (g) pGES426-M-HSA and

(h) pGES426-L-HSA. A schematic representation of these plasmids is provided in figure 2. To express the HSA under ADHl promoter, a BamHI EcoRI fragment containing the HSA cDNA was rendered blunt by DNA Pol I (Klenow fragment) and inserted into the Smal site of pAD4Δ [Ballester R. et al, Cell 59:681-686 (1989)].

Western Blot Analysis

Protein extracts were prepared as previously described [Gross E. et al, Mol. Cell. Biol. 12:2653-2661 (1992)]. All SDS-PAGE gels contained 10% acrylamide. Protein blotting was performed with a LKB semi-dry blotter for two hours under constant current (mA-0.8xgel area in cm²). Polyclonal anti HSA antibodies (RAHu/albumin) (from Nordic Immunology) were used in a dilution of 1 :50,000. Peroxidase conjugated Goat anti rabbit antibodies (from Jackson Immunological) were used in a dilution of 1 :25,000. Purified HSA (from SIGMA) was used as a standard positive control. RNA preparation and primer extension analysis

The RNA preparation and primer extension analysis were performed as previously described [Engelberg D. et al, Mol. Cell. Biol. 14:4929-4937 (1994)] using the following primers :-

HSA-extension: 5'ACCTCACTCTTGTGTGCATCTC 3'

GCN4-extension: 5'ATAATTCGCTAGTGAAACTGATGGGC 3'

Primer extension products were separated on 6% acrylamide 7 M urea gel.

Expression of a heterologous coding sequence requires a fragment of at least 904 bp upstream to the GCN4 coding sequence

To test whether elements controlling GCN4 expression could be used to regulate expression of a heterologous coding sequence, the inventors have cloned a sequence containing the regulatory elements of GCN4. Initially, a fragments containing nucleotides -706 to -1, prepared from a genomic DNA of the SPl strain, was cloned. This fragment was reported to be sufficient for regulated expression of Gcn4 [Hinnebusch A.G. et al, Mol. Cell Biol. 5:2349-2360 (1985)]. This DNA sequence was also sufficient for controlled expression of a GCN4/β-galactosidase chimeric coding sequence (containing 53 amino acids of Gcn4 fused to β-gal). The capability of these 706 bp alone (with no coding sequences) to control transcription and translation of an heterologous coding sequence has not been reported.

The cDNA encoding HSA was ligated downstream to the cloned 706 bp fragment. This GCN4-S-HSA cassette was inserted into a multicopy yeast plasmid as well as into centromeric and integrated plasmids (Fig. 2). The terminator of the ADHl gene was inserted downstream to GCN4-S-HSA. The resulting plasmids were introduced into yeast and HSA expression was monitored by western blot analysis. Expression was tested under various growth conditions, including amino acid starvation and 3-AT treatment. In all cases, using the short regulatory element, expression of HSA was not detectable (data not shown). Therefore, the inventors have cloned two longer fragments of GCN4 upstream sequences, one containing the sequences from -904 to -1 and a longer one containing the sequence from -1067 to -1 (Materials & Methods, Figs. 1 and 2). When the HSA gene was ligated to these fragments to obtain plasmids pGES-M-HSA and pGES-L-HS A and introduced to yeast, high expression level of HSA was detected (Fig. 3). In all constructs, HSA expression was barely detectable prior to induction with 3-AT, performed as described hereinafter. Expression level from constructs containing the Long regulatory element was usually higher than that obtained with the middle sized element (Mid.), as depicted from the levels of expression after 10 hours of induction (Fig. 3).

Expression of HSA under GCN4 regulatory elements is induced by 3-AT

To examine whether the cloned GCN4 elements could regulate HSA expression in a pattern similar to that of Gcn4 regulation, yeast cells (strain BJ2168) harboring pGES426-L-HSA were grown to logarithmic phase on SD(-URA). Then, cells were collected and re-suspended in SD(-URA,-HIS) medium supplemented with 20 mM 3-AT. Samples were removed from the culture at indicated time points (Figure 4A) and expression of HSA was measured (Fig. 4A). Already 2 hrs after addition of 3-AT, expression of HSA could be easily detected. As may be seen from the figures, expression reached its maximum level between 6 to 8 hours after induction.

These results, presented in Figs. 3 and 4, show that a vector based on GCN4 upstream elements could be efficiently used for inducible expression of foreign genes. To examine whether the level of expression could be fine controlled by the level of amino acids starvation, various concentrations of 3-AT were provided in an experiment conducted in a similar manner as described above. Fig. 4B exhibit that the level of HSA expressed is proportional to the level of 3-AT introduced, up to 40mM.

