WO2000036103A1 - Cytokine receptor chain - Google Patents
Cytokine receptor chain Download PDFInfo
- Publication number
- WO2000036103A1 WO2000036103A1 PCT/US1999/029493 US9929493W WO0036103A1 WO 2000036103 A1 WO2000036103 A1 WO 2000036103A1 US 9929493 W US9929493 W US 9929493W WO 0036103 A1 WO0036103 A1 WO 0036103A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- seq
- binding
- amino acid
- nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
- C07K14/7155—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/14—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
- A61P5/16—Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4 for decreasing, blocking or antagonising the activity of the thyroid hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
Definitions
- the present invention relates to mammalian cytokine receptor proteins with affinity for IL-13 (including without limitation human and murine receptor proteins), fragments thereof and recombinant polynucleotides and cells useful for expressing such proteins.
- IL-13 interleukin-13
- IL-13 interleukin-13
- IL-13 Various protein forms of IL-13 and DNA encoding various forms of IL-13 activity are described in McKenzie et al., Proc. Natl. Acad. Sci. USA 90:3735 (1993); Minty et al., Nature 362:248 (1993); and Aversa et al., WO94/04680.
- the term "IL-13” includes proteins having the sequence and/or biological activity described in these documents, whether produced by recombinant genetic engineering techniques; purified from cell sources producing the factor naturally or upon induction with other factors; or synthesized by chemical techniques; or a combination of the foregoing.
- IL-13 is a cytokine that has been implicated in production of several biological activities including: induction of IgG4 and IgE switching, including in human immature B cells (Punnonen et al., J. Immunol. 152: 1094 (1994)); induction of germ line IgE heavy chain (e) transcription and CD23 expression in normal human B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730 (1993)); and induction of B cell proliferation in the presence of CD40L or anti-CD40 mAb
- IL-13 Like most cytokines, IL-13 exhibits certain biological activities by interacting with an IL-13 receptor ("IL-13R”) on the surface of target cells. IL- 13R and the IL-4 receptor (“IL-4R”) sharing a common component, which is required for receptor activation; however, EL- 13 does not bind to cells transfected with the 130 kD IL-4R (Zurawski et al., supra). Thus, the IL-13R must contain at least one other ligand binding chain. Cytokine receptors are commonly composed or two or three chains. The cloning of one ligand binding chain for IL-13 has been recently reported (Hilton et al., Proc. Natl. Acad. Sci. 93:497-501).
- the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence of SEQ ID NO:l from nucleotide 256 to nucleotide 1404;
- nucleotide sequence encoding a species homologue of the sequence specified in (a) or (b); and (f) an allelic variant of the nucleotide sequence specified in (a) or (b).
- the nucleotide sequence encodes a protein having a biological activity of the human IL-13 receptor.
- the nucleotide sequence may be operably linked to an expression control sequence.
- the polynucleotide comprises the nucleotide sequence of SEQ ID NO:l from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:l from nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ ID NO:l from nucleotide 1324 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242; the nucleotide sequence of SEQ ID NO:3 from nucleotide 178 to nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from nucleotide
- the invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2;
- Host cells preferably mammalian cells, transformed with the polynucleotides are also provided.
- the invention provides a process for producing a IL- 13bc protein. The process comprises:
- Proteins produced according to these methods are also provided.
- the present invention also provides for an isolated IL-13bc protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2; (b) the amino acid sequence of SEQ ID NO:2 from amino acids 22 to
- the protein comprises the amino acid sequence of SEQ ID NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the sequence of SEQ ID NO:4; or the sequence from amino acid 26 to 341 of SEQ ID NO:4.
- the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from IL-13bc).
- Preferred fusion proteins comprise an antibody fragment, such as an Fc fragment.
- Particularly preferred embodiments comprise the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
- Pharmaceutical compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
- the present invention further provides for compositions comprising an antibody which specifically reacts with a protein of the present invention.
- Methods of identifying an inhibitor of IL-13 binding to the IL-13bc or IL-13 receptor comprise: (a) combining an IL- 13bc protein or a fragment thereof with IL- 13 or a fragment thereof, said combination forming a first binding mixture;
- Methods of inhibiting binding of IL-13 to the 1L-I3bc proteins or IL-13 receptor in a mammalian subject comprise administering a therapeutically effective amount of a composition containing an IL- 13bc protein, an IL-13bc or IL-13R inhibitor or an antibody to an IL-13bc protein.
- Methods are also provided for potentiating IL-13 activity, which comprise combining a protein having IL-13 activity with a protein of claim 11 and contacting such combination with a cell expressing at least one chain of EL-13R other than IL- 13bc.
- the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject.
- Further methods are provided for treating an IL-13-related condition in a mammalian subject, said method comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
- Other methods provide for a method of inhibiting the interaction of IL-13 with an IL-13bc protein in a mammalian subject comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
- the antagonist is selected from the group consisting of an IL-13bc protein, a soluble form of IL-13R ⁇ l, an antibody to IL-13 or an IL-13-binding fragment thereof, an antibody to IL- 13bc or an IL- 13bc-binding fragment thereof, an antibody to IL-13R ⁇ l or an IL-13R ⁇ l -binding fragment thereof, IL-13R- binding mutants of IL-4, a small molecule capable of inhibiting the interaction of IL-13 with IL-13bc and a small molecule capable of inhibiting the interaction of IL- 13 with IL-13R ⁇ l.
- Fig. 1 The figure presents photographs of IL-13, IL-4, EL- 11 and mock transfected COS cells after exposure to DL-13bc-Fc as described in Example 4 below.
- Fig. 2 Reversal of allergen-induced airway hyper responsiveness by in vivo blockade of interleukin-13. 10 days after initial intratracheal challenge, ON A- and PBS-immunized mice were again challenged intratracheally with either OVA or PBS. Mice were given sIL-13bc-Fc (400ug) or an equivalent amount of control hu- IgG by intraperitoneal injection on Day -1, O, +1 and +3 of the secondary antigen challenge.
- AHR Airway hyper responsiveness
- APTI airway-pressure-time index
- B Inflammatory cell composition of bronchoalveolar lavage fluids. Cell differential percentages were determined by light microscopic evaluation of cytospin preparations. Data are expressed as absolute numbers of ceUs.
- C OVA-specific serum IgE concentrations. Results are means +/- SEM of 8-10 animals per group. *P ⁇ 0.05 compared with respective PBS control groups; **P ⁇ 0.05 compared to OVA/Hu-Ig group (one-way A ⁇ OVA followed by Fisher's least significant difference test for multiple comparisons).
- Fig. 3 Effects of EL- 13 blockade on allergen-driven increases in mucus- containing cells in the airway epithelium.
- PBS Hu-Ig PBS-immunized and challenged controls, demonstrating few mucus-containing cells.
- OVAHu-Ig allergen-induced increases in interstitial inflammatory cells and increases in the number of goblet cells containing mucus.
- OVA/sEL-13bc-Fc dramatic inhibitory effect of EL-13 blockade on allergen-induced goblet cell mucus production.
- Fig. 4 IL-13 induction of airway hyperreactivity.
- Naive mice were given recombinant EL-13 (5 ug/mouse, 50 ul volume) or PBS daily by intratracheal instillation. 24 hrs after the last treatment, (A) Airway hyper responsiveness, (B)
- EL-13bc polynucleotides encoding the EL-13 binding chain of 1L-13R
- SEQ ID NO: 1 provides the nucleotide sequence of a cDNA encoding the murine IL-13bc.
