WO2000036103A1 - Cytokine receptor chain - Google Patents

Cytokine receptor chain Download PDF

Info

Publication number
WO2000036103A1
WO2000036103A1 PCT/US1999/029493 US9929493W WO0036103A1 WO 2000036103 A1 WO2000036103 A1 WO 2000036103A1 US 9929493 W US9929493 W US 9929493W WO 0036103 A1 WO0036103 A1 WO 0036103A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
seq
binding
amino acid
nucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US1999/029493
Other languages
English (en)
French (fr)
Other versions
WO2000036103A9 (en
Inventor
Mary Collins
Debra Donaldson
Lori Fitz
Tamlyn Neben
Matthew J. Whitters
Clive Wood
Marsha Wills-Karp
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetics Institute LLC
Johns Hopkins University
Original Assignee
Genetics Institute LLC
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=22786499&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2000036103(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to NZ512942A priority Critical patent/NZ512942A/xx
Priority to BR9916209-1A priority patent/BR9916209A/pt
Priority to DE69933696T priority patent/DE69933696T2/de
Priority to US09/868,123 priority patent/US7507706B1/en
Priority to CA2356779A priority patent/CA2356779C/en
Priority to MXPA01006006A priority patent/MXPA01006006A/es
Priority to JP2000588352A priority patent/JP5519087B2/ja
Application filed by Genetics Institute LLC, Johns Hopkins University filed Critical Genetics Institute LLC
Priority to EP99966166A priority patent/EP1141286B1/en
Priority to AU21775/00A priority patent/AU780031B2/en
Priority to DK99966166T priority patent/DK1141286T3/da
Publication of WO2000036103A1 publication Critical patent/WO2000036103A1/en
Anticipated expiration legal-status Critical
Publication of WO2000036103A9 publication Critical patent/WO2000036103A9/en
Priority to US10/989,313 priority patent/US7553487B2/en
Priority to AU2005202229A priority patent/AU2005202229B2/en
Priority to US12/408,458 priority patent/US20100086516A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/14Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4
    • A61P5/16Drugs for disorders of the endocrine system of the thyroid hormones, e.g. T3, T4 for decreasing, blocking or antagonising the activity of the thyroid hormones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence

