WO2002020789A1 - Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres - Google Patents

Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres Download PDF

Info

Publication number
WO2002020789A1
WO2002020789A1 PCT/IL2000/000545 IL0000545W WO0220789A1 WO 2002020789 A1 WO2002020789 A1 WO 2002020789A1 IL 0000545 W IL0000545 W IL 0000545W WO 0220789 A1 WO0220789 A1 WO 0220789A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gcn4
expression cassette
coding sequence
expression
Prior art date
Application number
PCT/IL2000/000545
Other languages
English (en)
Inventor
Avraham Laban
David Engelberg
Amnon Wolf
Original Assignee
Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.
Jexys Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd., Jexys Ltd. filed Critical Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.
Priority to PCT/IL2000/000545 priority Critical patent/WO2002020789A1/fr
Priority to AU2000270368A priority patent/AU2000270368A1/en
Publication of WO2002020789A1 publication Critical patent/WO2002020789A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/76—Albumins
    • C07K14/765—Serum albumin, e.g. HSA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to an expression cassette comprising sequences that promote transcription, sequences that promote translation, a heterologous coding sequence, a termination signal and optionally a selectable marker as herein after defined, and to the different uses of said expression cassette.
  • yeast An attractive alternative, for an expression system is of the yeast, and in particular, the baker's yeast Saccharomyces cere ⁇ isiae.
  • yeast Saccharomyces cere ⁇ isiae As with other eukaryotic systems, most foreign proteins expressed in this eukaryote are accurately processed post-translationally and are biologically active.
  • yeast As a food organism, yeast is highly acceptable for the production of pharmaceutical proteins, thus reducing the cost of manufacturing such proteins. Yet, despite the great potential of yeast as a protein factory, this organism is not widely used. The major reason for this may be the fact that the level of expression obtained in yeast is usually much lower than that obtained in bacteria [Romanos M.A. et al. (1992) ibid.].
  • yeast expression vectors are available. All vectors (similarly to the bacterial and mammalian vectors) contain strong promoters (usually a promoter of glycolitic genes for example, GPD1, ADH1, PGKl). In addition, they contain the 2 ⁇ origin of replication which allows several plasmid replications during one round of cell cycle [Schneider J.C. and Guarente L. Meth. Enzymol. 194:373-388 (1991); Schena M. et al. Meth. Enzymol. 194:389-398 (1991); Rose A.B. and Broach J.R., Meth. Enzymol. 185:234-279 (1990)].
  • promoters usually a promoter of glycolitic genes for example, GPD1, ADH1, PGKl.
  • 2 ⁇ origin of replication which allows several plasmid replications during one round of cell cycle [Schneider J.C. and Guarente L. Meth. Enzymol. 194:373-388 (19
  • these plasmids are present in 60-100 copies per cell.
  • Some of the vectors also contain an inducible promoter, the most widely used is the GALl-10 promoter [Schena M. et al. (1991) ibid.]. None of the currently used vectors (in yeast or any other system) harbors an efficient and regulated element to control translation.
  • the strategy used with- yeast vectors in order to increase expression is a combination of high transcription rate with the presence of many copies of the vector per cell.
  • Cells harboring those vectors must be grown on synthetic media under selective conditions to maintain the plasmids in the cell. These conditions are usually not optimal. When grown in laboratory flasks these cultures enter stationary phase at low concentrations and the quantities of proteins obtained are usually low. When grown in industrial fermentors, high cell concentrations could be obtained via special treatments and long and expensive incubation time.
  • the present invention aims at the development of an expression vector utilizing regulatory elements of the GCN4 gene.
  • GCN4 encodes a transcription activator, which induces transcription of coding sequences of biosynthetic enzymes [Hinnebusch A.G., Microbiol. Rev. 52:248-273 (1988); Hinnebusch A.G. In Broach J.R. et al., Eds. The Molecular and Cellular Biology of the Yeast Saccharomyces Gene Expression. Cold Spring Harbor Laboratory. NY pp 319-414 (1992); Hinnebusch A.G., J. Biol. Chem.272:21661-21664 (1997)]. Under optimal growth conditions on media supplemented with amino acids and pyrimidine and purine bases, GCN4 is not expressed.
  • Gcn4 expression When cells are starved for amino acids, Gcn4 expression is dramatically induced, and consequently, transcription of biosynthetic genes commences.
  • Expression of GCN4 is regulated mainly at the translational level.
  • the mRNA levels of GCN4 are high under most growth conditions, but nder optimal growth conditions, translation rate of this mRNA is extremely low and GCN4 protein is barely detectable. This minimal translation rate is maintained by 4 short open reading f ames located in the 5' non-coding leader of the message (4 upstream ORFs) [Hinnebusch, A.G. (1997) ibid.; Dever, T.E. et al. Cell 68:585-596 (1992)].
  • Ribosomes recognize the most upstream ORF and begin translation.
  • the GCN4 mRNA is preferably translated. This seems to be a logical response since the Gcn4 protein is required for induction of amino acids biosynthesis.
  • a ino acid starvation could be easily mimicked by treatment of yeast cells with inhibitors of biosynthetic enzymes.
  • the most widely used compound is 3-amino-l,2,4-triazole (3-AT), a competitive inhibitor of His3. Cells combat the competitive inhibition effect simply by producing more His3. Indeed, the rate of GCN4 translation (leading to HIS3 transcription) dramatically increases in response to 3-AT treatment [Hinnebusch A.G. (1988) ibid.; Hill D.E. et al. Science 234:451-457].
  • the sequence which resides upstream to the GCN4 coding sequence was shown to govern transcription and translation of GCN4/ ⁇ -galactosidase ( ⁇ -GAL) chimeric gene [Hinnebusch A.G. PNAS USA 81:6442-6446 (1984); Thireos G. et al, PNAS USA 81:5096-5100 (1984); Hinnebusch A.G. Mol. Cell. Biol. 5:2349-2360 (1985)].
  • GCN4 As translation of GCN4 (and of the GCN4/ ⁇ -GAL chimeric gene) increases when eIF2 (is phosphorylated and its activity decreases, it was recently suggested to use the GNC4/ ⁇ -GAL gene as a marker which monitors the level of eIF2 ⁇ phosphorylation and activity [Dever T.E. Methods 11:403-417 (1997)].