- SEQ DD NO:2 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-21.
- the mature murine 1L-I3bc is believed to have the sequence of amino acids 22-383 of SEQ DD NO:2.
- the mature murine receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 22-334 of SEQ ID NO:2), a transmembrane domain (comprising approximately amino acids 335-356 of SEQ ED NO:2) and an intracellular domain (comprising approximately amino acids 357-383 of SEQ ED NO:2).
- SEQ ED NO:3 provides the nucleotide sequence of a cDNA encoding the human EL-13bc.
- SEQ ID NO:4 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-25.
- the mature human IL-13bc is beheved to have the sequence of amino acids 26-380 of SEQ ED NO:4.
- the mature human receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 26-341 of SEQ ED NO:4), a transmembrane domain (comprising approximately amino acids 342-362 of SEQ ID NO:4) and an intracellular domain (comprising approximately amino acids 363-380 of SEQ ID NO:4).
- the first 81 amino acids of the human IL-13bc sequence are identical to the translated sequence of an expressed sequence tag (EST) identified as "yg99f lO.rl Homo sapiens cDNA clone 41648 5"' and assigned database accession number R52795.gb_est2. There are no homologies or sequence motifs in this EST sequence which would lead those skilled in the art to identify the encoded protein as a cytokine receptor.
- EST expressed sequence tag
- a cDNA clone corresponding to this database entry is publicly-available from the I.M.A.G.E. Consortium. Subsequent to the priority date of the present application, such clone was ordered by applicants and sequenced. The sequence of such clone was determined to be the sequence previously reported by applicants as SEQ ED NO:3 herein.
- Soluble forms of E--13bc protein can also be produced.
- Such soluble forms include without limitation proteins comprising amino acids 1-334 or 22-334 of SEQ ED NO:2 or amino acids 1-341 or 26-341 of SEQ ID NO:4.
- the soluble forms of the EL-13bc are further characterized by being soluble in aqueous solution, preferably at room temperature.
- EL-13bc proteins comprising only the intracellular domain or a portion thereof may also be produced.
- IL-13bc proteins of less than full length may be produced by expressing a corresponding fragment of the polynucleotide encoding the full-length EL- 13bc protein (SEQ ED NO:l or SEQ ID NO:3). These corresponding polynucleotide fragments are also part of the present invention.
- Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
- a protein has "a biological activity of the EL-13 receptor binding chain" if it possess one or more of the following characteristics: (1) the ability to bind IL-13 or a fragment thereof (preferably a biologically active fragment thereof); and/or (2) the ability to interact with the second non-EL-13-binding chain of D -13R to produce a signal characteristic of the binding of EL-13 to EL-13R.
- the biological activity possessed by the protein is the ability to bind DL-13 or a fragment hereof, more preferably with a K D of about 0.1 to about 100 nM.
- Methods for determining whether a particular protein or peptide has such activity include without limitation the methods described in the examples provided herein.
- IL-13bc or active fragments thereof may be fused to carrier molecules such as immunoglobulins.
- carrier molecules such as immunoglobulins.
- soluble forms of the IL- 13bc may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
- Other fusions proteins such as those with GST, Lex-A or MBP, may also be used.
- the invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NO:l or SEQ ED NO:3, that is, naturaUy-occurring alternative forms of the isolated polynucleotide of SEQ ID NO: 1 or SEQ D NO:3 which also encode EL-13bc proteins, preferably those proteins having a biological activity of IL-13bc. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ED NO:3 under highly stringent conditions (for example, O.lxSSC at 65°C).
- Isolated polynucleotides which encode EL-13bc proteins but which differ from the nucleotide sequence set forth in SEQ DD NO: 1 or SEQ DD NO:3 by virtue of the degeneracy of the genetic code are also encompassed by the present invention.
- the present invention also provides polynucleotides encoding homologues of the murine and human DL-13bc from other animal species, particularly other mammalian species.
- Species homologues can be identified and isolated by making probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries constructed from PBMCs, thymus or testis of the relevant species.
- the isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the EL-13bc protein recombinantly.
- an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991
- Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzyrnology 185, 537-566 (1990).
- operably linked means enzymatically or chemically ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the EL-13bc protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
- a number of types of cells may act as suitable host cells for expression of the EL-13bc protein. Any cell type capable of expressing functional D -13bc protein may be used.
- Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
- monkey COS cells Chinese Hamster Ovary (CHO) cells
- human kidney 293 cells human epidermal A431 cells
- human Colo205 cells human Colo205 cells
- CV-1 cells other transformed primate cell lines
- normal diploid cells cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix
- the EL-13bc protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
- suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
- Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incorporated herein by reference.
- Soluble forms of the IL-13bc protein may also be produced in insect cells using appropriate isolated polynucleotides as described above.
- the D -13bc protein may be produced in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
- yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
- Candida or any yeast strain capable of expressing heterologous proteins.
- Suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins.
- Expression in bacteria may result in formation of inclusion bodies incorporating the recombinant protein. Thus, refolding of the recombinant protein may be required in order to produce active or more active material.
- Several methods for obtaining correctly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaotropic agent.
- the D--13bc protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the EL-13bc protein.
- the IL- 13bc protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the EL-13bc protein of the invention can be purified from conditioned media.
- Membrane-bound forms of EL-13bc protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
- the EL-13bc protein can be purified using methods known to those skilled in the art.
- the IL-13bc protein of the invention can be concentrated using a commercially available protein concentration filter, for example, an
- the concentrate can be applied to a purification matrix such as a gel filtration medium.
- a purification matrix such as a gel filtration medium.
- an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneimine (PET) groups.
- the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
- a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g., S-Sepharose® columns).
- the purification of the DL-- 13bc protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin- toyopearl® or Cibacrom blue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography. Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-
- HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
- HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
- Affinity columns including IL- 13 or fragments thereof or including antibodies to the D -13bc protein can also be used in purification in accordance with known methods. Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
- the isolated IL-13bc protein is purified so that it is substantially free of other mammalian proteins.
- EL-13bc proteins of the invention may also be used to screen for agents which are capable of binding to D ⁇ -13bc or EL-13R or which interfere with the binding of IL-13 to the D ⁇ -13 or IL-13bc (either the extracellular or intracellular domains) and thus may act as inhibitors of normal binding and cytokine action ("IL-13R inhibitors").
- Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the EL- 13bc protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
- IL-13bc protein may be immobilized in purified form on a carrier and binding to purified D -13bc protein may be measured in the presence and in the absence of potential inhibiting agents.
- a suitable binding assay may alternatively employ a soluble form of EL- 13bc of the invention.
- Another example of a system in which inhibitors may be screened is described in Example 2 below.
- a first binding mixture is formed by combining EL-13 or a fragment thereof and IL- 13bc protein, and the amount of binding in the first binding mixture (B 0 ) is measured.
- a second binding mixture is also formed by combining DL-13 or a fragment thereof, 1L-I3bc protein, and the compound or agent to be screened, and the amount of binding in the second binding mixture (B) is measured.
- the amounts of binding in the first and second binding mixtures are compared, for example, by performing a calculation of the ratio B/B 0 .
- a compound or agent is considered to be capable of inhibiting binding if a decrease in binding in the second binding mixture as compared to the first binding mixture is observed.