Definitions

  • the present invention relates to mammalian cytokine receptor proteins with affinity for IL-13 (including without limitation human and murine receptor proteins), fragments thereof and recombinant polynucleotides and cells useful for expressing such proteins.
  • IL-13 interleukin-13
  • IL-13 interleukin-13
  • IL-13 Various protein forms of IL-13 and DNA encoding various forms of IL-13 activity are described in McKenzie et al., Proc. Natl. Acad. Sci. USA 90:3735 (1993); Minty et al., Nature 362:248 (1993); and Aversa et al., WO94/04680.
  • the term "IL-13” includes proteins having the sequence and/or biological activity described in these documents, whether produced by recombinant genetic engineering techniques; purified from cell sources producing the factor naturally or upon induction with other factors; or synthesized by chemical techniques; or a combination of the foregoing.
  • IL-13 is a cytokine that has been implicated in production of several biological activities including: induction of IgG4 and IgE switching, including in human immature B cells (Punnonen et al., J. Immunol. 152: 1094 (1994)); induction of germ line IgE heavy chain (e) transcription and CD23 expression in normal human B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730 (1993)); and induction of B cell proliferation in the presence of CD40L or anti-CD40 mAb
  • IL-13 Like most cytokines, IL-13 exhibits certain biological activities by interacting with an IL-13 receptor ("IL-13R”) on the surface of target cells. IL- 13R and the IL-4 receptor (“IL-4R”) sharing a common component, which is required for receptor activation; however, EL- 13 does not bind to cells transfected with the 130 kD IL-4R (Zurawski et al., supra). Thus, the IL-13R must contain at least one other ligand binding chain. Cytokine receptors are commonly composed or two or three chains. The cloning of one ligand binding chain for IL-13 has been recently reported (Hilton et al., Proc. Natl. Acad. Sci. 93:497-501).
  • the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) the nucleotide sequence of SEQ ID NO:l from nucleotide 256 to nucleotide 1404;
  • nucleotide sequence encoding a species homologue of the sequence specified in (a) or (b); and (f) an allelic variant of the nucleotide sequence specified in (a) or (b).
  • the nucleotide sequence encodes a protein having a biological activity of the human IL-13 receptor.
  • the nucleotide sequence may be operably linked to an expression control sequence.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO:l from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:l from nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ ID NO:l from nucleotide 1324 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242; the nucleotide sequence of SEQ ID NO:3 from nucleotide 178 to nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from nucleotide
  • the invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2;
  • Host cells preferably mammalian cells, transformed with the polynucleotides are also provided.
  • the invention provides a process for producing a IL- 13bc protein. The process comprises:
  • Proteins produced according to these methods are also provided.
  • the present invention also provides for an isolated IL-13bc protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2; (b) the amino acid sequence of SEQ ID NO:2 from amino acids 22 to
  • the protein comprises the amino acid sequence of SEQ ID NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the sequence of SEQ ID NO:4; or the sequence from amino acid 26 to 341 of SEQ ID NO:4.
  • the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from IL-13bc).
  • Preferred fusion proteins comprise an antibody fragment, such as an Fc fragment.
  • Particularly preferred embodiments comprise the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
  • Pharmaceutical compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
  • the present invention further provides for compositions comprising an antibody which specifically reacts with a protein of the present invention.
  • Methods of identifying an inhibitor of IL-13 binding to the IL-13bc or IL-13 receptor comprise: (a) combining an IL- 13bc protein or a fragment thereof with IL- 13 or a fragment thereof, said combination forming a first binding mixture;
  • Methods of inhibiting binding of IL-13 to the 1L-I3bc proteins or IL-13 receptor in a mammalian subject comprise administering a therapeutically effective amount of a composition containing an IL- 13bc protein, an IL-13bc or IL-13R inhibitor or an antibody to an IL-13bc protein.
  • Methods are also provided for potentiating IL-13 activity, which comprise combining a protein having IL-13 activity with a protein of claim 11 and contacting such combination with a cell expressing at least one chain of EL-13R other than IL- 13bc.
  • the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject.
  • Further methods are provided for treating an IL-13-related condition in a mammalian subject, said method comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
  • Other methods provide for a method of inhibiting the interaction of IL-13 with an IL-13bc protein in a mammalian subject comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
  • the antagonist is selected from the group consisting of an IL-13bc protein, a soluble form of IL-13R ⁇ l, an antibody to IL-13 or an IL-13-binding fragment thereof, an antibody to IL- 13bc or an IL- 13bc-binding fragment thereof, an antibody to IL-13R ⁇ l or an IL-13R ⁇ l -binding fragment thereof, IL-13R- binding mutants of IL-4, a small molecule capable of inhibiting the interaction of IL-13 with IL-13bc and a small molecule capable of inhibiting the interaction of IL- 13 with IL-13R ⁇ l.
  • Fig. 1 The figure presents photographs of IL-13, IL-4, EL- 11 and mock transfected COS cells after exposure to DL-13bc-Fc as described in Example 4 below.
  • Fig. 2 Reversal of allergen-induced airway hyper responsiveness by in vivo blockade of interleukin-13. 10 days after initial intratracheal challenge, ON A- and PBS-immunized mice were again challenged intratracheally with either OVA or PBS. Mice were given sIL-13bc-Fc (400ug) or an equivalent amount of control hu- IgG by intraperitoneal injection on Day -1, O, +1 and +3 of the secondary antigen challenge.
  • AHR Airway hyper responsiveness
  • APTI airway-pressure-time index
  • B Inflammatory cell composition of bronchoalveolar lavage fluids. Cell differential percentages were determined by light microscopic evaluation of cytospin preparations. Data are expressed as absolute numbers of ceUs.
  • C OVA-specific serum IgE concentrations. Results are means +/- SEM of 8-10 animals per group. *P ⁇ 0.05 compared with respective PBS control groups; **P ⁇ 0.05 compared to OVA/Hu-Ig group (one-way A ⁇ OVA followed by Fisher's least significant difference test for multiple comparisons).
  • Fig. 3 Effects of EL- 13 blockade on allergen-driven increases in mucus- containing cells in the airway epithelium.
  • PBS Hu-Ig PBS-immunized and challenged controls, demonstrating few mucus-containing cells.
  • OVAHu-Ig allergen-induced increases in interstitial inflammatory cells and increases in the number of goblet cells containing mucus.
  • OVA/sEL-13bc-Fc dramatic inhibitory effect of EL-13 blockade on allergen-induced goblet cell mucus production.
  • Fig. 4 IL-13 induction of airway hyperreactivity.
  • Naive mice were given recombinant EL-13 (5 ug/mouse, 50 ul volume) or PBS daily by intratracheal instillation. 24 hrs after the last treatment, (A) Airway hyper responsiveness, (B)
  • EL-13bc polynucleotides encoding the EL-13 binding chain of 1L-13R
  • SEQ ID NO: 1 provides the nucleotide sequence of a cDNA encoding the murine IL-13bc.
  • SEQ DD NO:2 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-21.
  • the mature murine 1L-I3bc is believed to have the sequence of amino acids 22-383 of SEQ DD NO:2.
  • the mature murine receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 22-334 of SEQ ID NO:2), a transmembrane domain (comprising approximately amino acids 335-356 of SEQ ED NO:2) and an intracellular domain (comprising approximately amino acids 357-383 of SEQ ED NO:2).
  • SEQ ED NO:3 provides the nucleotide sequence of a cDNA encoding the human EL-13bc.
  • SEQ ID NO:4 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-25.
  • the mature human IL-13bc is beheved to have the sequence of amino acids 26-380 of SEQ ED NO:4.
  • the mature human receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 26-341 of SEQ ED NO:4), a transmembrane domain (comprising approximately amino acids 342-362 of SEQ ID NO:4) and an intracellular domain (comprising approximately amino acids 363-380 of SEQ ID NO:4).
  • the first 81 amino acids of the human IL-13bc sequence are identical to the translated sequence of an expressed sequence tag (EST) identified as "yg99f lO.rl Homo sapiens cDNA clone 41648 5"' and assigned database accession number R52795.gb_est2. There are no homologies or sequence motifs in this EST sequence which would lead those skilled in the art to identify the encoded protein as a cytokine receptor.
  • EST expressed sequence tag
  • a cDNA clone corresponding to this database entry is publicly-available from the I.M.A.G.E. Consortium. Subsequent to the priority date of the present application, such clone was ordered by applicants and sequenced. The sequence of such clone was determined to be the sequence previously reported by applicants as SEQ ED NO:3 herein.
  • Soluble forms of E--13bc protein can also be produced.
  • Such soluble forms include without limitation proteins comprising amino acids 1-334 or 22-334 of SEQ ED NO:2 or amino acids 1-341 or 26-341 of SEQ ID NO:4.
  • the soluble forms of the EL-13bc are further characterized by being soluble in aqueous solution, preferably at room temperature.
  • EL-13bc proteins comprising only the intracellular domain or a portion thereof may also be produced.
  • IL-13bc proteins of less than full length may be produced by expressing a corresponding fragment of the polynucleotide encoding the full-length EL- 13bc protein (SEQ ED NO:l or SEQ ID NO:3). These corresponding polynucleotide fragments are also part of the present invention.
  • Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