Expression of HSA from GCN4-HSA constructs is regulated at the translational level

To verify that induction of HSA occurred at the translational level, HSA mRNA and protein levels, before and after induction with 3-AT, were measured (Fig. 5). Protein extracts were tested by Western blot analysis using anti HSA antibodies (Fig. 5A), whereas RNA preparations were subjected to primer extension analysis (Figs. 5B and 5C). It is evident from the results presented herein that the mRNA encoding HSA is expressed at a similar level before and after the 3-AT induction. In addition, as may be seen from a compression between Fig. 5B and Fig. 5C most initiation sites used by RNA polymerase to transcribe the GCN4-HSA mRNA were identical to those found in GCN4 mRNA's {also in Hinnebusch A.G., PNAS USA 81:6442-6446 (1984)]. In contrast to the constitutive and uniform expression of HSA RNA, the HSA protein was barely detectable before induction with 3-AT and its expression increased in time following induction. It has thus been concluded that 3-AT dependent induction of HSA expression occurs at the translational level.

The GCN4 based vector induced efficient expression as an integrated copy

Transcription rate of GCN4 seems to be high under most growth conditions [Hinnebusch et al. (1985) ibid.; Engelberg D. et. al. (1994) ibid.]. In addition, mRNA levels of HSA expressed from pGES plasmids are quite high (although lower than those of GCN4, see Fig. 5). It was therefore assumed by the inventors that the efficient expression from the pGES426-L-HSA stems mainly from efficient translation rate and less from the high copy number of the plasmid. To examine this assumption the GCN4-L-HSA fragments was inserted into an integrative vector obtaining the pGES306-L-HSA plasmid as described in the M&M. this construct was then integrated into the yeast genome and the resulting clones were grown on rich, non-selective media to high protein concentration (to about 5xl0⁸ cells/ml) prior to the addition of 3-AT. Under these conditions expression of HSA was still efficiently induced (Fig. 6). In fact, the level of HSA obtained per cell was just slightly less than that obtained using the multicopy pGES426-L-HSA vector. As the culture grown on YPD reached higher cell concentration, the quantity of intracellular HSA protein obtained was about two times more with the integrated vector (about 0.5 mg/liter).

To compare the new expression vectors of the present invention with commonly used vectors, the cDNA encoding HSA was ligated downstream to the ADHl promoter. In the previously described vector pAD4Δ [Ballester R. et al. (1989) ibid.], cultures harboring either pADH-HSA, or pGES426-L-HSA were grown in parallel. After induction of pGES426-L-HSA with 3-AT, the expression of HSA was compared. The levels of HSA expression obtained from both plasmids was similar. Using the commercial HSA as standard the amount of intracellular HSA was determined to be 250 μg/liter, being about half of the amount obtained using the integrative version, pGES306-L-HSA, on rich medium. It was therefore concluded that the pGES system could be more efficient than currently available yeast expression vectors.

Example 2

Expression of a heterologous coding sequence in cells other than yeast cells pGES expression systems ofthe invention, which will include, ter alia, a heterologous coding sequence, for example the HSA coding sequence, and as a selectable marker neomycin or hygromycin resistance gene (suitable for selection either in mammalian cells, insect cells, plant cells or avian cells) will be prepared as described hereinabove.

The plasmid obtained will be transferred into mammalian cells using electroporation or calcium phosphate precipitation.

The cells will then be grown on a suitable medium to a concentration of about 2xl07cells/ml and then transformed with the pGES based vectors described hereinbefore. When the expression vectors lack a selectable marker, the cells may be co-transfected with a second plasmid carrying the selectable marker.

Following transfection, the transfected cells will be selected by culturing the population of cells obtained after transfection, in the presence of the relevant agent, such as an antibiotics (e.g. G418, hygromycin). The selected cells will then be exposed to amino acid starvation conditions mimicked by the addition of 3-AT, to induce expression of the HSA coding sequence.

Claims

1) An expression cassette comprising:- a) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; b) a heterologous coding sequence downstream to said regulatory element; c) a termination signal operably linked downstream to said heterologous sequence; and d) optionally, an operably linked selectable marker.

2) The Expression cassette as claimed in claim 1, further comprising at least one operably linked replication element.

3) The expression cassette as claimed in claim 1 or claim 2, wherein said GCN4 transcription factor is ofthe yeast Saccharomyces cerevisiae.

4) The expression cassette as claimed in claim 3, wherein said regulatory element comprises the nucleotides -904 to -1 upstream to the GCN4 coding sequence.

5) The expression cassette as claimed in claim 3, wherein said regulatory element comprises the nucleotides -1067 to -1 upstream to the GCN4 coding sequence.