- the second chain of EL- 13R can be added to one or both of the binding mixtures.
- the formulation and optimization of binding mixtures is within the level of skill in the art, such binding mixtures may also contain buffers and salts necessary to enhance or to optimize binding, and additional control assays may be included in the screening assay of the invention.
- Compounds found to reduce the binding activity of EL- 13bc protein to EL- 13 or its fragment to any degree, preferably by at least about 10%, more preferably greater than about 50% or more, may thus be identified and then secondarily screened in other binding assays and in vivo assays. By these means compounds having inhibitory activity for IL-13bc binding which may be suitable as therapeutic agents may be identified.
- IL-13bc proteins may also be used as diagnostic agents for detecting the expression or presence of EL-13bc, EL-13R, EL- 13 or cells expressing EL-13bc, EL- 13R or IL-13.
- the proteins or polynucleotides may be employed for such purpose in standard procedures for diagnostics assays using these types of materials. Suitable methods are well known to those skilled in the art.
- D--13R refers to EL-13bc and/or a second EL-13 receptor chain known as "EL-13R ⁇ l” or "NR4" (see: murine receptor chain, Hilton et al., Proc. Natl. Acad. Sci. USA 1996, 93:497-501; human receptor chain, Aman et al., J. Biol. Chem. 1996, 271:29265-70, and Gauchat et al., Eur. J. Immunol. 1997,
- IL-13bc acts as a mediator of the known biological activities of D -13.
- IL-13bc protein particularly, soluble EL-13bc proteins
- EL-13R inhibitors i.e., antagonists of interaction of EL-13 with IL-13R (such as, for example, antibodies to D -13R (including particularly to EL-13bc or to D -13R ⁇ l) and fragments thereof, antibodies to DL-13 and fragments thereof, soluble lL-13R ⁇ l proteins, and small molecule and other inhibitors of the interaction of DL-13 with EL-13R (including with EL-13bc and/or with EL-13R ⁇ l) may be useful in treatment or modulation of various medical conditions in which EL-13 is implicated or which are effected by the activity (or lack thereof) of IL-13 (collectively "IL-13-related conditions").
- Mutated forms of EL-4 which bind to EL-13R can also be used as EL- 13 antagonists (see, for example, those disclosed in Shanafelt et al., Proc. Natl. Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993, 178:2213-8; and Grunewald et al., J. Immunol. 1998, 160:4004-9).
- EL-13-related conditions include without limitation Ig-mediated conditions and diseases, particularly IgE-mediated conditions (including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)); inflammatory conditions of the lungs; immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
- IgE-mediated conditions including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)
- inflammatory conditions of the lungs immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
- pathological states may result from disease, exposure to radiation or drugs, and include, for example, leukopenia, bacterial and viral infections, anemia, B cell or T cell deficiencies such as immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
- leukopenia bacterial and viral infections
- anemia B cell or T cell deficiencies
- immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
- EL-13bc proteins may also be useful to enhance macrophage activation (i.e., in vaccination, treatment of mycobacterial or intracellular organisms, or parasitic infections).
- IL-13bc proteins may also be used to potentiate the effects of EL-13 in vitro and in vivo.
- an DL-13bc protein can be combined with a protein having IL-13 activity (preferably DL-13) and the resulting combination can be contacted with a cell expressing at least one chain of IL-13R other than EL-13bc
- the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject in vivo.
- a mammalian subject in vivo.
- the pre-established association of the DL-13 protein with the DL-13bc protein will aid in formation of the complete IL-13 EL-13R complex necessary for proper signaling. See for example the methods described by Economides et al., Science 270:1351 (1995).
- EL-13bc protein and EL-13R inhibitors purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier may contain, in addition to DL-13bc or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
- pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
- the pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, IL-1, IL-2, IL-3, IL-4, D_-5, D ⁇ 6, IL-7, IL-8, IL-9, DL-10, IL-11, IL-12, IL-14, HL-15, G-CSF, stem cell factor, and erythropoietin.
- the pharmaceutical composition may also include anti-cytokine antibodies.
- the pharmaceutical composition may contain thrombolytic or anti-thrombotic factors such as plasminogen activator and
- the pharmaceutical composition may further contain other anti- inflammatory agents.
- additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with isolated EL-13bc protein or ⁇ _ ⁇ 13bc inhibitor, or to rriinimize side effects caused by the isolated EL- 13bc or DL-13bc inhibitor.
- isolated IL-13bc or IL-13bc inhibitor may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
- the pharmaceutical composition of the invention may be in the form of a liposome in which isolated 1L-I3bc protein or EL-13bc inhibitor is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which in aqueous solution.
- Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
- the term "therapeuticaUy effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
- a meaningful patient benefit e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
- the term refers to that ingredient alone.
- the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
- a therapeutically effective amount of isolated 1L-I3bc protein or IL-13bc inhibitor is administered to a mammal.
- Isolated EL- 13bc protein or D-,-13bc inhibitor may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors.
- DL-13bc protein or DL- 13bc inhibitor When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, DL-13bc protein or DL- 13bc inhibitor may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering EL-13bc protein or IL-13bc inhibitor in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
- EL-13bc protein or DL-13bc inhibitor used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
- IL-13bc protein or DL-13bc inhibitor When a therapeutically effective amount of EL-13bc protein or EL-13bc inhibitor is administered orally, IL-13bc protein or DL-13bc inhibitor will be in the form of a tablet, capsule, powder, solution or elixir.
- the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
- the tablet, capsule, and powder contain from about 5 to 95% EL-13bc protein or DL-13bc inhibitor, and preferably from about 25 to 90% EL-13bc protein or IL-13bc inhibitor.
- a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
- the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
- the pharmaceutical composition When ad ⁇ iinistered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of DL-13bc protein or E -13bc inhibitor, and preferably from about 1 to 50% IL-13bc protein or EL-13bc inhibitor.
- a therapeutically effective amount of EL-13bc protein or EL-13bc inhibitor is administered by intravenous, cutaneous or subcutaneous injection, EL- 13bc protein or EL-13bc inhibitor will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
- the preparation of such parenterally acceptable protein solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
- a preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to DL-13bc protein or EL-13bc inhibitor an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
- the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additive known to those of skill in the art.
- 1L-I3bc protein or IL-13bc inhibitor in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of 1L-I3bc protein or IL-13bc inhibitor.
- 13bc protein or DL--13bc inhibitor with which to treat each individual patient. Initially, the attending physician will administer low doses of DL-13bc protein or EL-13bc inhibitor and observe the patient's response. Larger doses of D_ ⁇ 13bc protein or DL--13bc inhibitor may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.1 ⁇ g to about 100 mg of LL-13bc protein or DL--13bc inhibitor per kg body weight.
- the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the DL-13bc protein or EL-13bc inhibitor will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
- IL-13bc proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the IL- 13bc protein and which may inhibit binding of DL-13 or fragments thereof to the receptor. Such antibodies may be obtained using the entire EL-13bc as an i munogen, or by using fragments of DL- 13bc, such as the soluble mature DL- 13bc.
- the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Additional peptide immunogens may be generated by replacing tyrosine residues with sulfated tyrosine residues. Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J.Amer.Chem.Soc. 85, 2149-2154 (1963); JL. Krstenansky, et al., FEBS Lett. 211, 10 (1987).