  • a protein has "a biological activity of the EL-13 receptor binding chain" if it possess one or more of the following characteristics: (1) the ability to bind IL-13 or a fragment thereof (preferably a biologically active fragment thereof); and/or (2) the ability to interact with the second non-EL-13-binding chain of D -13R to produce a signal characteristic of the binding of EL-13 to EL-13R.
  • the biological activity possessed by the protein is the ability to bind DL-13 or a fragment hereof, more preferably with a K D of about 0.1 to about 100 nM.
  • Methods for determining whether a particular protein or peptide has such activity include without limitation the methods described in the examples provided herein.
  • IL-13bc or active fragments thereof may be fused to carrier molecules such as immunoglobulins.
  • carrier molecules such as immunoglobulins.
  • soluble forms of the IL- 13bc may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
  • Other fusions proteins such as those with GST, Lex-A or MBP, may also be used.
  • the invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NO:l or SEQ ED NO:3, that is, naturaUy-occurring alternative forms of the isolated polynucleotide of SEQ ID NO: 1 or SEQ D NO:3 which also encode EL-13bc proteins, preferably those proteins having a biological activity of IL-13bc. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ED NO:3 under highly stringent conditions (for example, O.lxSSC at 65°C).
  • Isolated polynucleotides which encode EL-13bc proteins but which differ from the nucleotide sequence set forth in SEQ DD NO: 1 or SEQ DD NO:3 by virtue of the degeneracy of the genetic code are also encompassed by the present invention.
  • the present invention also provides polynucleotides encoding homologues of the murine and human DL-13bc from other animal species, particularly other mammalian species.
  • Species homologues can be identified and isolated by making probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries constructed from PBMCs, thymus or testis of the relevant species.
  • the isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991), in order to produce the EL-13bc protein recombinantly.
  • an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 (1991
  • Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzyrnology 185, 537-566 (1990).
  • operably linked means enzymatically or chemically ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the EL-13bc protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
  • a number of types of cells may act as suitable host cells for expression of the EL-13bc protein. Any cell type capable of expressing functional D -13bc protein may be used.
  • Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
  • monkey COS cells Chinese Hamster Ovary (CHO) cells
  • human kidney 293 cells human epidermal A431 cells
  • human Colo205 cells human Colo205 cells
  • CV-1 cells other transformed primate cell lines
  • normal diploid cells cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix
  • the EL-13bc protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987), incorporated herein by reference.
  • Soluble forms of the IL-13bc protein may also be produced in insect cells using appropriate isolated polynucleotides as described above.
  • the D -13bc protein may be produced in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
  • yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains,
  • Candida or any yeast strain capable of expressing heterologous proteins.
  • Suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins.
  • Expression in bacteria may result in formation of inclusion bodies incorporating the recombinant protein. Thus, refolding of the recombinant protein may be required in order to produce active or more active material.
  • Several methods for obtaining correctly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaotropic agent.
  • the D--13bc protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the EL-13bc protein.
  • the IL- 13bc protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the EL-13bc protein of the invention can be purified from conditioned media.
  • Membrane-bound forms of EL-13bc protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
  • the EL-13bc protein can be purified using methods known to those skilled in the art.
  • the IL-13bc protein of the invention can be concentrated using a commercially available protein concentration filter, for example, an
  • the concentrate can be applied to a purification matrix such as a gel filtration medium.
  • a purification matrix such as a gel filtration medium.
  • an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneimine (PET) groups.
  • the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
  • a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g., S-Sepharose® columns).
  • the purification of the DL-- 13bc protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin- toyopearl® or Cibacrom blue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography. Finally, one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-
  • HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
  • HPLC media e.g., silica gel having pendant methyl or other aliphatic groups
  • Affinity columns including IL- 13 or fragments thereof or including antibodies to the D -13bc protein can also be used in purification in accordance with known methods. Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
  • the isolated IL-13bc protein is purified so that it is substantially free of other mammalian proteins.
  • EL-13bc proteins of the invention may also be used to screen for agents which are capable of binding to D ⁇ -13bc or EL-13R or which interfere with the binding of IL-13 to the D ⁇ -13 or IL-13bc (either the extracellular or intracellular domains) and thus may act as inhibitors of normal binding and cytokine action ("IL-13R inhibitors").
  • Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the EL- 13bc protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
  • IL-13bc protein may be immobilized in purified form on a carrier and binding to purified D -13bc protein may be measured in the presence and in the absence of potential inhibiting agents.
  • a suitable binding assay may alternatively employ a soluble form of EL- 13bc of the invention.
  • Another example of a system in which inhibitors may be screened is described in Example 2 below.
  • a first binding mixture is formed by combining EL-13 or a fragment thereof and IL- 13bc protein, and the amount of binding in the first binding mixture (B 0 ) is measured.
  • a second binding mixture is also formed by combining DL-13 or a fragment thereof, 1L-I3bc protein, and the compound or agent to be screened, and the amount of binding in the second binding mixture (B) is measured.
  • the amounts of binding in the first and second binding mixtures are compared, for example, by performing a calculation of the ratio B/B 0 .
  • a compound or agent is considered to be capable of inhibiting binding if a decrease in binding in the second binding mixture as compared to the first binding mixture is observed.
  • the second chain of EL- 13R can be added to one or both of the binding mixtures.
  • the formulation and optimization of binding mixtures is within the level of skill in the art, such binding mixtures may also contain buffers and salts necessary to enhance or to optimize binding, and additional control assays may be included in the screening assay of the invention.
  • Compounds found to reduce the binding activity of EL- 13bc protein to EL- 13 or its fragment to any degree, preferably by at least about 10%, more preferably greater than about 50% or more, may thus be identified and then secondarily screened in other binding assays and in vivo assays. By these means compounds having inhibitory activity for IL-13bc binding which may be suitable as therapeutic agents may be identified.
  • IL-13bc proteins may also be used as diagnostic agents for detecting the expression or presence of EL-13bc, EL-13R, EL- 13 or cells expressing EL-13bc, EL- 13R or IL-13.
  • the proteins or polynucleotides may be employed for such purpose in standard procedures for diagnostics assays using these types of materials. Suitable methods are well known to those skilled in the art.
  • D--13R refers to EL-13bc and/or a second EL-13 receptor chain known as "EL-13R ⁇ l” or "NR4" (see: murine receptor chain, Hilton et al., Proc. Natl. Acad. Sci. USA 1996, 93:497-501; human receptor chain, Aman et al., J. Biol. Chem. 1996, 271:29265-70, and Gauchat et al., Eur. J. Immunol. 1997,
  • IL-13bc acts as a mediator of the known biological activities of D -13.
  • IL-13bc protein particularly, soluble EL-13bc proteins
  • EL-13R inhibitors i.e., antagonists of interaction of EL-13 with IL-13R (such as, for example, antibodies to D -13R (including particularly to EL-13bc or to D -13R ⁇ l) and fragments thereof, antibodies to DL-13 and fragments thereof, soluble lL-13R ⁇ l proteins, and small molecule and other inhibitors of the interaction of DL-13 with EL-13R (including with EL-13bc and/or with EL-13R ⁇ l) may be useful in treatment or modulation of various medical conditions in which EL-13 is implicated or which are effected by the activity (or lack thereof) of IL-13 (collectively "IL-13-related conditions").
  • Mutated forms of EL-4 which bind to EL-13R can also be used as EL- 13 antagonists (see, for example, those disclosed in Shanafelt et al., Proc. Natl. Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993, 178:2213-8; and Grunewald et al., J. Immunol. 1998, 160:4004-9).
  • EL-13-related conditions include without limitation Ig-mediated conditions and diseases, particularly IgE-mediated conditions (including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)); inflammatory conditions of the lungs; immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
  • IgE-mediated conditions including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)
  • inflammatory conditions of the lungs immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
  • pathological states may result from disease, exposure to radiation or drugs, and include, for example, leukopenia, bacterial and viral infections, anemia, B cell or T cell deficiencies such as immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
  • leukopenia bacterial and viral infections
  • anemia B cell or T cell deficiencies
  • immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