  • GCN4 upstream sequences (with no coding sequences) are capable of controlling transcription and translation of an heterologous gene at the translational level, in conjunction with another heterologous promoter.
  • the inventors have now surprisingly found that GCN4 upstream sequences could be utilized for efficient and regulated expression of foreign genes by the expression cassette of the invention.
  • the present invention provides an expression vector utilizing the 5'UTR of the GCN4 gene. This element, and variations or modifications thereof, is used to enhance translation of foreign coding sequences.
  • This 5'UTR is used as a modular unit to function as a regulator of in combination with any promoter of yeast or of other organisms.
  • the promoter of the GCN4 gene can be used as well.
  • the present invention relates to an expression cassette comprising: (a) an element capable of post-transcriptional regulation comprising the nucleotide sequence of the GCN4 transcription factor 5'UTR or a functional derivative or fragment thereof; (b) a promoter linked upstream to the sequence of the 5'UTR of GCN4 or a functional derivative thereof; (c) a heterologous coding sequence downstream to said regulatory element; and (c) a termination signal operably linked downstream to said heterologous sequence.
  • the expression cassette further comprises an operably linked selectable marker.
  • the regulatory element derived from the gene encoding the GCN4 transcription factor within the expression cassette of the present invention is preferably of the yeast's Saccharomyces cere ⁇ isiae, and more preferably comprises a sequence between -600 to -1 upstream to the GCN4 coding sequence, or a functional fragment thereof.
  • This 5'UTR that can be used as a modular unit that increases translation and can function in combination with any promoter.
  • the invention relates to sequences comprising at least-600 to -1 of the 5'UTR that can be used as a modular unit that increases translation and can function in combination with any promoter.
  • a preferred embodiment relates to the heterologous coding sequences within the expression cassette of the invention encode amino acid sequences, particularly those having a therapeutic -utility.
  • the invention in a second aspect, relates to an expression vector comprising the expression cassette of the invention.
  • the invention also relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of:- (a) providing eukaryotic cells; (b) transforming said eukaryotic cells with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the 5'UTR of the gene encoding the GCN4 transcription factor, preferably that of the yeast S.
  • step (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same;and (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence.
  • the method of the invention optionally comprising the step of isolating said functionally active protein or peptide obtained in step (c) from said cells.
  • derivatives of said expression vector may be expressed constitutively so that induction is not required.
  • the promoter could be inducible by certain inducers including but not limited to galactose, cuprum and other inducers as are known in the art.
  • the 5'UTR regulatory element of GCN4 may be inducible by starvation conditions or could be active constitutively.
  • the expression vector of the invention may further comprise at least one replication element.
  • the invention relates to a therapeutic protein or peptide produced by the method of the invention and to eukaryotic cells transformed with the expression cassette or vector of the invention, said cells being capable of expressing a heterologous coding sequence comprised therein, to obtain said therapeutic protein or peptide. ' .
  • FIG. 2 The sequence of the GCN4 elements used in the invention.
  • the sequence covers the DNA that resides from -1 to -2000 base pairs upstream of the GCN4 coding sequence.
  • the sequences encoding the 4 upstream ORFs are underlined.
  • the transcription initiation site (starting point of 5'UTR) is marked by an asterisk.
  • FIG. 3A-3C The basic pGES vector family containing the HSA cDNA.
  • Fig. 3A shows the integrative vector pGES306-HSA
  • Fig. 3B shows the centromeric vector pGES316-HSA
  • ' ig. 3C shows the multicopy vector pGES426-HSA.
  • Bac ori is a bacterial origin of rephcation
  • Prom promoter
  • Term terminator.
  • FIG. 4 Induction and expression of HSA by pGES vectors containing either the long regulatory element (Long) or the middle sized regulatory element (Mid), both containing the GCN4 promoter and post-transcriptional regulatory elements of the 5'UTR.
  • Western blot analysis using anti-HSA antibodies was performed on protein extracts prepared from cultures (BJ2168 cells) harboring either pGES306-L-HSA (Long) or pGES306-M-HSA (Mid.), 8 and 10 hours after addition of 3-AT.
  • FIG. 5A-5B Time course and dose response analysis of induction of HSA expression'.
  • Fig. 5A shows a cult ⁇ re of BJ2168 cells harboring pGES426-L-HSA grown to logarithmic phase and than supplemented with 3-AT (20 mM). Samples were removed at indicated time points and subjected to western blot analysis.
  • Fig. 5B shows a similar culture grown to logarithmic phase and then divided to six fractions, each fraction supplemented with the indicated concentrations of 3-AT. Cultures were further grown for 7 hours before collection and analysis by western blotting. Purified HSA (10 and 50 ng) were loaded on the right lane of each gel. Abbreviations: T + is time with.
  • Figure 6A-6C Expression of HSA from pGES vectors is induced at the translational level.
  • a culture harboring the oGES306-L-HSA vector and culture harboring the control plasmid pRS306-S were grown to logarithmic phase when 3-AT was added. At the indicated time points samples were removed.
  • Protein extracts and RNAs were prepared from each sample and analyzed by western blot and primer extension respectively.
  • Fig. 6A shows the western blot analysis.
  • Fig. 6B shows the primer extension analysis using GCN4 primer.
  • Fig. 6C shows the primer extension analysis using HSA primer.
  • T + is time with.
  • FIG. 7 pGES system is inducible in highly concentrated cultures.
  • Samples were removed and analyzed by western blot as the indicated time points after induction.
  • Purified HSA 50 ng was loaded on the right lane of the gel.
  • T + is time with.
  • Figure 8 Various derivatives of the basic pGES family, illuminating the modularity of the system.
  • Fig. 8A and 8B shows derivatives of pGES containing useful multicloning sites and different selectable markers.