- Neutralizing or non-neutralizing antibodies binding to JL-13bc protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutializing monoclonal antibodies may be capable of blocking IL-13 binding to the IL-13bc.
- Example 1 Isolation of DL-13bc cDNAs Isolation of the murine DL-13 receptor chain.
- RNA 5 ug of polyA+ RNA was prepared from the thymuses of 6-8 week old C3H/HeJ mice.
- Double stranded, hemimethylated cDNA was prepared using Stratagene's cDNA synthesis kit according to manufacturers instructions. Briefly, the first strand was primed with an oligodT-Xho primer, and after second strand synthesis, EcoRI adapters were added, and the cDNA was digested with Xhol, and purified. The cDNA was ligated to the XhoI-EcoRI sites of the Zap Express (Stratagene) lambda vector, and packaged using Gigapak D Gold packaging extracts (Stratagene) according to the manufacturers instructions.
- ZapExpress vector as per manufacturers instruction, and the DNA sequence was determined.
- the DNA sequence encoded a novel member of the hematopoietin receptor family.
- Clone A25 containing the polynucleotide having the sequence of SEQ ED NO: 1 was deposited with ATCC as pA25pBKCMV at accession number 69997 on February 22, 1996.
- a partial fragment of the human homolog of the murine receptor was isolated by PCR using oligonucleotides derived from the murine sequence.
- cDNA was prepared from human testis polyA+ RNA that was obtained from Clontech.
- a DNA fragment of 274 base pairs was amplified from this cDNA by PCR with the following oligonucleotides: ATAGTTAAACCATTGCCACC (SEQ ED NO:6) and CTCCATTCGCTCC AAATTCC (SEQ ED NO:7) using AmpliTaq polymerase (Promega) in IX Taq buffer containing 1.5 mM MgC12 for 30 cycles of incubation
- the human clone was deposited with ATCC as phA25#l lpDR2 at accession number 69998 on February 22, 1996.
- DNA encoding amino acids 1 -331 of the extracellular domain of murine LL- 13bc was fused to a spacer sequence encoding gly-ser-gly by PCR and ligated in frame with sequences encoding the hinge CH2 CH3 regions of human IgGl of the COS-1 expression vector pED.Fc .
- DL-13bc-Ig was produced from DEAE-dextran transfected COS-1 cells and purified via protein A sepharose chromatography
- the B9 cell line proliferated in response to EL-13, DL-4 or IL-6. Only responses to IL-13 were inhibited by the soluble EL-13bc-Ig, indicating that this receptor binds IL-13 specifically, but not IL-4 or DL-6.
- the tables show cpm. Two separate experiments are shown.
- a Biacore biosensor was used to measure directly the specific binding of
- EL-13 to purified DL-13bc-Ig (Pharmacia, Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance units (RU) of purified EL-13bc-Ig , human IgGl or irrelevant receptor were each covalently immobilized to different flow cells on the sensor chip as recommended by the manufacturer. (RU's are a refelction of the mass of protein bound to the sensor chip surface.) Purified EL-13 was injected across the flow cells at 5 ul/min for 10 mins in the presence or absence of excess purified IL-13bc-Ig. Binding was quantified as the difference in RU before and after sample injection.
- Expression vectors for DL-13, IL-4, DL-11 or empty vector were transfected into COS-1 cells in duplicated plates via the DEAE-dextran method. Two days after transfection cells were washed twice in phosphate buffered saline (PBS) and fixed in the culture dish for 10' at 4° C with methanol. Following fixation cells were washed twice with PBS then rinsed once with binding buffer (PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide) and incubated for two hours at 4° C in binding buffer with EL-13bc-Fc at l.Oug/ml or with relevant anti-cytokine antisera.
- PBS phosphate buffered saline
- binding buffer PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide
- Example 5 Other Systems for Determination Biological Activity of DL-13bc Protein
- Other systems can be used to determine whether a specific DL-13bc protein exhibits a "biological activity" of EL-13bc as defined herein. The following are examples of such systems.
- Binding of EL-13 to the extracellular region of the IL-13bc protein will specifically cause a rapid induction of phosphotyrosine on the receptor protein.
- a EL-13bc protein (such as, for example, a soluble form of the extracellular domain) is produced and used to detect DL-13 binding.
- a DNA construct is prepared in which the extracellular domain (truncated prior, preferably immediately prior, to the predicted transmembrane domain) is ligated in frame to a cDNA encoding the hinge C H 2 and C H 3 domains of a human immunoglobulin (Ig) ⁇ l.
- This construct is generated in an appropriate expression vector for COS cells, such as pED ⁇ C or pMT2.
- the plasmid is transiently transfected into COS cells.
- the secreted DL-13bc-Ig fusion protein is collected in the conditioned medium and purified by protein A chromatography.
- the purified DL-13bc-Ig fusion protein is used to demonstrate EL-13 binding in a number of applications.
- EL-13 can be coated onto the surface of an enzyme- linked immunosorbent assay (ELISA) plate, and then additional binding sites blocked with bovine serum albumin or casein using standard ELISA buffers.
- ELISA enzyme- linked immunosorbent assay
- DL-13bc-Ig fusion protein is then bound to the solid-phase DL-13, and binding is detected with a secondary goat anti-human Ig conjugated to horseradish peroxidase.
- the activity of specifically bound enzyme can be measured with a colorimetric substrate, such as tetramethyl benzidine and absorbance readings.
- IL-13 may also be expressed on the surface of cells, for example by providing a transmembrane domain or glucosyl phosphatidyl inositol (GPT) linkage. Cells expressing the membrane bound DL-13 can be identified using the DL-13bc-Ig fusion protein.
- the soluble DL-13bc-Ig fusion is bound to the surface of these cells and detected with goat anti-human Ig conjugated to a fluorochrome, such as fluorescein isothiocyanate and flow cytometry.
- a yeast genetic selection method the "interaction trap” [Gyuris et al, Cell 75:791-803, 1993] can be used to determine whether a DL-13bc protein has a biological activity of EL-13bc as defined herein.
- the expression of reporter genes from both LexAop-Leu2 and LexAop-LacZ relies on the interaction between the bait protein, for example in this case a species which interacts with human EL-13bc, and the prey, for example in this case the human DL-13bc protein.
- the prey for example in this case the human DL-13bc protein.
- Leu2 or LacZ expression The most simple method is to measure the activity of the LacZ encoded protein, ⁇ -galactosidase.
- This activity can be judged by the degree of blueness on the X-Gal containing medium or filter.
- standard assays can be found in "Methods in Yeast Genetics" Cold Spring Harbor, New York, 1990 (by Rose, M.D., Winston, F., and Hieter, P.).
- a particular species such as, for example, a cytosolic protein which binds to the intracellular domain of the EL-13bc in vivo
- that species can be used as the "bait" in the interaction trap with the DL-13bc protein to be tested serving as the "prey”, or vice versa.
- Example 6 Treatment of Asthma Using Soluble DL-13bc Protein A well-characterized murine model of allergic asthma was used, in which allergen exposure leads to airway hyper responsiveness ("AHR"), pulmonary eosinophilia, elevations in antigen-specific serum IgE levels, and increases in airway epithelial mucus content (3, 11).
- AHR airway hyper responsiveness
- pulmonary eosinophilia elevations in antigen-specific serum IgE levels
- increases in airway epithelial mucus content 3, 11
- Male A/J mice were immunized intraperitoneally and subsequently challenged intratracheally with soluble ovalbumin (OVA), the allergic phenotype being assessed 4 days after antigen challenge (13).