  • EL-13bc proteins may also be useful to enhance macrophage activation (i.e., in vaccination, treatment of mycobacterial or intracellular organisms, or parasitic infections).
  • IL-13bc proteins may also be used to potentiate the effects of EL-13 in vitro and in vivo.
  • an DL-13bc protein can be combined with a protein having IL-13 activity (preferably DL-13) and the resulting combination can be contacted with a cell expressing at least one chain of IL-13R other than EL-13bc
  • the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject in vivo.
  • a mammalian subject in vivo.
  • the pre-established association of the DL-13 protein with the DL-13bc protein will aid in formation of the complete IL-13 EL-13R complex necessary for proper signaling. See for example the methods described by Economides et al., Science 270:1351 (1995).
  • EL-13bc protein and EL-13R inhibitors purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier may contain, in addition to DL-13bc or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
  • the pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, IL-1, IL-2, IL-3, IL-4, D_-5, D ⁇ 6, IL-7, IL-8, IL-9, DL-10, IL-11, IL-12, IL-14, HL-15, G-CSF, stem cell factor, and erythropoietin.
  • the pharmaceutical composition may also include anti-cytokine antibodies.
  • the pharmaceutical composition may contain thrombolytic or anti-thrombotic factors such as plasminogen activator and
  • the pharmaceutical composition may further contain other anti- inflammatory agents.
  • additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with isolated EL-13bc protein or ⁇ _ ⁇ 13bc inhibitor, or to rriinimize side effects caused by the isolated EL- 13bc or DL-13bc inhibitor.
  • isolated IL-13bc or IL-13bc inhibitor may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
  • the pharmaceutical composition of the invention may be in the form of a liposome in which isolated 1L-I3bc protein or EL-13bc inhibitor is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which in aqueous solution.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
  • the term "therapeuticaUy effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
  • a meaningful patient benefit e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
  • the term refers to that ingredient alone.
  • the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
  • a therapeutically effective amount of isolated 1L-I3bc protein or IL-13bc inhibitor is administered to a mammal.
  • Isolated EL- 13bc protein or D-,-13bc inhibitor may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors.
  • DL-13bc protein or DL- 13bc inhibitor When co-administered with one or more cytokines, lymphokines or other hematopoietic factors, DL-13bc protein or DL- 13bc inhibitor may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering EL-13bc protein or IL-13bc inhibitor in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
  • EL-13bc protein or DL-13bc inhibitor used in the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
  • IL-13bc protein or DL-13bc inhibitor When a therapeutically effective amount of EL-13bc protein or EL-13bc inhibitor is administered orally, IL-13bc protein or DL-13bc inhibitor will be in the form of a tablet, capsule, powder, solution or elixir.
  • the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain from about 5 to 95% EL-13bc protein or DL-13bc inhibitor, and preferably from about 25 to 90% EL-13bc protein or IL-13bc inhibitor.
  • a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
  • the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
  • the pharmaceutical composition When ad ⁇ iinistered in liquid form, the pharmaceutical composition contains from about 0.5 to 90% by weight of DL-13bc protein or E -13bc inhibitor, and preferably from about 1 to 50% IL-13bc protein or EL-13bc inhibitor.
  • a therapeutically effective amount of EL-13bc protein or EL-13bc inhibitor is administered by intravenous, cutaneous or subcutaneous injection, EL- 13bc protein or EL-13bc inhibitor will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • the preparation of such parenterally acceptable protein solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
  • a preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to DL-13bc protein or EL-13bc inhibitor an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
  • the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additive known to those of skill in the art.
  • 1L-I3bc protein or IL-13bc inhibitor in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of 1L-I3bc protein or IL-13bc inhibitor.
  • 13bc protein or DL--13bc inhibitor with which to treat each individual patient. Initially, the attending physician will administer low doses of DL-13bc protein or EL-13bc inhibitor and observe the patient's response. Larger doses of D_ ⁇ 13bc protein or DL--13bc inhibitor may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 0.1 ⁇ g to about 100 mg of LL-13bc protein or DL--13bc inhibitor per kg body weight.
  • the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the DL-13bc protein or EL-13bc inhibitor will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
  • IL-13bc proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the IL- 13bc protein and which may inhibit binding of DL-13 or fragments thereof to the receptor. Such antibodies may be obtained using the entire EL-13bc as an i munogen, or by using fragments of DL- 13bc, such as the soluble mature DL- 13bc.
  • the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Additional peptide immunogens may be generated by replacing tyrosine residues with sulfated tyrosine residues. Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J.Amer.Chem.Soc. 85, 2149-2154 (1963); JL. Krstenansky, et al., FEBS Lett. 211, 10 (1987).
  • Neutralizing or non-neutralizing antibodies binding to JL-13bc protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutializing monoclonal antibodies may be capable of blocking IL-13 binding to the IL-13bc.
  • Example 1 Isolation of DL-13bc cDNAs Isolation of the murine DL-13 receptor chain.
  • RNA 5 ug of polyA+ RNA was prepared from the thymuses of 6-8 week old C3H/HeJ mice.
  • Double stranded, hemimethylated cDNA was prepared using Stratagene's cDNA synthesis kit according to manufacturers instructions. Briefly, the first strand was primed with an oligodT-Xho primer, and after second strand synthesis, EcoRI adapters were added, and the cDNA was digested with Xhol, and purified. The cDNA was ligated to the XhoI-EcoRI sites of the Zap Express (Stratagene) lambda vector, and packaged using Gigapak D Gold packaging extracts (Stratagene) according to the manufacturers instructions.
  • ZapExpress vector as per manufacturers instruction, and the DNA sequence was determined.
  • the DNA sequence encoded a novel member of the hematopoietin receptor family.
  • Clone A25 containing the polynucleotide having the sequence of SEQ ED NO: 1 was deposited with ATCC as pA25pBKCMV at accession number 69997 on February 22, 1996.
  • a partial fragment of the human homolog of the murine receptor was isolated by PCR using oligonucleotides derived from the murine sequence.
  • cDNA was prepared from human testis polyA+ RNA that was obtained from Clontech.
  • a DNA fragment of 274 base pairs was amplified from this cDNA by PCR with the following oligonucleotides: ATAGTTAAACCATTGCCACC (SEQ ED NO:6) and CTCCATTCGCTCC AAATTCC (SEQ ED NO:7) using AmpliTaq polymerase (Promega) in IX Taq buffer containing 1.5 mM MgC12 for 30 cycles of incubation
  • the human clone was deposited with ATCC as phA25#l lpDR2 at accession number 69998 on February 22, 1996.
  • DNA encoding amino acids 1 -331 of the extracellular domain of murine LL- 13bc was fused to a spacer sequence encoding gly-ser-gly by PCR and ligated in frame with sequences encoding the hinge CH2 CH3 regions of human IgGl of the COS-1 expression vector pED.Fc .
  • DL-13bc-Ig was produced from DEAE-dextran transfected COS-1 cells and purified via protein A sepharose chromatography
  • the B9 cell line proliferated in response to EL-13, DL-4 or IL-6. Only responses to IL-13 were inhibited by the soluble EL-13bc-Ig, indicating that this receptor binds IL-13 specifically, but not IL-4 or DL-6.
  • the tables show cpm. Two separate experiments are shown.
  • a Biacore biosensor was used to measure directly the specific binding of
  • EL-13 to purified DL-13bc-Ig (Pharmacia, Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance units (RU) of purified EL-13bc-Ig , human IgGl or irrelevant receptor were each covalently immobilized to different flow cells on the sensor chip as recommended by the manufacturer. (RU's are a refelction of the mass of protein bound to the sensor chip surface.) Purified EL-13 was injected across the flow cells at 5 ul/min for 10 mins in the presence or absence of excess purified IL-13bc-Ig. Binding was quantified as the difference in RU before and after sample injection.
  • Expression vectors for DL-13, IL-4, DL-11 or empty vector were transfected into COS-1 cells in duplicated plates via the DEAE-dextran method. Two days after transfection cells were washed twice in phosphate buffered saline (PBS) and fixed in the culture dish for 10' at 4° C with methanol. Following fixation cells were washed twice with PBS then rinsed once with binding buffer (PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide) and incubated for two hours at 4° C in binding buffer with EL-13bc-Fc at l.Oug/ml or with relevant anti-cytokine antisera.
  • PBS phosphate buffered saline
  • binding buffer PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide
  • Example 5 Other Systems for Determination Biological Activity of DL-13bc Protein
  • Other systems can be used to determine whether a specific DL-13bc protein exhibits a "biological activity" of EL-13bc as defined herein. The following are examples of such systems.
  • Binding of EL-13 to the extracellular region of the IL-13bc protein will specifically cause a rapid induction of phosphotyrosine on the receptor protein.
  • a EL-13bc protein (such as, for example, a soluble form of the extracellular domain) is produced and used to detect DL-13 binding.
  • a DNA construct is prepared in which the extracellular domain (truncated prior, preferably immediately prior, to the predicted transmembrane domain) is ligated in frame to a cDNA encoding the hinge C H 2 and C H 3 domains of a human immunoglobulin (Ig) ⁇ l.
  • This construct is generated in an appropriate expression vector for COS cells, such as pED ⁇ C or pMT2.