6) The expression cassette as claimed in claim 5, wherein said regulatory element has the nucleotides -1067 to -1 upstream to said GCN4 coding sequence.

7) The expression cassette as claimed in claim 1, wherein said heterologous coding sequence encodes a protein or peptide product.

8) The expression cassette as claimed in claim 1, wherein said coding sequence encodes a naturally occurring protein or peptide or a derivative thereof, a fragment of said protein or peptide or a chimera of said protein, peptide or fragment thereof.

9) The expression cassette as claimed in claim 8, wherein said protein or peptide is a therapeutic product selected from the group consisting of enzymes, antibodies, cytokines, hormones, receptors, transcription factors, fragments thereof or any chimera of said therapeutic products. 10) The expression cassette as claimed in claim 9, wherein said heterologous coding sequence encodes a mammalian protein such as the human serum albumin (HSA) protein.

11) The expression cassette as claimed in claim 1, wherein said termination signal is selected from the group consisting ofthe termination signal of ADHl, TRPl, GAP (GAPDH), MFl, PH05, PGK, CYCl or of GCN4.

12) The expression cassette as claimed in claim 2, wherein said replication element is selected from 2μ, CEN or CEN-ARS.

13) An expression vector comprising the expression cassette of claim 1.

14) An expression vector being the plasmid substantially as shown in Figures 2A, 2B or 2C.

15) A method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- a) providing eukaryotic cells; b) transforming said cells provided in (a) with an expression vector comprising :- i) a regulatory element comprising the nucleotide sequence of the GCN4 transcription factor promoter or a functional derivative or fragment thereof; ii) a heterologous coding sequence downstream to said regulatory element; iii) a termination signal operably linked to said heterologous sequence; and iv) optionally, an operably linked selectable marker; c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and e) optionally, isolating said functionally active protein or peptide obtained in step (c) from said cells.

16) The method as claimed in claim 15, wherein said expression cassette further comprises at least one replication element.

17) The method as claimed in claim 15, wherein said eukaryotic cells are mammalian cells.

18) The method as claimed in claim 15, wherein said eukaryotic cells are yeast cells.

19) The method as claimed in claim 18, wherein said yeast cells are selected from S. cerevisiae, Schizosaccharomycespom.be or Pichi pectoris.

20) The method as claimed in claim 19, wherein said yeast cells are of the S. cerevisiae type.

21) The method as claimed in claim 20, wherein said yeast cells are of the strain BJ2168.

22) The method as claimed in claim 15, wherein said GCN4 transcription factor is of the yeast S. cerevisiae.

23) The method as claimed in claim 15, wherein said regulatory element comprises the nucleotides from -904 to -1.

24) The method as claimed in claim 15, wherein said regulatory element comprises the nucleotides from -1067 to -1.

25) The method as claimed in claim 24, wherein said regulatory element has the nucleotides from -1067 to -1.

26) The method as claimed in claim 15, wherein said heterologous coding sequence encodes a protein or peptide or a derivative thereof, a fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments thereof.

27) The method as claimed in claim 26, wherein said protein or peptide is a therapeutic product selected from the group consisting of enzymes, antibodies, cytokines, hormones, receptors, transcription factors or any chimera of said therapeutic products.

28) The method as claimed in claim 27, wherein said heterologous coding sequence encodes a mammalian protein such as the human serum albumin (HSA) protein.

29) The method s claimed in claim 27, wherein said protein or peptide is produced in high quantities.

30) The method as claimed in claim 15, wherein said termination signal is the termination signal of ADHl, TRPl, GAP (GAPDH), MFl, PH05, PGK, CYCl or of GCN4.

31) The method as claimed in claim 15, wherein said starvation conditions are mimicked by the addition of an effective amount of 3-AT.

32) The method as claimed in claim 15, wherein said cells are transformed with an expression being the plasmid substantially as shown in Figures 2A, 2B or 2C.

33) A therapeutic protein or peptide produced by the method of claim 15.

34) The protein or peptide as claimed in claim 33 being the HSA protein.

35) Eukaryotic cells transformed with the expression cassette as claimed in claim 1 and capable of expressing said heterologous coding sequence.

36) Cells according to claim 35 being mammalian cells.

37) Cells according to claim 35 being yeast cells.

38) Use of the expression cassette as claimed in claim 1, wherein said heterologous coding sequence encodes a therapeutic protein or peptide, in the production of a therapeutic protein or peptide.

39) Use of the expression cassette as claimed in claim 1, wherein said heterologous coding sequence encodes a therapeutic protein or peptide, in the preparation of a pharmaceutical composition containing said protein or peptide.

40) Use of the expression cassette as claimed in claim 1, wherein said coding sequence encodes a chimeric protein, in the detection of protein-protein interaction.