- OVA soluble ovalbumin
- Blockade of DL-13 was performed by the systemic administration of a soluble EL- 13bc-IgGFc fusion protein (sDL- 13bc-Fc), which specifically binds to and neutralizes EL-13, 24 hours before subsequent intratracheal allergen challenge (14).
- sDL- 13bc-Fc soluble EL- 13bc-IgGFc fusion protein
- Challenge of allergen-immunized mice resulted in significant increases in airway responsiveness to acetylcholine (15) (Fig. 2A).
- Blockade of EL- 13 resulted in complete reversal of such established allergen-induced AHR; thus DL-13 is necessary for the expression of AHR in this model.
- EL-13 ablation to reverse AHR after full development of the phenotype of allergic asthma contrasts with the inability of EL-4 ablation to accomplish such a reversal.
- the mechanism underlying the effectiveness of DL-4R ⁇ blockade in reversing allergen- induced AHR may be the inhibition of DL-13-mediated processes, consistent with the fact that Stat ⁇ activation is downstream of DL-4R ⁇ -mediated signaling for both cytokines.
- EL-13 is probably the primary CD4+ T cell-derived factor responsible for allergen-induced AHR.
- Blockade of DL-13 did not alter OVA-specific IgE levels, a lack of suppression which is likely due to the fact that DL-13 blockade occurred after initial antigen priming and antibody formation. Nonetheless, these results show that AHR is not dependent upon IgE production in this model, consistent with reports that aUergic AHR develops normally in IgE deficient and B cell deficient mice (19).
- allergic asthma in murine models is associated with a marked increase in the mucus content of the airway epithelium (5, 11). Mucus hypersecretion is particularly profound in autopsy specimens from patients who die of acute asthma attacks (20). Blockade of IL-13 reverses allergen-induced increases in mucus- containing cells in the airways (Fig. 3), demonstrating that allergen-induced increases in airway mucus content are dependent upon DL-13.
- EL-4 is also implicated in this process, as EL-4 transgenic mice display marked goblet cell hyperplasia in the absence of antigen sensitization (5).
- OVA ovalbumin
- mice 14 days after immunization, mice were anesthetized with a mixture of ketamine and xylazine (45 and 8 mg/kg, respectively) and challenged intratracheally with 50 ul of a 1.5% solution of OVA or an equivalent volume of PBS as a control. 10 days after this first antigen challenge, mice were challenged again intratracheally with either OVA or PBS. Characterization of the allergic phenotype was performed 96 hours after the second antigen challenge.
- Human DL-13bc was cloned as described above.
- Fc was purified with rProtein A-Sepharose [J. F. Urban et al., Immunity 8, 255 (1998)].
- the in vitro DD 50 as determined by the ability to neutralize 3 ng/ml of murine DL-13 in the B9 proliferation assay was approximately 10 ng/ml.
- Human IgG used as a control for sEL-13bc-Fc, was similarly purified by rProtein A- Sepharose chromatography from a 10% solution of human immune globulin that is commercially available for intravenous administration (Miles) [ibid].
- Mice were given sDL-13bc-Fc (400ug), or an equivalent amount of the control hu-IgG, by intraperitoneal injection on Day -1, O, +1, and +3 of secondary antigen challenge.
- Airway reactivity to intravenous administration of acetylcholine was measured (11), 3 days after final intratracheal challenge. Mice were anesthetized with sodium pentobarbital (90 mg/kg), intubated, ventilated at a rate of 120 breaths/minute with a constant tidal volume of air (0.2 ml), and paralyzed with decamethonium bromide (25 mg/kg). After establishment of a stable airway pressure, acetylcholine was injected intravenously (50 ug/kg) and dynamic airway pressure was foUowed for 5 minutes.
- Serum OVA-specific IgE levels were determined by sandwich ELISA .
- Sample wells were coated with a 0.01% OVA solution in PBS, blocked with 10% FBS in PBS, and washed with 0.05% Tween-20 in PBS. Serum samples were diluted 1 : 10 and 1 : 100 with 10% FBS in PBS. After an overnight incubation, plates were washed with 0.05% Tween-20 in PBS and biotin-conjugated anti-mouse IgE (PharMingen, San Diego, CA) was added.
- H. E. Khouri, F. Laliberte, T. Vernet, Gene 2, 177 (1991)] followed by a six- histidine tag was fused by an enterokinase cleavage site to the mature region of murine EL-13 at Gly21 and constructed in the mammalian expression vector pHTop.
- H6-EK murine EL-13 protein was produced from stably- transfected CHO cells and purified via Ni-NTA chromatography to greater than 97% purity as determined by SDS-PAGE. Protein concentration was determined by absorption at 280 nm and endotoxin contamination was less than 30 EU/mg as measured by Cape Cod Associates LAL assay.
- the ED 50 of H6-EK murine IL-13 as determined by the Ba/F3.DL-13R 1 proliferation assay was lng/ml.
- Murine rEL-13 (5ug in a total volume of 50ul) was administered daily by intratracheal instillation to naive mice anesthesized with a mixture of ketamine and xylazine (45 and 8 mg/kg, respectively).