  • the plasmid is transiently transfected into COS cells.
  • the secreted DL-13bc-Ig fusion protein is collected in the conditioned medium and purified by protein A chromatography.
  • the purified DL-13bc-Ig fusion protein is used to demonstrate EL-13 binding in a number of applications.
  • EL-13 can be coated onto the surface of an enzyme- linked immunosorbent assay (ELISA) plate, and then additional binding sites blocked with bovine serum albumin or casein using standard ELISA buffers.
  • ELISA enzyme- linked immunosorbent assay
  • DL-13bc-Ig fusion protein is then bound to the solid-phase DL-13, and binding is detected with a secondary goat anti-human Ig conjugated to horseradish peroxidase.
  • the activity of specifically bound enzyme can be measured with a colorimetric substrate, such as tetramethyl benzidine and absorbance readings.
  • IL-13 may also be expressed on the surface of cells, for example by providing a transmembrane domain or glucosyl phosphatidyl inositol (GPT) linkage. Cells expressing the membrane bound DL-13 can be identified using the DL-13bc-Ig fusion protein.
  • the soluble DL-13bc-Ig fusion is bound to the surface of these cells and detected with goat anti-human Ig conjugated to a fluorochrome, such as fluorescein isothiocyanate and flow cytometry.
  • a yeast genetic selection method the "interaction trap” [Gyuris et al, Cell 75:791-803, 1993] can be used to determine whether a DL-13bc protein has a biological activity of EL-13bc as defined herein.
  • the expression of reporter genes from both LexAop-Leu2 and LexAop-LacZ relies on the interaction between the bait protein, for example in this case a species which interacts with human EL-13bc, and the prey, for example in this case the human DL-13bc protein.
  • the prey for example in this case the human DL-13bc protein.
  • Leu2 or LacZ expression The most simple method is to measure the activity of the LacZ encoded protein, ⁇ -galactosidase.
  • This activity can be judged by the degree of blueness on the X-Gal containing medium or filter.
  • standard assays can be found in "Methods in Yeast Genetics" Cold Spring Harbor, New York, 1990 (by Rose, M.D., Winston, F., and Hieter, P.).
  • a particular species such as, for example, a cytosolic protein which binds to the intracellular domain of the EL-13bc in vivo
  • that species can be used as the "bait" in the interaction trap with the DL-13bc protein to be tested serving as the "prey”, or vice versa.
  • Example 6 Treatment of Asthma Using Soluble DL-13bc Protein A well-characterized murine model of allergic asthma was used, in which allergen exposure leads to airway hyper responsiveness ("AHR"), pulmonary eosinophilia, elevations in antigen-specific serum IgE levels, and increases in airway epithelial mucus content (3, 11).
  • AHR airway hyper responsiveness
  • pulmonary eosinophilia elevations in antigen-specific serum IgE levels
  • increases in airway epithelial mucus content 3, 11
  • Male A/J mice were immunized intraperitoneally and subsequently challenged intratracheally with soluble ovalbumin (OVA), the allergic phenotype being assessed 4 days after antigen challenge (13).
  • OVA soluble ovalbumin
  • Blockade of DL-13 was performed by the systemic administration of a soluble EL- 13bc-IgGFc fusion protein (sDL- 13bc-Fc), which specifically binds to and neutralizes EL-13, 24 hours before subsequent intratracheal allergen challenge (14).
  • sDL- 13bc-Fc soluble EL- 13bc-IgGFc fusion protein
  • Challenge of allergen-immunized mice resulted in significant increases in airway responsiveness to acetylcholine (15) (Fig. 2A).
  • Blockade of EL- 13 resulted in complete reversal of such established allergen-induced AHR; thus DL-13 is necessary for the expression of AHR in this model.
  • EL-13 ablation to reverse AHR after full development of the phenotype of allergic asthma contrasts with the inability of EL-4 ablation to accomplish such a reversal.
  • the mechanism underlying the effectiveness of DL-4R ⁇ blockade in reversing allergen- induced AHR may be the inhibition of DL-13-mediated processes, consistent with the fact that Stat ⁇ activation is downstream of DL-4R ⁇ -mediated signaling for both cytokines.
  • EL-13 is probably the primary CD4+ T cell-derived factor responsible for allergen-induced AHR.
  • Blockade of DL-13 did not alter OVA-specific IgE levels, a lack of suppression which is likely due to the fact that DL-13 blockade occurred after initial antigen priming and antibody formation. Nonetheless, these results show that AHR is not dependent upon IgE production in this model, consistent with reports that aUergic AHR develops normally in IgE deficient and B cell deficient mice (19).
  • allergic asthma in murine models is associated with a marked increase in the mucus content of the airway epithelium (5, 11). Mucus hypersecretion is particularly profound in autopsy specimens from patients who die of acute asthma attacks (20). Blockade of IL-13 reverses allergen-induced increases in mucus- containing cells in the airways (Fig. 3), demonstrating that allergen-induced increases in airway mucus content are dependent upon DL-13.
  • EL-4 is also implicated in this process, as EL-4 transgenic mice display marked goblet cell hyperplasia in the absence of antigen sensitization (5).
  • OVA ovalbumin
  • mice 14 days after immunization, mice were anesthetized with a mixture of ketamine and xylazine (45 and 8 mg/kg, respectively) and challenged intratracheally with 50 ul of a 1.5% solution of OVA or an equivalent volume of PBS as a control. 10 days after this first antigen challenge, mice were challenged again intratracheally with either OVA or PBS. Characterization of the allergic phenotype was performed 96 hours after the second antigen challenge.
  • Human DL-13bc was cloned as described above.
  • Fc was purified with rProtein A-Sepharose [J. F. Urban et al., Immunity 8, 255 (1998)].
  • the in vitro DD 50 as determined by the ability to neutralize 3 ng/ml of murine DL-13 in the B9 proliferation assay was approximately 10 ng/ml.
  • Human IgG used as a control for sEL-13bc-Fc, was similarly purified by rProtein A- Sepharose chromatography from a 10% solution of human immune globulin that is commercially available for intravenous administration (Miles) [ibid].
  • Mice were given sDL-13bc-Fc (400ug), or an equivalent amount of the control hu-IgG, by intraperitoneal injection on Day -1, O, +1, and +3 of secondary antigen challenge.
  • Airway reactivity to intravenous administration of acetylcholine was measured (11), 3 days after final intratracheal challenge. Mice were anesthetized with sodium pentobarbital (90 mg/kg), intubated, ventilated at a rate of 120 breaths/minute with a constant tidal volume of air (0.2 ml), and paralyzed with decamethonium bromide (25 mg/kg). After establishment of a stable airway pressure, acetylcholine was injected intravenously (50 ug/kg) and dynamic airway pressure was foUowed for 5 minutes.
  • Serum OVA-specific IgE levels were determined by sandwich ELISA .
  • Sample wells were coated with a 0.01% OVA solution in PBS, blocked with 10% FBS in PBS, and washed with 0.05% Tween-20 in PBS. Serum samples were diluted 1 : 10 and 1 : 100 with 10% FBS in PBS. After an overnight incubation, plates were washed with 0.05% Tween-20 in PBS and biotin-conjugated anti-mouse IgE (PharMingen, San Diego, CA) was added.
  • H. E. Khouri, F. Laliberte, T. Vernet, Gene 2, 177 (1991)] followed by a six- histidine tag was fused by an enterokinase cleavage site to the mature region of murine EL-13 at Gly21 and constructed in the mammalian expression vector pHTop.
  • H6-EK murine EL-13 protein was produced from stably- transfected CHO cells and purified via Ni-NTA chromatography to greater than 97% purity as determined by SDS-PAGE. Protein concentration was determined by absorption at 280 nm and endotoxin contamination was less than 30 EU/mg as measured by Cape Cod Associates LAL assay.
  • the ED 50 of H6-EK murine IL-13 as determined by the Ba/F3.DL-13R 1 proliferation assay was lng/ml.
  • Murine rEL-13 (5ug in a total volume of 50ul) was administered daily by intratracheal instillation to naive mice anesthesized with a mixture of ketamine and xylazine (45 and 8 mg/kg, respectively).
  • a murine IgE-specific ELISA was used to quantitate total IgE immunoglobulin levels in serum using complementary antibody pairs for mouse
  • IgE (R35-72 and R35-92) obtained from PharMingen according to the manufacturer's instructions. Duplicate samples (of a 1/10 dilution in 10% FBS in PBS) were examined from each animal. O.D. readings of samples were converted to pg/ml using values obtained from standard curves generated with known concentrations of recombinant mouse IgE (5-2000 pg/ml), and the final concentration was obtained by multiplying by the dilution factor. 25. C. L. Emson, S. E. Bell, A. Jones, W. Wisden, A. N. J. McKenzie, J. Exp.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pulmonology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Dermatology (AREA)
  • Urology & Nephrology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
PCT/US1999/029493 1998-12-14 1999-12-13 Cytokine receptor chain Ceased WO2000036103A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
AU21775/00A AU780031B2 (en) 1998-12-14 1999-12-13 Cytokine receptor chain
EP99966166A EP1141286B1 (en) 1998-12-14 1999-12-13 Cytokine receptor chain
DE69933696T DE69933696T2 (de) 1998-12-14 1999-12-13 Cytokinrezeptor-kette
US09/868,123 US7507706B1 (en) 1998-12-14 1999-12-13 Cytokine receptor chain
CA2356779A CA2356779C (en) 1998-12-14 1999-12-13 Cytokine receptor chain
MXPA01006006A MXPA01006006A (es) 1998-12-14 1999-12-13 Cadena receptora de citocina.
JP2000588352A JP5519087B2 (ja) 1998-12-14 1999-12-13 サイトカインレセプター鎖
NZ512942A NZ512942A (en) 1998-12-14 1999-12-13 Polynucleotides encoding the IL-13 binding chains of the interleukin receptor, pharmaceutical compositions comprising the protein and methods of identifying inhibitors
BR9916209-1A BR9916209A (pt) 1998-12-14 1999-12-13 Cadeia de receptor de citocina
DK99966166T DK1141286T3 (da) 1998-12-14 1999-12-13 Kæde af cytokinreceptorer
US10/989,313 US7553487B2 (en) 1998-12-14 2004-11-15 Method and compositions for treating asthma
AU2005202229A AU2005202229B2 (en) 1998-12-14 2005-05-24 Cytokine Receptor Chain
US12/408,458 US20100086516A1 (en) 1998-12-14 2009-03-20 Cytokine receptor chain