  • Fig. 8C shows a vector in which the 5'UTR of GCN4 was combined with another promoter (of GAL1).
  • Fig. 8D shows a vector in which the four upstreams ORFs in the 5'UTR of GCN4 were either mutated or eliminated. Translation from this vector is not regulated, but rather constitutive.
  • Fig. 8E shows a vector with GAL1 promoter 5'UTR of GCN4 with 4 upstream ORFs either mutated or eliminated.
  • Fig 8F and 8G show a pGES vector with sequences encoding a leader peptide (LP) and either haemaglutinin (HA) or polyhistidine (PolyH) tags as well as multicloning site (MCS).
  • LP leader peptide
  • HA haemaglutinin
  • PolyH polyhistidine
  • MCS multicloning site
  • Fig.8 The vectors shown in Fig.8 are merely exemplary, each of them represents a family of vectors (e. g. with different selectable markers, different cloning sites, different origin of replications, different promoters, different modifications in the 5'UTR) that uses the principles described in the specification.
  • the present invention discloses the development of a new family of yeast expression vectors, which are based on the 5'UTR sequence of GCN4 as the regulatory element. This system affords efficient regulation of heterologous gene expression at the translational level. Expression from these vectors is tightly controlled and is induced under amino acid starvation conditions.
  • the post-transcriptional regulatory elements of the 5'UTR are used in conjunction with the GCN4 promoter for enhancement of heterologous gene expression. It will be appreciated by the artisan that any promoter could serve for this purpose.
  • the invention also discloses vectors in which the GCN4 5'UTR was modified. Modifications or fragments of the GCN4 5'UTR may advantageously be combined with other regulatory elements including an additional promoter. Expression from vectors comprising modifications of the GCN4 5'UTR may be either regulated or constitutive.
  • Biosynthesis of proteins (transcription and translation) in living organisms is similar. Therefore, in principle, any cell type may be used as a host for the expression of a foreign gene. Nevertheless, for practical reasons, to date only few cell-systems have been employed as "factories" for proteins. These practical reasons include, inter alia, the cost of growing the host cell, the efficiency in which the foreign protein is expressed, the cell's stabihty which may alter as a result of the expression of unrecognized proteins, the desire to obtain biologically functional proteins and the cost and efficacy of producing a purified protein.
  • yeast for the expression of foreign proteins provides numerous advantages. While yeast are edible organisms and thus safe to use as a "factory" for pharmaceuticals. Prokaryotes, such as Escherichia coli, have toxic cell wall pyrogens, while mammalian cells may contain oncogenic or viral DNA, so that the products from these organisms must be tested more extensively. Further, yeast can be grown rapidly on simple media and to high cell density, their genetics are advanced, and they can be manipulated almost as readily as E. coli [Romanos M.A. et al. Yeast 8:423-488 (1992)]. Therefore, the use of yeast cells for the production of proteins reduces cost and is less time consuming. In addition, since yeast cells are eukaryotic cells, many of the post-translational processes necessary for the production of a biologically functional product are correctly performed.
  • the system of the present invention differs from currently available expression vectors since it is controlled at the translational level, ensuring efficient translation and allowing rapid induction. All currently available expression systems ensure transcription, but cannot control or enforce translation. Under non-inducible conditions, expression from the vectors of the invention is quite well suppressed.
  • the system of the invention allows fine control on the level of expression, since this level is directly proportional to the concentration of the inducer.
  • integrated versions of the expression vectors described in the invention are almost as efficient as multicopy versions. Therefore, the pGES expression system could be used under various growing conditions, including in rich, non-selective media, which is clearly an advantage.
  • the present invention thus relates to an expression cassette comprising: (a) a regulatory element comprising the nucleotide sequence of the 5'UTR of the gene encoding the GCN4 transcription factor, or a functional derivative or fragment thereof; (b) a promoter operably linked upstream to said regulatory element; (c) a heterologous coding sequence downstream to said regulatory element; and (d) a termination signal operably linked downstream to said heterologous sequence;
  • the expression cassette further comprises an operably linked selectable marker.
  • the expression cassette may comprise a genomic or cDNA library, which may be used for many different purposes, as known to the man skilled in the art, e.g. for screening.
  • heterologous coding sequence is meant any sequence which encodes a protein or peptide which one requires to be expressed.
  • the coding sequence may be a naturally occurring sequence or a derivative thereof of any origin or an artificial sequence or a derivative thereof.
  • nucleic acids in a coding or in a non-coding sequence, means any modification thereof including, insertions, deletions, mutations and substitutions.
  • 'functional fragment' used herein in connection with nucleic acids means any fragment which will provide substantially the same functional result as the original intact sequence in terms of enhanced expression as determined relative to an equivalent construct lacking the regulatory element of the invention.
  • the expression cassette of the invention may further comprise operably linked thereto a rephcation element, to provide an expression vehicle which will be substantially independent from the host cell rephcation elements.
  • a rephcation element When a rephcation element is required for the efficient expression of the coding sequence within the expression cassette of the invention, it may be any suitable replication element, for example, the 2 ⁇ element, which supports maintenance of many copies of the gene in the cell [Rose A.B. and Broach J.R. Meth. Enzymol. 185:234-279 (1990)] or a centromeric element (CEN) which rephcates together with the endogenous DNA and is maintained therefore as a single copy per cell. CEN based vectors are combined in many cases with auto-rephcating sequences I
  • ARS The CEN-ARS based vectors, which may also be employed, are maintained in few copies (usually 1-2).