- a murine IgE-specific ELISA was used to quantitate total IgE immunoglobulin levels in serum using complementary antibody pairs for mouse
- IgE (R35-72 and R35-92) obtained from PharMingen according to the manufacturer's instructions. Duplicate samples (of a 1/10 dilution in 10% FBS in PBS) were examined from each animal. O.D. readings of samples were converted to pg/ml using values obtained from standard curves generated with known concentrations of recombinant mouse IgE (5-2000 pg/ml), and the final concentration was obtained by multiplying by the dilution factor. 25. C. L. Emson, S. E. Bell, A. Jones, W. Wisden, A. N. J. McKenzie, J. Exp.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pulmonology (AREA)
- Diabetes (AREA)
- Endocrinology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
- Dermatology (AREA)
- Urology & Nephrology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU21775/00A AU780031B2 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
| EP99966166A EP1141286B1 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
| DE69933696T DE69933696T2 (de) | 1998-12-14 | 1999-12-13 | Cytokinrezeptor-kette |
| US09/868,123 US7507706B1 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
| CA2356779A CA2356779C (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
| MXPA01006006A MXPA01006006A (es) | 1998-12-14 | 1999-12-13 | Cadena receptora de citocina. |
| JP2000588352A JP5519087B2 (ja) | 1998-12-14 | 1999-12-13 | サイトカインレセプター鎖 |
| NZ512942A NZ512942A (en) | 1998-12-14 | 1999-12-13 | Polynucleotides encoding the IL-13 binding chains of the interleukin receptor, pharmaceutical compositions comprising the protein and methods of identifying inhibitors |
| BR9916209-1A BR9916209A (pt) | 1998-12-14 | 1999-12-13 | Cadeia de receptor de citocina |
| DK99966166T DK1141286T3 (da) | 1998-12-14 | 1999-12-13 | Kæde af cytokinreceptorer |
| US10/989,313 US7553487B2 (en) | 1998-12-14 | 2004-11-15 | Method and compositions for treating asthma |
| AU2005202229A AU2005202229B2 (en) | 1998-12-14 | 2005-05-24 | Cytokine Receptor Chain |
| US12/408,458 US20100086516A1 (en) | 1998-12-14 | 2009-03-20 | Cytokine receptor chain |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US21133598A | 1998-12-14 | 1998-12-14 | |
| US09/211,335 | 1998-12-14 |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US21133598A Continuation-In-Part | 1998-12-14 | 1998-12-14 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US09/868,123 A-371-Of-International US7507706B1 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
| US10/989,313 Division US7553487B2 (en) | 1998-12-14 | 2004-11-15 | Method and compositions for treating asthma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2000036103A1 true WO2000036103A1 (en) | 2000-06-22 |
| WO2000036103A9 WO2000036103A9 (en) | 2002-04-11 |
Family
ID=22786499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US1999/029493 Ceased WO2000036103A1 (en) | 1998-12-14 | 1999-12-13 | Cytokine receptor chain |
Country Status (16)
| Country | Link |
|---|---|
| US (1) | US7507706B1 (https=) |
| EP (1) | EP1141286B1 (https=) |
| JP (3) | JP5519087B2 (https=) |
| CN (2) | CN1352686A (https=) |
| AT (1) | ATE342976T1 (https=) |
| AU (1) | AU780031B2 (https=) |
| BR (1) | BR9916209A (https=) |
| CA (1) | CA2356779C (https=) |
| CY (1) | CY1107657T1 (https=) |
| DE (1) | DE69933696T2 (https=) |
| DK (1) | DK1141286T3 (https=) |
| ES (1) | ES2277460T3 (https=) |
| MX (1) | MXPA01006006A (https=) |
| NZ (1) | NZ512942A (https=) |
| PT (1) | PT1141286E (https=) |
| WO (1) | WO2000036103A1 (https=) |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002055100A3 (en) * | 2000-10-20 | 2003-03-27 | Inst Genetics Llc | Method and composition for inhibition of tumor growth and enhancing an immune response |
| WO2004064860A1 (en) * | 2003-01-17 | 2004-08-05 | Children's Hospital Medical Center | Use of tff2, or agents inducing tff2, in the therapy of allergies |
| WO2004067026A1 (en) * | 2003-01-18 | 2004-08-12 | Children's Hospital Medical Center | Regulation of allergen induced gene |
| WO2004092404A3 (en) * | 2003-04-11 | 2005-03-03 | Wyeth Corp | Inhibitors of acidic mammalian chitinase as asthma therapeutics |
| WO2005085866A1 (en) * | 2004-02-27 | 2005-09-15 | Novartis Ag | Screening assay for modulators of interaction between interleukin-12 and/or -23 with their receptors |
| US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
| US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
| US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
| US7585500B2 (en) | 2004-11-17 | 2009-09-08 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
| US7645449B2 (en) | 2003-02-07 | 2010-01-12 | Giorgio Stassi | Sensitizing cells for apoptosis by selectively blocking cytokines |
| US7674459B2 (en) | 2003-12-23 | 2010-03-09 | Genentech, Inc. | Treatment of cancer with a novel anti-IL13 monoclonal antibody |
| EP2162743A4 (en) * | 2007-05-29 | 2010-07-14 | Univ Cincinnati | METHOD FOR MODULATING IGNITION AND COMPOSITIONS THEREFOR |
| US7829090B2 (en) | 2003-07-15 | 2010-11-09 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7910708B2 (en) | 2005-10-21 | 2011-03-22 | Novartis Ag | Anti-IL13 human antibodies |
| US9920120B2 (en) | 2013-09-13 | 2018-03-20 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
| US9945858B2 (en) | 2013-09-13 | 2018-04-17 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products |
| US10093978B2 (en) | 2013-08-12 | 2018-10-09 | Genentech, Inc. | Compositions for detecting complement factor H (CFH) and complement factor I (CFI) polymorphisms |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090098142A1 (en) * | 2004-06-09 | 2009-04-16 | Kasaian Marion T | Methods and compositions for treating and monitoring treatment of IL-13-associated disorders |
| AR066240A1 (es) * | 2007-04-23 | 2009-08-05 | Wyeth Corp | Metodos y composiciones para tratar y monitorear el tratamiento de trastornos asociados con il-13 |
| JP7657548B2 (ja) * | 2017-04-21 | 2025-04-07 | エランコ・ユーエス・インコーポレイテッド | 獣医学的使用のためのil4/il13受容体分子 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5599905A (en) * | 1988-10-31 | 1997-02-04 | Immunex Corporation | Interleukin-4 receptors |
| WO1997015663A1 (en) * | 1995-10-23 | 1997-05-01 | Amrad Operations Pty. Ltd. | A novel haemopoietin receptor and genetic sequences encoding same |
| US5696234A (en) * | 1994-08-01 | 1997-12-09 | Schering Corporation | Muteins of mammalian cytokine interleukin-13 |
Family Cites Families (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| WO1989004838A1 (en) | 1987-11-25 | 1989-06-01 | Immunex Corporation | Interleukin-1 receptors |
| US5359037A (en) | 1988-09-12 | 1994-10-25 | Yeda Research And Development Co. Ltd. | Antibodies to TNF binding protein I |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5011778A (en) | 1989-05-23 | 1991-04-30 | Otsuka Pharmaceutical Co., Ltd. | Monoclonal antibodies directed to IL-1 activated endothelial cells and medicaments employing the monoclonal antibodies |
| ATE136906T1 (de) | 1989-12-20 | 1996-05-15 | Schering Corp | Antikörperantagonisten gegen humanes interleukin- 4 |
| US5859205A (en) | 1989-12-21 | 1999-01-12 | Celltech Limited | Humanised antibodies |