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US21133598A 1998-12-14 1998-12-14
US09/211,335 1998-12-14

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
US21133598A Continuation-In-Part 1998-12-14 1998-12-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US09/868,123 A-371-Of-International US7507706B1 (en) 1998-12-14 1999-12-13 Cytokine receptor chain
US10/989,313 Division US7553487B2 (en) 1998-12-14 2004-11-15 Method and compositions for treating asthma

Publications (2)

Publication Number Publication Date
WO2000036103A1 true WO2000036103A1 (en) 2000-06-22
WO2000036103A9 WO2000036103A9 (en) 2002-04-11

Family

ID=22786499

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/029493 Ceased WO2000036103A1 (en) 1998-12-14 1999-12-13 Cytokine receptor chain

Country Status (16)

Country Link
US (1) US7507706B1 (https=)
EP (1) EP1141286B1 (https=)
JP (3) JP5519087B2 (https=)
CN (2) CN1352686A (https=)
AT (1) ATE342976T1 (https=)
AU (1) AU780031B2 (https=)
BR (1) BR9916209A (https=)
CA (1) CA2356779C (https=)
CY (1) CY1107657T1 (https=)
DE (1) DE69933696T2 (https=)
DK (1) DK1141286T3 (https=)
ES (1) ES2277460T3 (https=)
MX (1) MXPA01006006A (https=)
NZ (1) NZ512942A (https=)
PT (1) PT1141286E (https=)
WO (1) WO2000036103A1 (https=)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002055100A3 (en) * 2000-10-20 2003-03-27 Inst Genetics Llc Method and composition for inhibition of tumor growth and enhancing an immune response
WO2004064860A1 (en) * 2003-01-17 2004-08-05 Children's Hospital Medical Center Use of tff2, or agents inducing tff2, in the therapy of allergies
WO2004067026A1 (en) * 2003-01-18 2004-08-12 Children's Hospital Medical Center Regulation of allergen induced gene
WO2004092404A3 (en) * 2003-04-11 2005-03-03 Wyeth Corp Inhibitors of acidic mammalian chitinase as asthma therapeutics
WO2005085866A1 (en) * 2004-02-27 2005-09-15 Novartis Ag Screening assay for modulators of interaction between interleukin-12 and/or -23 with their receptors
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7585500B2 (en) 2004-11-17 2009-09-08 Amgen Inc. Fully human monoclonal antibodies to IL-13
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US7645449B2 (en) 2003-02-07 2010-01-12 Giorgio Stassi Sensitizing cells for apoptosis by selectively blocking cytokines
US7674459B2 (en) 2003-12-23 2010-03-09 Genentech, Inc. Treatment of cancer with a novel anti-IL13 monoclonal antibody
EP2162743A4 (en) * 2007-05-29 2010-07-14 Univ Cincinnati METHOD FOR MODULATING IGNITION AND COMPOSITIONS THEREFOR
US7829090B2 (en) 2003-07-15 2010-11-09 Medimmune Limited Human antibody molecules for IL-13
US7910708B2 (en) 2005-10-21 2011-03-22 Novartis Ag Anti-IL13 human antibodies
US9920120B2 (en) 2013-09-13 2018-03-20 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US9945858B2 (en) 2013-09-13 2018-04-17 Genentech, Inc. Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products
US10093978B2 (en) 2013-08-12 2018-10-09 Genentech, Inc. Compositions for detecting complement factor H (CFH) and complement factor I (CFI) polymorphisms

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090098142A1 (en) * 2004-06-09 2009-04-16 Kasaian Marion T Methods and compositions for treating and monitoring treatment of IL-13-associated disorders
AR066240A1 (es) * 2007-04-23 2009-08-05 Wyeth Corp Metodos y composiciones para tratar y monitorear el tratamiento de trastornos asociados con il-13
JP7657548B2 (ja) * 2017-04-21 2025-04-07 エランコ・ユーエス・インコーポレイテッド 獣医学的使用のためのil4/il13受容体分子