  • the expression cassettes of the invention may also be employed as an integrative single copy fragment, which does not require growing the cells on a selective medium.
  • the said regulatory elements derived from the GCN4 transcription factor gene is preferably of the yeast Saccharomyces cere ⁇ isiae.
  • the regulatory element employed in the expression cassette of the invention comprises any sequence, or any fragment comprising at least part of the sequence from minus 600 to minus 1 of the 5'UTR of GCN4 and any functional derivative obtained by mutation thereof is a modular fragment that could be used in combination with any promoter of any origin.
  • regulatory element comprising the sequence substantially as denoted by SEQ ID NO: 15 or any sequence or any fragment thereof.
  • a fragment of said sequence comprising at least part of the sequence from minus 600 to minus 1 of the 5'UTR of GCN4 and any derivative thereof further comprising elimi ation of at least one of the 4 upstream ORFs is a modular fragment that may be used in combination with any promoter of any origin.
  • a preferred embodiment relates to the expression cassette of the invention wherein the promoter may be the GCN4 transcription factor promoter of the yeast Saccharomyces cere ⁇ isiae.
  • this promoter can be taken from nucleotides minus 2000 to minus 600 upstream to the GCN4 coding sequence, substantially as denoted by SEQ ID NO: 11.
  • the expression cassette of the invention comprises promoter comprising nucleotides minus 1067 to minus 600 upstream to the GCN4 coding sequence and more preferably, it comprises the nucleotides from minus 904 to minus 600 of said sequence upstream to the GCN4 coding sequence, substantially as denoted by SEQ ID NO: 14 and 13 respectively, or any fragment or derivative thereof.
  • the expression cassette of the invention may comprise the GALl promoter or any functional fragments thereof.
  • the expression cassette according to the invention comprises a coding sequence, which encodes a naturally occurring amino acid sequence or a derivative thereof.
  • the amino acid sequence corresponds to a natural protein, polypepti.de or peptide or to a functional derivative of said natural protein or peptide, to an essential fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments.
  • the term 'functional derivative' used herein means any modification of the naturally occurring sequence, including insertions, deletions or substitutions of nucleic or amino acids residues therein, or any other suitable modification which does not damage the biological function of the nucleic or amino acid sequence.
  • the functional derivatives according to the invention may also be any dimeric or multimeric form of said amino acid according to the invention.
  • Functional proteins or peptides within the scope of the invention encompass any protein or peptide that one requires to have expressed, advantageously those proteins or peptides having a therapeutic value.
  • Such proteins or peptides may be selected from the group consisting of enzymes, antibodies, cytokmes, hormones, receptors, transcription factors or any chimera of said therapeutic products with a different protein or peptide".
  • the term "therapeutic” as used herein means any protein, polypeptide or peptide having an industrial application. Thus it may refer to any pharmaceutical, agricultural, veterinary or diagnostic product as well as for enzymes, toxins and inhibitors used in chemical industry, plastic industry, food industry and in chemical and biological research .
  • the expression cassette comprises a heterologous coding sequence, which encodes the human serum albumin (HSA) protein.
  • HSA human serum albumin
  • the termination signal according to the invention may be any suitable terminator which is capable of terminating the transcription of coding sequence and of adding polyadenylated ribonucleotides to the 3 end of the primary transcript obtained therefrom.
  • the termination signal thus may be selected from the group consisting of the yeast alcohol dehydronease gene (ADHl), TRPl, glyceralkehyde-3-phosphate dehydrogenase (GAP, GAPDH), MF1, phosphate regulated terminator (e.g. of PH05), phosphoglyce ate kinase (PGK , CYCl or the GCN4 terminator.
  • the termination signal can be selected from genes of any organism, not necessarily yeast.
  • the invention in a second aspect, relates to an expression vector comprising the expression cassette of the invention.
  • the expression vector of the invention may include, in addition to the expression cassette, any other element required for the efficient and regulated expression of the product encoded by the coding sequence, such as an ORI sequence. Further, the vector may include an appropriate polyA signal, and or an intron splicing signal, e.g. of the SV40 virus.
  • the vector may include other elements such as sequences which encode peptides facilitating the secretion of the protein expressed by the heterologous coding sequence incorporated in the expression cassette into the growing media (secretion elements). Further, it may contain sequences which encode peptides capable of eliciting production of antibodies thereagainst, or even those encoding tagging proteins, which bind to specific columns during affinity purification (e.g. polyHis that binds to agarose-nickel beads, gluthatione S-transferase (GST) that binds to gluthatione beads, cellulose binding domain (CBD) which binds to cellulose).
  • GST gluthatione S-transferase
  • CBD cellulose binding domain
  • the vector may include combinations of several of the above elements.
  • the vectors may comprise a sequence encoding a leader peptide that facilitates secretion and a sequence encoding a tag such as CBD, GST, or polyhistidine.
  • the expression vectors of the invention contain the leader peptide of the mating factor alpha, the CBD sequence, or the polyhistidine sequence (as will be exemplified hereinafter and in Fig. 8).
  • the expression vector according to the invention is the integrative plasmid substantially as shown in Figure 3A.
  • the expression vector of the invention is the centromeric plasmid substantially as shown in Figure 3B.
  • the expression vector of the invention may be the multicopy plasmid substantially as shown in Figure 3C.
  • the invention in a third aspect, relates to a method for the regulated production of a therapeutic protein or peptide in eukaryotic cells, which method comprises the steps of: (a) providing eukaryotic cells; (b) transforming said eukaryotic cells with an expression vector comprising:- (i) a regulatory element comprising the nucleotide sequence of the 5'UTR of the gene encoding the GCN4 transcription factor, preferably that of the yeast S.