| US5246701A (en) | 1990-10-05 | 1993-09-21 | Ludwig Institute For Cancer Research | Method for inhibiting production of IgE by using IL-9 inhibitors |
| EP0506574B1 (fr) | 1991-03-29 | 1995-11-29 | Sanofi | Protéine à activité de type cytokine, ADN recombinant codant pour cette protéine, cellules et microorganismes transformés |
| WO1993015766A1 (en) | 1992-02-10 | 1993-08-19 | Seragen, Inc. | Desensitization to specific allergens |
| US5397703A (en) | 1992-07-09 | 1995-03-14 | Cetus Oncology Corporation | Method for generation of antibodies to cell surface molecules |
| WO1994004680A1 (en) | 1992-08-21 | 1994-03-03 | Schering Corporation | Human interleukin-13 |
| US5596072A (en) | 1992-08-21 | 1997-01-21 | Schering Corporation | Method of refolding human IL-13 |
| EP0604693A1 (en) | 1992-12-29 | 1994-07-06 | Schering-Plough | Monoclonal antibodies against the human interleukin-4 receptor and hybridomas producing the same |
| ES2143553T3 (es) | 1993-09-02 | 2000-05-16 | Dartmouth College | Anticuerpos anti-gp39 y sus utilizaciones. |
| EP0659766A1 (en) | 1993-11-23 | 1995-06-28 | Schering-Plough | Human monoclonal antibodies against human cytokines and methods of making and using such antibodies |
| GB9415379D0 (en) | 1994-07-29 | 1994-09-21 | Smithkline Beecham Plc | Novel compounds |
| US5705154A (en) | 1995-03-08 | 1998-01-06 | Schering Corporation | Humanized monoclonal antibodies against human interleukin-4 |
| FR2742156A1 (fr) | 1995-12-06 | 1997-06-13 | Sanofi Sa | Polypeptide recepteur de l'il-13 |
| MX336813B (es) | 1996-02-09 | 2016-02-02 | Abbvie Biotechnology Ltd | Anticuerpos humanos que ligan el tnfa humano. |
| US6664227B1 (en) | 1996-03-01 | 2003-12-16 | Genetics Institute, Llc | Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains |
| US5710023A (en) * | 1996-03-01 | 1998-01-20 | Genetics Institute, Inc. | IL-13 cytokine receptor chain |
| WO1997033913A1 (en) | 1996-03-13 | 1997-09-18 | Zymogenetics, Inc. | Cytokine-receptor expressed in testis cells |
| WO1997047741A1 (en) * | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| WO1997047742A1 (en) | 1996-06-12 | 1997-12-18 | Smithkline Beecham Corporation | Hr-1 receptor |
| EP0812913A3 (en) | 1996-06-12 | 1999-08-04 | Smithkline Beecham Corporation | HR-1 receptor, a receptor of the cytokine receptors family |
| WO1998010638A1 (en) | 1996-09-10 | 1998-03-19 | Amrad Operations Pty. Ltd. | Therapeutic molecules |
| GB9625899D0 (en) | 1996-12-13 | 1997-01-29 | Glaxo Group Ltd | Substances and their uses |
| CN1247472A (zh) | 1997-01-10 | 2000-03-15 | 拜奥根有限公司 | 用抗cd40l化合物治疗狼疮性肾炎 |
| US6387615B2 (en) * | 1997-04-11 | 2002-05-14 | Isis Innovation Limited | Methods and materials for the diagnosis or prognosis of asthma |
| GB9723553D0 (en) | 1997-11-07 | 1998-01-07 | Duff Gordon W | Prediction of the risk of chronic obstructive airway disease |
| DK1034298T3 (da) | 1997-12-05 | 2012-01-30 | Scripps Research Inst | Humanisering af murint antistof |
| MXPA01006006A (es) | 1998-12-14 | 2004-08-12 | Genetics Inst | Cadena receptora de citocina. |
| WO2000078336A1 (en) | 1999-06-21 | 2000-12-28 | Genetics Institute, Inc. | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains |
| WO2001023410A2 (en) | 1999-09-28 | 2001-04-05 | Genaissance Pharmaceuticals, Inc. | Drug target isogenes: polymorphisms in the interleukin 13 gene |
| WO2001025282A1 (en) | 1999-10-06 | 2001-04-12 | The Penn State Research Foundation | Il13 mutants |
| US6846486B1 (en) | 2000-02-24 | 2005-01-25 | Advanced Biotherapy Concepts, Inc. | Method of treating allergy by administering an anti-histamine antibody |
| DK2990420T3 (en) | 2000-05-26 | 2017-04-03 | Immunex Corp | USE OF INTERLEUKIN-4 RECEPTOR ANTIBODIES AND COMPOSITIONS THEREOF |
-
1999
- 1999-12-13 MX MXPA01006006A patent/MXPA01006006A/es not_active IP Right Cessation
- 1999-12-13 CN CN99815591A patent/CN1352686A/zh active Pending
- 1999-12-13 DK DK99966166T patent/DK1141286T3/da active
- 1999-12-13 DE DE69933696T patent/DE69933696T2/de not_active Revoked
- 1999-12-13 CA CA2356779A patent/CA2356779C/en not_active Expired - Fee Related
- 1999-12-13 ES ES99966166T patent/ES2277460T3/es not_active Expired - Lifetime
- 1999-12-13 US US09/868,123 patent/US7507706B1/en not_active Expired - Fee Related
- 1999-12-13 AU AU21775/00A patent/AU780031B2/en not_active Ceased
- 1999-12-13 AT AT99966166T patent/ATE342976T1/de active
- 1999-12-13 BR BR9916209-1A patent/BR9916209A/pt not_active Application Discontinuation
- 1999-12-13 JP JP2000588352A patent/JP5519087B2/ja not_active Expired - Fee Related
- 1999-12-13 WO PCT/US1999/029493 patent/WO2000036103A1/en not_active Ceased
- 1999-12-13 PT PT99966166T patent/PT1141286E/pt unknown
- 1999-12-13 NZ NZ512942A patent/NZ512942A/xx not_active IP Right Cessation
- 1999-12-13 CN CN201410767170.2A patent/CN104611339A/zh active Pending
- 1999-12-13 EP EP99966166A patent/EP1141286B1/en not_active Revoked
-
2007
- 2007-01-17 CY CY20071100068T patent/CY1107657T1/el unknown
-
2010
- 2010-04-20 JP JP2010097430A patent/JP2010263889A/ja active Pending
-
2014
- 2014-02-13 JP JP2014025113A patent/JP2014113165A/ja not_active Withdrawn
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5599905A (en) * | 1988-10-31 | 1997-02-04 | Immunex Corporation | Interleukin-4 receptors |
| US5696234A (en) * | 1994-08-01 | 1997-12-09 | Schering Corporation | Muteins of mammalian cytokine interleukin-13 |
| WO1997015663A1 (en) * | 1995-10-23 | 1997-05-01 | Amrad Operations Pty. Ltd. | A novel haemopoietin receptor and genetic sequences encoding same |
Non-Patent Citations (3)
| Title |
|---|
| OBIRI ET AL.: "Receptor for Interleukin 13: Interaction with interleukin 4 by a mechanism that does not involve the common gamma chain shared by receptors for interleukins 2, 4, 7, 9 and 15", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 15, 14 April 1995 (1995-04-14), pages 8797 - 8804, XP002927538 * |
| VITA ET AL.: "Characterization and Comparison of the Interleukin 13 Receptor with the Interleukin 4 Receptor on Several Cell Types", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 8, 24 February 1995 (1995-02-24), pages 3512 - 3517, XP002927540 * |
| ZURAWSKI ET AL.: "The Primary Binding Subunit of the Human Interleukin-4 Receptor is Also a Component of the Interleukin-13 Receptor", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 23, 9 June 1995 (1995-06-09), pages 13869 - 13878, XP002927539 * |
Cited By (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7507706B1 (en) | 1998-12-14 | 2009-03-24 | Genetics Institute, Llc | Cytokine receptor chain |
| US7553487B2 (en) | 1998-12-14 | 2009-06-30 | Genetics Institute, Llc | Method and compositions for treating asthma |
| WO2002055100A3 (en) * | 2000-10-20 | 2003-03-27 | Inst Genetics Llc | Method and composition for inhibition of tumor growth and enhancing an immune response |
| EP2027867A1 (en) * | 2000-10-20 | 2009-02-25 | Genetics Institute, LLC | Method and composition for inhibition of tumor growth and enhancing an immune response |
| WO2004064860A1 (en) * | 2003-01-17 | 2004-08-05 | Children's Hospital Medical Center | Use of tff2, or agents inducing tff2, in the therapy of allergies |
| WO2004067026A1 (en) * | 2003-01-18 | 2004-08-12 | Children's Hospital Medical Center | Regulation of allergen induced gene |