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5599905A (en) * 1988-10-31 1997-02-04 Immunex Corporation Interleukin-4 receptors
WO1997015663A1 (en) * 1995-10-23 1997-05-01 Amrad Operations Pty. Ltd. A novel haemopoietin receptor and genetic sequences encoding same
US5696234A (en) * 1994-08-01 1997-12-09 Schering Corporation Muteins of mammalian cytokine interleukin-13

Family Cites Families (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5225539A (en) 1986-03-27 1993-07-06 Medical Research Council Recombinant altered antibodies and methods of making altered antibodies
WO1989004838A1 (en) 1987-11-25 1989-06-01 Immunex Corporation Interleukin-1 receptors
US5359037A (en) 1988-09-12 1994-10-25 Yeda Research And Development Co. Ltd. Antibodies to TNF binding protein I
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5011778A (en) 1989-05-23 1991-04-30 Otsuka Pharmaceutical Co., Ltd. Monoclonal antibodies directed to IL-1 activated endothelial cells and medicaments employing the monoclonal antibodies
ATE136906T1 (de) 1989-12-20 1996-05-15 Schering Corp Antikörperantagonisten gegen humanes interleukin- 4
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US5246701A (en) 1990-10-05 1993-09-21 Ludwig Institute For Cancer Research Method for inhibiting production of IgE by using IL-9 inhibitors
EP0506574B1 (fr) 1991-03-29 1995-11-29 Sanofi Protéine à activité de type cytokine, ADN recombinant codant pour cette protéine, cellules et microorganismes transformés
WO1993015766A1 (en) 1992-02-10 1993-08-19 Seragen, Inc. Desensitization to specific allergens
US5397703A (en) 1992-07-09 1995-03-14 Cetus Oncology Corporation Method for generation of antibodies to cell surface molecules
WO1994004680A1 (en) 1992-08-21 1994-03-03 Schering Corporation Human interleukin-13
US5596072A (en) 1992-08-21 1997-01-21 Schering Corporation Method of refolding human IL-13
EP0604693A1 (en) 1992-12-29 1994-07-06 Schering-Plough Monoclonal antibodies against the human interleukin-4 receptor and hybridomas producing the same
ES2143553T3 (es) 1993-09-02 2000-05-16 Dartmouth College Anticuerpos anti-gp39 y sus utilizaciones.
EP0659766A1 (en) 1993-11-23 1995-06-28 Schering-Plough Human monoclonal antibodies against human cytokines and methods of making and using such antibodies
GB9415379D0 (en) 1994-07-29 1994-09-21 Smithkline Beecham Plc Novel compounds
US5705154A (en) 1995-03-08 1998-01-06 Schering Corporation Humanized monoclonal antibodies against human interleukin-4
FR2742156A1 (fr) 1995-12-06 1997-06-13 Sanofi Sa Polypeptide recepteur de l'il-13
MX336813B (es) 1996-02-09 2016-02-02 Abbvie Biotechnology Ltd Anticuerpos humanos que ligan el tnfa humano.
US6664227B1 (en) 1996-03-01 2003-12-16 Genetics Institute, Llc Treatment of fibrosis by antagonism of IL-13 and IL-13 receptor chains
US5710023A (en) * 1996-03-01 1998-01-20 Genetics Institute, Inc. IL-13 cytokine receptor chain
WO1997033913A1 (en) 1996-03-13 1997-09-18 Zymogenetics, Inc. Cytokine-receptor expressed in testis cells
WO1997047741A1 (en) * 1996-06-12 1997-12-18 Smithkline Beecham Corporation Hr-1 receptor
WO1997047742A1 (en) 1996-06-12 1997-12-18 Smithkline Beecham Corporation Hr-1 receptor
EP0812913A3 (en) 1996-06-12 1999-08-04 Smithkline Beecham Corporation HR-1 receptor, a receptor of the cytokine receptors family
WO1998010638A1 (en) 1996-09-10 1998-03-19 Amrad Operations Pty. Ltd. Therapeutic molecules
GB9625899D0 (en) 1996-12-13 1997-01-29 Glaxo Group Ltd Substances and their uses
CN1247472A (zh) 1997-01-10 2000-03-15 拜奥根有限公司 用抗cd40l化合物治疗狼疮性肾炎
US6387615B2 (en) * 1997-04-11 2002-05-14 Isis Innovation Limited Methods and materials for the diagnosis or prognosis of asthma
GB9723553D0 (en) 1997-11-07 1998-01-07 Duff Gordon W Prediction of the risk of chronic obstructive airway disease
DK1034298T3 (da) 1997-12-05 2012-01-30 Scripps Research Inst Humanisering af murint antistof
MXPA01006006A (es) 1998-12-14 2004-08-12 Genetics Inst Cadena receptora de citocina.
WO2000078336A1 (en) 1999-06-21 2000-12-28 Genetics Institute, Inc. Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains
WO2001023410A2 (en) 1999-09-28 2001-04-05 Genaissance Pharmaceuticals, Inc. Drug target isogenes: polymorphisms in the interleukin 13 gene
WO2001025282A1 (en) 1999-10-06 2001-04-12 The Penn State Research Foundation Il13 mutants
US6846486B1 (en) 2000-02-24 2005-01-25 Advanced Biotherapy Concepts, Inc. Method of treating allergy by administering an anti-histamine antibody
DK2990420T3 (en) 2000-05-26 2017-04-03 Immunex Corp USE OF INTERLEUKIN-4 RECEPTOR ANTIBODIES AND COMPOSITIONS THEREOF

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5599905A (en) * 1988-10-31 1997-02-04 Immunex Corporation Interleukin-4 receptors
US5696234A (en) * 1994-08-01 1997-12-09 Schering Corporation Muteins of mammalian cytokine interleukin-13
WO1997015663A1 (en) * 1995-10-23 1997-05-01 Amrad Operations Pty. Ltd. A novel haemopoietin receptor and genetic sequences encoding same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
OBIRI ET AL.: "Receptor for Interleukin 13: Interaction with interleukin 4 by a mechanism that does not involve the common gamma chain shared by receptors for interleukins 2, 4, 7, 9 and 15", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 15, 14 April 1995 (1995-04-14), pages 8797 - 8804, XP002927538 *
VITA ET AL.: "Characterization and Comparison of the Interleukin 13 Receptor with the Interleukin 4 Receptor on Several Cell Types", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 8, 24 February 1995 (1995-02-24), pages 3512 - 3517, XP002927540 *
ZURAWSKI ET AL.: "The Primary Binding Subunit of the Human Interleukin-4 Receptor is Also a Component of the Interleukin-13 Receptor", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 23, 9 June 1995 (1995-06-09), pages 13869 - 13878, XP002927539 *