  • a promoter operably linked to said regulatory element (iii) a heterologous coding sequence downstream to said regulatory element; (iv) a termination signal operably linked to said heterologous sequence; and (v) optionally, an operably linked selectable marker; (c) selecting from the cell population obtained in (b) those cells which harbor said expression vector and growing the same; (d) inducing expression of said heterologous coding sequence in said cells under amino acid starvation conditions or under, conditions which mimic said starvation to obtain a functionally active protein or peptide encoded by said heterologous coding sequence; and (e) optionally, isolating said functionally active protein or peptide obtained in step (c) from said cells or from the cell's medium.
  • the expression cassette when necessary for efficient expression, further comprises a rephcation element.
  • the cells provided for the expression of the coding sequence may be any eukaryotic cell capable of efficiently and sufficiently expressing said coding sequence, thus producing an active product.
  • the eukaryotic cell may be of a mammalian type.
  • the eukaryotic cells employed by the method of the invention may be yeast cells.
  • the yeast, cells will be those capable of expressing said coding sequence and may include, inter alia, the yeast S. cere ⁇ isiae, Schizosaccharomycespom.be or Pichiapastoris.
  • the yeast cells are of the S. cere ⁇ isiae type, in particular, those of the strains SP1, W303, C13ABYS86, BJ2407, BJ2168, H625, H628, and H640 and is preferably of the BJ2168 strain.
  • the regulatory element comprising sequences of the yeast S. cere ⁇ isiae GCN4 transcription factor 5'UTR.
  • This regulatory element comprises nucleotides taken from the -600 to -1 sequence of the 5'UTR, or any derivative or fragments thereof, substantially as denoted by SEQ ID: 15.
  • This modular fragment may be used in combination with any promoter.
  • the method of the invention utilizes the GCN4 promoter.
  • the GCN4 prompter comprises nucleotides taken from the sequence of -2000 to -600 upstream to the GCN4 coding sequence, or any functional fragment thereof. Nevertheless, said promoter sequence may preferably comprise the nucleotides from -1067 to -600 upstream to the GCN4 transcription factor. Moreover, the sequence employed by one currently preferred method of the invention is that having the nucleotides from -1067 to -600, substantially as denoted by SEQ ID NO: -13, upstream to the GCN4 coding sequence as the promoter operablly linked to the regulatory elements of the invention.
  • a fragment comprising at least part of the sequence within the 5'UTR of the GCN4 comprising nucleotides -600 to -1 or any derivative thereof may be used modularly in combination with other promoters.
  • the promoter employed by the method of the invention may be an inducible strong promoter such as the GALl, together with the 5'UTR of GCN4 (Fig. 8).
  • This vector is highly inducible at the level of transcription (using galactose) and at the level of translation (using 3-aminotriazole).
  • any heterologous coding sequence which encodes an amino acid sequence
  • the amino acid sequence may comprise naturally occurring amino acids and/or derivatives of the same, as defined hereinbefore.
  • the a ino acid sequences produced by utilizing the expression cassette of the invention will preferably correspond to a natural protein or peptide having an industrial purpose or to a functional derivative thereof, to a fragment of said proteins or peptides or to a chimera of said proteins, peptides or fragments thereof.
  • the protein or peptide product may be an enzyme, an antibody, a cytokine, a hormone, a receptor, a transcription factor or a functional derivative thereof or any other protein or peptide having a biological and/or therapeutic function.
  • the product of the invention could also be a non-coding RNA, catalytic RNA or any functional or non-functional artificial (not occurring naturally) peptide.
  • the product could be also an array of many different peptides produced through the use of a cDNA or a genomic library.
  • the human serum albumin protein is obtained by the method of the invention.
  • One substantial advantage of the method of the invention is the possibility to obtain the expressed protein in a controlled manner and with high yield.
  • HSA is obtained in high quantities.
  • Starvation conditions may be mimicked by specific drugs which inhibit amino acid biosynthesis, such as 3-aminotriazole (3-AT), allowing stringent control and easy induction of expression of the foreign gene.
  • drugs capable of mimicl ng amino acid starvation may include 5-fluorotryptophan.
  • the termination signal may be any suitable termination signal, taken from any organism. However, it is preferably selected from yeast, for example, the termination signal of ADHl, TRP1, GAP (GAPDH), MF1, PH05, PGK, CYC1 or of GCN4.
  • yeast for example, the termination signal of ADHl, TRP1, GAP (GAPDH), MF1, PH05, PGK, CYC1 or of GCN4.
  • the cells are transformed by the method of the invention with the expression vector which is the integrative plasmid substantially as shown in Figure 3A.
  • the cells may be transformed by the method of the invention with the centromeric expression vector substantially as shown in Figure 3B.
  • the cells may be transformed by the method of the invention with the multicopy expression vector substantially as shown in Figure 3C.
  • the intracellular level of protein expression (per cell) obtained with the pGES vectors is somewhat higher than that obtained through the use of currently available vectors. Furthermore, as it could be used as an integrated vector and is still inducible in dense cultures (Fig. 6), these vectors may give rise to improved protein production (in quantity and quality). An improved transcription rate could also be obtained through a combination of a strong constitutive promoter (from another gene) with the regulatory element of GCN4 5'UTR. Such chimera may be more efficient than pGES and still be regulated at the translational level.
  • More preferred combinations will utilize an inducible strong promoter as is known in the art including but not hmited to that of the GALl gene for example, together with the 5'UTR of GCN4 (Fig. 8B and 8D).
  • This vector is highly inducible at the level of transcription (using galactose) and at the level of translation (using 3-aminotriazole).