| US7645449B2 (en) | 2003-02-07 | 2010-01-12 | Giorgio Stassi | Sensitizing cells for apoptosis by selectively blocking cytokines |
| WO2004092404A3 (en) * | 2003-04-11 | 2005-03-03 | Wyeth Corp | Inhibitors of acidic mammalian chitinase as asthma therapeutics |
| US9315575B2 (en) | 2003-07-15 | 2016-04-19 | Medimmune Limited | Methods of treatment using human antibody molecules for IL-13 |
| US9856317B2 (en) | 2003-07-15 | 2018-01-02 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7947273B2 (en) | 2003-07-15 | 2011-05-24 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7829090B2 (en) | 2003-07-15 | 2010-11-09 | Medimmune Limited | Human antibody molecules for IL-13 |
| US7935343B2 (en) | 2003-07-15 | 2011-05-03 | Medimmune Limited | Human antibody molecules for IL-13 |
| US8088618B2 (en) | 2003-12-23 | 2012-01-03 | Genentech, Inc. | Anti-IL 13 antibodies and uses thereof |
| US9605065B2 (en) | 2003-12-23 | 2017-03-28 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US11434287B2 (en) | 2003-12-23 | 2022-09-06 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US7674459B2 (en) | 2003-12-23 | 2010-03-09 | Genentech, Inc. | Treatment of cancer with a novel anti-IL13 monoclonal antibody |
| US9067994B2 (en) | 2003-12-23 | 2015-06-30 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US8734801B2 (en) | 2003-12-23 | 2014-05-27 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US8067199B2 (en) | 2003-12-23 | 2011-11-29 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US8734797B2 (en) | 2003-12-23 | 2014-05-27 | Genentech, Inc. | Anti-IL13 antibodies and uses thereof |
| US8318160B2 (en) | 2003-12-23 | 2012-11-27 | Genentech, Inc. | Treatment of cancer with novel anti-IL13 monoclonal antibodies |
| WO2005085866A1 (en) * | 2004-02-27 | 2005-09-15 | Novartis Ag | Screening assay for modulators of interaction between interleukin-12 and/or -23 with their receptors |
| US7615213B2 (en) | 2004-06-09 | 2009-11-10 | Wyeth | Antibodies against human interleukin-13 and pharmaceutical compositions thereof |
| US7501121B2 (en) | 2004-06-17 | 2009-03-10 | Wyeth | IL-13 binding agents |
| US7585500B2 (en) | 2004-11-17 | 2009-09-08 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US7994302B2 (en) | 2004-11-17 | 2011-08-09 | Amgen Inc. | Fully human monoclonal antibodies to IL-13 |
| US8992916B2 (en) | 2005-10-21 | 2015-03-31 | Novartis Ag | Methods of using anti-IL13 human antibodies |
| US9650438B2 (en) | 2005-10-21 | 2017-05-16 | Novartis Ag | Nucleic acid encoding anti-IL13 human antibodies |
| US7910708B2 (en) | 2005-10-21 | 2011-03-22 | Novartis Ag | Anti-IL13 human antibodies |
| US8580260B2 (en) | 2005-10-21 | 2013-11-12 | Novartis Ag | Method of using anti-IL-13 antibodies |
| EP2162743A4 (en) * | 2007-05-29 | 2010-07-14 | Univ Cincinnati | METHOD FOR MODULATING IGNITION AND COMPOSITIONS THEREFOR |
| US10093978B2 (en) | 2013-08-12 | 2018-10-09 | Genentech, Inc. | Compositions for detecting complement factor H (CFH) and complement factor I (CFI) polymorphisms |
| US9945858B2 (en) | 2013-09-13 | 2018-04-17 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products |
| US10494429B2 (en) | 2013-09-13 | 2019-12-03 | Genentech, Inc. | Compositions comprising purified anti-abeta monoclonal antibodies |
| US10597447B2 (en) | 2013-09-13 | 2020-03-24 | Genentech, Inc. | Compositions comprising purified recombinant IL-13 antibody |
| US10597446B2 (en) | 2013-09-13 | 2020-03-24 | Genentech, Inc. | Method of treatment comprising purified recombinant IL-13 antibody |
| US10788494B2 (en) | 2013-09-13 | 2020-09-29 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products |
| US10822404B2 (en) | 2013-09-13 | 2020-11-03 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
| US9920120B2 (en) | 2013-09-13 | 2018-03-20 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
| US11519912B2 (en) | 2013-09-13 | 2022-12-06 | Genentech, Inc. | Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products |
| US11667706B2 (en) | 2013-09-13 | 2023-06-06 | Genentech, Inc. | Methods of purifying recombinant anti-abeta antibodies |
| US12312399B2 (en) | 2013-09-13 | 2025-05-27 | Genentech, Inc. | Methods and compositions comprising purified recombinant polypeptides |
Also Published As
| Publication number | Publication date |
|---|---|
| CY1107657T1 (el) | 2013-04-18 |
| CN104611339A (zh) | 2015-05-13 |
| ES2277460T3 (es) | 2007-07-01 |
| JP5519087B2 (ja) | 2014-06-11 |
| DE69933696T2 (de) | 2007-08-23 |
| NZ512942A (en) | 2004-01-30 |
| BR9916209A (pt) | 2001-12-26 |
| ATE342976T1 (de) | 2006-11-15 |
| CA2356779C (en) | 2012-03-13 |
| US7507706B1 (en) | 2009-03-24 |
| JP2014113165A (ja) | 2014-06-26 |
| EP1141286A4 (en) | 2002-06-26 |
| EP1141286B1 (en) | 2006-10-18 |
| JP2003511007A (ja) | 2003-03-25 |
| CA2356779A1 (en) | 2000-06-22 |
| AU2177500A (en) | 2000-07-03 |
| JP2010263889A (ja) | 2010-11-25 |
| DE69933696D1 (de) | 2006-11-30 |
| CN1352686A (zh) | 2002-06-05 |
| DK1141286T3 (da) | 2007-02-19 |
| WO2000036103A9 (en) | 2002-04-11 |
| PT1141286E (pt) | 2007-01-31 |
| AU780031B2 (en) | 2005-02-24 |
| MXPA01006006A (es) | 2004-08-12 |
| EP1141286A1 (en) | 2001-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100086516A1 (en) | Cytokine receptor chain | |
| US5710023A (en) | IL-13 cytokine receptor chain | |
| US7507706B1 (en) | Cytokine receptor chain | |
| EP1173484B1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
| EP0797664B1 (en) | Use of a human interleukin-11 receptor | |
| US7078494B1 (en) | Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding | |
| WO2000078336A1 (en) | Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains | |
| AU2005202229B2 (en) | Cytokine Receptor Chain | |
| US7094402B2 (en) | Antibodies to human interleukin-11 receptor | |
| HK1138294A (en) | Treatment of fibrosis by antagonism of il-13 and/or il-13 receptor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 99815591.8 Country of ref document: CN |
|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
| ENP | Entry into the national phase |
Ref document number: 2000 588352 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2001/006006 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2356779 Country of ref document: CA Ref document number: 2356779 Country of ref document: CA Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 21775/00 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1999966166 Country of ref document: EP Ref document number: 512942 Country of ref document: NZ |
|
| WWP | Wipo information: published in national office |
Ref document number: 1999966166 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 09868123 Country of ref document: US |
|
| AK | Designated states |
Kind code of ref document: C2 Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
| COP | Corrected version of pamphlet |
Free format text: PAGES 1/4-4/4, DRAWINGS, REPLACED BY NEW PAGES 1/4-4/4; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE |
|
| WWG | Wipo information: grant in national office |
Ref document number: 21775/00 Country of ref document: AU |
|
| WWG | Wipo information: grant in national office |
Ref document number: 1999966166 Country of ref document: EP |