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
WO2002055100A3 (en) * 2000-10-20 2003-03-27 Inst Genetics Llc Method and composition for inhibition of tumor growth and enhancing an immune response
EP2027867A1 (en) * 2000-10-20 2009-02-25 Genetics Institute, LLC Method and composition for inhibition of tumor growth and enhancing an immune response
WO2004064860A1 (en) * 2003-01-17 2004-08-05 Children's Hospital Medical Center Use of tff2, or agents inducing tff2, in the therapy of allergies
WO2004067026A1 (en) * 2003-01-18 2004-08-12 Children's Hospital Medical Center Regulation of allergen induced gene
US7645449B2 (en) 2003-02-07 2010-01-12 Giorgio Stassi Sensitizing cells for apoptosis by selectively blocking cytokines
WO2004092404A3 (en) * 2003-04-11 2005-03-03 Wyeth Corp Inhibitors of acidic mammalian chitinase as asthma therapeutics
US9315575B2 (en) 2003-07-15 2016-04-19 Medimmune Limited Methods of treatment using human antibody molecules for IL-13
US9856317B2 (en) 2003-07-15 2018-01-02 Medimmune Limited Human antibody molecules for IL-13
US7947273B2 (en) 2003-07-15 2011-05-24 Medimmune Limited Human antibody molecules for IL-13
US7829090B2 (en) 2003-07-15 2010-11-09 Medimmune Limited Human antibody molecules for IL-13
US7935343B2 (en) 2003-07-15 2011-05-03 Medimmune Limited Human antibody molecules for IL-13
US8088618B2 (en) 2003-12-23 2012-01-03 Genentech, Inc. Anti-IL 13 antibodies and uses thereof
US9605065B2 (en) 2003-12-23 2017-03-28 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US11434287B2 (en) 2003-12-23 2022-09-06 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US7674459B2 (en) 2003-12-23 2010-03-09 Genentech, Inc. Treatment of cancer with a novel anti-IL13 monoclonal antibody
US9067994B2 (en) 2003-12-23 2015-06-30 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8734801B2 (en) 2003-12-23 2014-05-27 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8067199B2 (en) 2003-12-23 2011-11-29 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8734797B2 (en) 2003-12-23 2014-05-27 Genentech, Inc. Anti-IL13 antibodies and uses thereof
US8318160B2 (en) 2003-12-23 2012-11-27 Genentech, Inc. Treatment of cancer with novel anti-IL13 monoclonal antibodies
WO2005085866A1 (en) * 2004-02-27 2005-09-15 Novartis Ag Screening assay for modulators of interaction between interleukin-12 and/or -23 with their receptors
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7585500B2 (en) 2004-11-17 2009-09-08 Amgen Inc. Fully human monoclonal antibodies to IL-13
US7994302B2 (en) 2004-11-17 2011-08-09 Amgen Inc. Fully human monoclonal antibodies to IL-13
US8992916B2 (en) 2005-10-21 2015-03-31 Novartis Ag Methods of using anti-IL13 human antibodies
US9650438B2 (en) 2005-10-21 2017-05-16 Novartis Ag Nucleic acid encoding anti-IL13 human antibodies
US7910708B2 (en) 2005-10-21 2011-03-22 Novartis Ag Anti-IL13 human antibodies
US8580260B2 (en) 2005-10-21 2013-11-12 Novartis Ag Method of using anti-IL-13 antibodies
EP2162743A4 (en) * 2007-05-29 2010-07-14 Univ Cincinnati METHOD FOR MODULATING IGNITION AND COMPOSITIONS THEREFOR
US10093978B2 (en) 2013-08-12 2018-10-09 Genentech, Inc. Compositions for detecting complement factor H (CFH) and complement factor I (CFI) polymorphisms
US9945858B2 (en) 2013-09-13 2018-04-17 Genentech, Inc. Compositions and methods for detecting and quantifying host cells protein in cell lines and recombinant polypeptide products
US10494429B2 (en) 2013-09-13 2019-12-03 Genentech, Inc. Compositions comprising purified anti-abeta monoclonal antibodies
US10597447B2 (en) 2013-09-13 2020-03-24 Genentech, Inc. Compositions comprising purified recombinant IL-13 antibody
US10597446B2 (en) 2013-09-13 2020-03-24 Genentech, Inc. Method of treatment comprising purified recombinant IL-13 antibody
US10788494B2 (en) 2013-09-13 2020-09-29 Genentech, Inc. Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products
US10822404B2 (en) 2013-09-13 2020-11-03 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US9920120B2 (en) 2013-09-13 2018-03-20 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides
US11519912B2 (en) 2013-09-13 2022-12-06 Genentech, Inc. Compositions and methods for detecting and quantifying host cell protein in cell lines and recombinant polypeptide products
US11667706B2 (en) 2013-09-13 2023-06-06 Genentech, Inc. Methods of purifying recombinant anti-abeta antibodies
US12312399B2 (en) 2013-09-13 2025-05-27 Genentech, Inc. Methods and compositions comprising purified recombinant polypeptides

Also Published As

Publication number Publication date
CY1107657T1 (el) 2013-04-18
CN104611339A (zh) 2015-05-13
ES2277460T3 (es) 2007-07-01
JP5519087B2 (ja) 2014-06-11
DE69933696T2 (de) 2007-08-23
NZ512942A (en) 2004-01-30
BR9916209A (pt) 2001-12-26
ATE342976T1 (de) 2006-11-15
CA2356779C (en) 2012-03-13
US7507706B1 (en) 2009-03-24
JP2014113165A (ja) 2014-06-26
EP1141286A4 (en) 2002-06-26
EP1141286B1 (en) 2006-10-18
JP2003511007A (ja) 2003-03-25
CA2356779A1 (en) 2000-06-22
AU2177500A (en) 2000-07-03
JP2010263889A (ja) 2010-11-25
DE69933696D1 (de) 2006-11-30
CN1352686A (zh) 2002-06-05
DK1141286T3 (da) 2007-02-19
WO2000036103A9 (en) 2002-04-11
PT1141286E (pt) 2007-01-31
AU780031B2 (en) 2005-02-24
MXPA01006006A (es) 2004-08-12
EP1141286A1 (en) 2001-10-10

Similar Documents

Publication Publication Date Title
US20100086516A1 (en) Cytokine receptor chain
US5710023A (en) IL-13 cytokine receptor chain
US7507706B1 (en) Cytokine receptor chain
EP1173484B1 (en) Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains
EP0797664B1 (en) Use of a human interleukin-11 receptor
US7078494B1 (en) Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding
WO2000078336A1 (en) Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains
AU2005202229B2 (en) Cytokine Receptor Chain
US7094402B2 (en) Antibodies to human interleukin-11 receptor
HK1138294A (en) Treatment of fibrosis by antagonism of il-13 and/or il-13 receptor

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 99815591.8

Country of ref document: CN

AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
ENP Entry into the national phase

Ref document number: 2000 588352

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/006006

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2356779

Country of ref document: CA

Ref document number: 2356779

Country of ref document: CA

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 21775/00

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 1999966166

Country of ref document: EP

Ref document number: 512942

Country of ref document: NZ

WWP Wipo information: published in national office

Ref document number: 1999966166

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWE Wipo information: entry into national phase

Ref document number: 09868123

Country of ref document: US

AK Designated states

Kind code of ref document: C2

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/4-4/4, DRAWINGS, REPLACED BY NEW PAGES 1/4-4/4; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

WWG Wipo information: grant in national office

Ref document number: 21775/00

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 1999966166

Country of ref document: EP