  • the invention concerns with eukaryotic cells transformed with the expression cassette or expression vector of the invention which cells are capable of expressing the heterologous coding sequence comprised therein.
  • Eukaryotic cells transformed with the system of the invention may be mammalian cells, yeast cells, fungi, insect cells, avian cells or any other eukaryotic cell capable of efficiently producing the desired therapeutic protein or peptide.
  • insect cell lines which may be transformed with the system of the invention, but not limited thereto, are Spodeoptera frugiperda (e.g. sf9 cell line), Trichoplusia ni (Tn), Mamestra brassicae, Estigmene acrea, Anopheles gambiae, Aedes albopictus and Aedes aegypti Mos20.
  • Examples for mammailan cells which may be transformed with the system of the present invention, but not limited thereto, are CV-1, COS, C127, NIH3T3, FR3T3 or the CHO cell lines.
  • GCN4 translation rate is constitutively high and not regulated (gcd mutants are described by Hinnebusch et al.
  • any protein or peptide, particularly therapeutic ones, produced by such cells encompass part of the invention.
  • One example for such a protein is the HSA protein.
  • the invention relates to the use of the expression cassette of the invention, wherein the , heterologous coding sequence encodes a therapeutic protein or peptide, in the production of a therapeutic protein or peptide.
  • the invention relates to the use of the expression cassette of the invention, wherein the heterologous coding sequence encodes a therapeutic protein or peptide, in the preparation of a pharmaceutical composition containing said protein or peptide.
  • the expression cassette of the invention may be utilized for the expression of libraries, for example, for cloning via functional complementation of mutants, for screening genes which allow growth under certain conditions (e.g. toxic conditions, under extreme conditions or in the presence of drugs), for the detection of protein-protein interactions (through the expression of a sequence encoding a chimeric peptide), as with the two hybrid system.
  • the nucleotide sequence of GAL4-DNA binding domain fused to a cDNA Hbrary will be expressed using the expression cassette of the invention.
  • the expression cassette may also be utilized in the Sos recruitment system (SRS) or in the Ras recruitment system (RRS) system, in " which the membrane localized cDNA Hbrary, the SOS -cDNA Hbrary or the RAS-cDNA Hbrary, may be expressed using the system of the invention.
  • the SP1 strain (MATa, his3, leu2, ura3, trpl, ade8 and can [Kataoka T. et al., Cell 37:437-445 (1984)] was obtained form Wigler M.) was used as a source of genomic DNA from which the GCN4 upstream sequences were loned by PCR.
  • the BJ2168 strain (MATa, prcl-407, prb 1-1122, pep4-3, leu2, trpl, and ura3-52 [Zubenko, G.S. et al., Genetics 96:137-146 (1980)] was used as a host for. all expression plasmids and was obtained from the yeast genetic stock center at UC Berkley.
  • Yeast ceHs were grown on either YPD (1% yeastextract, 2% bactopeptone, 2% glucose) or on SD media (0.17% yeast nitrogen base w/o amino acids and ammonium sulfate (Difco), 0.5% NH4(S04)2, 2% glucose and the required amino acids and uracil (40 mg Hter)).
  • Strains arboring plasmids were grown on SD (-uracil).
  • Primer 3' 5'GCGCCGGATCCTTTATTTGTATTTAATTTATTTTCTTGAGC-3', substantially denoted by SEQ ID NO: 1. This primer contains the BamHI site and was used in all PCR reactions (Fig. 1).
  • Mid promoter - 5'GCGCCGATAGTGCCGAACACCACCGGCATCTTG-3' substantiaUy denoted by SEQ ID NO: 3.
  • This primer was used in combination with the primer 3' to clone the middle length promoter by amplifying the sequence from nucleotide number -904 to nucleotide -1.
  • This primer was used in combination with primer 3' to clone the shorter promoter by amplifying the sequence from nucleotide number -706 to nucleotide -1.
  • PCR products were digested with Spel and BamHI and Hgated to pBluescript to obtain the plasmids pBSG-Short (pBSG-S), pBSG-Mid (pBSG-M) and p . BSG-Long (pBSG-L).
  • the cloned DNAs were sequenced and found identical to the sequence of this region as appears in the Saccharomyces genome database.
  • HSA human serum albumin
  • HSA-ATG 5'GCGCGCGGATCCATGAAGTGGGTAACCTTTATTTCCC-3', substantially denoted by SEQ ID NO: 5.
  • HSA-900 5'GCAGATCTCCATGGCAGCATTCC-3 ⁇ substantially denoted by SEQ ID NO: 6.
  • the plasmids obtained were named pBSG-S-HSA, pBSG-M-HSA and pBSG-L-HSA.
  • the GCS4-HSA moiety of each of these plasmids was removed as a Spel-EcoRI fragment and inserted into pRS316 (a centromeric yeast plasmid
  • pGES306-S-HSA for the GCN4 based expression system, being derived from the pRS306 plasmid and containing the short GCN4 regulatory element and the HSA cDNA;
  • FIG. 3 A schematic representation of these plasmids is provided in figure 3.
  • a BamHI EcoRI fragment containing the HSA cDNA was rendered blunt by DNA Pol I (Klenow fragment) and inserted into the Smal site of pAD4 ⁇ [BaHester R. et al, Cell 59:681-686 (1989)].
  • the leader peptide of the mating factor alpha and the sequence encoding CBD were added using appropriate oHgonucleotides.
  • the GALl promoter-GCN4 5'UTR fusion was created by Hgation of the GALl promoter to the Seal site in the GCN4 element. Mutagenesis of the 4 upstream ORFs in the 5'UTR of the GCN4 gene was carried out using the quick-change ldt (Stratagene) according to manufacturer instructions.
  • Protein extracts were prepared as previously described [Gross E. et al., Mol. CeU. Biol. 12:2653-2661 (1992)].
  • AH SDS-PAGE gels contained 10% acrylamide. Protein blotting was performed -with a LKB semi-dry blotter for two hours under constant current (mA-0.8xgel area in cm2).
  • Polyclonal anti HSA antibodies (RAHu/albumin) (from Nordic Immunology) were used in a dilution of 1:50,000.
  • Peroxidase conjugated Goat anti rabbit antibodies from Jackson Immunological
  • Purified HSA was used as a standard positive control.
  • RNA preparation and primer extension analysis were performed as previously described [Engelberg D. et al., Mol. CeU. Biol. 14:4929-4937 (1994)] using the foUowing primers:-
  • HSA-extension 5'ACCTCACTCTTGTGTGCATCTC 3', substantiaUy denoted by SEQ ID NO: 7.
  • GCN4-extension 5'ATAATTCGCTAGTGAAACTGATGGGC 3', substantiaUy denoted by SEQ ID NO: 8.
  • Primer extension products were separated on 6% acrylamide 7 M urea gel.
  • heterologous coding sequence requires a fragment of at least 904 bp upstream to the GCN4 coding sequence
  • the cDNA encoding HSA was hgated downstream to the cloned 706 bp fragment.
  • This GCN4-S-HSA cassette was inserted into a multicopy yeast plasmid as weU as into centromeric and integrated plasmids (Fig. 3).
  • the terminator of the ADHl ' gene was inserted downstream to GCN4-S-HSA.
  • the resulting plasmids were introduced into yeast and HSA expression was monitored by western blot analysis. Expression was tested under various growth conditions, including amino acid starvation and 3-AT treatment. In aU cases, using the short regulatory element, expression of HSA was not detectable (data not shown).
  • the inventors have cloned two longer fragments of GCN4 upstream sequences, one containing the sequences from -904 to -1 and a longer one containing the sequence from -1067 to -1 (Materials & Methods, Figs. 1 and 3).
  • HSA gene was hgated to these fragments to obtain plasmids pGES-M-HSA and pGES-L-HSA and introduced to yeast, high expression level of HSA was detected (Fig. 4).
  • HSA expression was barely detectable prior to induction with 3-AT, performed as described hereinafter.
  • Expression level from constructs containing the Long regulatory element was usually higher than that obtained with the middle sized element (Mid.), as depicted from the levels of expression after 10 hours of induction (Fig. 4).
  • yeast ceUs harboring pGES426-L-HSA were grown to logarithmic phase on SD(-URA). Then, ceUs were coUected and re-suspended in SD(-URA, -HIS) medium supplemented with 20 mM 3-AT. Samples were removed from the culture at indicated time points ( Figure 5A) and expression of HSA was measured (Fig. 5A). Already 2 hrs after addition of 3-AT, expression of HSA could be easUy detected. As may be seen from the figures, expression reached its maximum level between 6 to 8 hours after induction.
  • HSA mRNA , and protein levels, before and after induction with 3-AT were measured (Fig. 6).
  • Protein extracts were tested by Western blot analysis using anti HSA antibodies
  • the GCN4 based vector induced efficient expression as an integrated copy Transcription rate of GCN4 seems to be high under most growth conditions [Hinnebusch et al. (1985) ibid.; Engelberg D. et. al. (1994) ibid.].
  • mRNA levels of HSA expressed from pGES plasmids are quite high (although lower than those of GCN4, see Fig. 6). It was therefore assumed by the inventors that the efficient expression from the pGES426-L-HSA stems mainly from efficient translation rate and less from the high copy number of the plasmid.
  • the GCN4-L-HSA fragments was inserted into an integrative vector obtaining the pGES306-L-HSA plasmid as described in the M&M. This construct was then integrated into the yeast genome and the resulting clones were grown on rich, non-selective media to high protein concentration (to about 5xl0 8 ceUs/ml) prior to the addition of 3-AT. Under these conditions expression of HSA was stiU efficiently induced (Fig. 7). In fact, the level of HSA obtained per ceU was just sHghtly. less than that obtained using the multicopy pGES426-L-HSA vector.
  • the cDNA encoding HSA was Hgated downstream to the ADHl promoter.
  • vector pAD4 ⁇ Bact al (1989) ibid.
  • cultures harboring either pADH-HSA, or pGES426-L-HSA were grown in paraUel.
  • the expression of HSA was compared.
  • the levels of HSA expression obtained with pGES426-L-HSA was significantly higher than that obtained with pADH-HSA and reached the level of 6 mgtliter.
  • the inventors current estimation is that the amount obtain with the integrated vector (pGES306-L-HSA) when ceUs rich high density on rich medium is at least twice the level obtained with pGES426-L-HSA. It was therefore concluded that the pGES system could be more efficient than currently available yeast expression vectors.
  • a heterologous coding sequence in cells other than yeast cells pGES expression systems of the invention which wiU include, inter alia, a heterologous coding sequence, for example the HSA coding sequence, and as a selectable marker neomycin or hygromycin resistance gene (suitable for selection either in mammalian ceUs, insect ceUs, plant ceUs or avian ceUs) wiU be prepared as described herein.
  • the plasmid obtained wiU be transferred into mammalian ceUs using electr op oration or calcium phosphate precipitation.
  • ceUs wiU then be grown on a suitable medium to a concentration of about 2xl0 7 ceUs/ml and then transformed with the pGES based vectors described hereinbefore.
  • the ceUs may be co-transfected with a second plasmid carrying the selectable marker.
  • the transfected ceUs will be selected by culturing the population of ceUs obtained after transfection, in the presence of the relevant agent, such as an antibiotics (e.g. G418, hygromycin).
  • the relevant agent such as an antibiotics (e.g. G418, hygromycin).
  • the selected ceUs wiU then be exposed to amino acid starvation conditions mimicked by the addition of 3-AT, to induce expression of the HSA coding sequence.
  • induction of expression wiU be obtained through treatments known to induce PKR activity which is the homolog of the yeast Gcn2 kinase that activates GCN4 translation in response to starvation.
  • Treatments known to induce PKR activity include but are not limited to exposure to double stranded RNA, TNF and UV radiation.
  • some derivatives of the GCN4 5'UTR including but not Hmited to those mutated in the 4 upstream ORFs may give rise to constitutive translation and wiU not require induction.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne une cassette d'expression qui comprend : un élément régulateur renfermant la séquence nucléotidique de la région 5'UTR du gène codant le facteur de transcription GCN4 ou un dérivé ou fragment fonctionnel de ce dernier ; un promoteur fonctionnellement lié en amont de l'élément régulateur précité ; une séquence codante hétérologue en aval de l'élément régulateur précité ; et un signal de terminaison fonctionnellement lié en aval de la séquence hétérologue précitée. Facultativement, la cassette d'expression comprend également un marqueur sélectionnable fonctionnellement lié. Le système d'expression de l'invention permet d'obtenir une expression de haut niveau de protéines ou peptides hétérologues susceptible d'être régulée tant au niveau de la translation qu'au niveau de la transcription.
PCT/IL2000/000545 2000-09-07 2000-09-07 Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres WO2002020789A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
PCT/IL2000/000545 WO2002020789A1 (fr) 2000-09-07 2000-09-07 Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres
AU2000270368A AU2000270368A1 (en) 2000-09-07 2000-09-07 Gcn4-derived expression of heterologous coding sequences

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IL2000/000545 WO2002020789A1 (fr) 2000-09-07 2000-09-07 Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres

Publications (1)

Publication Number Publication Date
WO2002020789A1 true WO2002020789A1 (fr) 2002-03-14

Family

ID=11042994

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2000/000545 WO2002020789A1 (fr) 2000-09-07 2000-09-07 Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres

Country Status (2)

Country Link
AU (1) AU2000270368A1 (fr)
WO (1) WO2002020789A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1678301A1 (fr) * 2003-09-08 2006-07-12 The University of Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle
WO2019076355A1 (fr) * 2017-10-19 2019-04-25 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Procédé de régulation de l'expression génique

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991014780A1 (fr) * 1990-03-21 1991-10-03 Board Of Regents, The University Of Texas System Vecteurs d'expression de levure
WO2000052181A2 (fr) * 1999-02-28 2000-09-08 Yissum Research Development Company Of The Hebrew University Of Jerusalem Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991014780A1 (fr) * 1990-03-21 1991-10-03 Board Of Regents, The University Of Texas System Vecteurs d'expression de levure
WO2000052181A2 (fr) * 1999-02-28 2000-09-08 Yissum Research Development Company Of The Hebrew University Of Jerusalem Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HINNEBUSCH A G: "EVIDENCE FOR TRANSLATIONAL REGULATION OF THE ACTIVATOR OF GENERAL AMINO-ACID CONTROL IN YEAST", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 81, no. 20, 1984, 1984, pages 6442 - 6446, XP002166783, ISSN: 0027-8424 *
HINNEBUSCH ALAN G: "Translational regulation of yeast GCN4: A window on factors that control initiator-tRNA binding to the ribosome.", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 35, 1997, pages 21661 - 21664, XP002166784, ISSN: 0021-9258 *
MIMRAN AVISHAI ET AL: "GCN4-based expression system (pGES): Translationally regulated yeast expression vectors.", BIOTECHNIQUES, vol. 28, no. 3, March 2000 (2000-03-01), pages 552 - 560, XP000939054, ISSN: 0736-6205 *
THIREOS G ET AL: "5' UNTRANSLATED SEQUENCES ARE REQUIRED FOR THE TRANSLATIONAL CONTROL OF A YEAST SACCHAROMYCES-CEREVISIAE REGULATORY GENE", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 81, no. 16, 1984, 1984, pages 5096 - 5100, XP002166782, ISSN: 0027-8424 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1678301A1 (fr) * 2003-09-08 2006-07-12 The University of Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle
EP1678301A4 (fr) * 2003-09-08 2008-03-05 Univ Queensland Systeme d'expression bacterien inductible utilisant un promoteur sspa de la salmonelle
WO2019076355A1 (fr) * 2017-10-19 2019-04-25 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Procédé de régulation de l'expression génique
US11739313B2 (en) 2017-10-19 2023-08-29 Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences Method for regulating gene expression

Also Published As

Publication number Publication date
AU2000270368A1 (en) 2002-03-22

Similar Documents

Publication Publication Date Title
DE69332893T2 (de) Methode zur erhöhung der produktion von rekombinanten disulfidverknüpften-proteinen in (saccharomyces cerevisiae)
US5773245A (en) Methods for increasing secretion of overexpressed proteins
Keys et al. Multiprotein transcription factor UAF interacts with the upstream element of the yeast RNA polymerase I promoter and forms a stable preinitiation complex.
Hayano et al. Protein disulfide isomerase mutant lacking its isomerase activity accelerates protein folding in the cell
US20100297738A1 (en) Expression system
Waterham et al. Peroxisomal targeting, import, and assembly of alcohol oxidase in Pichia pastoris
JP2018522565A (ja) プロモーター変異体
KR20140015137A (ko) 분비 효율이 개선된 재조합 단백질의 생산 방법
CN102648286A (zh) 在巴斯德毕赤氏酵母中生产缺乏与针对宿主细胞抗原的抗体的可检测交叉结合活性的蛋白质的方法
CN101605887A (zh) 蛋白的高分泌生产方法
DE69738158T2 (de) Alpha-Amylase Transkriptionsfaktor
EP1002095B1 (fr) Souches ameliorees pour l'expression de proteines
JPH07250689A (ja) タンパク質−タンパク質相互作用を検出するためのペリプラズム膜結合系
EP0631627A1 (fr) Procede de production de proteines dans la levure
EP0950098B1 (fr) Expression stable de proteines a helice triple
CN103764837A (zh) 用于生产具有修饰的o-糖基化的蛋白的酵母菌株
US5817782A (en) Lag 1:gene for increasing the longevity of eukaryotes
WO2002020789A1 (fr) Expression derivee de gcn4 de sequences codantes heterologues et differentes utilisations de ces dernieres
EP1173593A2 (fr) Expression derivee de gcn4 de sequences de codage heterologues et diverses utilisations associees
JP5997140B2 (ja) 生産細胞株
US20070072267A1 (en) Transformant having galactose induction system and use thereof
US6613547B1 (en) Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 1 promoter and terminator
JP2001509392A (ja) 組換え酵母細胞による分泌タンパク質の産生増加
DE69403464T2 (de) Herstellung von glycolate-oxydase in methylotrophen hefen
US6348331B1 (en) Pichia methanolica glyceraldehyde-3-phosphate dehydrogenase 2 promoter

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP